Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

Directory of Open Access Journals (Sweden)

Xiangdong Kong

Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

DEFF Research Database (Denmark)

Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

2011-01-01

of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

[Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].

Science.gov (United States)

Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi

2009-11-01

We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

A rapid and direct real time PCR-based method for identification of Salmonella spp

DEFF Research Database (Denmark)

Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

2003-01-01

The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

A rapid method for screening arrayed plasmid cDNA library by PCR

International Nuclear Information System (INIS)

Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

1999-01-01

Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

Science.gov (United States)

Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

2001-10-01

Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

Science.gov (United States)

Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

2007-01-01

PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

Science.gov (United States)

Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

2016-02-01

Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

Directory of Open Access Journals (Sweden)

Hiroshi Fukushima

2009-01-01

Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

Science.gov (United States)

Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

2011-09-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

Directory of Open Access Journals (Sweden)

Touseef Hussain

2018-05-01

Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

Quantitative PCR high-resolution melting (qPCR-HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: application to MLH1 germline mutations in Lynch syndrome.

Science.gov (United States)

Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette

2009-06-01

Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

OpenAIRE

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

Science.gov (United States)

Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

2016-11-01

Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

Science.gov (United States)

Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

2000-01-01

Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

Science.gov (United States)

Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

2017-10-01

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

Science.gov (United States)

Gallaher, Sean D.; Berk, Arnold J.

2013-01-01

Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

A dual PCR-based sequencing approach for the identification and discrimination of Echinococcus and Taenia taxa.

Science.gov (United States)

Boubaker, Ghalia; Marinova, Irina; Gori, Francesca; Hizem, Amani; Müller, Norbert; Casulli, Adriano; Jerez Puebla, Luis Enrique; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2016-08-01

Reliable and rapid molecular tools for the genetic identification and differentiation of Echinococcus species and/or genotypes are crucial for studying spatial and temporal transmission dynamics. Here, we describe a novel dual PCR targeting regions in the small (rrnS) and large (rrnL) subunits of mitochondrial ribosomal RNA (rRNA) genes, which enables (i) the specific identification of species and genotypes of Echinococcus (rrnS + L-PCR) and/or (ii) the identification of a range of taeniid cestodes, including different species of Echinococcus, Taenia and some others (17 species of diphyllidean helminths). This dual PCR approach was highly sensitive, with an analytical detection limit of 1 pg for genomic DNA of Echinococcus. Using concatenated sequence data derived from the two gene markers (1225 bp), we identified five unique and geographically informative single nucleotide polymorphisms (SNPs) that allowed genotypes (G1 and G3) of Echinococcus granulosus sensu stricto to be distinguished, and 25 SNPs that allowed differentiation within Echinococcus canadensis (G6/7/8/10). In conclusion, we propose that this dual PCR-based sequencing approach can be used for molecular epidemiological studies of Echinococcus and other taeniid cestodes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

Directory of Open Access Journals (Sweden)

Kang Feng-feng

2012-03-01

Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

Science.gov (United States)

Govan, V A; Brözel, V; Allsopp, M H; Davison, S

1998-05-01

Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

Directory of Open Access Journals (Sweden)

Ramadass P

2002-01-01

Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

Directory of Open Access Journals (Sweden)

Kirill V Sergueev

Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

Directory of Open Access Journals (Sweden)

Van Esbroeck Marjan

2011-03-01

Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

Science.gov (United States)

Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

2018-02-02

As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

Science.gov (United States)

Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

2015-01-01

We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods

Directory of Open Access Journals (Sweden)

Nelly eDatukishvili

2015-07-01

Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

Science.gov (United States)

Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

2017-10-27

Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

Science.gov (United States)

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

PCR-based Approaches for the Detection of Clinical Methicillin-resistant Staphylococcus aureus

Science.gov (United States)

Liu, Ying; Zhang, Jiang; Ji, Yinduo

2016-01-01

Staphylococcus aureus is an important pathogen that can cause a variety of infections, including superficial and systematic infections, in humans and animals. The persistent emergence of multidrug resistant S. aureus, particularly methicillin-resistant S. aureus, has caused dramatically economic burden and concerns in the public health due to limited options of treatment of MRSA infections. In order to make a correct choice of treatment for physicians and understand the prevalence of MRSA, it is extremely critical to precisely and timely diagnose the pathogen that induces a specific infection of patients and to reveal the antibiotic resistant profile of the pathogen. In this review, we outlined different PCR-based approaches that have been successfully utilized for the rapid detection of S. aureus, including MRSA and MSSA, directly from various clinical specimens. The sensitivity and specificity of detections were pointed out. Both advantages and disadvantages of listed approaches were discussed. Importantly, an alternative approach is necessary to further confirm the detection results from the molecular diagnostic assays. PMID:27335617

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

Science.gov (United States)

Wan, Weijie; Yeow, John T W

2012-04-01

This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

Science.gov (United States)

Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

2012-08-01

Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

Science.gov (United States)

Zhang, D F; Zhang, Q Q; Li, A H

2014-11-01

Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

Science.gov (United States)

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

Science.gov (United States)

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

Science.gov (United States)

Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2015-07-01

Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

Science.gov (United States)

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

Science.gov (United States)

Leach, L; Zhu, Y; Chaturvedi, S

2018-02-01

Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

Science.gov (United States)

Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

2015-07-07

Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

Directory of Open Access Journals (Sweden)

Ivan Manga

2013-01-01

Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

Directory of Open Access Journals (Sweden)

Parida Manmohan

2008-01-01

Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

Science.gov (United States)

Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

2016-01-01

Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

Science.gov (United States)

Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

2017-05-01

Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

Science.gov (United States)

Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

2018-03-16

Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

Rapid PCR amplification using a microfluidic device with integrated microwave heating and air impingement cooling.

Science.gov (United States)

Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

2010-07-07

A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.

TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

Directory of Open Access Journals (Sweden)

Ma Mingxiao

Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

Science.gov (United States)

Hanabara, Yutaro; Ueda, Yutaka

2016-11-22

A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

Evaluation of PCR electrospray-ionization mass spectrometry for rapid molecular diagnosis of bovine mastitis.

Science.gov (United States)

Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely

2013-06-01

Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Rapid and sensitive detection of Pseudomonas aeruginosa in chlorinated water and aerosols targeting gyrB gene using real-time PCR.

Science.gov (United States)

Lee, C S; Wetzel, K; Buckley, T; Wozniak, D; Lee, J

2011-10-01

For the rapid detection of Pseudomonas aeruginosa from chlorinated water and aerosols, gyrB gene-based real-time PCR assay was developed and investigated. Two novel primer sets (pa722F/746MGB/899R and pa722F/746MGB/788R) were designed using the most updated 611 Pseudomonas and 748 other bacterial gyrB genes for achieving high specificity. Their specificity showed 100% accuracy when tested with various strains including clinical isolates from cystic fibrosis patients. The assay was tested with Ps. aeruginosa-containing chlorinated water and aerosols to simulate the waterborne and airborne transmission routes (detection limit 3·3 × 10² CFU per PCR-2·3 × 10³ CFU per PCR). No chlorine interference in real-time PCR was observed at drinking water level (c. 1 mg l⁻¹), but high level of chorine (12 mg l⁻¹) interfered the assay, and thus neutralization was needed. Pseudomonas aeruginosa in aerosol was successfully detected after capturing with gelatin filters with minimum 2 min of sampling time when the initial concentration of 10⁴ CFU ml⁻¹ bacteria existed in the nebulizer. A highly specific and rapid assay (2-3 h) was developed by targeting gyrB gene for the detection of Ps. aeruginosa in chlorinated water and aerosols, combined with optimized sample collection methods and sample processing, so the direct DNA extraction from either water or aerosol was possible while achieving the desired sensitivity of the method.   The new assay can provide timely and accurate risk assessment to prevent Ps. aeruginosa exposure from water and aerosol, resulting in reduced disease burden, especially among immune-compromised and susceptible individuals. This approach can be easily utilized as a platform technology for the detection of other types of micro-organisms, especially for those that are transmitted via water and aerosol routes, such as Legionella pneumophila. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

Directory of Open Access Journals (Sweden)

Siti Harnina Bintari

2014-12-01

Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

Science.gov (United States)

Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

2011-02-01

In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

Science.gov (United States)

Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

2018-06-01

Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

Science.gov (United States)

Benitez, Alvaro J; Winchell, Jonas M

2016-04-01

We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

International Nuclear Information System (INIS)

Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

2008-01-01

Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

Science.gov (United States)

Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

2015-01-01

Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

Directory of Open Access Journals (Sweden)

Michael S Bartsch

Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

Directory of Open Access Journals (Sweden)

Henrich Birgit

2008-04-01

Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

Science.gov (United States)

Schaeffer, Anke; Henrich, Birgit

2008-01-01

Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

Development of a qPCR method to rapidly assess the function of NKT cells.

Science.gov (United States)

Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J

2014-05-01

NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

Directory of Open Access Journals (Sweden)

Hyoung Rai Ko

2017-09-01

Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

Science.gov (United States)

von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

2018-05-01

Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

Directory of Open Access Journals (Sweden)

Xingmei Xie

Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

Directory of Open Access Journals (Sweden)

Ervi Salwati

2012-09-01

Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

Science.gov (United States)

Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

2017-01-01

Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

Science.gov (United States)

Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

2014-01-01

Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

Science.gov (United States)

Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

2010-07-01

To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

Science.gov (United States)

Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

2014-01-01

A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

Directory of Open Access Journals (Sweden)

Lingyang Tian

2014-01-01

Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

Science.gov (United States)

Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

2015-08-01

Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases.

Science.gov (United States)

Rossetti, Lia; Giraffa, Giorgio

2005-11-01

About a thousand lactic acid bacteria (LAB) isolated from dairy products, especially cheeses, were identified and typed by species-specific PCR and RAPD-PCR, respectively. RAPD-PCR profiles, which were obtained by using the M13 sequence as a primer, allowed us to implement a large database of different fingerprints, which were analysed by BioNumerics software. Cluster analysis of the combined RAPD-PCR fingerprinting profiles enabled us to implement a library, which is a collection of library units, which in turn is a selection of representative database entries. A library unit, in this case, can be considered to be a definable taxon. The strains belonged to 11 main RAPD-PCR fingerprinting library units identified as Lactobacillus casei/paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus brevis, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus and Lactococcus lactis. The possibility to routinely identify newly typed, bacterial isolates by consulting the library of the software was valued. The proposed method could be suggested to refine previous strain identifications, eliminate redundancy and dispose of a technologically useful LAB strain collection. The same approach could also be applied to identify LAB strains isolated from other food ecosystems.

Rapid and accurate identification by real-time PCR of biotoxin-producing dinoflagellates from the family gymnodiniaceae.

Science.gov (United States)

Smith, Kirsty F; de Salas, Miguel; Adamson, Janet; Rhodes, Lesley L

2014-03-07

The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR) assays targeting the large subunit ribosomal RNA (LSU rRNA) gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

Science.gov (United States)

Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

1999-12-01

A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

PCR-RFLP on β-tubulin gene for rapid identification of the most clinically important species of Aspergillus.

Science.gov (United States)

Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba

2015-10-01

Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

Science.gov (United States)

Altınel, Ahmet

2017-01-01

Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

Science.gov (United States)

Schoener, E R; Hunter, S; Howe, L

2017-07-01

Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

Reduction of the use of antimicrobial drugs following the rapid detection of Streptococcus agalactiae in the vagina at delivery by real-time PCR assay.

Science.gov (United States)

Poncelet-Jasserand, E; Forges, F; Varlet, M-N; Chauleur, C; Seffert, P; Siani, C; Pozzetto, B; Ros, A

2013-08-01

To assess whether the determination of the presence of group B streptococci (GBS) in the vagina using a rapid polymerase chain reaction (PCR) assay at delivery was able to spare useless antimicrobial treatments, as compared with conventional culture at 34-38 weeks of gestation. Practical evaluation and prospective cost-effectiveness analysis. A university hospital in France. A cohort of 225 women in labour at the University-Hospital of Saint-Etienne. Each woman had a conventional culture performed at 34-38 weeks of gestation. At the beginning of labour, two vaginal swabs were sampled for rapid PCR testing and culture. The decision to prescribe a prophylactic antimicrobial treatment or not was taken according to the result of the PCR test. A comparative cost-effectiveness analysis of the two diagnostic strategies was carried out. Number of women receiving inadequate prophylactic antimicrobial drugs following each testing strategy, costs of PCR testing and culture, frequency of vaginal GBS, and diagnostic performance of the PCR test at delivery. The percentage of unnecessarily treated women was significantly reduced using the rapid test versus conventional culture (4.5 and 13.6%, respectively; P < 0.001). The rate of vaginal GBS at delivery was 12.5%. The incremental cost-effectiveness ratio (ICER) for each inadequate management avoided was €36 and €173 from the point of view of the healthcare system and hospital, respectively. The PCR assay reduced the number of inadequate antimicrobial treatments aimed to prevent the early onset of GBS disease. However, this strategy generates extra costs that must be put into balance with its clinical benefits. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.

A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

Directory of Open Access Journals (Sweden)

Lingxiang Zhu

Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

Science.gov (United States)

Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

2006-09-01

A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

Directory of Open Access Journals (Sweden)

Lisha, V.

2017-01-01

Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

Science.gov (United States)

Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

2017-08-01

Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

Rapid and Accurate Identification by Real-Time PCR of Biotoxin-Producing Dinoflagellates from the Family Gymnodiniaceae

Directory of Open Access Journals (Sweden)

Kirsty F. Smith

2014-03-01

Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

Comparison of Enzymatic Method Rapid Yeast Plus System with RFLP-PCR for Identification of Isolated Yeast from Vulvovaginal Candidiasis.

Science.gov (United States)

Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura

2011-09-01

To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.

A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

Science.gov (United States)

Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

2009-11-18

Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

Science.gov (United States)

Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

2017-06-01

A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Development and evaluation of a rapid PCR detection kit for Ophiocordyceps sinensis].

Science.gov (United States)

Hou, Fei-Xia; Cao, Jing; Wang, Sha-Sha; Wang, Xi; Yuan, Yuan; Peng, Cheng; Wan, De-Guang; Guo, Jin-Lin

2017-03-01

Ophiocordyceps sinensis is a valuable traditional Chinese medicine. Due to resource shortage, expensive price and huge market demand, there are many adulterants of O. sinensis in markets. Therefore, it is necessary to establish a rapid and effective method for distinguishing O. sinensis. Based on the species-specific PCR of O. sinensis, this study developed a detection kit by optimizing the components and evaluated the specificity, detection limit, repeatability and shelf life of the kit. The results showed that when the quality of O. sinensis accounted for more than 1/200 of that mixture, it could be detected successfully. Moreover, only O. sinensis could be amplified and glowed bright green fluorescence under ultraviolet light. The kit was still in effect when it was placed at 37 ℃ for three days, which indicated that it was stable and effective for one year stored in 4 ℃. The kit in the same batch under different operation conditions, and in different batch under the same operation conditions gave the same result and accuracy, which showed good repeatability of the kit. It is simple, rapid and accurate to distinguish O. sinensis from its adulterants using the kit, and lays the foundation for commercialization of traditional Chinese medicine fast detection kit. Copyright© by the Chinese Pharmaceutical Association.

Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

Science.gov (United States)

Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

2017-11-01

Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

Science.gov (United States)

Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

2015-02-01

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

African Journals Online (AJOL)

mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

Science.gov (United States)

Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

2017-01-01

Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR

Science.gov (United States)

Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich

2012-06-01

To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

Science.gov (United States)

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

Science.gov (United States)

Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

2018-05-01

Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

Real-time PCR in virology.

Science.gov (United States)

Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

2002-03-15

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

Interlaboratory comparison of real-time pcr protocols for quantification of general fecal indicator bacteria

Science.gov (United States)

Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.

2012-01-01

The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.

Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

DEFF Research Database (Denmark)

Munch, M.; Nielsen, L.P.; Handberg, Kurt

2001-01-01

A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

2013-01-01

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

Science.gov (United States)

Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

2003-01-01

Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

Directory of Open Access Journals (Sweden)

María-José Chapela

2015-12-01

Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System.

Science.gov (United States)

DeShields, Joseph B; Bomberger, Rachel A; Woodhall, James W; Wheeler, David L; Moroz, Natalia; Johnson, Dennis A; Tanaka, Kiwamu

2018-02-23

On-site diagnosis of plant diseases can be a useful tool for growers for timely decisions enabling the earlier implementation of disease management strategies that reduce the impact of the disease. Presently in many diagnostic laboratories, the polymerase chain reaction (PCR), particularly real-time PCR, is considered the most sensitive and accurate method for plant pathogen detection. However, laboratory-based PCRs typically require expensive laboratory equipment and skilled personnel. In this study, soil-borne pathogens of potato are used to demonstrate the potential for on-site molecular detection. This was achieved using a rapid and simple protocol comprising of magnetic bead-based nucleic acid extraction, portable real-time PCR (fluorogenic probe-based assay). The portable real-time PCR approach compared favorably with a laboratory-based system, detecting as few as 100 copies of DNA from Spongospora subterranea. The portable real-time PCR method developed here can serve as an alternative to laboratory-based approaches and a useful on-site tool for pathogen diagnosis.

New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

Science.gov (United States)

Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

2001-01-01

Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

DNA extraction method for PCR in mycorrhizal fungi.

Science.gov (United States)

Manian, S; Sreenivasaprasad, S; Mills, P R

2001-10-01

To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

The use of newly developed real-time PCR for the rapid identification of bacteria in culture-negative osteomyelitis.

Science.gov (United States)

Kobayashi, Naomi; Bauer, Thomas W; Sakai, Hiroshige; Togawa, Daisuke; Lieberman, Isador H; Fujishiro, Takaaki; Procop, Gary W

2006-12-01

We report a case of a culture-negative osteomyelitis in which our newly developed real-time polymerase chain reaction (PCR) could differentiate Staphylococcus aureus from Staphylococcus epidermidis. This is the first report that described the application of this novel assay to an orthopedics clinical sample. This assay may be useful for other clinical culture-negative cases in a combination with a broad-spectrum assay as a rapid microorganism identification method.

Rapid and Specific Detection of Acidovorax avenae subsp. citrulli Using SYBR Green-Based Real-Time PCR Amplification of the YD-Repeat Protein Gene.

Science.gov (United States)

Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk

2015-09-01

The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.

Rapid detection of enterovirus in cerebrospinal fluid by a fully-automated PCR assay is associated with improved management of aseptic meningitis in adult patients.

