WorldWideScience

Sample records for rapid pcr approach

  1. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  2. A Rapid and High-Throughput Screening Approach for Methicillin-Resistant Staphylococcus aureus Based on the Combination of Two Different Real-Time PCR Assays

    Science.gov (United States)

    van Maarseveen, Noortje M.; van Hannen, Erik J.; van Zwet, Anton A.; Mascini, Ellen M.

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is an important pathogen that has been responsible for major nosocomial epidemics worldwide. For infection control programs, rapid and adequate detection of MRSA is of great importance. We developed a rapid and high-throughput molecular screening approach that consists of an overnight selective broth enrichment, followed by mecA, mecC, and S. aureus-specific (SA442 gene) real-time PCR assays, with subsequent confirmation using a staphylococcal cassette chromosome mec element (SCCmec)-orfX-based real-time PCR assay (GeneOhm MRSA assay) and culture. Here, the results of the screening approach over a 2-year period are presented. During this period, a total of 13,387 samples were analyzed for the presence of MRSA, 2.6% of which were reported as MRSA positive. No MRSA isolates carrying the mecC gene were detected during this study. Based on the results of the real-time PCR assays only, 95.2% of the samples could be reported as negative within 24 h. Furthermore, the performance of these real-time PCR assays was evaluated using a set of 104 assorted MRSA isolates, which demonstrated high sensitivity for both the combination of mecA and mecC with SA442 and the BD GeneOhm MRSA assay (98.1% and 97.1%, respectively). This molecular screening approach proved to be an accurate method for obtaining reliable negative results within 24 h after arrival at the laboratory and contributes to improvement of infection control programs, especially in areas with a low MRSA prevalence. PMID:24871220

  3. Real-time PCR followed by high-resolution melting curve analysis: A rapid and pragmatic approach for screening of multidrug-resistant extrapulmonary tuberculosis.

    Science.gov (United States)

    Sharma, Kusum; Sharma, Megha; Singh, Shreya; Modi, Manish; Sharma, Aman; Ray, Pallab; Varma, Subhash

    2017-09-01

    Multidrug resistance (MDR) in extrapulmonary tuberculosis (EPTB) is a diagnostic challenge in an endemic country like India. Timely detection of MDR-TB can contribute to a better patient outcome. To perform real-time PCR (qPCR) using rpoB, mpb64 and IS6110 gene on a variety of EPTB samples and to compare the performance of different gene targets. All qPCR positive samples were subjected to high resolution melt-curve analysis (HRM analysis) for rpoB and katG gene to evaluate its potential for MDR screening among different sample types. Real-time PCR using rpoB, mpb64 and IS6110 genes was carried out on 200 cases of study group and 100 cases of non-TB control group. The study group consisted of 100 culture-confirmed and 100 clinically suspected cases of EPTB. Phenotypic drug susceptibility testing (DST) for culture isolates was performed by the 1% indirect agar proportion method. DNA extracted from all qPCR positive samples was subjected to rpoB and katG HRM analysis for screening of MDR. Sequencing was used to confirm the results of HRM analysis and the results were also compared with phenotypic DST in all culture positive cases. The sensitivity of qPCR using rpoB, mpb64 and IS6110 was 86.5%, 86.5% and 76.5%, respectively. All isolates from the control group were negative by all the three targets, giving a specificity of 100%. HRM analysis detected MDR in 22/200 (11%) isolates. 3/200 (1.5%) had mono-rifampicin resistance while 8/200 (4%) had mono-isoniazid resistance. HRM analysis identified an additional 4 MDR cases directly from the samples which were negative by culture. On sequencing, mutations were observed at codon 531 (60%); 533 (16%); 516 (12%) and 526 (12%) of the rpoB gene and at codon 315 (100%) of the katG gene. There was 100% concordance in the results of phenotypic DST, HRM analysis and sequencing. The HRM analysis can play a promising role in the reliable and rapid screening of EPTB samples for detection of MDR. Copyright © 2017 Elsevier Ltd. All

  4. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSApositive samples, ...

  5. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  6. [Rapid detection of Shigella dysenteriae by PCR assay].

    Science.gov (United States)

    Chen, Hongyuan; Zhong, Qingping; Wang, Li; Sun, Yuanming

    2010-09-01

    Based on the invasive plasmid antigen H gene (ipaH) of S. dysenteriae, one pair of specific primers was designed for PCR assays in this study. The concentrations of dNTP, Mg2+ and primer, dosage of Taq DNA polymerase, annealing temperature and circulating parameter in the PCR amplification system were optimized. In this way, a rapid and stable method of PCR assay for the detection of S. dysenteriae was established. The specificity and sensitivity of PCR were also analyzed. The detection limits of pure culture and genomic DNA in the PCR assay were 1.06 x 10(2) cfu/ml and 106.34 pg/PCR system, respectively. The detection limit for S. dysenteriae in artificially contaminated food samples was 3.21 x 10(4) cfu/ml. These results indicated that the PCR method for S. dysenteriae detection was simple, rapid, high in specificity and sensitivity and suitable for the detection of pathogens in foods caused by Shigella dysenteriae.

  7. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  8. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  9. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16: 11141-11156. Fang H, Hedin G (2003). Rapid screening and identification of methicillin-resistant Staphylococcus aureus from clinical samples by selective-broth and real-time PCR assay.