Science.gov (United States)

Giulieri, Stefano G; Chapuis-Taillard, Caroline; Manuel, Oriol; Hugli, Olivier; Pinget, Christophe; Wasserfallen, Jean-Blaise; Sahli, Roland; Jaton, Katia; Marchetti, Oscar; Meylan, Pascal

2015-01-01

Enterovirus (EV) is the most frequent cause of aseptic meningitis (AM). Lack of microbiological documentation results in unnecessary antimicrobial therapy and hospitalization. To assess the impact of rapid EV detection in cerebrospinal fluid (CSF) by a fully-automated PCR (GeneXpert EV assay, GXEA) on the management of AM. Observational study in adult patients with AM. Three groups were analyzed according to EV documentation in CSF: group A = no PCR or negative PCR (n=17), group B = positive real-time PCR (n = 20), and group C = positive GXEA (n = 22). Clinical, laboratory and health-care costs data were compared. Clinical characteristics were similar in the 3 groups. Median turn-around time of EV PCR decreased from 60 h (IQR (interquartile range) 44-87) in group B to 5h (IQR 4-11) in group C (p<0.0001). Median duration of antibiotics was 1 (IQR 0-6), 1 (0-1.9), and 0.5 days (single dose) in groups A, B, and C, respectively (p < 0.001). Median length of hospitalization was 4 days (2.5-7.5), 2 (1-3.7), and 0.5 (0.3-0.7), respectively (p < 0.001). Median hospitalization costs were $5458 (2676-6274) in group A, $2796 (2062-5726) in group B, and $921 (765-1230) in group C (p < 0.0001). Rapid EV detection in CSF by a fully-automated PCR improves management of AM by significantly reducing antibiotic use, hospitalization length and costs. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular typing for blood group antigens within 40 minutes by direct PCR from plasma or serum

Science.gov (United States)

Wagner, Franz Friedrich; Flegel, Willy Albert; Bittner, Rita; Döscher, Andrea

2016-01-01

Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fya, Fyb, Jka and Jkb antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. PMID:27991657

A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

Science.gov (United States)

Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

2015-01-01

Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid strain typing of Bacillus coagulans.

Science.gov (United States)

Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa

2017-01-01

In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

Science.gov (United States)

Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

2017-01-01

In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

Science.gov (United States)

Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

2018-01-23

To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

African Journals Online (AJOL)

Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

A one-step, real-time PCR assay for rapid detection of rhinovirus.

Science.gov (United States)

Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

2010-01-01

One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

Directory of Open Access Journals (Sweden)

Serrano Oscar K

2008-10-01

Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

Science.gov (United States)

Kim, S A; Park, S H; Lee, S I; Ricke, S C

2017-12-01

The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

Science.gov (United States)

Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A

2017-09-01

With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

Real-time PCR in virology

OpenAIRE

Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

2002-01-01

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

Science.gov (United States)

Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

2012-06-01

Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

Directory of Open Access Journals (Sweden)

Antonio Olmos

2008-01-01

Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

Powerful qPCR assays for the early detection of latent invaders: interdisciplinary approaches in clinical cancer research and plant pathology.

Science.gov (United States)

Luchi, Nicola; Capretti, Paolo; Pazzagli, Mario; Pinzani, Pamela

2016-06-01

Latent invaders represent the first step of disease before symptoms occur in the host. Based on recent findings, tumors are considered to be ecosystems in which cancer cells act as invasive species that interact with the native host cell species. Analogously, in plants latent fungal pathogens coevolve within symptomless host tissues. For these reasons, similar detection approaches can be used for an early diagnosis of the invasion process in both plants and humans to prevent or reduce the spread of the disease. Molecular tools based on the evaluation of nucleic acids have been developed for the specific, rapid, and early detection of human diseases. During the last decades, these techniques to assess and quantify the proliferation of latent invaders in host cells have been transferred from the medical field to different areas of scientific research, such as plant pathology. An improvement in molecular biology protocols (especially referring to qPCR assays) specifically designed and optimized for detection in host plants is therefore advisable. This work is a cross-disciplinary review discussing the use of a methodological approach that is employed within both medical and plant sciences. It provides an overview of the principal qPCR tools for the detection of latent invaders, focusing on comparisons between clinical cancer research and plant pathology, and recent advances in the early detection of latent invaders to improve prevention and control strategies.

Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....

Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS for rapid strain typing of Bacillus coagulans.

Directory of Open Access Journals (Sweden)

Jun Sato

Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

Directory of Open Access Journals (Sweden)

Irina N Riediger

2017-09-01

Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

OpenAIRE

Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

2014-01-01

Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...

PCR-based verification of positive rapid diagnostic tests for intestinal protozoa infections with variable test band intensity.

Science.gov (United States)

Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg

2017-10-01

Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.

Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

Science.gov (United States)

Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

2018-01-01

The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

Science.gov (United States)

Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

2016-10-19

Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

Science.gov (United States)

Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

2017-01-01

Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

OpenAIRE

Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

2008-01-01

Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

Directory of Open Access Journals (Sweden)

Georg Walch

2016-04-01

Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

Rapid detection of Lactobacillus kefiranofaciens in kefir grain and kefir milk using newly developed real-time PCR.

Science.gov (United States)

Kim, Dong-Hyeon; Chon, Jung-Whan; Kim, Hong-Seok; Yim, Jin-Hyeok; Kim, Hyunsook; Seo, Kun-Ho

2015-04-01

Lactobacillus kefiranofaciens is an indicator microorganism for kefir and a key factor in kefir grain formation and kefiran production. We designed a novel real-time PCR primer and probe set, LKF_KU504, for the rapid detection of L. kefiranofaciens. In inclusivity and exclusivity tests, only 14 L. kefiranofaciens strains were positive among 61 microorganisms, indicating 100 % sensitivity and specificity. The LKF_KU504 set also differentiated kefir milk from 30 commercial nonkefir yogurts. The levels of L. kefiranofaciens in kefir grain and kefir milk were significantly different, indicating L. kefiranofaciens was more concentrated in kefir grain than in kefir milk.

Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit

Science.gov (United States)

Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu

2017-01-01

Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107

Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

DEFF Research Database (Denmark)

Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

2002-01-01

sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

Directory of Open Access Journals (Sweden)

Da-Sheng Lee

2010-01-01

Full Text Available Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

OpenAIRE

Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

2015-01-01

Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

Rapid real-time PCR assay for culture and tissue identification of Geomyces destructans: the etiologic agent of bat geomycosis (white nose syndrome).

Science.gov (United States)

Chaturvedi, Sudha; Rudd, Robert J; Davis, April; Victor, Tanya R; Li, Xiaojiang; Appler, Kim A; Rajkumar, Sunanda S; Chaturvedi, Vishnu

2011-10-01

Geomyces destructans is the etiologic agent of bat geomycosis, commonly referred to as white nose syndrome (WNS). This infection has caused severe morbidity and mortality in little brown bats (Myotis lucifugus) and has also spread to other bat species with significant decline in the populations. Currently, G. destructans infection is identified by culture, ITS-PCR, and histopathology. We hypothesized that a real-time PCR assay would considerably improve detection of G. destructans in bats. The 100 bp sequence of the Alpha-L-Rhamnosidase gene was validated as a target for real-time PCR. The assay sensitivity was determined from serial dilution of DNA extracted from G. destructans conidia (5 × 10(-1)-5 × 10(7)), and the specificity was tested using DNA from 30 closely and distantly related fungi and 5 common bacterial pathogens. The real-time PCR assay was highly sensitive with detection limit of two G. destructans conidia per reaction at 40 PCR cycles. The assay was also highly specific as none of the other fungal or bacterial DNA cross-reacted in the real-time PCR assay. One hundred and forty-seven bat tissue samples, suspected of infection with G. destructans, were used to compare the real-time PCR assay to other methods employed for the detection of G. destructans. Real-time PCR was highly sensitive with 80 of 147 (55%) samples testing positive for G. destructans DNA. In comparison, histopathology examination revealed 64/147 (44%) positive samples. The internal transcribed spacer (ITS)-PCR yielded positive amplicon for G. destructans from 37 tissue samples (25%). The least sensitive assay was the fungal culture with only 17 tissue samples (12%) yielding G. destructans in culture. The data suggested that the real-time PCR assay is highly promising for rapid, sensitive, and specific identification of G. destructans. Further trials and inter-laboratory comparisons of this novel assay are recommended to improve the diagnosis of bat geomycosis.

Comparison of false-negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture.

Science.gov (United States)

Hutchison, J R; Piepel, G F; Amidan, B G; Hess, B M; Sydor, M A; Deatherage Kaiser, B L

2018-05-01

We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials and assay methods on false-negative rate (FNR) and limit of detection (LOD 95 ) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2-500 per coupon) onto glass, stainless steel, vinyl tile and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD 95 results. Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD 95 was lowest for glass and highest for vinyl tile. LOD 95 values overall were lower for mRV-PCR than for the culture method. This study adds to the limited data on FNR and LOD 95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis. © 2018 The Society for Applied Microbiology.

Quantitative real-time PCR approaches for microbial community studies in wastewater treatment systems: applications and considerations.

Science.gov (United States)

Kim, Jaai; Lim, Juntaek; Lee, Changsoo

2013-12-01

Quantitative real-time PCR (qPCR) has been widely used in recent environmental microbial ecology studies as a tool for detecting and quantifying microorganisms of interest, which aids in better understandings of the complexity of wastewater microbial communities. Although qPCR can be used to provide more specific and accurate quantification than other molecular techniques, it does have limitations that must be considered when applying it in practice. This article reviews the principle of qPCR quantification and its applications to microbial ecology studies in various wastewater treatment environments. Here we also address several limitations of qPCR-based approaches that can affect the validity of quantification data: template nucleic acid quality, nucleic acid extraction efficiency, specificity of group-specific primers and probes, amplification of nonviable DNA, gene copy number variation, and limited number of sequences in the database. Even with such limitations, qPCR is reportedly among the best methods for quantitatively investigating environmental microbial communities. The application of qPCR is and will continue to be increasingly common in studies of wastewater treatment systems. To obtain reliable analyses, however, the limitations that have often been overlooked must be carefully considered when interpreting the results. Copyright © 2013 Elsevier Inc. All rights reserved.

Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

Science.gov (United States)

Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

2012-02-01

Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

Science.gov (United States)

Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

2014-09-01

The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

Identification and characterization of a novel tospovirus species using a new RT-PCR approach

NARCIS (Netherlands)

Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

2001-01-01

Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Feroze Ahmed Ganaie

2015-01-01

Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

Science.gov (United States)

Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

2017-10-01

Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

Directory of Open Access Journals (Sweden)

Siwon Lee

2013-09-01

Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

Science.gov (United States)

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

Polymeric LabChip real-time PCR as a point-of-care-potential diagnostic tool for rapid detection of influenza A/H1N1 virus in human clinical specimens.

Directory of Open Access Journals (Sweden)

Hyun-Ok Song

Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD......) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...

Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

Science.gov (United States)

Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

2016-05-01

The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

Quantitative (real-time) PCR

International Nuclear Information System (INIS)

Denman, S.E.; McSweeney, C.S.

2005-01-01

Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

DEFF Research Database (Denmark)

Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

1999-01-01

The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...

Rapid detox: understanding new treatment approaches for the addicted patient.

Science.gov (United States)

McCabe, S

2000-01-01

Despite substantive advances in understanding of genetic and biochemical basis of substance abuse and addiction in the last decade, little information has been translated into alternative treatment models for the addicted patient. Rapid detox, an alternative form of detox treatment, is gaining in both acceptance and popularity. To increase readers' understanding of the neurobiology of addiction and the mode of action of new detox approaches for patients addicted to opiate drugs. A review of the current literature pertaining to rapid detox. Rapid detox is a viable alternative for selected patients attempting to detox from opiate agents of abuse. Increasing knowledge of new treatment approaches allows nurses working to assist addicted patients in planning and receiving treatment based on new awareness of the neurobiology of addiction.

An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

Directory of Open Access Journals (Sweden)

Antonio Olmos

2008-01-01

Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

Comparison of false-negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture

Energy Technology Data Exchange (ETDEWEB)

Hutchison, J. R. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Piepel, G. F. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Amidan, B. G. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Hess, B. M. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Sydor, M. A. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Deatherage Kaiser, B. L. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA

2018-03-13

Aims: We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials, and assay methods on false-negative rate (FNR) and limit of detection (LOD95) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Methods and Results: Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2 – 500 coupon-1) onto glass, stainless steel, vinyl tile, and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD95 results. Conclusions: Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD95 was lowest for glass and highest for vinyl tile. LOD95 values overall were lower for mRV-PCR than for the culture method. Significance and Impact of Study: This study adds to the limited data on FNR and LOD95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis.

Rapid and sensitive detection of cytokines using functionalized gold nanoparticle-based immuno-PCR, comparison with immuno-PCR and ELISA

Czech Academy of Sciences Publication Activity Database

Potůčková, Lucie; Franko, Filip; Bambousková, Monika; Dráber, Petr

2011-01-01

Roč. 371, 1-2 (2011), s. 38-47 ISSN 0022-1759 R&D Projects: GA AV ČR KAN200520701; GA MŠk 1M0506; GA MŠk LC545; GA ČR GA301/09/1826; GA ČR GAP302/10/1759; GA ČR(CZ) GD204/05/H023 Grant - others:AV ČR(CZ) M200520901 Institutional research plan: CEZ:AV0Z50520514 Keywords : immuno-PCR * nano-iPCR * nanogold particles Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.203, year: 2011

COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

Directory of Open Access Journals (Sweden)

Tülin GÜVEN GÖKMEN

Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

Parallel susceptibility testing of bacteria through culture-quantitative PCR in 96-well plates

Directory of Open Access Journals (Sweden)

Jun Luo

2018-05-01

Full Text Available Objective: The methods combining culture and quantitative PCR(qPCR offer new solutions for rapid antibiotic susceptibility testing(AST. However, the multiple steps of DNA extraction and cold storage of PCR reagents needed make them unsuitable for rapid high throughput AST. In this study, a parallel culture-qPCR method was developed to overcome above problems. Method: In this method, bacteria culture and DNA extraction automatically and simultaneously completed through using a common PCR instrument as a controllable heating device. A lyophilized 16S rDNA targeted qPCR reagent was also developed, which was stable and could be kept at 4 °C for long time and at 37 °C for about two months. Result: Testing of 36 P. aeruginosa isolates and 28 S. aureus isolates showed that the method had good agreements with the standard broth microdilution method, with an overall agreement of 97.22% (95% CI, 85.83–99.51 for P. aeruginosa and 96.43% (95% CI, 79.76–99.81 for S. aureus. This method could test 12 samples against a panel of up to 7 antibiotics simultaneously in two 96-well PCR plates within 4 h, which greatly improves the testing efficiency of the culture-qPCR method. Conclusion: With rapidness to obtain results and the capabilities for automation and multiple-sample testing, the parallel culture-qPCR method would have great potentials in clinical labs. Keywords: Antibiotic susceptibility testing, Thermo-cold lysis, Lyophilized qPCR reagent, Quantitative PCR, Bacteria

Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.

Science.gov (United States)

Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P

2003-08-01

The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer......A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD...

Comparison of viable plate count, turbidity measurement and real-time PCR for quantification of Porphyromonas gingivalis.

Science.gov (United States)

Clais, S; Boulet, G; Van Kerckhoven, M; Lanckacker, E; Delputte, P; Maes, L; Cos, P

2015-01-01

The viable plate count (VPC) is considered as the reference method for bacterial enumeration in periodontal microbiology but shows some important limitations for anaerobic bacteria. As anaerobes such as Porphyromonas gingivalis are difficult to culture, VPC becomes time-consuming and less sensitive. Hence, efficient normalization of experimental data to bacterial cell count requires alternative rapid and reliable quantification methods. This study compared the performance of VPC with that of turbidity measurement and real-time PCR (qPCR) in an experimental context using highly concentrated bacterial suspensions. Our TaqMan-based qPCR assay for P. gingivalis 16S rRNA proved to be sensitive and specific. Turbidity measurements offer a fast method to assess P. gingivalis growth, but suffer from high variability and a limited dynamic range. VPC was very time-consuming and less repeatable than qPCR. Our study concludes that qPCR provides the most rapid and precise approach for P. gingivalis quantification. Although our data were gathered in a specific research context, we believe that our conclusions on the inferior performance of VPC and turbidity measurements in comparison to qPCR can be extended to other research and clinical settings and even to other difficult-to-culture micro-organisms. Various clinical and research settings require fast and reliable quantification of bacterial suspensions. The viable plate count method (VPC) is generally seen as 'the gold standard' for bacterial enumeration. However, VPC-based quantification of anaerobes such as Porphyromonas gingivalis is time-consuming due to their stringent growth requirements and shows poor repeatability. Comparison of VPC, turbidity measurement and TaqMan-based qPCR demonstrated that qPCR possesses important advantages regarding speed, accuracy and repeatability. © 2014 The Society for Applied Microbiology.

Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

DEFF Research Database (Denmark)

Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

2012-01-01

expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

Development and Evaluation of a Rapid and Sensitive EBOV-RPA Test for Rapid Diagnosis of Ebola Virus Disease.

Science.gov (United States)

Yang, Mingjuan; Ke, Yuehua; Wang, Xuesong; Ren, Hang; Liu, Wei; Lu, Huijun; Zhang, Wenyi; Liu, Shiwei; Chang, Guohui; Tian, Shuguang; Wang, Lihua; Huang, Liuyu; Liu, Chao; Yang, Ruifu; Chen, Zeliang

2016-06-01

Confirming Ebola virus disease (EVD), a deadly infectious disease, requires real-time RT-PCR, which takes up to a few hours to yield results. Therefore, a rapid diagnostic assay is imperative for EVD diagnosis. A rapid nucleic acid test based on recombinase polymerase amplification (EBOV-RPA) was developed to specifically detect the 2014 outbreak strains. The EBOV-RPA assay was evaluated by testing samples from suspected EVD patients in parallel with RT-PCR. An EBOV-RPA, which could be completed in 20 min, was successfully developed. Of 271 patients who tested positive for Ebola virus by RT-PCR, 264 (sensitivity: 97%, 95% CI: 95.5-99.3%) were positive by EBOV-RPA; 101 of 104 patients (specificity: 97%, 95% CI: 93.9-100%) who tested negative by RT-PCR were also negative by EBOV-RPA. The sensitivity values for samples with a Ct value of RPA had significantly high Ct values. Results of external quality assessment samples with EBOV-RPA were 100%, consistent with those of RT-PCR. The EBOV-RPA assay showed 97% sensitivity and 97% specificity for all EVD samples tested, making it a rapid and sensitive test for EVD diagnosis.

Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

Science.gov (United States)

Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

2018-01-01

Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

Spatiotemporal Dynamics of Vibrio cholerae in Turbid Alkaline Lakes as Determined by Quantitative PCR.

Science.gov (United States)

Bliem, Rupert; Reischer, Georg; Linke, Rita; Farnleitner, Andreas; Kirschner, Alexander

2018-06-01

In recent years, global warming has led to a growing number of Vibrio cholerae infections in bathing water users in regions formerly unaffected by this pathogen. It is therefore of high importance to monitor V. cholerae in aquatic environments and to elucidate the main factors governing its prevalence and abundance. For this purpose, rapid and standardizable methods that can be performed by routine water laboratories are prerequisite. In this study, we applied a recently developed multiplex quantitative PCR (qPCR) strategy (i) to monitor the spatiotemporal variability of V. cholerae abundance in two small soda pools and a large lake that is intensively used for recreation and (ii) to elucidate the main factors driving V. cholerae dynamics in these environments. V. cholerae was detected with qPCR at high concentrations of up to 970,000 genomic units 100 ml -1 during the warm season, up to 2 orders of magnitude higher than values obtained by cultivation. An independent cytometric approach led to results comparable to qPCR data but with significantly more positive samples due to problems with DNA recovery for qPCR. Not a single sample was positive for toxigenic V. cholerae , indicating that only nontoxigenic V. cholerae (NTVC) was present. Temperature was the main predictor of NTVC abundance, but the quality and quantity of dissolved organic matter were also important environmental correlates. Based on this study, we recommend using the developed qPCR strategy for quantification of toxigenic and nontoxigenic V. cholerae in bathing waters with the need for improvements in DNA recovery. IMPORTANCE There is a definitive need for rapid and standardizable methods to quantify waterborne bacterial pathogens. Such methods have to be thoroughly tested for their applicability to environmental samples. In this study, we critically tested a recently developed multiplex qPCR strategy for its applicability to determine the spatiotemporal variability of V. cholerae abundance in

High-resolution melting-curve analysis of ligation-mediated real-time PCR for rapid evaluation of an epidemiological outbreak of extended-spectrum-beta-lactamase-producing Escherichia coli.

Science.gov (United States)

Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E; Schön, Thomas

2011-12-01

Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE.

Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

DEFF Research Database (Denmark)

Mahende, Coline; Ngasala, Billy; Lusingu, John

2016-01-01

with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. Results: A total of 867 febrile patients......Background: Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity...... of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. Methods: The study enrolled children aged 2-59 months...

Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

Directory of Open Access Journals (Sweden)

Jiashun Wang

Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

Failure of PCR to Detect Treponema pallidum ssp. pertenue DNA in Blood in Latent Yaws.

Directory of Open Access Journals (Sweden)

Michael Marks

Full Text Available Yaws, caused by Treponema pallidum ssp. pertenue, is a neglected tropical disease closely related to venereal syphilis and is targeted for eradication by 2020. Latent yaws represents a diagnostic challenge, and current tools cannot adequately distinguish between individuals with true latent infection and individuals who are serofast following successful treatment. PCR on blood has previously been shown to detect T. pallidum DNA in patients with syphilis, suggesting that this approach may be of value in yaws. We performed real-time PCR for Treponema pallidum ssp. pertenue on blood samples from 140 children with positive T. pallidum Particle Agglutination (TPPA and Rapid Plasma Reagin (RPR tests and 7 controls (negative serology, all collected as part of a prospective study of yaws in the Solomon Islands. All samples were also tested by a nested PCR for T. pallidum. 12 patients had clinical evidence of active yaws whilst 128 were considered to have latent yaws. 43 children had high titre rapid plasma reagins (RPRs of ≥1:32. PCR testing with both assays gave negative results in all cases. It is possible that the failure to detect T. pallidum ssp. pertenue in blood reflects lower loads of organism in latent yaws compared to those in latent infection with T. pallidum ssp. pertenue, and/or a lower propensity for haematogenous dissemination in yaws than in syphilis. As the goal of the yaws control programme is eradication, a tool that can differentiate true latent infection from individuals who are serofast would be of value; however, PCR of blood is not that tool.

Failure of PCR to Detect Treponema pallidum ssp. pertenue DNA in Blood in Latent Yaws.

Science.gov (United States)

Marks, Michael; Katz, Samantha; Chi, Kai-Hua; Vahi, Ventis; Sun, Yongcheng; Mabey, David C; Solomon, Anthony W; Chen, Cheng Y; Pillay, Allan

2015-01-01

Yaws, caused by Treponema pallidum ssp. pertenue, is a neglected tropical disease closely related to venereal syphilis and is targeted for eradication by 2020. Latent yaws represents a diagnostic challenge, and current tools cannot adequately distinguish between individuals with true latent infection and individuals who are serofast following successful treatment. PCR on blood has previously been shown to detect T. pallidum DNA in patients with syphilis, suggesting that this approach may be of value in yaws. We performed real-time PCR for Treponema pallidum ssp. pertenue on blood samples from 140 children with positive T. pallidum Particle Agglutination (TPPA) and Rapid Plasma Reagin (RPR) tests and 7 controls (negative serology), all collected as part of a prospective study of yaws in the Solomon Islands. All samples were also tested by a nested PCR for T. pallidum. 12 patients had clinical evidence of active yaws whilst 128 were considered to have latent yaws. 43 children had high titre rapid plasma reagins (RPRs) of ≥1:32. PCR testing with both assays gave negative results in all cases. It is possible that the failure to detect T. pallidum ssp. pertenue in blood reflects lower loads of organism in latent yaws compared to those in latent infection with T. pallidum ssp. pertenue, and/or a lower propensity for haematogenous dissemination in yaws than in syphilis. As the goal of the yaws control programme is eradication, a tool that can differentiate true latent infection from individuals who are serofast would be of value; however, PCR of blood is not that tool.

Performance of Droplet Digital PCR in Non-Invasive Fetal RHD Genotyping - Comparison with a Routine Real-Time PCR Based Approach.

Directory of Open Access Journals (Sweden)

Iveta Svobodová

Full Text Available Detection and characterization of circulating cell-free fetal DNA (cffDNA from maternal circulation requires an extremely sensitive and precise method due to very low cffDNA concentration. In our study, droplet digital PCR (ddPCR was implemented for fetal RHD genotyping from maternal plasma to compare this new quantification alternative with real-time PCR (qPCR as a golden standard for quantitative analysis of cffDNA. In the first stage of study, a DNA quantification standard was used. Clinical samples, including 10 non-pregnant and 35 pregnant women, were analyzed as a next step. Both methods' performance parameters-standard curve linearity, detection limit and measurement precision-were evaluated. ddPCR in comparison with qPCR has demonstrated sufficient sensitivity for analysing of cffDNA and determination of fetal RhD status from maternal circulation, results of both methods strongly correlated. Despite the more demanding workflow, ddPCR was found to be slightly more precise technology, as evaluated using quantitative standard. Regarding the clinical samples, the precision of both methods equalized with decreasing concentrations of tested DNA samples. In case of cffDNA with very low concentrations, variance parameters of both techniques were comparable. Detected levels of fetal cfDNA in maternal plasma were slightly higher than expected and correlated significantly with gestational age as measured by both methods (ddPCR r = 0.459; qPCR r = 0.438.

Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

Science.gov (United States)

Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

2017-01-01

Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

Science.gov (United States)

Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

2015-01-01

Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

OpenAIRE

Lee, Da-Sheng

2010-01-01

Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DN...

Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

DEFF Research Database (Denmark)

Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

2008-01-01

This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

Science.gov (United States)

Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

2000-06-15

Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

A multiplex PCR for detection of six viruses in ducks.

Science.gov (United States)

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

Exploring viral reservoir: The combining approach of cell sorting and droplet digital PCR.

Science.gov (United States)

Gibellini, Lara; Pecorini, Simone; De Biasi, Sara; Pinti, Marcello; Bianchini, Elena; De Gaetano, Anna; Digaetano, Margherita; Pullano, Rosalberta; Lo Tartaro, Domenico; Iannone, Anna; Mussini, Cristina; Cossarizza, Andrea; Nasi, Milena

2018-02-01

Combined antiretroviral therapy (cART) blocks different steps of HIV replication and maintains plasma viral RNA at undetectable levels. The virus can remain in long-living cells and create a reservoir where HIV can restart replicating after cART discontinuation. A persistent viral production triggers and maintains a persistent immune activation, which is a well-known feature of chronic HIV infection, and contributes either to precocious aging, or to the increased incidence of morbidity and mortality of HIV positive patients. The new frontier of the treatment of HIV infection is nowadays eradication of the virus from all host cells and tissues. For this reason, it is crucial to have a clear and precise idea of where the virus hides, and which are the cells that keep it silent. Important efforts have been made to improve the detection of viral reservoirs, and new techniques are now giving the opportunity to characterize viral reservoirs. Among these techniques, a strategic approach based upon cell sorting and droplet digital PCR (ddPCR) is opening new horizons and opportunities of research. This review provides an overview of the methods that combine cell sorting and ddPCR for the quantification of HIV DNA in different cell types, and for the detection of its maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

PCR-based approach to SINE isolation: simple and complex SINEs.

Science.gov (United States)

Borodulina, Olga R; Kramerov, Dmitri A

2005-04-11

Highly repeated copies of short interspersed elements (SINEs) occur in eukaryotic genomes. The distribution of each SINE family is usually restricted to some genera, families, or orders. SINEs have an RNA polymerase III internal promoter, which is composed of boxes A and B. Here we propose a method for isolation of novel SINE families based on genomic DNA PCR with oligonucleotide identical to box A as a primer. Cloning of the size-heterogeneous PCR-products and sequencing of their terminal regions allow determination of SINE structure. Using this approach, two novel SINE families, Rhin-1 and Das-1, from the genomes of great horseshoe bat (Rhinolophus ferrumequinum) and nine-banded armadillo (Dasypus novemcinctus), respectively, were isolated and studied. The distribution of Rhin-1 is restricted to two of six bat families tested. Copies of this SINE are characterized by frequent internal insertions and significant length (200-270 bp). Das-1 being only 90 bp in length is one of the shortest SINEs known. Most of Das-1 nucleotide sequences demonstrate significant similarity to alanine tRNA which appears to be an evolutionary progenitor of this SINE. Together with three other known SINEs (ID, Vic-1, and CYN), Das-1 constitutes a group of simple SINEs. Interestingly, three SINE families of this group are alanine tRNA-derived. Most probably, this tRNA gave rise to short and simple but successful SINEs several times during mammalian evolution.

High-Resolution Melting-Curve Analysis of Ligation-Mediated Real-Time PCR for Rapid Evaluation of an Epidemiological Outbreak of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli ▿

Science.gov (United States)

Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E.; Schön, Thomas

2011-01-01

Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE. PMID:21956981

Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

Directory of Open Access Journals (Sweden)

Adeline Bidault

2015-12-01

Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

Immuno-PCR, a new technique for the serodiagnosis of tuberculosis.

Science.gov (United States)

Mehta, Promod K; Dahiya, Bhawna; Sharma, Suman; Singh, Netrapal; Dharra, Renu; Thakur, Zoozeal; Mehta, Neeru; Gupta, Krishna B; Gupta, Mahesh C; Chaudhary, Dhruva

2017-08-01

Rapid and accurate diagnosis of tuberculosis (TB) is essential to control the disease. The conventional microbiological tests have limitations and there is an urgent need to devise a simple, rapid and reliable point-of-care (POC) test. The failure of TB diagnostic tests based on antibody detection due to inconsistent and imprecise results has stimulated renewed interest in the development of rapid antigen detection methods. However, the World Health Organization (WHO) has emphasized to continue research for designing new antibody-based detection tests with improved accuracy. Immuno-polymerase chain reaction (I-PCR) combines the simplicity and versatility of enzyme-linked immunosorbent assay (ELISA) with the exponential amplification capacity and sensitivity of PCR thus leading to several-fold increase in sensitivity in comparison to analogous ELISA. In this review, we have described the serodiagnostic potential of I-PCR assays for an early diagnosis of TB based on the detection of potential mycobacterial antigens and circulating antibodies in body fluids of TB patients. Copyright © 2017 Elsevier B.V. All rights reserved.

PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

Science.gov (United States)

Janczarek, Monika; Palusińska-Szysz, Marta

2016-05-01

Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

Directory of Open Access Journals (Sweden)

Denis Martine

2011-05-01

Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests

Science.gov (United States)

Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.

1999-01-01

Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815

Exploring MALDI-TOF MS approach for a rapid identification of Mycobacterium avium ssp. paratuberculosis field isolates.

Science.gov (United States)

Ricchi, M; Mazzarelli, A; Piscini, A; Di Caro, A; Cannas, A; Leo, S; Russo, S; Arrigoni, N

2017-03-01

The aim of the study was to explore the suitability of matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) for a rapid and correct identification of Mycobacterium avium ssp. paratuberculosis (MAP) field isolates. MALDI-TOF MS approach is becoming one of the most popular tests for the identification of intact bacterial cells which has been shown to be fast and reliable. For this purpose, 36 MAP field isolates were analysed through MALDI-TOF MS and the spectra compared with two different databases: one provided by the vendor of the system employed (Biotyper ver. 3·0; Bruker Daltonics) and a homemade database containing spectra from both tuberculous and nontuberculous Mycobacteria. Moreover, principal component analysis procedure was employed to confirm the ability of MALDI-TOF MS to discriminate between very closely related subspecies. Our results suggest MAP can be differentiated from other Mycobacterium species, both when the species are very close (M. intracellulare) and when belonging to different subspecies (M. avium ssp. avium and M. avium ssp. silvaticum). The procedure applied is fast, easy to perform, and achieves an earlier accurate species identification of MAP and nontuberculous Mycobacteria in comparison to other procedures. The gold standard test for the diagnosis of paratuberculosis is still isolation of MAP by cultural methods, but additional assays, such as qPCR and subculturing for determination of mycobactin dependency are required to confirm its identification. We have provided here evidence pertaining to the usefulness of MALDI-TOF MS approach for a rapid identification of this mycobacterium among other members of M. avium complex. © 2016 The Society for Applied Microbiology.

Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

Science.gov (United States)

Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

2011-01-01

Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

Science.gov (United States)

Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

2006-01-01

Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

Rapid detection, characterization, and enumeration of foodborne pathogens.

Science.gov (United States)

Hoorfar, J

2011-11-01

As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

A rapid cycleave PCR method for distinguishing the vaccine strain Brucella abortus A19 in China.

Science.gov (United States)

Nan, Wenlong; Zhang, Yueyong; Tan, Pengfei; Xu, Zouliang; Chen, Yuqi; Mao, Kairong; Chen, Yiping

2016-05-01

Brucellosis is a widespread zoonotic disease caused by Brucella spp. Immunization with attenuated vaccines has proved to be an effective method of prevention; however, it may also interfere with diagnosis. Brucella abortus strain A19, which is homologous to B. abortus strain S19, is widely used for the prevention of bovine brucellosis in China. For effective monitoring of the control of brucellosis, it is essential to distinguish A19 from field strains. Single-nucleotide polymorphism-based assays offer a new approach to such discrimination studies. In the current study, we developed a cycleave PCR assay that successfully distinguished attenuated vaccine strains A19 and S19 from 22 strains of B. abortus and 57 strains of 5 other Brucella species. The assay gave a negative reaction with 4 non-Brucella species. The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 7.6 fg for the A19 strain and 220 fg for the single non-A19/non-S19 Brucella strain tested (B. abortus 104M). The assay was also reproducible (intra- and interassay coefficients of variation: 0.003-0.01 and 0.004-0.025, respectively). The cycleave assay gave an A19/S19-specific reaction in 3 out of 125 field serum samples, with the same 3 samples being positive in an alternative A19/S19-specific molecular assay. The cycleave assay gave a total of 102 Brucella-specific reactions (3 being the A19/S19-specific reactions), whereas an alternative Brucella-specific assay gave 92 positive reactions (all also positive in the cycleave assay). Therefore, this assay represents a simple, rapid, sensitive, and specific tool for use in brucellosis control. © 2016 The Author(s).

Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

Science.gov (United States)

Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

2016-01-01

Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease

Directory of Open Access Journals (Sweden)

Manoj Kumar

2013-01-01

Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.

Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.

Science.gov (United States)

Pavšič, Jernej; Žel, Jana; Milavec, Mojca

2016-01-01

Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.

Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

Science.gov (United States)

Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

2010-12-01

Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

Validation of chimerism in pediatric recipients of allogeneic hematopoietic stem cell transplantation (HSCT) a comparison between two methods: real-time PCR (qPCR) vs. variable number tandem repeats PCR (VNTR PCR).

Science.gov (United States)

Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana

2013-01-01

Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.

Comparative validation using quantitative real-time PCR (qPCR and conventional PCR of bovine semen centrifuged in continuous density gradient

Directory of Open Access Journals (Sweden)

M.V. Resende

2011-06-01

Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.

Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

Science.gov (United States)

Keane, O M; Budd, K E; Flynn, J; McCoy, F

2013-09-21

Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

Directory of Open Access Journals (Sweden)

Vlademir Cantarelli

2011-10-01

Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

OpenAIRE

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-01-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

Real-Time RT-PCR for the Detection of Lyssavirus Species

Directory of Open Access Journals (Sweden)

A. Deubelbeiss

2014-01-01

Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

Rapid detection and strain typing of Chlamydia trachomatis using a highly multiplexed microfluidic PCR assay.

Directory of Open Access Journals (Sweden)

Rosemary S Turingan

Full Text Available Nucleic acid amplification tests (NAATs are recommended by the CDC for detection of Chlamydia trachomatis (Ct urogenital infections. Current commercial NAATs require technical expertise and sophisticated laboratory infrastructure, are time-consuming and expensive, and do not differentiate the lymphogranuloma venereum (LGV strains that require a longer duration of treatment than non-LGV strains. The multiplexed microfluidic PCR-based assay presented in this work simultaneously interrogates 13 loci to detect Ct and identify LGV and non-LGV strain-types. Based on amplified fragment length polymorphisms, the assay differentiates LGV, ocular, urogenital, and proctocolitis clades, and also serovars L1, L2, and L3 within the LGV group. The assay was evaluated in a blinded fashion using 95 clinical swabs, with 76 previously reported as urogenital Ct-positive samples and typed by ompA genotyping and/or Multi-Locus Sequence Typing. Results of the 13-plex assay showed that 51 samples fell within urogenital clade 2 or 4, 24 samples showed both clade 2 and 4 signatures, indicating possible mixed infection, gene rearrangement, or inter-clade recombination, and one sample was a noninvasive trachoma biovar (either a clade 3 or 4. The remaining 19 blinded samples were correctly identified as LGV clade 1 (3, ocular clade 3 (4, or as negatives (12. To date, no NAAT assay can provide a point-of-care applicable turnaround time for Ct detection while identifying clinically significant Ct strain types to inform appropriate treatment. Coupled with rapid DNA processing of clinical swabs (approximately 60 minutes from swab-in to result-out, the assay has significant potential as a rapid POC diagnostic for Ct infections.

A novel approach for rapid micropropagation of maspine pineapple ...

African Journals Online (AJOL)

A novel approach for rapid micropropagation of maspine pineapple ( Ananas comosus L.) shoots using liquid shake culture system. ... Maspine (Ananas comosus L.) is currently the most preferred pineapple variety in Malaysia due to its pleasant aroma and applicability in caning. Large quantities of plant materials are ...