  10. Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks

    DEFF Research Database (Denmark)

    Blixenkrone-Møller, Merete; Martella, Vito

    2007-01-01

    CDV is a highly contagious viral pathogen causing a lethal systemic disease in dogs and other carnivores. Several lineages or genotypes of CDV exist that are variously distributed throughout several continents. Legal or uncontrolled trading of animals may modify the epidemiology of CDV, introducing...... novel strains in CDV-naïve areas or accounting for the resurgence of CDV in areas where vaccine prophylaxis was effective and successful to control the disease. A hemi-nested PCR system was developed to genotype strains of the major CDV lineages, America-1, Europe, Asia-1, Asia-2 and Arctic. The assay...

  11. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  12. Rapid identification of Sporothrix schenckii in biopsy tissue by PCR.

    Science.gov (United States)

    Liu, X; Zhang, Z; Hou, B; Wang, D; Sun, T; Li, F; Wang, H; Han, S

    2013-12-01

    The dimorphic fungus Sporothrix schenckii is the etiological agent of sporotrichosis, an important cutaneous mycosis with a worldwide distribution. At present, it is challenging to rapidly discover and identify Sporothrix schenckii in biopsy tissues nowadays. To explore new methods for rapid diagnosis of sporotrichosis. We screened specific primers for Sporothrix schenckii using 50 clinical isolates from patients with sporotrichosis. DNA was extracted from the lesions of 30 cases of clinically suspected sporotrichosis using the Graham s method of CTAB and amplified by PCR using the screened specific primers. The primer S2-R2 was applicable for the identification of S. schenckii from different geographic areas and clinical types with high specificity and sensitivity. Twenty-five out of the thirty cases (83.3%) amplified using the primer S2-R2 showed positive bands. Further positive bands were observed in 95.6% of cases tested positive by fungal culture. Using the PCR technique and specific primers, we developed a new diagnostic method that can rapidly diagnose sporotrichosis with tissues obtained from clinical biopsies. © 2012 The Authors. Journal of the European Academy of Dermatology and Venereology © 2012 European Academy of Dermatology and Venereology.

  13. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis.

    Science.gov (United States)

    Webster, B L; Rollinson, D; Stothard, J R; Huyse, T

    2010-03-01

    Schistosoma haematobium and S. bovis are widespread schistosome species causing human and cattle schistosomiasis, respectively, in Africa. The sympatric occurrence of these two species and their ability to infect the same Bulinus intermediate snail hosts necessitates precise methods of identification of the larval stages. A rapid diagnostic 'mulitplex' one-step polymerase chain reaction protocol (RD-PCR) was developed using cytochrome oxidase subunit 1 (COX1) mitochondrial DNA (mtDNA) to discriminate between S. haematobium and S. bovis. A single forward primer and two species-specific reverse primers were used to produce a polymerase chain reaction (PCR) fragment of 306 bp and 543 bp for S. bovis and S. haematobium, respectively. Serial dilutions were carried out on various lifecycle stages and species combinations to test the sensitivity and specificity of the primers. This RD-PCR proved highly sensitive, detecting a single larval stage and as little as 0.78 ng of genomic DNA (gDNA) from an adult schistosome, providing a cost-effective, rapid and robust molecular tool for high-throughput screening of S. haematobium and S. bovis populations. In areas where human and cattle schistosomiasis overlap and are transmitted in close proximity, this mitochondrial assay will be a valuable identification tool for epidemiological studies, especially when used in conjunction with other nuclear diagnostic markers.

  14. Rapid sex determination using PCR technique compared to classic cytogenetics.

    Science.gov (United States)

    Settin, Ahmad; Elsobky, Ezzat; Hammad, Ayman; Al-Erany, Abeer

    2008-01-01

    Fetal sexual differentiation relies on the translation of chromosomal sex established at fertilization into gonadal sex and somatic sex as development proceeds. In cases where chromosomal, gonadal, and somatic sex are incongruent in human infants and children, rapid establishment of the diagnosis and implementation of medical and surgical management is of paramount importance, since the gender identity is so important to the psychological well-being throughout life. This work was done in order to test the value of PCR technique for rapid sex determination compared to classic cytogenetic technique. Subjects included 20, cases including 10 neonates with ambiguous genitalia, 2 adult females with delayed puberty and 8 adult males with infertility, in addition to 20 normal infants of both sexes as a control group. The diagnosis of sex was attempted through examination, cytogenetic study, ultrasonography, gonadal biopsy and hormonal analysis, in addition to PCR amplification for the detection of SRY and ATL1 gene loci on Y and X chromosomes respectively. Four neonates were diagnosed as partial testicular feminization showed both positive bands for the Y and X chromosomes and a karyogram of 46/XY. Three neonates were diagnosed as true hermaphrodites showed positive amplification for both Y and X chromosomes with a mosaic karyogram 46,XX/XY. Three neonates were diagnosed as cases of adrenogenital syndrome showed positive amplification of only the Xchromosome and had a karyogram of 46/XX. One of the two adult females was diagnosed as turner syndrome showed positive amplification of the X chromosome and a karyogram of 45/XO; the other one was diagnosed as complete testicular feminization had a positive amplification of X and Y chromosomes and a karyogram of 46/XY. The 8 adult males with infertility showed a positive amplification of X and Y chromosome and a karyogram of 47/XXY (Klinefelter syndrome) in 7 cases and 46/XY gonadal dysgenesis in one case. We concluded that PCR

  15. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    OpenAIRE

    Bi Yanzhen; Qiao Xianfeng; Hua Zaidong; Zhang Liping; Liu Ximei; Li Li; Hua Wenjun; Xiao Hongwei; Zhou Jingrong; Wei Qingxin; Zheng Xinmin

    2012-01-01

    Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to pr...