Rapid detection and differentiation of Clonorchis sinensis and Opisthorchis viverrini using real-time PCR and high resolution melting analysis.

Science.gov (United States)

Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

2014-01-01

Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

Directory of Open Access Journals (Sweden)

Xian-Quan Cai

2014-01-01

Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

Science.gov (United States)

Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

2017-02-08

Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

Rapid differentiation of Staphylococcus aureus isolates harbouring egc loci with pseudogenes psient1 and psient2 and the selu or seluv gene using PCR-RFLP.

Science.gov (United States)

Collery, Mark M; Smyth, Cyril J

2007-02-01

The egc locus of Staphylococus aureus harbours two enterotoxin genes (seg and sei) and three enterotoxin-like genes (selm, seln and selo). Between the sei and seln genes are located two pseudogenes, psient1 and psient2, or the selu or seluv gene. While these two alternative sei-seln intergenic regions can be distinguished by PCR, to date, DNA sequencing has been the only confirmatory option because of the very high degree of sequence similarity between egc loci bearing the pseudogenes and the selu or seluv gene. In silico restriction enzyme digestion of genomic regions encompassing the egc locus from the 3' end of the sei gene through the 5' first quarter of the seln gene allowed pseudogene- and selu- or seluv-bearing egc loci to be distinguished by PCR-RFLP. Experimental application of these findings demonstrated that endonuclease HindIII cleaved PCR amplimers bearing pseudogenes but not those with a selu or seluv gene, while selu- or seluv-bearing amplimers were susceptible to cleavage by endonuclease HphI, but not by endonuclease HindIII. The restriction enzyme BccI cleaved selu- or seluv-harbouring amplimers at a unique restriction site created by their signature 15 bp insertion compared with pseudogene-bearing amplimers, thereby allowing distinction of these egc loci. PCR-RFLP analysis using these restriction enzymes provides a rapid, easy to interpret alternative to DNA sequencing for verification of PCR findings on the nature of an egc locus type, and can also be used for the primary identification of the intergenic sei-seln egc locus type.

A multiplex PCR method for rapid identification of Brachionus rotifers.

Science.gov (United States)

Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

2009-01-01

Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

Directory of Open Access Journals (Sweden)

Fatemeh Dehghan

2014-11-01

Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

PCR+ In Diesel Fuels and Emissions Research

Energy Technology Data Exchange (ETDEWEB)

McAdams, H.T.

2002-04-15

In past work for the U.S. Department of Energy (DOE) and Oak Ridge National Laboratory (ORNL), PCR+ was developed as an alternative methodology for building statistical models. PCR+ is an extension of Principal Components Regression (PCR), in which the eigenvectors resulting from Principal Components Analysis (PCA) are used as predictor variables in regression analysis. The work was motivated by the observation that most heavy-duty diesel (HDD) engine research was conducted with test fuels that had been ''concocted'' in the laboratory to vary selected fuel properties in isolation from each other. This approach departs markedly from the real world, where the reformulation of diesel fuels for almost any purpose leads to changes in a number of interrelated properties. In this work, we present new information regarding the problems encountered in the conventional approach to model-building and how the PCR+ method can be used to improve research on the relationship between fuel characteristics and engine emissions. We also discuss how PCR+ can be applied to a variety of other research problems related to diesel fuels.

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) for large genomic rearrangements (LGRs) detection: A new approach to assess quantitative status of BRCA1 gene in a reference laboratory.

Science.gov (United States)

Minucci, Angelo; De Paolis, Elisa; Concolino, Paola; De Bonis, Maria; Rizza, Roberta; Canu, Giulia; Scaglione, Giovanni Luca; Mignone, Flavio; Scambia, Giovanni; Zuppi, Cecilia; Capoluongo, Ettore

2017-07-01

Evaluation of copy number variation (CNV) in BRCA1/2 genes, due to large genomic rearrangements (LGRs), is a mandatory analysis in hereditary breast and ovarian cancers families, if no pathogenic variants are found by sequencing. LGRs cannot be detected by conventional methods and several alternative methods have been developed. Since these approaches are expensive and time consuming, identification of alternative screening methods for LGRs detection is needed in order to reduce and optimize the diagnostic procedure. The aim of this study was to investigate a Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) as molecular tool to detect recurrent BRCA1 LGRs. C-PCR-HRMA was performed on exons 3, 14, 18, 19, 20 and 21 of the BRCA1 gene; exons 4, 6 and 7 of the ALB gene were used as reference fragments. This study showed that it is possible to identify recurrent BRCA1 LGRs, by melting peak height ratio between target (BRCA1) and reference (ALB) fragments. Furthermore, we underline that a peculiar amplicon-melting profile is associated to a specific BRCA1 LGR. All C-PCR-HRMA results were confirmed by Multiplex ligation-dependent probe amplification. C-PCR-HRMA has proved to be an innovative, efficient and fast method for BRCA1 LGRs detection. Given the sensitivity, specificity and ease of use, c-PCR-HRMA can be considered an attractive and powerful alternative to other methods for BRCA1 CNVs screening, improving molecular strategies for BRCA testing in the context of Massive Parallel Sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of Bacillus spores using PCR and FTA filters.

Science.gov (United States)

Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

2004-05-01

Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

Science.gov (United States)

Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

2002-12-20

A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

Decoding DNA labels by melting curve analysis using real-time PCR.

Science.gov (United States)

Balog, József A; Fehér, Liliána Z; Puskás, László G

2017-12-01

Synthetic DNA has been used as an authentication code for a diverse number of applications. However, existing decoding approaches are based on either DNA sequencing or the determination of DNA length variations. Here, we present a simple alternative protocol for labeling different objects using a small number of short DNA sequences that differ in their melting points. Code amplification and decoding can be done in two steps using quantitative PCR (qPCR). To obtain a DNA barcode with high complexity, we defined 8 template groups, each having 4 different DNA templates, yielding 158 (>2.5 billion) combinations of different individual melting temperature (Tm) values and corresponding ID codes. The reproducibility and specificity of the decoding was confirmed by using the most complex template mixture, which had 32 different products in 8 groups with different Tm values. The industrial applicability of our protocol was also demonstrated by labeling a drone with an oil-based paint containing a predefined DNA code, which was then successfully decoded. The method presented here consists of a simple code system based on a small number of synthetic DNA sequences and a cost-effective, rapid decoding protocol using a few qPCR reactions, enabling a wide range of authentication applications.

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

Science.gov (United States)

Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

Directory of Open Access Journals (Sweden)

Yogita Maheshwari

Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

Validation of RNAi by real time PCR

DEFF Research Database (Denmark)

Josefsen, Knud; Lee, Ying Chiu

2011-01-01

Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...

The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

Science.gov (United States)

Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

2016-08-03

Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification

Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.

Science.gov (United States)

Jahan, F; Shamsuzzaman, S M; Akter, S

2014-12-01

Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.

The potential of three different PCR-related approaches for the authentication of mixtures of herbal substances and finished herbal medicinal products.

Science.gov (United States)

Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner

2018-04-01

Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined

Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

Science.gov (United States)

Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

2017-10-01

Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

Science.gov (United States)

Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

2005-01-01

We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

Science.gov (United States)

Jamjoom, Manal; Sultan, Amal H

2009-04-01

The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

Detection of Tomato black ring virus by real-time one-step RT-PCR.

Science.gov (United States)

Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

2011-01-01

A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.

Science.gov (United States)

Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein

2016-01-01

We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

Science.gov (United States)

Waterfall, C M; Cobb, B D

2001-12-01

Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

Rapid PCR Detection of Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum

OpenAIRE

Scott A. Cunningham; Jayawant N. Mandrekar; Jon E. Rosenblatt; Robin Patel

2013-01-01

Objective. We compared laboratory developed real-time PCR assays for detection of Mycoplasma hominis and for detection and differentiation of Ureaplasma urealyticum and parvum to culture using genitourinary specimens submitted for M. hominis and Ureaplasma culture. Methods. 283 genitourinary specimens received in the clinical bacteriology laboratory for M. hominis and Ureaplasma species culture were evaluated. Nucleic acids were extracted using the Total Nucleic Acid Kit on the MagNA Pure 2.0...

A novel approach for rapid screening of mitochondrial D310 polymorphism

International Nuclear Information System (INIS)

Aral, Cenk; Kaya, Handan; Ataizi-Çelikel, Çiğdem; Akkiprik, Mustafa; Sönmez, Özgür; Güllüoğlu, Bahadır M; Özer, Ayşe

2006-01-01

Mutations in the mitochondrial DNA (mtDNA) have been reported in a wide variety of human neoplasms. A polynucleotide tract extending from 303 to 315 nucleotide positions (D310) within the non-coding region of mtDNA has been identified as a mutational hotspot of primary tumors. This region consists of two polycytosine stretches interrupted by a thymidine nucleotide. The number of cytosines at the first and second stretches are 7 and 5 respectively, according to the GeneBank sequence. The first stretch exhibits a polymorphic length variation (6-C to 9-C) among individuals and has been investigated in many cancer types. Large-scale studies are needed to clarify the relationship between cytosine number and cancer development/progression. However, time and money consuming methods such as radioactivity-based gel electrophoresis and sequencing, are not appropriate for the determination of this polymorphism for large case-control studies. In this study, we conducted a rapid RFLP analysis using a restriction enzyme, BsaXI, for the single step simple determination of 7-C carriers at the first stretch in D310 region. 25 colorectal cancer patients, 25 breast cancer patients and 41 healthy individuals were enrolled into the study. PCR amplification followed by restriction enzyme digestion of D310 region was performed for RFLP analysis. Digestion products were analysed by agarose gel electrophoresis. Sequencing was also applied to samples in order to confirm the RFLP data. Samples containing 7-C at first stretch of D310 region were successfully determined by the BsaXI RFLP method. Heteroplasmy and homoplasmy for 7-C content was also determined as evidenced by direct sequencing. Forty-one percent of the studied samples were found to be BsaXI positive. Furthermore, BsaXI status of colorectal cancer samples were significantly different from that of healthy individuals. In conclusion, BsaXI RFLP analysis is a simple and rapid approach for the single step determination of D310

[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

Science.gov (United States)

Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

2017-08-10

To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

Implementation of the rapid cross section adjustment approach at General Electric

International Nuclear Information System (INIS)

Cowan, C.L.; Kujawski, E.; Protsik, R.

1978-01-01

The General Electric rapid cross section adjustment approach was developed to use the shielding factor method for formulating multigroup cross sections. In this approach, space- and composition-dependent cross sections for a particular reactor or shield design are prepared from a generalized cross section library by the use of resonance self-shielding factors, and by the adjustment of elastic scattering cross sections for the local neutron flux spectra. The principal tool in the cross section adjustment package is the data processing code TDOWN. This code was specified to give the user a high degree of flexibility in the analysis of advanced reactor designs. Of particular interest in the analysis of critical experiments is the ability to carry out cell heterogeneity self-shielding calculations using a multiregion equivalence relationship, and the homogenization of the cross sections over the specified cell with the flux weighting obtained from transport theory calculations. Extensive testing of the rapid cross section adjustment approach, including comparisons with Monte Carlo methods, indicated that this approach can be utilized with a high degree of confidence in the design analysis of complex fast reactor systems. 2 figures, 1 table

Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

Science.gov (United States)

Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

2016-12-01

Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

Science.gov (United States)

Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

2005-07-01

To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

Rapid molecular identification and characteristics of Lactobacillus strains.

Science.gov (United States)

Markiewicz, L H; Biedrzycka, E; Wasilewska, E; Bielecka, M

2010-09-01

Eleven type strains and 24 Lactobacillus isolates, preliminarily classified to the species due to phenotypic features, were investigated. Standard methods of identification with species-specific PCRs and typing with PFGE (with ApaI, NotI and SmaI restriction enzymes) allowed us to distinguish 16 unique strains belonging to 5 species (L. acidophilus, L. delbrueckii ssp. bulgaricus, L. plantarum, L. rhamnosus, L. salivarius). Alternative approach with 16S-23S rDNA ARDRA identification (with merely two restrictases, BsuRI and TaqI) and PCR-based typing (RAPD with two random- and rep-PCR with (GTG)(5) primers) showed to be more discriminative, i.e. 21 unique strains were classified in the same species as above. As a result, 7 out of 24 phenotypically species-assigned isolates were reclassified. The alternative procedure of rapid identification and typing of Lactobacillus isolates appeared to be equally effective and shortened from 1 week to 2-3 d (in comparison to the standard methods).

Highly sensitive detection of the PIK3CAH1047R mutation in colorectal cancer using a novel PCR-RFLP method

International Nuclear Information System (INIS)

Li, Wan-Ming; Hu, Ting-Ting; Zhou, Lin-Lin; Feng, Yi-Ming; Wang, Yun-Yi; Fang, Jin

2016-01-01

The PIK3CA H1047R mutation is considered to be a potential predictive biomarker for EGFR-targeted therapies. In this study, we developed a novel PCR-PFLP approach to detect the PIK3CA H1047R mutation in high effectiveness. A 126-bp fragment of PIK3CA exon-20 was amplified by PCR, digested with FspI restriction endonuclease and separated by 3 % agarose gel electrophoresis for the PCR-RFLP analysis. The mutant sequence of the PIK3CA H1047R was spiked into the corresponding wild-type sequence in decreasing ratios for sensitivity analysis. Eight-six cases of formalin-fixed paraffin-embedded colorectal cancer (CRC) specimens were subjected to PCR-RFLP to evaluate the applicability of the method. The PCR-RFLP method had a capability to detect as litter as 0.4 % of mutation, and revealed 16.3 % of the PIK3CA H1047R mutation in 86 CRC tissues, which was significantly higher than that discovered by DNA sequencing (9.3 %). A positive association between the PIK3CA H1047R mutation and the patients’ age was first found, except for the negative relationship with the degree of tumor differentiation. In addition, the highly sensitive detection of a combinatorial mutation of PIK3CA, KRAS and BRAF was achieved using individual PCR-RFLP methods. We developed a sensitive, simple and rapid approach to detect the low-abundance PIK3CA H1047R mutation in real CRC specimens, providing an effective tool for guiding cancer targeted therapy

Multiplex real-time PCR assay for Legionella species.

Science.gov (United States)

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

Directory of Open Access Journals (Sweden)

Danielle C. Leal

2011-07-01

Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

Quantitative threefold allele-specific PCR (QuanTAS-PCR) for highly sensitive JAK2 V617F mutant allele detection

International Nuclear Information System (INIS)

Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander

2013-01-01

The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a

Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

International Nuclear Information System (INIS)

Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

2000-01-01

A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

PCR amplification of repetitive sequences as a possible approach in relative species quantification

DEFF Research Database (Denmark)

Ballin, Nicolai Zederkopff; Vogensen, Finn Kvist; Karlsson, Anders H

2012-01-01

Abstract Both relative and absolute quantifications are possible in species quantification when single copy genomic DNA is used. However, amplification of single copy genomic DNA does not allow a limit of detection as low as one obtained from amplification of repetitive sequences. Amplification...... of repetitive sequences is therefore frequently used in absolute quantification but problems occur in relative quantification as the number of repetitive sequences is unknown. A promising approach was developed where data from amplification of repetitive sequences were used in relative quantification of species...... to relatively quantify the amount of chicken DNA in a binary mixture of chicken DNA and pig DNA. However, the designed PCR primers lack the specificity required for regulatory species control....

Comparison of PCR and common clinical tests for the diagnosis of H. pylori in dyspeptic patients.

Science.gov (United States)

Pacheco, N; Mago, V; Gómez, I; Gueneau, P; Guelrud, M; Reyes, N; Pericchi, L R; Domínguez-Bello, M G

2001-04-01

Helicobacter pylori has been recognized as a major gastric pathogen. The objective of this study was to assess the diagnostic value of common clinical tests to detect H. pylori infection, by comparison with PCR. Serum and gastric biopsy specimens from 106 dyspeptic patients were examined. Serology was performed with Pyloriset Dry test, and biopsies were examined histologically, for rapid urease activity and PCR amplification of an ureA gene segment of H. pylori. PCR primers were specific for H. pylori and required at least 1.47 pg of H. pylori DNA, corresponding to about 800 bacterial cells. According to serology, histology, rapid urease, and PCR, positive results were respectively found in 56%, 86%, 64%, and 85% of dyspeptic patients, primarily with gastritis. Relative to PCR, the sensitivity (and specificity) was 55% (38%) for serology, 86% (13%) for histology, 70% (69%) for urease. When combining histology and urease, Bayesian analysis of data indicated no advantage of using combined methods over rapid urease test alone. Histology should not any longer be considered a gold standard test for Helicobacter pylori. Urea breath test still seems the first option for non invasive diagnostic. If an invasive diagnostic is justified, highly specific and sensitive molecular methods should be used to examine specimens.

Differentiation of five enterohepatic Helicobacter species by nested PCR with high-resolution melting curve analysis.

Science.gov (United States)

Wu, Miaoli; Rao, Dan; Zhu, Yujun; Wang, Jing; Yuan, Wen; Zhang, Yu; Huang, Ren; Guo, Pengju

2017-04-01

Enterohepatic Helicobacter species (EHS) are widespread in rodent species around the world. Several studies have demonstrated that infection with EHS can interfere with the outcomes of animal experiments in cancer research and significantly influence the study results. Therefore, it is essential to establish a rapid detection and identification of EHS for biomedical research using laboratory rodents. Our study aimed to develop a rapid and sensitive method to detect and distinguish five enterohepatic Helicobacter species. Nested PCR followed by high-resolution melting curve analysis (HRM) was developed for identification of H. bilis, H. rodentium, H. muridarum, H. typhlonius, as well as H. hepaticus. To validate the accuracy of nested PCR-HRM analysis, quantitative real-time PCR methods for five different enterohepatic Helicobacter species were developed. A total of 50 cecal samples were tested using both nested PCR-HRM analysis and qPCR method. The nested PCR-HRM method could distinguish five enterohepatic Helicobacter species by different melting temperatures. The melting curve were characterized by peaks of 78.7 ± 0.12°C for H. rodentium, 80.51 ± 0.09°C for H. bilis, 81.6 ± 0.1°C for H. typhlonius, 82.11 ± 0.18°C for H. muridarum, and 82.95 ± 0.09°C for H. hepaticus. The nested PCR-HRM assay is a simple, rapid, and cost-effective assay. This assay could be a useful tool for molecular epidemiology study of enterohepatic Helicobacter infection and an attractive alternative for genotyping of enterohepatic Helicobacter species. © 2016 John Wiley & Sons Ltd.

Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

Science.gov (United States)

da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

2011-01-01

The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear

Directory of Open Access Journals (Sweden)

Gholamreza HASSANPOUR

2016-12-01

Full Text Available Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria.Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction.Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR.Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

Directory of Open Access Journals (Sweden)

Hansson Per

2005-11-01

Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

Rapid Fishery Assessment by Market Survey (RFAMS--an improved rapid-assessment approach to characterising fish landings in developing countries.

Directory of Open Access Journals (Sweden)

William T White

Full Text Available The complex multi-gear, multi-species tropical fisheries in developing countries are poorly understood and characterising the landings from these fisheries is often impossible using conventional approaches. A rapid assessment method for characterising landings at fish markets, using an index of abundance and estimated weight within taxonomic groups, is described. This approach was developed for contexts where there are no detailed data collection protocols, and where consistent data collection across a wide range of fisheries types and geographic areas is required, regardless of the size of the site and scale of the landings. This methodology, which was demonstrated at seven fish landing sites/fish markets in southern Indonesia between July 2008 and January 2011, provides a rapid assessment of the abundance and diversity in the wild catch over a wide variety of taxonomic groups. The approach has wider application for species-rich fisheries in developing countries where there is an urgent need for better data collection protocols, monitoring future changes in market demographics, and evaluating health of fisheries.

Rapid detection of methicillin-resistant Staphylococcus aureus directly from clinical samples: methods, effectiveness and cost considerations

Directory of Open Access Journals (Sweden)

Stürenburg, Enno

2009-07-01

Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA isolates is a serious public health problem whose ever-increasing rate is commensurate with the pressure it is exerting on the healthcare system. At present, more than 20% of clinical S. aureus isolates in German hospitals are methicillin resistant. Strategies from low-prevalence countries show that this development is not necessarily inevitable. In the Scandinavian countries and the Netherlands, thanks to a rigorous prevention programme, MRSA prevalence has been kept at an acceptably low level (<1–3%. Central to these ‘search and destroy’ control strategies is an admission screening using several MRSA swabs taken from mucocutaneous colonisation sites of high-risk patients (‘MRSA surveillance’. It has also been reported that the speed with which MRSA carriage is detected has an important role to play, as it is a key component of any effective strategy to prevent the pathogen from spreading. Since MRSA culturing involves a 2–3 day delay before the final results are available, rapid detection techniques (commonly referred to as ‘MRSA rapid tests’ using PCR methods and, most recently, rapid culturing methods have been developed. The implementation of rapid tests reduces the time of detection of MRSA carriers from 48–72 to 2–5 h. Clinical evaluation data have shown that MRSA can thus be detected with very high sensitivity. Specificity however is sometimes impaired due to false-positive PCR signals occurring in mixed flora specimens. In order to rule out any false-positive PCR results, a culture screen must always be carried out simultaneously.The data provide preliminary evidence that a PCR assay can reduce nosocomial MRSA transmission in high-risk patients or high-risk areas, whereas an approach that screens all patients admitted to the hospital is probably not effective. Information concerning the cost-effectiveness of rapid MRSA tests is still sparse and thus the issue remains

REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-02-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-10-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Rapid detection, characterization, and enumeration of foodborne pathogens

DEFF Research Database (Denmark)

Hoorfar, Jeffrey

2011-01-01

. The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...

Evaluation of Legionella real-time PCR against traditional culture for routine and public health testing of water samples.

Science.gov (United States)

Collins, S; Stevenson, D; Walker, J; Bennett, A

2017-06-01

To evaluate the usefulness of Legionella qPCR alongside traditional culture for enumeration of Legionella from water samples as part of both routine and public health investigation testing. Routine water samples (n = 2002) and samples from public health investigations (n = 215) were analysed by culture and qPCR for Legionella spp., Legionella pneumophila and L. pneumophila sg-1. A negative qPCR result was highly predictive of a negative culture result for all water systems (negative predictive values, NPV from 97·4 to 100%). Positive predictive values (PPV) were lower (0-50%). Results for qPCR were generally larger than culture with average log 10 differences of 1·1 for Legionella spp. and 1·2 for L. pneumophila. Alert and action levels of 1000 and 10 000 GU per litre, respectively, are proposed for Legionella qPCR for hot and cold water systems (HCWS). The use of qPCR significantly reduced the time to results for public health investigations by rapidly identifying potential sources and ruling out others, thus enabling a more rapid and efficient response. The high NPV of qPCR supports its use to rapidly screen out negative samples without culture. Alert and action levels for Legionella qPCR for HCWS are proposed. Quantitative PCR will be a valuable tool for both routine and public health testing. This study generated comparative data of >2000 water samples by qPCR and culture. Action and alert levels have been recommended that could enable duty holders to interpret qPCR results to facilitate timely Legionella control and public health protection. © 2017 Crown copyright. Journal of Applied Microbiology © 2017 The Society for Applied Microbiology.

Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR.

Science.gov (United States)

Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich

2010-12-01

This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.

A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

Science.gov (United States)

Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

Science.gov (United States)

Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

Science.gov (United States)

Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

2015-01-01

Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Detection of Schistosoma mansoni and Schistosoma haematobium by Real-Time PCR with High Resolution Melting Analysis

Directory of Open Access Journals (Sweden)

Hany Sady

2015-07-01

Full Text Available The present study describes a real-time PCR approach with high resolution melting-curve (HRM assay developed for the detection and differentiation of Schistosoma mansoni and S. haematobium in fecal and urine samples collected from rural Yemen. The samples were screened by microscopy and PCR for the Schistosoma species infection. A pair of degenerate primers were designed targeting partial regions in the cytochrome oxidase subunit I (cox1 gene of S. mansoni and S. haematobium using real-time PCR-HRM assay. The overall prevalence of schistosomiasis was 31.8%; 23.8% of the participants were infected with S. haematobium and 9.3% were infected with S. mansoni. With regards to the intensity of infections, 22.1% and 77.9% of S. haematobium infections were of heavy and light intensities, respectively. Likewise, 8.1%, 40.5% and 51.4% of S. mansoni infections were of heavy, moderate and light intensities, respectively. The melting points were distinctive for S. mansoni and S. haematobium, categorized by peaks of 76.49 ± 0.25 °C and 75.43 ± 0.26 °C, respectively. HRM analysis showed high detection capability through the amplification of Schistosoma DNA with as low as 0.0001 ng/µL. Significant negative correlations were reported between the real-time PCR-HRM cycle threshold (Ct values and microscopic egg counts for both S. mansoni in stool and S. haematobium in urine (p < 0.01. In conclusion, this closed-tube HRM protocol provides a potentially powerful screening molecular tool for the detection of S. mansoni and S. haematobium. It is a simple, rapid, accurate, and cost-effective method. Hence, this method is a good alternative approach to probe-based PCR assays.

Using molecular techniques for rapid detection of Salmonella ...

African Journals Online (AJOL)

PRECIOUS

2010-02-01

Feb 1, 2010 ... A total of 152 samples of chicken and chicken products ... detection of Salmonella species in the collected field samples ... that 16 million new cases of typhoid fever occur each ... vative methods for the rapid identification of Salmonella ... saved for the PCR-Non Selective test (PCR-NS) and 1 ml of the.

Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae.

Science.gov (United States)

Takahashi, Hajime; Saito, Rumi; Miya, Satoko; Tanaka, Yuichiro; Miyamura, Natsumi; Kuda, Takashi; Kimura, Bon

2017-04-04

The family Enterobacteriaceae, members of which are widely distributed in the environment, includes many important human pathogens. In this study, a rapid real-time PCR method targeting rplP, coding for L16 protein, a component of the ribosome large subunit, was developed for enumerating Enterobacteriaceae strains, and its efficiency was evaluated using naturally contaminated food products. The rplP-targeted real-time PCR amplified Enterobacteriaceae species with Ct values of 14.0-22.8, whereas the Ct values for non-Enterobacteriaceae species were >30, indicating the specificity of this method for the Enterobacteriaceae. Using a calibration curve of Ct=-3.025 (log CFU/g)+37.35, which was calculated from individual plots of the cell numbers in different concentrations of 5 Enterobacteriaceae species, the rplP-targeted real-time PCR was applied to 51 food samples. A Enterobacteriaceae species in foods rapidly and accurately, and therefore, it can be used for the microbiological risk analysis of foods. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

Science.gov (United States)

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

Stochastic Approaches Within a High Resolution Rapid Refresh Ensemble

Science.gov (United States)

Jankov, I.

2017-12-01

It is well known that global and regional numerical weather prediction (NWP) ensemble systems are under-dispersive, producing unreliable and overconfident ensemble forecasts. Typical approaches to alleviate this problem include the use of multiple dynamic cores, multiple physics suite configurations, or a combination of the two. While these approaches may produce desirable results, they have practical and theoretical deficiencies and are more difficult and costly to maintain. An active area of research that promotes a more unified and sustainable system is the use of stochastic physics. Stochastic approaches include Stochastic Parameter Perturbations (SPP), Stochastic Kinetic Energy Backscatter (SKEB), and Stochastic Perturbation of Physics Tendencies (SPPT). The focus of this study is to assess model performance within a convection-permitting ensemble at 3-km grid spacing across the Contiguous United States (CONUS) using a variety of stochastic approaches. A single physics suite configuration based on the operational High-Resolution Rapid Refresh (HRRR) model was utilized and ensemble members produced by employing stochastic methods. Parameter perturbations (using SPP) for select fields were employed in the Rapid Update Cycle (RUC) land surface model (LSM) and Mellor-Yamada-Nakanishi-Niino (MYNN) Planetary Boundary Layer (PBL) schemes. Within MYNN, SPP was applied to sub-grid cloud fraction, mixing length, roughness length, mass fluxes and Prandtl number. In the RUC LSM, SPP was applied to hydraulic conductivity and tested perturbing soil moisture at initial time. First iterative testing was conducted to assess the initial performance of several configuration settings (e.g. variety of spatial and temporal de-correlation lengths). Upon selection of the most promising candidate configurations using SPP, a 10-day time period was run and more robust statistics were gathered. SKEB and SPPT were included in additional retrospective tests to assess the impact of using

Pure chromosome-specific PCR libraries from single sorted chromosomes

NARCIS (Netherlands)

VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

1994-01-01

Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

Science.gov (United States)

Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

2018-04-04

In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract

NARCIS (Netherlands)

Zoetendal, E.G.; Ben-Amor, K.; Akkermans, A.D.L.; Abee, T.; Vos, de W.M.

2001-01-01

A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven

Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

Science.gov (United States)

Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

2018-03-01

Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

Routine clinical application of the FRAXA Pfu PCR assay: limits and utility.

Science.gov (United States)

Condorelli, D F; Milana, G; Dell'Albani, P; Roccazzello, A M; Insirello, E; Pavone, L; Mollica, F

1996-11-01

Fragile X genotype is characterized by the excessive amplification of an unstable region of DNA: a trinucleotide repeat CGG of variable copy number present in the FRAXA locus. Methods based on polymerase chain reaction (PCR) amplification of the CGG repeat region could facilitate the development of a rapid screening assay. Unfortunately, amplification across CGG repeats can be inefficient and unreliable due to their 100% G + C base composition. The utility of the exonuclease-deficient Pfu polymerase for amplification and detection of the CGG repeats at the FRAXA locus has been reported. In the present study we analysed the utility of a Pfu PCR assay as a rapid initial screening method to rule out a diagnosis of fragile X syndrome in males with mental retardation. Affected males did not show any amplification products or a smear of amplification products between 350 and 550 bp. Only 10% of affected male samples did not show any amplification products, while the vast majority showed the amplification smear. The amplification smears represent a serious drawback of the method, since they cannot be distinguished from the amplification products of normal samples after separation in 1% agarose gel. Several modifications of the PCR conditions were attempted to eliminate this problem, but none was appropriate for clinical applications. However, the problem was easily solved by using a higher resolution electrophoretic system that allows a clear distinction of normal bands from pathological smears. We tested the specificity of the Pfu PCR assay, followed by an improved MetaPhor gel electrophoretic separation of PCR products, on 50 samples from normal males and 24 samples form affected males. The results showed that this method is a rapid, sensitive and specific assay for the exclusion of fragile X syndrome diagnosis in mentally retarded males.

Simultaneous detection of Legionella species and Legionella pneumophila by duplex PCR (dPCR assay in cooling tower water samples from Jakarta, Indonesia

Directory of Open Access Journals (Sweden)

Andi Yasmon

2010-11-01

Full Text Available Aim: Since culture method is time-consuming and has low  sensitivity, we developed a duplex PCR (dPCR assay for the detection of Legionella sp. and L. pneumophila in cooling tower samples. We used culture method as a gold standard.Methods: Optimization of dPCR method was performed to obtain an assay with high sensitivity and specifi city. The optimized method was used to detect Legionella sp. dan L. pneumophila in 9 samples obtained from 9 buildings in Jakarta. For culture method, the bacteria were grown or isolated on selective growth factor supplemented-buffered charcoal yeast extract (BCYE media.Results: Of 9 samples tested by dPCR assay, 6 were positive for Legionella species,1 was positive for L. pneumophila, and 2 showed negative results. For the same samples, no Legionella sp. was detected by the culture method.Conclusion: dPCR assay was much more sensitive than the culture method and was potentially used as a rapid, specifi c and sensitive test for routine detection of Legionella sp. dan for L. pneumophila in water samples. (Med J Indones 2010; 19:223-7Keywords: BCYE media, mip gene, 16S-rRNA gene

Quantification of viable bacteria in wastewater treatment plants by using propidium monoazide combined with quantitative PCR (PMA-qPCR).

Science.gov (United States)

Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao

2014-02-01

The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.

Detection of Epstein Barr virus in formalin-fixed paraffin tissues by fluorescent direct in situ PCR

Directory of Open Access Journals (Sweden)

N Marziliano

2009-06-01

Full Text Available Specific viral laboratory diagnosis of primary Epstein-Barr Virus (EBV infection is usually based on antibody-detection assays. However, molecular detection is also considered the reference standard assay for diagnosis of central nervous system infections and of most cases of nasopharyngeal carcinoma (NPC. One-step or nested polymerase chain reaction (PCR has rapidly replaced immunological assays based on virus-specific Ig antibodies for the laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis. In this article, we will present a rapid, sensitive and robust molecular tool for the viral detection of EBV (EBNA-1 within tissue specimens by making use of in situ PCR (IS-PCR.

RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

DEFF Research Database (Denmark)

Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

2003-01-01

A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

Science.gov (United States)

Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

2017-08-17

Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

Science.gov (United States)

Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

2015-01-01

Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

Identification and genotyping of molluscum contagiosum virus from genital swab samples by real-time PCR and Pyrosequencing.

Science.gov (United States)

Trama, Jason P; Adelson, Martin E; Mordechai, Eli

2007-12-01

Laboratory diagnosis of molluscum contagiosum virus (MCV) is important as lesions can be confused with those caused by Cryptococcus neoformans, herpes simplex virus, human papillomavirus, and varicella-zoster virus. To develop a rapid method for identifying patients infected with MCV via swab sampling. Two dual-labeled probe real-time PCR assays, one homologous to the p43K gene and one to the MC080R gene, were designed. The p43K PCR was designed to be used in conjunction with Pyrosequencing for confirmation of PCR products and discrimination between MCV1 and MCV2. Both PCR assays were optimized with respect to reaction components, thermocycling parameters, and primer and probe concentrations. The specificities of both PCR assays were confirmed by non-amplification of 38 known human pathogens. Sensitivity assays demonstrated detection of as few as 10 copies per reaction. Testing 703 swabs, concordance between the two real-time PCR assays was 99.9%. Under the developed conditions, Pyrosequencing of the p43K PCR product was capable of providing enough nucleotide sequence to definitively differentiate MCV1 and MCV2. These real-time PCR assays can be used for the rapid, sensitive, and specific detection of MCV and, when combined with Pyrosequencing, can further discriminate between MCV1 and MCV2.

Rapid Detection of Salmonella enterica in Food Using a Compact Disc-Shaped Device

Directory of Open Access Journals (Sweden)

Shunsuke Furutani

2016-01-01

Full Text Available Rapid detection of food-borne pathogens is essential to public health and the food industry. Although the conventional culture method is highly sensitive, it takes at least a few days to detect food-borne pathogens. Even though polymerase chain reaction (PCR can detect food-borne pathogens in a few hours, it is more expensive and unsatisfactorily sensitive relative to the culture method. We have developed a method to rapidly detect Salmonella enterica by using a compact disc (CD-shaped device that can reduce reagent consumption in conventional PCR. The detection method, which combines culture and PCR, is more rapid than the conventional culture method and is more sensitive and cheaper than PCR. In this study, we also examined a sample preparation method that involved collecting bacterial cells from food. The bacteria collected from chicken meat spiked with S. enterica were mixed with PCR reagents, and PCR was performed on the device. At a low concentration of S. enterica, the collected S. enterica was cultured before PCR for sensitive detection. After cultivation for 4 h, S. enterica at 1.7 × 104 colony-forming units (CFUs·g−1 was detected within 8 h, which included the time needed for sample preparation and detection. Furthermore, the detection of 30 CFUs·g−1 of S. enterica was possible within 12 h including 8 h for cultivation.

Inhibitory effect of common microfluidic materials on PCR outcome

KAUST Repository

Kodzius, Rimantas

2012-02-20

Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR

MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

Science.gov (United States)

Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

2016-05-01

The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

A Practical Approach to Rapid Prototyping of SCA Waveforms

OpenAIRE

DePriest, Jacob Andrew

2006-01-01

With the growing interest in software defined radios (SDRs), cognitive radios, the Joint Tactical Radio System (JTRS), and the Software Communication Architecture (SCA) comes the need for a rapid prototyping approach to radio design. In the past, radios have traditionally been designed to have a static implementation with the express goal of implementing a specific type of communication, such as 802.11b, CDMA voice communication, or just a simple FM tuner. However, when designing an ...

Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

Directory of Open Access Journals (Sweden)

Maryam AlTamimi

2017-01-01

Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

Science.gov (United States)

Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

2015-07-01

Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

Science.gov (United States)

Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

2014-08-11

Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

'Distorted structure modelling' - a more physical approach to Rapid Distortion Theory

International Nuclear Information System (INIS)

Savill, A.M.

1979-11-01

Rapid Distortion Theory is reviewed in the light of the modern mechanistic approach to turbulent motion. The apparent failure of current models, based on this theory, to predict stress intensity ratios accurately in distorted shear flows is attributed to their oversimplistic assumptions concerning the inherent turbulence structure of such flows. A more realistic picture of this structure and the manner in which it responds to distortion is presented in terms of interactions between the mean flow and three principal types of eddies. If Rapid Distortion Theory is modified to account for this it is shown that the stress intensity ratios can be accurately predicted in three test flows. It is concluded that a computational scheme based on Rapid Distortion Theory might ultimately be capable of predicting turbulence parameters in the highly complex geometries of reactor cooling systems. (author)

Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

Science.gov (United States)

Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

2011-01-01

Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis.