  16. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

    Science.gov (United States)

    Smith, Cindy J; Osborn, A Mark

    2009-01-01

    Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

  17. A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

    Directory of Open Access Journals (Sweden)

    Grace Wong

    Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

  18. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  19. Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

    Science.gov (United States)

    Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

    2015-01-01

    Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

  20. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  1. RUCS: rapid identification of PCR primers for unique core sequences.

    Science.gov (United States)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online.

  2. PCR-based rapid genotyping of Stenotrophomonas maltophilia isolates

    Directory of Open Access Journals (Sweden)

    Zarrilli Raffaele

    2008-11-01

    Full Text Available Abstract Background All bacterial genomes contain repetitive sequences which are members of specific DNA families. Such repeats may occur as single units, or found clustered in multiple copies in a head-to-tail configuration at specific loci. The number of clustered units per locus is a strain-defining parameter. Assessing the length variability of clusters of repeats is a versatile typing methodology known as multilocus variable number of tandem repeat analysis (MLVA. Results Stenotrophomonas maltophilia is an environmental bacterium increasingly involved in nosocomial infections and resistant to most antibiotics. The availability of the whole DNA sequence of the S. maltophilia strain K279a allowed us to set up fast and accurate PCR-based diagnostic protocols based on the measurement of length variations of loci carrying a variable number of short palindromic repeats marking the S. maltophilia genome. On the basis of the amplimers size, it was possible to deduce the number of repeats present at 12 different loci in a collection of S. maltophilia isolates, and therefore label each of them with a digit. PCR-negative regions were labelled 0. Co-amplification of two pairs of loci provided a 4-digit code sufficient for immediate subtyping. By increasing the number of loci analyzed, it should be possible to assign a more specific digit profile to isolates. In general, MLVA data match genotyping data obtained by PFGE (pulsed-field gel electrophoresis. However, some isolates exhibiting the same PCR profiles at all loci display distinct PFGE patterns. Conclusion The utilization of the present protocol allows to type several S. maltophilia isolates in hours. The results are immediately interpretable without the need for sophisticated softwares. The data can be easily reproducible, and compared among different laboratories.

  3. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  4. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  5. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy.

    Science.gov (United States)

    Bi, Yanzhen; Qiao, Xianfeng; Hua, Zaidong; Zhang, Liping; Liu, Ximei; Li, Li; Hua, Wenjun; Xiao, Hongwei; Zhou, Jingrong; Wei, Qingxin; Zheng, Xinmin

    2012-07-06

    Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to DNA engineering and gene functional

  6. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Science.gov (United States)

    Chan, Kamfai; Wong, Pui-Yan; Yu, Peter; Hardick, Justin; Wong, Kah-Yat; Wilson, Scott A; Wu, Tiffany; Hui, Zoe; Gaydos, Charlotte; Wong, Season S

    2016-01-01

    The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR) and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR), thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  7. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  8. Rapid detection and ruling out of neonatal sepsis by PCR coupled with Electrospray Ionization Mass Spectrometry (PCR/ESI-MS).

    Science.gov (United States)

    Delcò, Cristina; Karam, Oliver; Pfister, Riccardo; Gervaix, Alain; Renzi, Gesuele; Emonet, Stéphane; Schrenzel, Jacques; Posfay-Barbe, Klara M

    2017-05-01

    Sepsis is an important cause of morbidity and mortality in neonates and clinicians are typically required to administer empiric antibiotics while waiting for blood culture results. However, prolonged and inappropriate use of antibiotics is associated with various complications and adverse events. Better tools to rapidly rule out bacterial infections are therefore needed. We aimed to assess the negative predictive value of PCR coupled with Electrospray Ionization Mass Spectrometry (PCR/ESI-MS) compared to conventional blood cultures in neonatal sepsis. Prospective observational study. All consecutive neonates (PCR/ESI-MS analysis were collected at the same time as samples for the blood culture, before the initiation of antibiotics. Our primary objective was to evaluate the negative predictive value of PCR/ESI-MS for the detection of bacteria in the bloodstream of newborns with suspected sepsis. Our secondary objective was the evaluation of the sensitivity, specificity and positive predictive value of the PCR/ESI-MS in such a neonatal population. We analysed 114 samples over 14months. The median age and weight were 32weeks+3days and 1840g, respectively. Two patients had negative PCR/ESI-MS results, but positive blood cultures. Overall, the negative predictive value was 98% (95%CI: 92% to 100%). Based on these results, PCR/ESI-MS analysis of blood samples of neonates with suspected sepsis appears to have a very good negative predictive value when compared to blood cultures as gold standard. This novel test might allow for early reassessment of the need for antibiotics. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [Evaluation of the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for the detection of a novel influenza A (H1N1) virus].

    Science.gov (United States)

    Hwang, Yusun; Kim, Kyounghee; Lee, Miae

    2010-04-01

    In April 2009, a novel influenza A (H1N1) virus was detected in the US, and at the time of conducting this study, H1N1 infection had reached pandemic proportions. In Korea, rapid antigen tests and PCR assays have been developed to detect the H1N1 virus. We evaluated the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for detecting the H1N1 virus. From August to September 2009, we tested 734 samples obtained from nasopharyngeal swab or nasal swab using rapid antigen test (SD Influenza Antigen, Standard Diagnostics, Inc., Korea) and multiplex PCR (Seeplex FluA ACE Subtyping, Seegene, Korea). We also tested 224 samples using the AdvanSure real-time PCR (LG Life Sciences, Korea) to compare the results obtained using real-time PCR with those obtained using multiplex PCR. Furthermore, 99 samples were tested using the AdvanSure real-time PCR and the AccuPower real-time PCR (Bioneer, Korea). In comparison with the results of multiplex PCR, the sensitivity and specificity of the rapid antigen test were 48.0% and 99.8%, respectively. The concordance rate for multiplex PCR and the AdvanSure real-time PCR was 99.6% (kappa=0.991, P=0.000), and that for the AdvanSure real-time PCR and the AccuPower real-time PCR was 97.0% (kappa=0.936, P=0.000). The rapid antigen test is significantly less sensitive than PCR assay; therefore, it is not useful for H1N1 detection; however multiplex PCR, the AdvanSure real-time PCR, and the Accu-Power real-time PCR can be useful for H1N1 detection.

  10. Novel Multitarget Real-Time PCR Assay for Rapid Detection of Bordetella Species in Clinical Specimens ▿

    Science.gov (United States)

    Tatti, Kathleen M.; Sparks, Kansas N.; Boney, Kathryn O.; Tondella, Maria Lucia

    2011-01-01

    A novel multitarget real-time PCR (RT-PCR) assay for the rapid identification of Bordetella pertussis, B. parapertussis, and B. holmesii was developed using multicopy insertion sequences (ISs) in combination with the pertussis toxin subunit S1 (ptxS1) singleplex assay. The RT-PCR targets for the multiplex assay include IS481, commonly found in B. pertussis and B. holmesii; IS1001 of B. parapertussis; and the IS1001-like sequence of B. holmesii. Overall, 402 Bordetella species and 66 non-Bordetella species isolates were tested in the multitarget assay. Cross-reactivity was found only with 5 B. bronchiseptica isolates, which were positive with IS1001 of B. parapertussis. The lower limit of detection (LLOD) of the multiplex assay was similar to the LLOD of each target in an individual assay format, which was approximately 1 genomic equivalent per reaction for all targets. A total of 197 human clinical specimens obtained during cough-illness outbreak investigations were used to evaluate the multitarget RT-PCR assay. The multiplex assay results from 87 clinical specimens were compared to the individual RT-PCR assay and culture results. The multitarget assay is useful as a diagnostic tool to confirm B. pertussis infections and to rapidly identify other Bordetella species. In conclusion, the use of this multitarget RT-PCR approach increases specificity, while it decreases the amount of time, reagents, and specimen necessary for RT-PCRs used for accurate diagnosis of pertussis-like illness. PMID:21940464

  11. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  12. Rapid Identification of Measles Virus Vaccine Genotype by Real-Time PCR.

    Science.gov (United States)

    Roy, Felicia; Mendoza, Lillian; Hiebert, Joanne; McNall, Rebecca J; Bankamp, Bettina; Connolly, Sarah; Lüdde, Amy; Friedrich, Nicole; Mankertz, Annette; Rota, Paul A; Severini, Alberto

    2017-03-01

    During measles outbreaks, it is important to be able to rapidly distinguish between measles cases and vaccine reactions to avoid unnecessary outbreak response measures such as case isolation and contact investigations. We have developed a real-time reverse transcription-PCR (RT-PCR) method specific for genotype A measles virus (MeV) (MeVA RT-quantitative PCR [RT-qPCR]) that can identify measles vaccine strains rapidly, with high throughput, and without the need for sequencing to determine the genotype. We have evaluated the method independently in three measles reference laboratories using two platforms, the Roche LightCycler 480 system and the Applied Biosystems (ABI) 7500 real-time PCR system. In comparison to the standard real-time RT-PCR method, the MeVA RT-qPCR showed 99.5% specificity for genotype A and 94% sensitivity for both platforms. The new assay was able to detect RNA from five currently used vaccine strains, AIK-C, CAM-70, Edmonston-Zagreb, Moraten, and Shanghai-191. The MeVA RT-qPCR assay has been used successfully for measles surveillance in reference laboratories, and it could be readily deployed to national and subnational laboratories on a wide scale. Copyright © 2017 American Society for Microbiology.

  13. Gold Nanorod-based Photo-PCR System for One-Step, Rapid Detection of Bacteria.

    Science.gov (United States)

    Kim, Jinjoo; Kim, Hansol; Park, Ji Ho; Jon, Sangyong

    2017-01-01

    The polymerase chain reaction (PCR) has been an essential tool for diagnosis of infectious diseases, but conventional PCR still has some limitations with respect to applications to point-of-care (POC) diagnostic systems that require rapid detection and miniaturization. Here we report a light-based PCR method, termed as photo-PCR, which enables rapid detection of bacteria in a single step. In the photo-PCR system, poly(enthylene glycol)-modified gold nanorods (PEG-GNRs), used as a heat generator, are added into the PCR mixture, which is subsequently periodically irradiated with a 808-nm laser to create thermal cycling. Photo-PCR was able to significantly reduce overall thermal cycling time by integrating bacterial cell lysis and DNA amplification into a single step. Furthermore, when combined with KAPA2G fast polymerase and cooling system, the entire process of bacterial genomic DNA extraction and amplification was further shortened, highlighting the potential of photo-PCR for use in a portable, POC diagnostic system.