Science.gov (United States)

Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

2011-12-01

Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.

Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

Science.gov (United States)

Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

2011-01-01

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

Science.gov (United States)

Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

2017-12-18

Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first

Decay Of Bacterial Pathogens, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure-Amended Soils

Science.gov (United States)

This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...

Decay Of Bacterial Pathogen, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure Amended Soils

Science.gov (United States)

This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...

Ureaplasma parvum prosthetic joint infection detected by PCR.

Science.gov (United States)

Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

2014-06-01

We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

Directory of Open Access Journals (Sweden)

Gouri Chaubal

2018-02-01

Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

Science.gov (United States)

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

A Bac Library and Paired-PCR Approach to Mapping and Completing the Genome Sequence of Sulfolobus Solfataricus P2

DEFF Research Database (Denmark)

She, Qunxin; Confalonieri, F.; Zivanovic, Y.

2000-01-01

The original strategy used in the Sulfolobus solfatnricus genome project was to sequence non overlapping, or minimally overlapping, cosmid or lambda inserts without constructing a physical map. However, after only about two thirds of the genome sequence was completed, this approach became counter......-productive because there was a high sequence bias in the cosmid and lambda libraries. Therefore, a new approach was devised for linking the sequenced regions which may be generally applicable. BAC libraries were constructed and terminal sequences of the clones were determined and used for both end mapping and PCR...

Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

DEFF Research Database (Denmark)

Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

2016-01-01

Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

Science.gov (United States)

Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

2016-06-01

The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

Use of species-specific PCR for the identification of 10 sea cucumber species

Science.gov (United States)

Wen, Jing; Zeng, Ling

2014-11-01

We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

OpenAIRE

Luo, Guizhen; Mitchell, Thomas G.

2002-01-01

A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

Science.gov (United States)

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Application of propidium monoazide quantitative real-time PCR to quantify the viability of Lactobacillus delbrueckii ssp. bulgaricus.

Science.gov (United States)

Shao, Yuyu; Wang, Zhaoxia; Bao, Qiuhua; Zhang, Heping

2016-12-01

In this study, a combination of propidium monoazide (PMA) and quantitative real-time PCR (qPCR) was used to develop a method to determine the viability of cells of Lactobacillus delbrueckii ssp. bulgaricus ND02 (L. bulgaricus) that may have entered into a viable but nonculturable state. This can happen due to its susceptibility to cold shock during lyophilization and storage. Propidium monoazide concentration, PMA incubation time, and light exposure time were optimized to fully exploit the PMA-qPCR approach to accurately assess the total number of living L. bulgaricus ND02. Although PMA has little influence on living cells, when concentrations of PMA were higher than 30μg/mL the number of PCR-positive living bacteria decreased from 10 6 to 10 5 cfu/mL in comparison with qPCR enumeration. Mixtures of living and dead cells were used as method verification samples for enumeration by PMA-qPCR, demonstrating that this method was feasible and effective for distinguishing living cells of L. bulgaricus when mixed with a known number of dead cells. We suggest that several conditions need to be studied further before PMA-qPCR methods can be accurately used to distinguish living from dead cells for enumeration under more realistic sampling situations. However, this research provides a rapid way to enumerate living cells of L. bulgaricus and could be used to optimize selection of cryoprotectants in the lyophilization process and develop technologies for high cell density cultivation and optimal freeze-drying processes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Development and evaluation of novel one-step TaqMan realtime RT-PCR assays for the detection and direct genotyping of genogroup I and II noroviruses

DEFF Research Database (Denmark)

Schultz, Anna Charlotte; Vega, Everado; Dalsgaard, Anders

2011-01-01

BackgroundCurrent detection and genotyping methods of genogroup (G) I and II noroviruses (NoVs) consist of a 2-step approach including detection of viral RNA by TaqMan realtime RT-PCR (RT-qPCR) followed by conventional RT-PCR and sequencing of partial regions of ORF1 or ORF2. ObjectiveTo develop ......Man RT-qPCR assays for the sensitive detection and direct genotyping of GI and GII NoVs from clinical and environmental matrices...... novel long-template one-step TaqMan assays (L-RT-qPCR) for the rapid detection and direct genotyping of GI and GII NoVs and to evaluate the sensitivity and specificity of the assays. Study designGI and GII-specific broadly reactive L-RT-qPCR assays were developed by combining existing NoV primers...... and probes targeting the open reading frame (ORF)1–ORF2 junction as well as region C at the 5′–ORF2. The assays were validated using GI and GII RNA transcripts and a coded panel of 75 stool samples containing NoV strains representing 9 GI genotypes and 12 GII genotypes, as well as sapoviruses, astroviruses...

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

Science.gov (United States)

Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

2010-03-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

Science.gov (United States)

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Long-PCR based next generation sequencing of the whole mitochondrial genome of the peacock skate Pavoraja nitida (Elasmobranchii: Arhynchobatidae).

Science.gov (United States)

Yang, Lei; Naylor, Gavin J P

2016-01-01

We determined the complete mitochondrial genome sequence (16,760 bp) of the peacock skate Pavoraja nitida using a long-PCR based next generation sequencing method. It has 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region in the typical vertebrate arrangement. Primers, protocols, and procedures used to obtain this mitogenome are provided. We anticipate that this approach will facilitate rapid collection of mitogenome sequences for studies on phylogenetic relationships, population genetics, and conservation of cartilaginous fishes.

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

A nested PCR approach for unambiguous typing of pestiviruses infecting cattle.

Science.gov (United States)

Decaro, Nicola; Sciarretta, Rossana; Lucente, Maria Stella; Mari, Viviana; Amorisco, Francesca; Colaianni, Maria Loredana; Cordioli, Paolo; Parisi, Antonio; Lelli, Rossella; Buonavoglia, Canio

2012-02-01

An atypical pestivirus ('Hobi'-like pestivirus, putative bovine viral diarrhoea 3, BVDV-3) was identified firstly in contaminated foetal calf serum batches and isolated subsequently from an outbreak of respiratory disease in a cattle herd in Italy. The isolation of the novel pestivirus from animals affected clinically posed concerns about the validity of BVDV eradication programs, considering that 'Hobi'-like pestivirus (BVDV-3) is undetected or mistyped by the molecular diagnostic tools currently employed. In this paper, the development of a nested PCR (nPCR) assay for unambiguous typing of all bovine pestiviruses is reported. The assay consisted of a first-round amplification using an oligonucleotide pair which binds to conserved sequences located in the 5' untranslated region and capsid gene, followed by a heminested PCR using virus-specific forward primers. The assay performances were evaluated analytically, showing good sensitivity and specificity. By analysis of 100 BVDV-positive samples typed using a nPCR assay discriminating ruminant pestiviruses, five samples recognised previously as BVDV-2 were not typed when submitted to the new assay (n=2) or reacted as 'Hobi'-like pestivirus BVDV-3 (n=3). Sequence analysis of the first-round amplification products showed that the untyped strains were border disease viruses, whereas the other three strains were true 'Hobi'-like viruses. The development of a molecular assay able to identify simultaneously all bovine pestiviruses known currently will help warrant biosafety of live vaccines and other biological products and assess the molecular epidemiology of 'Hobi'-like pestivirus, thus leading to the improvement of the eradication programs through unambiguous typing of pestiviruses infecting cattle. Copyright © 2011 Elsevier Ltd. All rights reserved.

Transgene detection by digital droplet PCR.

Directory of Open Access Journals (Sweden)

Dirk A Moser

Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

Differentiation of bacterial feeding nematodes in soil ecological studies by means of arbitrarily primed PCR

Science.gov (United States)

Van Der Knaap, Esther; Rodriguez, Russell J.; Freckman, Diana W.

1993-01-01

Arbitrarily-primed polymerase chain reaction (ap-PCR) was used to differentiate closely related bacterial-feeding nematodes of the genera: Caenorhabditis, Acrobeloides, Cephalobus and Zeldia. Average percentage similarity of bands generated by ap-PCR with seven different primers between 14 isolates of Caenorhabditis elegans was ⪢ 90%, whereas between C. elegans, C. briggsae and C. remanei similarity was nematode populations were also obtained from ap-PCR analysis of single worms. Due to the difficulty of identification of soil nematodes, the ap-PCR offers potential as a rapid and reliable technique to assess biodiversity. Ap-PCR will make it feasible, for the first time, to study the ecological interactions of unique nematode genotypes in soil habitats.

A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

Science.gov (United States)

Shibuta, K; Abe, M; Suzuki, T

1994-01-01

The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

Science.gov (United States)

Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

2014-01-01

Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

Directory of Open Access Journals (Sweden)

Qing Fan

Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

Shape based kinetic outlier detection in real-time PCR

Directory of Open Access Journals (Sweden)

D'Atri Mario

2010-04-01

Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

Directory of Open Access Journals (Sweden)

Jonas Binladen

2007-02-01

Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

Rapid diagnosis and identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima, Peru Diagnóstico e identificación rápidos por PCR de Yersinia ruckeri aislada de Oncorhynchus mykiss procedentes de Canta, Lima, Perú

Directory of Open Access Journals (Sweden)

Susana Sirvas-Cornejo

2012-02-01

Full Text Available Twenty individuals of rainbow trout were sampled (fry and juveniles from Acochinchan Fishfarm (Canta, Lima - Peru, and analyzed with the Polimerase Chain Reaction test (PCR in order to achieve a rapid identification of Yersinia ruckeri, which is the pathogen agent that causes the enteric red mouth disease (ERM and produces high rates of mortality. Nine fish samples were asymptomatic, while 11 of them showed signs of ERM. In addition, 22 bacterial strains were isolated from the liver, spleen and kidney. PCR and specific primers (16S rRNA, were used to amplified a specific 575 bp DNA fragment of Yersinia ruckeri. Nineteen strains were identified as Yersinia ruckeri by PCR in symptomatic and asymptomatic fishes. It was established a diagnosis time of 26 hours, compared with the 2 or 3 days that would take the diagnosis using biochemical tests.Se muestrearon 20 ejemplares (alevines y juveniles de trucha arco iris cultivados en la piscifactoría Acochinchán (Canta, Lima, Perú, y se les aplico la técnica de la Reacción en Cadena de la Polimerasa (PCR con la finalidad de obtener una identificación rápida del agente patógeno Yersinia ruckeri que produce la enfermedad entérica de la boca roja (ERM y genera elevadas tasas de mortalidad. Nueve ejemplares fueron asintomáticos mientras que 11 presentaron signos de ERM. Se aislaron 22 cepas bacterianas del hígado, bazo y riñón. Se empleó la técnica de la PCR para la amplificación y cebadores específicos (ARNr 16S, que permitieron amplificar un fragmento de ADN de 575 pb de Yersinia ruckeri. Diecinueve cepas fueron identificadas como Yersinia ruckeri mediante la PCR, tanto en peces sintomáticos como asintomáticos. Se estableció un tiempo de diagnóstico de 26 horas, en comparación con los 2 ó 3 días que duraría el diagnóstico empleando las pruebas bioquímicas.

Detection of hepatitis C virus RNA using reverse transcription PCR

International Nuclear Information System (INIS)

Yap, S.F.

1998-01-01

Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

Rapid detection of most frequent Slovenian germ-line mutations in BRCA1 gene using real-time PCR and melting curve analysis

International Nuclear Information System (INIS)

Novakovic, S.; Stegel, V.

2005-01-01

Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)

VEGF-A mRNA measurement in meningiomas using a new simplified approach

DEFF Research Database (Denmark)

Dyrbye, Henrik; Nassehi, Damoun; Sørensen, Lars Peter

2016-01-01

of mRNA-concentration, they were expected to be comparable. The aim of the present study was to compare Lumistar to the traditional RT-qPCR approach in a routine laboratory setting, where there is emphasis on rapid analysis response. Meningioma (n = 10) and control brain tissue (n = 5) samples were...

Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

Science.gov (United States)

Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

2012-10-01

A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

Rapid method for identification of transgenic fish zygosity

Directory of Open Access Journals (Sweden)

. Alimuddin

2007-07-01

Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

DETECTION AND QUANTIFICATION OF COW FECAL POLLUTION WITH REAL-TIME PCR

Science.gov (United States)

Assessment of health risk and fecal bacteria loads associated with cow fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for enumeration of two recently described cow-specific g...

Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

Science.gov (United States)

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-06-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

Science.gov (United States)

Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

2010-04-01

Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach

DEFF Research Database (Denmark)

Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere

2013-01-01

was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...

Evaluation of pre-PCR processing approaches for enumeration of Salmonella enterica in naturally contaminated animal feed

DEFF Research Database (Denmark)

Schelin, Jenny; Andersson, Gunnar; Vigre, Håkan

2014-01-01

Three pre‐PCR processing strategies for the detection and/or quantification of Salmonella in naturally contaminated soya bean meal were evaluated. Methods included: (i) flotation‐qPCR [enumeration of intact Salmonella cells prior to quantitative PCR (qPCR)], (ii) MPN‐PCR (modified most probable...... be due to the presence of nonculturable Salmonella and/or a heterogeneous distribution of Salmonella in the material. The evaluated methods provide different possibilities to assess the prevalence of Salmonella in feed, together with the numbers of culturable, as well as nonculturable cells, and can...... be applied to generate data to allow more accurate quantitative microbial risk assessment for Salmonella in the feed chain....

An immunomagnetic separation-real-time PCR system for the detection of Alicyclobacillus acidoterrestris in fruit products.

Science.gov (United States)

Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli

2014-04-03

Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.

Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot

International Nuclear Information System (INIS)

Xun Zhe; Guan Yifu; Zhao Xiaoyun

2013-01-01

Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg 2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. (paper)

Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

Science.gov (United States)

Day, J B; Basavanna, U

2015-01-01

To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

Science.gov (United States)

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Comparison of the quantification of KRAS mutations by digital PCR and E-ice-COLD-PCR in circulating-cell-free DNA from metastatic colorectal cancer patients.

Science.gov (United States)

Sefrioui, David; Mauger, Florence; Leclere, Laurence; Beaussire, Ludivine; Di Fiore, Frédéric; Deleuze, Jean-François; Sarafan-Vasseur, Nasrin; Tost, Jörg

2017-02-01

Circulating cell-free DNA (ccfDNA) bears great promise as biomarker for personalized medicine, but ccfDNA is present only at low levels in the plasma or serum of cancer patients. E-ice-COLD-PCR is a recently developed enrichment method to detect and identify mutations present at low-abundance in clinical samples. However, recent studies have shown the importance to accurately quantify low-abundance mutations as clinically important decisions will depend on certain mutation thresholds. The possibility for an enrichment method to accurately quantify the mutation levels remains a point of concern and might limit its clinical applicability. In the present study, we compared the quantification of KRAS mutations in ccfDNA from metastatic colorectal cancer patients by E-ice-COLD-PCR with two digital PCR approaches. For the quantification of mutations by E-ice-COLD-PCR, cell lines with known mutations diluted into WT genomic DNA were used for calibration. E-ice-COLD-PCR and the two digital PCR approaches showed the same range of the mutation level and were concordant for mutation levels below the clinical relevant threshold. E-ice-COLD-PCR can accurately detect and quantify low-abundant mutations in ccfDNA and has a shorter time to results making it compatible with the requirements of analyses in a clinical setting without the loss of quantitative accuracy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

DEFF Research Database (Denmark)

Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

2012-01-01

Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

Viability qPCR, a new tool for Legionella risk management.

Science.gov (United States)

Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F

2017-11-01

Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

Science.gov (United States)

Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

2013-01-01

Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Customizable PCR-microplate array for differential identification of multiple pathogens.

Science.gov (United States)

Woubit, Abdela; Yehualaeshet, Teshome; Roberts, Sherrelle; Graham, Martha; Kim, Moonil; Samuel, Temesgen

2013-11-01

Customizable PCR-microplate arrays were developed for the rapid identification of Salmonella Typhimurium, Salmonella Saintpaul, Salmonella Typhi, Shigella dysenteriae, Escherichia coli O157:H7, Francisella tularensis subsp. tularensis, Francisella tularensis subsp. novicida, Vibrio cholerae, Vibrio parahaemolyticus, Yersinia pestis, and Yersinia pseudotuberculosis. Previously, we identified highly specific primers targeting each of these pathogens. Here, we report the development of customizable PCR-microplate arrays for simultaneous identification of the pathogens using the primers identified. A mixed aliquot of genomic DNA from 38 strains was used to validate three PCR-microplate array formats. Identical PCR conditions were used to run all the samples on the three formats. Specific amplifications were obtained on all three custom plates. In preliminary tests performed to evaluate the sensitivity of these assays in samples inoculated in the laboratory with Salmonella Typhimurium, amplifications were obtained from 1 g of beef hot dog inoculated at as low as 9 CFU/ml or from milk inoculated at as low as 78 CFU/ml. Such microplate arrays could be valuable tools for initial identification or secondary confirmation of contamination by these pathogens.

PCR

African Journals Online (AJOL)

Elham

2013-07-03

Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR.

Science.gov (United States)

Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li

2003-09-01

Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

Energy Technology Data Exchange (ETDEWEB)

Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

1994-09-01

Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

Digital PCR as a tool to measure HIV persistence.

Science.gov (United States)

Rutsaert, Sofie; Bosman, Kobus; Trypsteen, Wim; Nijhuis, Monique; Vandekerckhove, Linos

2018-01-30

Although antiretroviral therapy is able to suppress HIV replication in infected patients, the virus persists and rebounds when treatment is stopped. In order to find a cure that can eradicate the latent reservoir, one must be able to quantify the persisting virus. Traditionally, HIV persistence studies have used real-time PCR (qPCR) to measure the viral reservoir represented by HIV DNA and RNA. Most recently, digital PCR is gaining popularity as a novel approach to nucleic acid quantification as it allows for absolute target quantification. Various commercial digital PCR platforms are nowadays available that implement the principle of digital PCR, of which Bio-Rad's QX200 ddPCR is currently the most used platform in HIV research. Quantification of HIV by digital PCR is proving to be a valuable improvement over qPCR as it is argued to have a higher robustness to mismatches between the primers-probe set and heterogeneous HIV, and forfeits the need for a standard curve, both of which are known to complicate reliable quantification. However, currently available digital PCR platforms occasionally struggle with unexplained false-positive partitions, and reliable segregation between positive and negative droplets remains disputed. Future developments and advancements of the digital PCR technology are promising to aid in the accurate quantification and characterization of the persistent HIV reservoir.