  14. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated...... to be especially convenient because the pre-mix containing all PCR reagents except for the bacterial cells could be kept at -20 degreesC for at least I month before its use. The optimized TaqMan((R)) real-time PCR assay is a useful, simple and rapid method for routine identification of Salmonella spp...

  15. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  16. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    OpenAIRE

    Nelly eDatukishvili; Tamara eKutateladze; Inga eGabriadze; Kakha eBitskinashvili; Boris eVishnepolsky

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of C...

  17. SCAR makers and multiplex PCR-based rapid molecular typing of Lentinula edodes strains.

    Science.gov (United States)

    Wu, Xueqian; Li, Haibo; Zhao, Weiwei; Fu, Lizhong; Peng, Huazheng; He, Liang; Cheng, Junwen; Wei, Hailong; Wu, Qingqi

    2010-11-01

    Lentinula edodes is the second most important cultivated mushroom worldwide, the most commercial strains have been identified only through traditional phenotypic analysis. In this study, a simple rapid PCR-based molecular method was developed for distinguishing commercial strains of L. edodes by developing specific sequence characterized amplified region (SCAR) markers and establishing multiplex PCR assays with the SCAR primers. Derived from the randomly amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) techniques, 10 informative SCAR markers were generated from 10 polymorphic RAPD and SRAP bands. The differences in SCAR phenotypes among different strains made these SCAR markers potentially useful to characterize 6 strains and identify them from other studied strains. Moreover, different SCAR phenotypes also made the other 17 studied strains to be divided into four distinguishable groups. The multiplex PCR assays were further established for the joint use of some SCAR markers efficiently. Compared with some identification methods reported previously, the special feature of this new molecular method is technically rapid and convenient in the practical use and suitable for analyzing large numbers of samples. Thus, the simple rapid PCR-based molecular method can be used as a helpful assistant tool for the lentinula industry. To our knowledge, this study is the first to describe a development of a new SCAR maker-based multiplex PCR assay for rapid molecular typing of edible mushroom.

  18. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  19. Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

    Directory of Open Access Journals (Sweden)

    Martin Stofanko

    2013-01-01

    Full Text Available Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations.

  20. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-02-07

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  2. Rapid Diagnosis of Azole-Resistant Aspergillosis by Direct PCR Using Tissue Specimens

    NARCIS (Netherlands)

    van der Linden, Jan W. M.; Snelders, Eveline; Arends, Jan P.; Daenen, Simon M.; Melchers, Willem J. G.; Verweij, Paul E.

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  3. Rapid diagnosis of azole-resistant aspergillosis by direct PCR using tissue specimens.

    NARCIS (Netherlands)

    Linden, J.W.M. van der; Snelders, E.; Arends, J.P.; Daenen, S.M.G.J.; Melchers, W.J.G.; Verweij, P.E.

    2010-01-01

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  4. A duplex PCR for rapid and simultaneous detection of Brucella spp. in human blood samples.

    Science.gov (United States)

    Mirnejad, Reza; Mohamadi, Mozafar; Piranfar, Vahbeh; Mortazavi, Seied Mojtaba; Kachuei, Reza

    2013-06-01

    To design a duplex PCR for rapid and simultaneous detection of Brucella species. in human blood samples. Fifty-two peripheral bloods samples were collected from suspicious patients with brucellosis. Following DNA extraction, PCR assay were performed, using three primers that could simultaneously identify and differentiate three major species of pathogenic Brucella in humans and animals. Of the 52 peripheral bloods samples tested, 25 sample (48%) showed positive reactions in PCR. Twelve samples were positive for Brucella abortus 39 (B. abortus 39) (23%), 13 for Brucella melitensis 39 (B. melitensis 39) (25%) and 0 for Brucella ovis 39 (B. ovis 39) (0%). This work demonstrates that in case where specific primers were utilized, duplex PCR has proved to be a simple, fast, and relatively inexpensive method for simultaneous detection of important species of Brucella in clinical samples. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  5. PCR

    African Journals Online (AJOL)

    sunny

    (5'-. MGATAAGRTGTAATCCW-3') and. (5'-. TGGAAGCCATCATCGACGAAGCCAT-3') were designed to amplify a new partial rbcS gene by PCR. About 400 bp DNA fragment was obtained by PCR. This DNA fragment was cloned into the pMD18-T vector. (TakaRa) for sequencing. Sequence analysis of this DNA fragment.

  6. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  7. Real-time PCR for rapidly detecting aniline-degrading bacteria in activated sludge.

    Science.gov (United States)

    Kayashima, Takakazu; Suzuki, Hisako; Maeda, Toshinari; Ogawa, Hiroaki I

    2013-05-01

    We developed a detection method that uses quantitative real-time PCR (qPCR) and the TaqMan system to easily and rapidly assess the population of aniline-degrading bacteria in activated sludge prior to conducting a biodegradability test on a chemical compound. A primer and probe set for qPCR was designed by a multiple alignment of conserved amino acid sequences encoding the large (α) subunit of aniline dioxygenase. PCR amplification tests showed that the designed primer and probe set targeted aniline-degrading strains such as Acidovorax sp., Gordonia sp., Rhodococcus sp., and Pseudomonas putida, thereby suggesting that the developed method can detect a wide variety of aniline-degrading bacteria. There was a strong correlation between the relative copy number of the α-aniline dioxygenase gene in activated sludge obtained with the developed qPCR method and the number of aniline-degrading bacteria measured by the Most Probable Number method, which is the conventional method, and a good correlation with the lag time of the BOD curve for aniline degradation produced by the biodegradability test in activated sludge samples collected from eight different wastewater treatment plants in Japan. The developed method will be valuable for the rapid and accurate evaluation of the activity of inocula prior to conducting a ready biodegradability test. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. PCR

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... The overall prevalence of human cytomegalovirus (HCMV) infection in 16 ... Key words: Cytomegalovirus, PCR, human cytomegalovirus (HCMV) and ELISA. .... McGeoch DJ, Hayward GS (2003). The human cytomegalovirus genome revisited: Comparison with the chimpanzee cytomegalovirus genome.