PCR methodology as a valuable tool for identification of endodontic pathogens.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N

2003-07-01

This paper reviews the principles of polymerase chain reaction (PCR) methodology, its application in identification of endodontic pathogens and the perspectives regarding the knowledge to be reached with the use of this highly sensitive, specific and accurate methodology as a microbial identification test. Studies published in the medical, dental and biological literature. Evaluation of published epidemiological studies examining the endodontic microbiota through PCR methodology. PCR technology has enabled the detection of bacterial species that are difficult or even impossible to culture as well as cultivable bacterial strains showing a phenotypically divergent or convergent behaviour. Moreover, PCR is more rapid, much more sensitive, and more accurate when compared with culture. Its use in endodontics to investigate the microbiota associated with infected root canals has expanded the knowledge on the bacteria involved in the pathogenesis of periradicular diseases. For instance, Tannerella forsythensis (formerly Bacteroides forsythus), Treponema denticola, other Treponema species, Dialister pneumosintes, and Prevotella tannerae were detected in infected root canals for the first time and in high prevalence when using PCR analysis. The diversity of endodontic microbiota has been demonstrated by studies using PCR amplification, cloning and sequencing of the PCR products. Moreover, other fastidious bacterial species, such as Porphyromonas endodontalis, Porphyromonas gingivalis and some Eubacterium spp., have been reported in endodontic infections at a higher prevalence than those reported by culture procedures.

Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

Directory of Open Access Journals (Sweden)

Tandale Babasaheb V

2008-12-01

Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

Novel approach for assessing performance of PCR cyclers used for diagnostic testing

DEFF Research Database (Denmark)

Schoder, D.; Schmalwieser, A.; Schauberger, G.

2005-01-01

of thermal homogeneities became most evident at the denaturation level during the first 15 s. At the time point zero, the accurate cyclers showed temperature deviations of 0.5 to 1.5 degrees C, whereas less-accurate cyclers failed to reach the set temperature by 13 to 20 degrees C. Consequently, the two less......As part of a large international project for validation and standardization of PCR, the influence of thermocyclers on PCR was tested. Six brand-new, Peltier technology-driven 96-well thermocyclers were subjected to a novel and stringent in-tube (not block) physical testing. The temperature...

Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

Science.gov (United States)

Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

2014-09-01

Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

Science.gov (United States)

Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

2017-07-01

The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

A multiplex PCR for detection of Listeria monocytogenes and its lineages.

Science.gov (United States)

Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

2016-11-01

A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Automated purification of Borrelia burgdorferi s.l. PCR products with KingFisherTM magnetic particle processor prior to genome sequencing

International Nuclear Information System (INIS)

Maekinen, Johanna; Marttila, Harri; Viljanen, Matti K.

2001-01-01

Borrelia burgdorferi sensu lato genospecies were differentiated by PCR-based sequencing of the borrelial flagellin gene. To evaluate the usefulness of KingFisher TM magnetic particle processor in PCR product purification, borrelia PCR products were purified with KingFisher TM magnetic particle processor prior to cycle sequencing and the quality of the sequence data received was analyzed. KingFisher was found to offer a rapid and reliable alternative for borrelial PCR product purification

PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal.

Science.gov (United States)

Bello Gonzalez, Teresita; Rivera-Olivero, Ismar Alejandra; Sisco, María Carolina; Spadola, Enza; Hermans, Peter W; de Waard, Jacobus H

2014-04-15

Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPCR), resolving 24 serotypes in four PCR reactions and optimally targeting the most prevalent invasive and colonizing pneumococcal serotypes found in Venezuela. A total of 223 pneumococcal isolates, 140 invasive and 83 carriage isolates, previously serotyped by the Quellung reaction and representing the 18 most common serotypes/groups identified in Venezuela, were serotyped with the adapted mPCR. The mPCR serotyped 76% of all the strains in the first two PCR reactions and 91% after four reactions, correctly identifying 17 serotypes/groups. An isolate could be serotyped with mPCR in less than 2 minutes versus 15 minutes for the Quellung reaction, considerably lowering labor costs. A restrictive weakness of mPCR was found for the detection of 19F strains. Most Venezuelan 19F strains were not typeable using the mPCR, and two 19F cps serotype variants were identified. The mPCR assay is an accurate, rapid, and economical method for the identification of the vast majority of the serotypes from Venezuela and can be used in place of the standard Quellung reaction. An exception is the identification of serotype 19F. In this setting, most 19F strains were not detectable with mPCR, demonstrating a need of serology-based quality control for PCR-based serotyping.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

Directory of Open Access Journals (Sweden)

Amanda de Faveri Pitz

2013-12-01

Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method

Directory of Open Access Journals (Sweden)

H Ansari

2010-02-01

Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

Science.gov (United States)

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Absolute quantification by droplet digital PCR versus analog real-time PCR

Science.gov (United States)

Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh

2014-01-01

Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387

Accurate Detection of Methicillin-Resistant Staphylococcus aureus in Mixtures by Use of Single-Bacterium Duplex Droplet Digital PCR.

Science.gov (United States)

Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping; Wei, Hongping

2017-10-01

Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers ( nuc and mecA ) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli , MSSA, and other mecA -positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. Copyright © 2017 American Society for Microbiology.

A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

Science.gov (United States)

Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

2008-11-01

A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

Evaluation of loop-mediated isothermal amplification assay for rapid diagnosis of Acanthamoeba keratitis

Directory of Open Access Journals (Sweden)

Abhishek Mewara

2017-01-01

Full Text Available Background: The clinical features of Acanthamoeba keratitis (AK are non-specific and closely resemble bacterial, viral and fungal keratitis. Materials and Methods: We compared loop-mediated isothermal amplification (LAMP with microscopy, non-nutrient agar (NNA culture and polymerase chain reaction (PCR in clinical suspects of AK. Results: Of 52 clinical samples (42 AK suspects and 10 proven bacterial, viral or fungal keratitis, 3 were positive by direct microscopy (sensitivity 60%, confidence interval [CI]: 17%–92.7%, and 5 by NNA culture, 18S rDNA PCR and LAMP (sensitivity 100%, CI: 46.3%–100%. The limit of detection of Acanthamoeba DNA was 1 pg/μl by both LAMP and PCR. Conclusion: PCR and LAMP assays targeting 18S rDNA gene were found particularly suitable for a rapid and accurate diagnosis of AK. LAMP assay takes 2–3 h lesser than PCR, and thus offers a rapid, highly sensitive and specific, simple and affordable diagnostic modality for patients suspected of AK, especially in resource limited settings

Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

Science.gov (United States)

Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

2017-09-15

Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata

Directory of Open Access Journals (Sweden)

Hamid Moghimi

2017-06-01

Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.

an overview on the application of polymerase chain reaction (pcr)

African Journals Online (AJOL)

DR. AMINU

Hill New York Pp818. Chul, W.P., Jang-Hee, H., Jin-Hyeok, J. et al (2004). Detection rates of Bacteria in chronic Otitis. Media with Effusion in Children, Journal of. Korean Medical Sciences 19: 735-738. Cockerill, F.R. and Smith, T.F. (2002). Rapid-Cycle real time PCR: A revolution of clinical. Microbiology. ASM News 68:2.

Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

Science.gov (United States)

Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

2015-01-01

We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

Eliminating PCR contamination

International Nuclear Information System (INIS)

Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

1991-01-01

The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

Science.gov (United States)

Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

2017-01-01

Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

Directory of Open Access Journals (Sweden)

Ashutosh Wadhwa

2017-01-01

Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

Chromatin Immunoprecipitation (ChIP): Revisiting the Efficacy of Sample Preparation, Sonication, Quantification of Sheared DNA, and Analysis via PCR

Science.gov (United States)

Schoppee Bortz, Pamela D.; Wamhoff, Brian R.

2011-01-01

The “quantitative” ChIP, a tool commonly used to study protein-DNA interactions in cells and tissue, is a difficult assay often plagued with technical error. We present, herein, the process required to merge multiple protocols into a quick, reliable and easy method and an approach to accurately quantify ChIP DNA prior to performing PCR. We demonstrate that high intensity sonication for at least 30 min is required for full cellular disruption and maximum DNA recovery because ChIP lysis buffers fail to lyse formaldehyde-fixed cells. In addition, extracting ChIP DNA with chelex-100 yields samples that are too dilute for evaluation of shearing efficiency or quantification via nanospectrophotometry. However, DNA extracted from the Mock-ChIP supernatant via the phenol-chloroform-isoamyl alcohol (PCIA) method can be used to evaluate DNA shearing efficiency and used as the standard in a fluorescence-based microplate assay. This enabled accurate quantification of DNA in chelex-extracted ChIP samples and normalization to total DNA concentration prior to performing real-time PCR (rtPCR). Thus, a quick ChIP assay that can be completed in nine bench hours over two days has been validated along with a rapid, accurate and repeatable way to quantify ChIP DNA. The resulting rtPCR data more accurately depicts treatment effects on protein-DNA interactions of interest. PMID:22046253

The PCR-Based Diagnosis of Central Nervous System Tuberculosis: Up to Date

Directory of Open Access Journals (Sweden)

Teruyuki Takahashi

2012-01-01

Full Text Available Central nervous system (CNS tuberculosis, particularly tuberculous meningitis (TBM, is the severest form of Mycobacterium tuberculosis (M.Tb infection, causing death or severe neurological defects in more than half of those affected, in spite of recent advancements in available anti-tuberculosis treatment. The definitive diagnosis of CNS tuberculosis depends upon the detection of M.Tb bacilli in the cerebrospinal fluid (CSF. At present, the diagnosis of CNS tuberculosis remains a complex issue because the most widely used conventional “gold standard” based on bacteriological detection methods, such as direct smear and culture identification, cannot rapidly detect M.Tb in CSF specimens with sufficient sensitivity in the acute phase of TBM. Recently, instead of the conventional “gold standard”, the various molecular-based methods including nucleic acid amplification (NAA assay technique, particularly polymerase chain reaction (PCR assay, has emerged as a promising new method for the diagnosis of CNS tuberculosis because of its rapidity, sensitivity and specificity. In addition, the innovation of nested PCR assay technique is worthy of note given its contribution to improve the diagnosis of CNS tuberculosis. In this review, an overview of recent progress of the NAA methods, mainly highlighting the PCR assay technique, was presented.

Real-Time PCR (qPCR) Primer Design Using Free Online Software

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

Stem-Loop RT-qPCR as an Efficient Tool for the Detection and Quantification of Small RNAs in Giardia lamblia

Directory of Open Access Journals (Sweden)

Jaime Marcial-Quino

2016-12-01

Full Text Available Stem-loop quantitative reverse transcription PCR (RT-qPCR is a molecular technique used for identification and quantification of individual small RNAs in cells. In this work, we used a Universal ProbeLibrary (UPL-based design to detect—in a rapid, sensitive, specific, and reproducible way—the small nucleolar RNA (snoRNA GlsR17 and its derived miRNA (miR2 of Giardia lamblia using a stem-loop RT-qPCR approach. Both small RNAs could be isolated from both total RNA and small RNA samples. Identification of the two small RNAs was carried out by sequencing the PCR-amplified small RNA products upon ligation into the pJET1.2/blunt vector. GlsR17 is constitutively expressed during the 72 h cultures of trophozoites, while the mature miR2 is present in 2-fold higher abundance during the first 48 h than at 72 h. Because it has been suggested that miRNAs in G. lamblia have an important role in the regulation of gene expression, the use of the stem-loop RT-qPCR method could be valuable for the study of miRNAs of G. lamblia. This methodology will be a powerful tool for studying gene regulation in G. lamblia, and will help to better understand the features and functions of these regulatory molecules and how they work within the RNA interference (RNAi pathway in G. lamblia.

Stem-Loop RT-qPCR as an Efficient Tool for the Detection and Quantification of Small RNAs in Giardia lamblia

Science.gov (United States)

Marcial-Quino, Jaime; Gómez-Manzo, Saúl; Fierro, Francisco; Vanoye-Carlo, America; Rufino-González, Yadira; Sierra-Palacios, Edgar; Castillo-Villanueva, Adriana; Castillo-Rodríguez, Rosa Angélica; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto; Reyes-Vivas, Horacio

2016-01-01

Stem-loop quantitative reverse transcription PCR (RT-qPCR) is a molecular technique used for identification and quantification of individual small RNAs in cells. In this work, we used a Universal ProbeLibrary (UPL)-based design to detect—in a rapid, sensitive, specific, and reproducible way—the small nucleolar RNA (snoRNA) GlsR17 and its derived miRNA (miR2) of Giardia lamblia using a stem-loop RT-qPCR approach. Both small RNAs could be isolated from both total RNA and small RNA samples. Identification of the two small RNAs was carried out by sequencing the PCR-amplified small RNA products upon ligation into the pJET1.2/blunt vector. GlsR17 is constitutively expressed during the 72 h cultures of trophozoites, while the mature miR2 is present in 2-fold higher abundance during the first 48 h than at 72 h. Because it has been suggested that miRNAs in G. lamblia have an important role in the regulation of gene expression, the use of the stem-loop RT-qPCR method could be valuable for the study of miRNAs of G. lamblia. This methodology will be a powerful tool for studying gene regulation in G. lamblia, and will help to better understand the features and functions of these regulatory molecules and how they work within the RNA interference (RNAi) pathway in G. lamblia. PMID:27999395

Quantitative analysis of food and feed samples with droplet digital PCR.

Directory of Open Access Journals (Sweden)

Dany Morisset

Full Text Available In this study, the applicability of droplet digital PCR (ddPCR for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs. Real-time quantitative polymerase chain reaction (qPCR is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed.

App Factory: A flexible approach to rehabilitation engineering in an era of rapid technology advancement.

Science.gov (United States)

Jones, Michael; Mueller, James; Morris, John

2017-01-01

This article describes a flexible and effective approach to research and development in an era of rapid technological advancement. The approach relies on secondary dispersal of grant funds to commercial developers through a competitive selection process. This "App Factory" model balances the practical reliance on multi-year funding needed to sustain a rehabilitation engineering research center (RERC), with the need for agility and adaptability of development efforts undertaken in a rapidly changing technology environment. This approach also allows us to take advantage of technical expertise needed to accomplish a particular development task, and provides incentives to deliver successful products in a cost-effective manner. In this article, we describe the App Factory structure, process, and results achieved to date; and we discuss the lessons learned and the potential relevance of this approach for other grant-funded research and development efforts. Data presented on the direct costs and number of downloads of the 16 app development projects funded in the App Factory's first 3 years show that it can be an effective means for supporting focused, short-term assistive technology development projects.

16S pan-bacterial PCR can accurately identify patients with ventilator-associated pneumonia.

Science.gov (United States)

Conway Morris, Andrew; Gadsby, Naomi; McKenna, James P; Hellyer, Thomas P; Dark, Paul; Singh, Suveer; Walsh, Timothy S; McAuley, Danny F; Templeton, Kate; Simpson, A John; McMullan, Ronan

2017-11-01

Ventilator-associated pneumonia (VAP) remains a challenge to intensive care units, with secure diagnosis relying on microbiological cultures that take up to 72 hours to provide a result. We sought to derive and validate a novel, real-time 16S rRNA gene PCR for rapid exclusion of VAP. Bronchoalveolar lavage (BAL) was obtained from two independent cohorts of patients with suspected VAP. Patients were recruited in a 2-centre derivation cohort and a 12-centre confirmation cohort. Confirmed VAP was defined as growth of >10 4 colony forming units/ml on semiquantitative culture and compared with a 16S PCR assay. Samples were tested from 67 patients in the derivation cohort, 10 (15%) of whom had confirmed VAP. Using cycles to cross threshold (C t ) values as the result of the 16S PCR test, the area under the receiver operating characteristic (ROC) curve (AUROC) was 0.94 (95% CI 0.86 to 1.0, p<0.0001). Samples from 92 patients were available from the confirmation cohort, 26 (28%) of whom had confirmed VAP. The AUROC for C t in this cohort was 0.89 (95% CI 0.83 to 0.95, p<0.0001). This study has derived and assessed the diagnostic accuracy of a novel application for 16S PCR. This suggests that 16S PCR in BAL could be used as a rapid test in suspected VAP and may allow better stewardship of antibiotics. VAPRAPID trial ref NCT01972425. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

Science.gov (United States)

Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

Real-time quantitative PCR of Staphylococcus aureus and application in restaurant meals.

Science.gov (United States)

Berrada, H; Soriano, J M; Mañes, J; Picó, Y

2006-01-01

Staphylococcus aureus is considered the second most common pathogen to cause outbreaks of food poisoning, exceeded only by Campylobacter. Consumption of foods containing this microorganism is often identified as the cause of illness. In this study, a rapid, reliable, and sensitive real-time quantitative PCR was developed and compared with conventional culture methods. Real-time quantitative PCR was carried out by purifying DNA extracts of S. aureus with a Staphylococcus sample preparation kit and quantifying it in the LightCycler system with hybridization probes. The assay was linear from a range of 10 to 10(6) S. aureus cells (r2 > 0.997). The PCR reaction presented an efficiency of >85%. Accuracy of the PCR-based assay, expressed as percent bias, was around 13%, and the precision, expressed as a percentage of the coefficient of variation, was 7 to 10%. Intraday and interday variability were studied at 10(2) CFU/g and was 12 and 14%, respectively. The proposed method was applied to the analysis of 77 samples of restaurant meals in Valencia (Spain). In 11.6% of samples S. aureus was detected by real-time quantitative PCR, as well as by the conventional microbiological method. An excellent correspondence between real-time quantitative PCR and microbiological numbers (CFU/g) was observed with deviations of < 28%.

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

Science.gov (United States)

Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

2015-03-01

Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

Random Amplified Polymorphic DNA PCR in the Teaching of Molecular Epidemiology

Science.gov (United States)

Reinoso, Elina B.; Bettera, Susana G.

2016-01-01

In this article, we describe a basic practical laboratory designed for fifth-year undergraduate students of Microbiology as part of the Epidemiology course. This practice provides the students with the tools for molecular epidemiological analysis of pathogenic microorganisms using a rapid and simple PCR technique. The aim of this work was to assay…

Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

Directory of Open Access Journals (Sweden)

Law eJodi Woan-Fei

2015-01-01

Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

Comparison of Direct Sequencing, Real-Time PCR-High Resolution Melt (PCR-HRM) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis for Genotyping of Common Thiopurine Intolerant Variant Alleles NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C).

Science.gov (United States)

Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat

2017-05-12

Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.

CONCEPTUAL APPROACHES TO THE RAPID DETECTION OF CAMPYLOBACTER SPP. IN MEAT OF SLAUGHTER ANIMALS

Directory of Open Access Journals (Sweden)

D. S. Bataeva

2017-01-01

Full Text Available The modern approach to quality assurance of food products based on the ISO 9000 standards indicates the need for the implementation of quality management systems in processing plants. According to the analysis of scientific publication databases (Science Direct and Web of Science, it is established that only 0.5–1.7% of publications are related to studying meat of slaughter animals (except for birds concerning the presence of Campylobacter. The priority method of investigation is PCR. Ready-to-use PCR test system was developed for the detection of Campylobacter spp. on the basis of selected gene-specific primers to bacteria of Campylobacter genus. Specificity of the test system is established for Gram-negative bacteria of Salmonella, Escherichia, and Proteus genera, and for oxidase-positive Aeromonas. Gene-specific primers for Campylobacter were selected and ready-to-use PCR test system was developed on their basis. It was found that the selected primers have 100% convergence to the genome of Campylobacter genus bacteria, the PCR efficiency is not less than 95%, and the detection limit is not more than 1× 104 CFU/g. When estimating the specificity of the primers, it was taken into account that the bacteria of Campylobacter genus may be incorporated in a consortium with intestine microbiome, mainly with Enterobacteriaceae and lactic acid bacteria. However, Bolton’s enrichment medium is selective and, during the cultivation process, suppresses the growth of Gram-positive lactic acid bacteria. It was found that the selected primers were 100% specific and did not give false positive reactions with this group of microorganisms. The developed test system was successfully validated in a cycle of qualitative tests in the FEPAS system and implemented into laboratory practice. It was proved that the developed test system may be used both in screening at the stages of Campylobacter enrichment and in identification of pure culture of the

Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

DEFF Research Database (Denmark)

Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

2004-01-01

As part of a multi-centre European project, FOOD-PCR, the feasibility of a novel approach for production of dried bacterial DNA that could be used as certified reference materials (CRM) was assessed. Selected strains of Salmonella typhimurium, Listeria monocytogenes, Escherichia coli O157...

Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR.

Science.gov (United States)

Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G

2008-05-01

Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.

Rapid and Accurate Detection of Bacteriophage Activity against Escherichia coli O157:H7 by Propidium Monoazide Real-Time PCR

Directory of Open Access Journals (Sweden)

Hui Liu

2014-01-01

Full Text Available Conventional methods to determine the efficacy of bacteriophage (phage for biocontrol of E. coli require several days, due to the need to culture bacteria. Furthermore, cell surface-attached phage particles may lyse bacterial cells during experiments, leading to an overestimation of phage activity. DNA-based real-time quantitative polymerase chain reaction (qPCR is a fast, sensitive, and highly specific means of enumerating pathogens. However, qPCR may underestimate phage activity due to its inability to distinguish viable from nonviable cells. In this study, we evaluated the suitability of propidium monoazide (PMA, a microbial membrane-impermeable dye that inhibits amplification of extracellular DNA and DNA within dead or membrane-compromised cells as a means of using qPCR to identify only intact E. coli cells that survive phage exposure. Escherichia coli O157:H7 strain R508N and 4 phages (T5-like, T1-like, T4-like, and O1-like were studied. Results compared PMA-qPCR and direct plating and confirmed that PMA could successfully inhibit amplification of DNA from compromised/damaged cells E. coli O157:H7. Compared to PMA-qPCR, direct plating overestimated (P < 0.01 phage efficacy as cell surface-attached phage particles lysed E. coli O157:H7 during the plating process. Treatment of samples with PMA in combination with qPCR can therefore be considered beneficial when assessing the efficacy of bacteriophage for biocontrol of E. coli O157:H7.

Efficiency of peracetic acid in inactivating bacteria, viruses, and spores in water determined with ATP bioluminescence, quantitative PCR, and culture-based methods.

Science.gov (United States)

Park, Eunyoung; Lee, Cheonghoon; Bisesi, Michael; Lee, Jiyoung

2014-03-01

The disinfection efficiency of peracetic acid (PAA) was investigated on three microbial types using three different methods (filtration-based ATP (adenosine-triphosphate) bioluminescence, quantitative polymerase chain reaction (qPCR), culture-based method). Fecal indicator bacteria (Enterococcus faecium), virus indicator (male-specific (F(+)) coliphages (coliphages)), and protozoa disinfection surrogate (Bacillus subtilis spores (spores)) were tested. The mode of action for spore disinfection was visualized using scanning electron microscopy. The results indicated that PAA concentrations of 5 ppm (contact time: 5 min), 50 ppm (10 min), and 3,000 ppm (5 min) were needed to achieve 3-log reduction of E. faecium, coliphages, and spores, respectively. Scanning electron microscopy observation showed that PAA targets the external layers of spores. The lower reduction rates of tested microbes measured with qPCR suggest that qPCR may overestimate the surviving microbes. Collectively, PAA showed broad disinfection efficiency (susceptibility: E. faecium > coliphages > spores). For E. faecium and spores, ATP bioluminescence was substantially faster (∼5 min) than culture-based method (>24 h) and qPCR (2-3 h). This study suggests PAA as an effective alternative to inactivate broad types of microbial contaminants in water. Together with the use of rapid detection methods, this approach can be useful for urgent situations when timely response is needed for ensuring water quality.

Phenylketonuria mutation analysis in Northern Ireland: A rapid stepwise approach

Energy Technology Data Exchange (ETDEWEB)

Zschocke, J.; Graham, C.A.; Nevin, N.C. [Queen`s Univ., Belfast (Australia)] [and others

1995-12-01

We present a multistep approach for the rapid analysis of phenylketonuria (PKU) mutations. In the first step, three common mutations and a polymorphic short tandem repeat (STR) system are rapidly analyzed with a fluorescent multiplex assay. In the second step, minihaplotypes combining STR and VNTR data are used to determine rare mutations likely to be present in an investigated patient, which are then confirmed by restriction enzyme analysis. The remaining mutations are analyzed with denaturant gradient-gel electrophoresis and sequencing. The first two steps together identify both mutations in 90%-95% of PKU patients, and results can be obtained within 2 d. We have investigated 121 Northern Irish families with hyperphenylalaninemia, including virtually all patients born since 1972, and have found 34 different mutations on 241 of the 242 mutant alleles. Three mutations (R408W, 165T, and F39L) account for 57.5% of mutations, while 14 mutations occur with a frequency of 1%-6%. The present analysis system is efficient and inexpensive and is particularly well suited to routine mutation analysis in a diagnostic setting. 19 refs., 5 tabs.

Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

Science.gov (United States)

Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

2014-12-01

Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

International Nuclear Information System (INIS)

Maria Lina R; Andi Yasmon

2011-01-01

There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

A longitudinal evaluation of Treponema pallidum PCR testing in early syphilis

Directory of Open Access Journals (Sweden)

Shields Matt

2012-12-01

Full Text Available Abstract Background Syphilis is a growing public health problem among men who have sex with men (MSM globally. Rapid and accurate detection of syphilis is vital to ensure patients and their contacts receive timely treatment and reduce ongoing transmission. Methods We evaluated a PCR assay for the diagnosis of Treponema pallidum using swabs of suspected early syphilis lesions in longitudinally assessed MSM. Results We tested 260 MSM for T pallidum by PCR on 288 occasions: 77 (26.7% had early syphilis that was serologically confirmed at baseline or within six weeks, and 211 (73.3% remained seronegative for syphilis. Of 55 men with primary syphilis, 49 were PCR positive, giving a sensitivity of 89.1% (95% CI: 77.8%-95.9% and a specificity of 99.1% (95% CI: 96.5%-99.9%. Of 22 men with secondary syphilis, 11 were PCR positive, giving a sensitivity of 50% (95% CI: 28.2%-71.8% and a specificity of 100% (95% CI: 66.4%-71.8%. Of the 77 syphilis cases, 43 (56% were HIV positive and the sensitivity and specificity of the PCR test did not vary by HIV status. The PCR test was able to detect up to five (10% primary infections that were initially seronegative, including one HIV positive man with delayed seroconversion to syphilis (72 to 140 days and one HIV positive man who did not seroconvert to syphilis over 14 months follow-up. Both men had been treated for syphilis within a week of the PCR test. Conclusions T pallidum PCR is a potentially powerful tool for the early diagnosis of primary syphilis, particularly where a serological response has yet to develop.

High throughput detection of Coxiella burnetii by real-time PCR with internal control system and automated DNA preparation

Directory of Open Access Journals (Sweden)

Kramme Stefanie

2008-05-01

Full Text Available Abstract Background Coxiella burnetii is the causative agent of Q-fever, a widespread zoonosis. Due to its high environmental stability and infectivity it is regarded as a category B biological weapon agent. In domestic animals infection remains either asymptomatic or presents as infertility or abortion. Clinical presentation in humans can range from mild flu-like illness to acute pneumonia and hepatitis. Endocarditis represents the most common form of chronic Q-fever. In humans serology is the gold standard for diagnosis but is inadequate for early case detection. In order to serve as a diagnostic tool in an eventual biological weapon attack or in local epidemics we developed a real-time 5'nuclease based PCR assay with an internal control system. To facilitate high-throughput an automated extraction procedure was evaluated. Results To determine the minimum number of copies that are detectable at 95% chance probit analysis was used. Limit of detection in blood was 2,881 copies/ml [95%CI, 2,188–4,745 copies/ml] with a manual extraction procedure and 4,235 copies/ml [95%CI, 3,143–7,428 copies/ml] with a fully automated extraction procedure, respectively. To demonstrate clinical application a total of 72 specimens of animal origin were compared with respect to manual and automated extraction. A strong correlation between both methods was observed rendering both methods suitable. Testing of 247 follow up specimens of animal origin from a local Q-fever epidemic rendered real-time PCR more sensitive than conventional PCR. Conclusion A sensitive and thoroughly evaluated real-time PCR was established. Its high-throughput mode may show a useful approach to rapidly screen samples in local outbreaks for other organisms relevant for humans or animals. Compared to a conventional PCR assay sensitivity of real-time PCR was higher after testing samples from a local Q-fever outbreak.

Validation of the Pockit Dengue Virus Reagent Set for Rapid Detection of Dengue Virus in Human Serum on a Field-Deployable PCR System.

Science.gov (United States)

Tsai, Jih-Jin; Liu, Li-Teh; Lin, Ping-Chang; Tsai, Ching-Yi; Chou, Pin-Hsing; Tsai, Yun-Long; Chang, Hsiao-Fen Grace; Lee, Pei-Yu Alison

2018-05-01

Dengue virus (DENV) infection, a mosquito-borne disease, is a major public health problem in tropical countries. Point-of-care DENV detection with good sensitivity and specificity enables timely early diagnosis of DENV infection, facilitating effective disease management and control, particularly in regions of low resources. The Pockit dengue virus reagent set (GeneReach Biotech), a reverse transcription insulated isothermal PCR (RT-iiPCR), is available to detect all four serotypes of DENV on the field-deployable Pockit system, which is ready for on-site applications. In this study, analytical and clinical performances of the assay were evaluated. The index assay did not react with 14 non-DENV human viruses, indicating good specificity. Compared to the U.S. CDC DENV-1-4 real-time quantitative RT-PCR (qRT-PCR) assay, testing with serial dilutions of virus-spiked human sera demonstrated that the index assay had detection endpoints that were separately comparable with the 4 serotypes. Excellent reproducibility was observed among repeat tests done by six operators at three sites. In clinical performance, 195 clinical sera collected around Kaohsiung city in 2012 and 21 DENV-4-spiked sera were tested with the RT-iiPCR and qRT-PCR assays in parallel. The 121 (11 DENV-1, 78 DENV-2, 11 DENV-3, and 21 DENV-4) qRT-PCR-positive and 95 qRT-PCR-negative samples were all positive and negative by the RT-iiPCR reagent results, respectively, demonstrating high (100%) interrater agreement (95% confidence interval [CI 95% ], ∼98.81% to 100%; κ = 1). With analytical and clinical performance equivalent to those of the reference qRT-PCR assay, the index PCR assay on the field-deployable system can serve as a highly sensitive and specific on-site tool for DENV detection. Copyright © 2018 American Society for Microbiology.

Evaluation of Palm PCRTM G1-12 System: a portable battery-operated PCR thermal cycler

Directory of Open Access Journals (Sweden)

Siti Aminah Ahmed

2016-08-01

Full Text Available Polymerase chain reaction (PCR is the basis of recombinant and other molecular biological techniques. Availability of cheap and robust PCR platforms enables the tests to be performed easily, even in resource constrained settings. Herein we compared the efficacy of a portable thermal cycler ( Palm PCRTM G1-12 System for rapid DNA amplification against the standard Peltier-based thermal cycler using plasmid DNA and genomic DNA in single and multiplex PCR experiments. Our study revealed that the Palm PCRTM G1-12 System could be a portable DNA amplification system to conduct various molecular techniques, especially in places where resources are limited.

Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children

NARCIS (Netherlands)

Bruijnesteijn van Coppenraet, E. S.; Lindeboom, J. A.; Prins, J. M.; Peeters, M. F.; Claas, E. C. J.; Kuijper, E. J.

2004-01-01

A real-time PCR assay was developed to diagnose and identify the causative agents of suspected mycobacterial lymphadenitis. Primers and probes for the real-time PCR were designed on the basis of the internal transcribed spacer sequence, enabling the recognition of the genus Mycobacterium and the

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

Use of next generation sequencing data to develop a qPCR method for specific detection of EU-unauthorized genetically modified Bacillus subtilis overproducing riboflavin.

Science.gov (United States)

Barbau-Piednoir, Elodie; De Keersmaecker, Sigrid C J; Delvoye, Maud; Gau, Céline; Philipp, Patrick; Roosens, Nancy H

2015-11-11

Recently, the presence of an unauthorized genetically modified (GM) Bacillus subtilis bacterium overproducing vitamin B2 in a feed additive was notified by the Rapid Alert System for Food and Feed (RASFF). This has demonstrated that a contamination by a GM micro-organism (GMM) may occur in feed additives and has confronted for the first time,the enforcement laboratories with this type of RASFF. As no sequence information of this GMM nor any specific detection or identification method was available, Next GenerationSequencing (NGS) was used to generate sequence information. However, NGS data analysis often requires appropriate tools, involving bioinformatics expertise which is not alwayspresent in the average enforcement laboratory. This hampers the use of this technology to rapidly obtain critical sequence information in order to be able to develop a specific qPCRdetection method. Data generated by NGS were exploited using a simple BLAST approach. A TaqMan® qPCR method was developed and tested on isolated bacterial strains and on the feed additive directly. In this study, a very simple strategy based on the common BLAST tools that can be used by any enforcement lab without profound bioinformatics expertise, was successfully used toanalyse the B. subtilis data generated by NGS. The results were used to design and assess a new TaqMan® qPCR method, specifically detecting this GM vitamin B2 overproducing bacterium. The method complies with EU critical performance parameters for specificity, sensitivity, PCR efficiency and repeatability. The VitB2-UGM method also could detect the B. subtilis strain in genomic DNA extracted from the feed additive, without prior culturing step. The proposed method, provides a crucial tool for specifically and rapidly identifying this unauthorized GM bacterium in food and feed additives by enforcement laboratories. Moreover, this work can be seen as a case study to substantiate how the use of NGS data can offer an added value to easily

A new PCR approach for the identification of Fusarium graminearum Um novo protocolo de PCR para a identificação de Fusarium graminearum

Directory of Open Access Journals (Sweden)

Gleison Ricardo de Biazio

2008-09-01

Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as

Evaluation of PCR and high-resolution melt curve analysis for differentiation of Salmonella isolates.

Science.gov (United States)

Saeidabadi, Mohammad Sadegh; Nili, Hassan; Dadras, Habibollah; Sharifiyazdi, Hassan; Connolly, Joanne; Valcanis, Mary; Raidal, Shane; Ghorashi, Seyed Ali

2017-06-01

Consumption of poultry products contaminated with Salmonella is one of the major causes of foodborne diseases worldwide and therefore detection and differentiation of Salmonella spp. in poultry is important. In this study, oligonucleotide primers were designed from hemD gene and a PCR followed by high-resolution melt (HRM) curve analysis was developed for rapid differentiation of Salmonella isolates. Amplicons of 228 bp were generated from 16 different Salmonella reference strains and from 65 clinical field isolates mainly from poultry farms. HRM curve analysis of the amplicons differentiated Salmonella isolates and analysis of the nucleotide sequence of the amplicons from selected isolates revealed that each melting curve profile was related to a unique DNA sequence. The relationship between reference strains and tested specimens was also evaluated using a mathematical model without visual interpretation of HRM curves. In addition, the potential of the PCR-HRM curve analysis was evaluated for genotyping of additional Salmonella isolates from different avian species. The findings indicate that PCR followed by HRM curve analysis provides a rapid and robust technique for genotyping of Salmonella isolates to determine the serovar/serotype.

Rapid Quantification of Viable Campylobacter Bacteria on Chicken Carcasses, Using Real-Time PCR and Propidium Monoazide Treatment, as a Tool for Quantitative Risk Assessment

DEFF Research Database (Denmark)

Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

2010-01-01

A number of intervention strategies against Campylobacter contaminated poultry focus on post-slaughter reduction of the number of cells, emphasizing the need for rapid and reliable quantitative detection of only viable Campylobacter. We present a new and rapid quantitative approach for enumeration...... method does not detect DNA from dead Campylobacter, but recognises the infectious potential of the VBNC state, and is thereby able to assess the effect of control strategies, and provide trustworthy data for risk assessment....

Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

DEFF Research Database (Denmark)

Porse, B T; Garrett, R A

1995-01-01

Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single-site mutati...

Molecular quantification of environmental DNA using microfluidics and digital PCR.

Science.gov (United States)

Hoshino, Tatsuhiko; Inagaki, Fumio

2012-09-01

Real-time PCR has been widely used to evaluate gene abundance in natural microbial habitats. However, PCR-inhibitory substances often reduce the efficiency of PCR, leading to the underestimation of target gene copy numbers. Digital PCR using microfluidics is a new approach that allows absolute quantification of DNA molecules. In this study, digital PCR was applied to environmental samples, and the effect of PCR inhibitors on DNA quantification was tested. In the control experiment using λ DNA and humic acids, underestimation of λ DNA at 1/4400 of the theoretical value was observed with 6.58 ng μL(-1) humic acids. In contrast, digital PCR provided accurate quantification data with a concentration of humic acids up to 9.34 ng μL(-1). The inhibitory effect of paddy field soil extract on quantification of the archaeal 16S rRNA gene was also tested. By diluting the DNA extract, quantified copy numbers from real-time PCR and digital PCR became similar, indicating that dilution was a useful way to remedy PCR inhibition. The dilution strategy was, however, not applicable to all natural environmental samples. For example, when marine subsurface sediment samples were tested the copy number of archaeal 16S rRNA genes was 1.04×10(3) copies/g-sediment by digital PCR, whereas real-time PCR only resulted in 4.64×10(2) copies/g-sediment, which was most likely due to an inhibitory effect. The data from this study demonstrated that inhibitory substances had little effect on DNA quantification using microfluidics and digital PCR, and showed the great advantages of digital PCR in accurate quantifications of DNA extracted from various microbial habitats. Copyright © 2012 Elsevier GmbH. All rights reserved.