  9. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  10. Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method.

    Science.gov (United States)

    Nihonyanagi, Shin; Kanoh, Yuhsaku; Okada, Kiyomi; Uozumi, Toshiki; Kazuyama, Yukumasa; Yamaguchi, Tokiko; Nakazaki, Nobuhiko; Sakurai, Keizou; Hirata, Yasuyoshi; Munekata, Shinichi; Ohtani, Shinichi; Takemoto, Tsuyoshi; Bandoh, Yuki; Akahoshi, Tohru

    2012-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) with exogenous cassette DNA containing the methicillin-resistant gene mecA (SCCmec) poses a problem as a drug-resistant bacterium responsible for hospital- and community-acquired infections. The frequency of MRSA detection has recently been increasing rapidly in Japan, and SCCmec has also been classified more diversely into types I-V. A rapid test is essential for early diagnosis and treatment of MRSA infections, but detection by conventional methods requires at least two days. The newly developed multiplex PCR lateral flow method allows specific amplification of femA to detect S. aureus, mecA to detect SCCmec, and kdpC to detect SCCmec type II; moreover, PCR products can be evaluated visually in about 3 h. In the present study, we developed a PCR lateral flow method for MRSA using this method and investigated its clinical usefulness in the detection of MRSA. The results showed a diagnostic concordance rate of 91.7% for MRSA and methicillin-susceptible S. aureus between bacteriological examination and PCR lateral flow, and a high level of specificity in PCR lateral flow. In addition, a higher detection rate for S. aureus using the same sample was observed for PCR lateral flow (70.2%) than for bacteriological tests (48.6%). The above results show that PCR lateral flow for MRSA detection has high sensitivity, specificity, and speed, and its clinical application as a method for early diagnosis of MRSA infections appears to be feasible.

  11. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  12. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  13. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  14. Development of multiplex-PCR assay for rapid detection of Candida spp.

    Directory of Open Access Journals (Sweden)

    Ni Made A. Tarini

    2010-05-01

    Full Text Available Aim Candida spp. infection commonly occur in immunocompromised patients. Biochemical assay for identification of Candida spp. is time-consuming and shows many undetermined results. Specific detection for antibody, antigen and metabolites of Candida spp. had low sensitivity and specificity. In this study, we developed a rapid diagnostic method, Multiplex-PCR, to identify Candida spp.Methods Five Candida spp. isolates were cultured, identifi ed with germ tube and API® 20 C AUX (BioMerieux® SA kit. Furthermore, DNA was purified by QIAamp DNA mini (Qiagen® kit for Multiplex-PCR assay.Results DNA detection limit by Multiplex-PCR assays for C. albicans, C. tropicalis, C. parapsilosis, C. krusei and C. glabrata were 4 pg, 0.98 pg, 0.98 pg, 0.5 pg and 16 pg respectively. This assay was also more sensitive than culture in that Multiplex-PCR could detect 2.6-2.9 x 100 CFU/ml, whereas culture 2.6-2.9 x 102 CFU/ml.Conclusion Multiplex-PCR is much more sensitive than culture and thus, can be recommended as a sensitive and specific assay for identification of Candida spp. (Med J Indones 2010; 19:83-7Keywords: Candida spp., multiplex-PCR

  15. Development of a Multiplex PCR Assay for Rapid Molecular Serotyping of Haemophilus parasuis

    Science.gov (United States)

    Peters, Sarah E.; Wang, Jinhong; Hernandez-Garcia, Juan; Weinert, Lucy A.; Luan, Shi-Lu; Chaudhuri, Roy R.; Angen, Øystein; Aragon, Virginia; Williamson, Susanna M.; Langford, Paul R.; Rycroft, Andrew N.; Wren, Brendan W.; Maskell, Duncan J.; Tucker, Alexander W.

    2015-01-01

    Haemophilus parasuis causes Glässer's disease and pneumonia in pigs. Indirect hemagglutination (IHA) is typically used to serotype this bacterium, distinguishing 15 serovars with some nontypeable isolates. The capsule loci of the 15 reference strains have been annotated, and significant genetic variation was identified between serovars, with the exception of serovars 5 and 12. A capsule locus and in silico serovar were identified for all but two nontypeable isolates in our collection of >200 isolates. Here, we describe the development of a multiplex PCR, based on variation within the capsule loci of the 15 serovars of H. parasuis, for rapid molecular serotyping. The multiplex PCR (mPCR) distinguished between all previously described serovars except 5 and 12, which were detected by the same pair of primers. The detection limit of the mPCR was 4.29 × 105 ng/μl bacterial genomic DNA, and high specificity was indicated by the absence of reactivity against closely related commensal Pasteurellaceae and other bacterial pathogens of pigs. A subset of 150 isolates from a previously sequenced H. parasuis collection was used to validate the mPCR with 100% accuracy compared to the in silico results. In addition, the two in silico-nontypeable isolates were typeable using the mPCR. A further 84 isolates were analyzed by mPCR and compared to the IHA serotyping results with 90% concordance (excluding those that were nontypeable by IHA). The mPCR was faster, more sensitive, and more specific than IHA, enabling the differentiation of 14 of the 15 serovars of H. parasuis. PMID:26424843

  16. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  17. Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2009-01-01

    Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

  18. Multiplex Solid-Phase PCR for Rapid Detection and Identification of Salmonella spp. at Sub-species

    DEFF Research Database (Denmark)

    Cao, Cuong; Høgberg, Jonas; Wolff, Anders

    -PCR gel electrophoresis. The method will be useful for development of point-of-care devices for rapid detection and identification of Salmonella spp. A solid-phase PCR for rapid detection and identification of S. enteritidis, S. typhimurium and S. dublin is developed. The method offers advantages......This study presents a solid-phase PCR (SP-PCR) for rapid detection, identification, and sub-typing of various Salmonella species, the major food-borne cause of salmonellosis. The target DNA is firstly amplified with PCR primers (one primer is labeled with fluorophores) in the liquid phase...... by the liquid phase primer thus generating new templates for the SP-PCR. After the reaction, PCR products labeled with fluorophores remain attached to the substrate and can be visualized directly by fluorescence readout devices. Using this method, S. enteritidis, S. typhimurium and S. dublin can be detected...

  19. Single-step blood direct PCR: A robust and rapid method to diagnose triplet repeat disorders.

    Science.gov (United States)

    Singh, Inder; Swarup, Vishnu; Shakya, Sunil; Goyal, Vinay; Faruq, Mohammed; Srivastava, Achal Kumar

    2017-08-15

    DNA extraction prior to polymerase chain reaction (PCR) amplification in genetic diagnoses of triplet repeat disorders (TRDs) is tedious and labour-intensive and has the limitations of sample contamination with foreign DNA, including that from preceding samples. Therefore, we aimed to develop a rapid, robust, and cost-effective method for expeditious genetic investigation of TRDs from whole blood as a DNA template. Peripheral blood samples were collected from 70 clinically suspected patients of progressive ataxia. The conventional method using genomic DNA and single-step Blood-Direct PCR (BD-PCR) method with just 2μl of whole blood sample were tested to amplify triplet repeat expansion in genes related to spinocerebellar ataxia (SCA) types 1, 2, 3, 12 and Friedreich's ataxia (FRDA). Post-PCR, the allele sizes were mapped and repeat numbers were calculated using GeneMapper and macros run in Microsoft Excel programmes. Successful amplification of target regions was achieved in all samples by both methods. The frequency of the normal and mutated allele was concordant between both methods, diagnosing 37% positive for a mutation in either of the candidate genes. The BD-PCR resulted in higher intensities of product peaks of normal and pathogenic alleles. The nearly-accurate sizing of the normal and expanded allele was achieved in a shorter time (4-5h), without DNA extraction and any risk of cross contamination, which suggests the BD-PCR to be a reliable, inexpensive, and rapid method to confirm TRDs. This technique can be introduced in routine diagnostic procedures of other tandem repeat disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Rapid Molecular Detection of Multidrug-Resistant Tuberculosis by PCR-Nucleic Acid Lateral Flow Immunoassay

    Science.gov (United States)

    Kamphee, Hatairat; Chaiprasert, Angkana; Prammananan, Therdsak; Wiriyachaiporn, Natpapas; Kanchanatavee, Airin; Dharakul, Tararaj

    2015-01-01

    Several existing molecular tests for multidrug-resistant tuberculosis (MDR-TB) are limited by complexity and cost, hindering their widespread application. The objective of this proof of concept study was to develop a simple Nucleic Acid Lateral Flow (NALF) immunoassay as a potential diagnostic alternative, to complement conventional PCR, for the rapid molecular detection of MDR-TB. The NALF device was designed using antibodies for the indirect detection of labeled PCR amplification products. Multiplex PCR was optimized to permit the simultaneous detection of the drug resistant determining mutations in the 81-bp hot spot region of the rpoB gene (rifampicin resistance), while semi-nested PCR was optimized for the S315T mutation detection in the katG gene (isoniazid resistance). The amplification process additionally targeted a conserved region of the genes as Mycobacterium tuberculosis (Mtb) DNA control. The optimized conditions were validated with the H37Rv wild-type (WT) Mtb isolate and Mtb isolates with known mutations (MT) within the rpoB and katG genes. Results indicate the correct identification of WT (drug susceptible) and MT (drug resistant) Mtb isolates, with the least limit of detection (LOD) being 104 genomic copies per PCR reaction. NALF is a simple, rapid and low-cost device suitable for low resource settings where conventional PCR is already employed on a regular basis. Moreover, the use of antibody-based NALF to target primer-labels, without the requirement for DNA hybridization, renders the device generic, which could easily be adapted for the molecular diagnosis of other infectious and non-infectious diseases requiring nucleic acid detection. PMID:26355296

  1. Rapid Molecular Detection of Multidrug-Resistant Tuberculosis by PCR-Nucleic Acid Lateral Flow Immunoassay.

    Directory of Open Access Journals (Sweden)

    Hatairat Kamphee

    Full Text Available Several existing molecular tests for multidrug-resistant tuberculosis (MDR-TB are limited by complexity and cost, hindering their widespread application. The objective of this proof of concept study was to develop a simple Nucleic Acid Lateral Flow (NALF immunoassay as a potential diagnostic alternative, to complement conventional PCR, for the rapid molecular detection of MDR-TB. The NALF device was designed using antibodies for the indirect detection of labeled PCR amplification products. Multiplex PCR was optimized to permit the simultaneous detection of the drug resistant determining mutations in the 81-bp hot spot region of the rpoB gene (rifampicin resistance, while semi-nested PCR was optimized for the S315T mutation detection in the katG gene (isoniazid resistance. The amplification process additionally targeted a conserved region of the genes as Mycobacterium tuberculosis (Mtb DNA control. The optimized conditions were validated with the H37Rv wild-type (WT Mtb isolate and Mtb isolates with known mutations (MT within the rpoB and katG genes. Results indicate the correct identification of WT (drug susceptible and MT (drug resistant Mtb isolates, with the least limit of detection (LOD being 104 genomic copies per PCR reaction. NALF is a simple, rapid and low-cost device suitable for low resource settings where conventional PCR is already employed on a regular basis. Moreover, the use of antibody-based NALF to target primer-labels, without the requirement for DNA hybridization, renders the device generic, which could easily be adapted for the molecular diagnosis of other infectious and non-infectious diseases requiring nucleic acid detection.

  2. Rapid method for simulating gas spectra using reversed PCR temperature calibration models based on Hitran data

    DEFF Research Database (Denmark)

    Bak, J.

    1999-01-01

    A computer program was produced to make rapid simulations of CO gas spectra at a spectral resolution of 1 cm(-1) and at temperatures ranging from 295 to 845 K and concentrations from 5 to 400 mg/m(3). The program is based on loadings and scores from three principal component regression (PCR) temp...... a uniform slab of gas at various temperatures, concentrations, and pathlengths. The gain in speed of the calculations of the spectra is based on the fact that the PCR models include mathematical pretreatments and compress the data effectively.......A computer program was produced to make rapid simulations of CO gas spectra at a spectral resolution of 1 cm(-1) and at temperatures ranging from 295 to 845 K and concentrations from 5 to 400 mg/m(3). The program is based on loadings and scores from three principal component regression (PCR......) temperature calibration models. Three sets of 12 Hitran-simulated high-density spectra, each set spanning the entire temperature range at constant concentrations (50, 150, and 300 mg/m(3)), were used as calibration spectra in the PCR temperature models. All the spectra were convoluted with a sine...

  3. Real-time PCR TaqMan assay for rapid screening of bloodstream infection

    Science.gov (United States)

    2014-01-01

    Background Sepsis is one of the main causes of mortality and morbidity. The rapid detection of pathogens in blood of septic patients is essential for adequate antimicrobial therapy and better prognosis. This study aimed to accelerate the detection and discrimination of Gram-positive (GP) and Gram-negative (GN) bacteria and Candida species in blood culture samples by molecular methods. Methods The Real-GP®, -GN®, and -CAN® real-time PCR kit (M&D, Wonju, Republic of Korea) assays use the TaqMan probes for detecting pan-GP, pan-GN, and pan-Candida species, respectively. The diagnostic performances of the real-time PCR kits were evaluated with 115 clinical isolates, 256 positive and 200 negative blood culture bottle samples, and the data were compared to results obtained from conventional blood culture. Results Eighty-seven reference strains and 115 clinical isolates were correctly identified with specific probes corresponding to GP-bacteria, GN-bacteria and Candida, respectively. The overall sensitivity and specificity of the real-time PCR kit with blood culture samples were 99.6% and 89.5%, respectively. Conclusions The Real-GP®, -GN®, and -CAN® real-time PCR kits could be useful tools for the rapid and accurate screening of bloodstream infections (BSIs). PMID:24393579

  4. Real-time PCR assay for rapid qualitative and quantitative detection of Entamoeba histolytica.

    Science.gov (United States)

    Orosz, Erika; Perkátai, Katalin; Kapusinszky, Beatrix; Farkas, Agnes; Kucsera, István

    2012-12-01

    Simple real-time PCR assay with one set of primer and probe for rapid, sensitive qualitative and quantitative detection of Entamoeba histolytica has been used. Consensus sequences were used to amplify a species-specific region of the 16S rRNA gene, and fluorescence resonance energy transfer hybridization probes were used for detection in a LightCycler platform (Roche). The anchor probe sequence was designed to be a perfect match for the 16S rRNA gene of Entamoeba species, while the acceptor probe sequence was designed for Entamoeba histolytica, which allowed differentiation. The performed characteristics of the real-time PCR assay were compared with ELISA antigen and microscopical detection from 77 samples of individuals with suspected clinical diagnosis of imported E. histolytica infection. Stool and liver abscess pus samples were examined with analytical sensitivity of 5 parasites per PCR reaction. The melting curve means Tms (standard deviation) in clinical isolates were 54°C. The real-time assay was 100% sensitive and specific for differentiation of Entamoeba histolytica, compared with conventional ELISA or microscopy. This real-time PCR assay with melting curve analysis is rapid, and specific for the detection and differentiation of Entamoeba histolytica. The suitability for routine use of this assay in clinical diagnostic laboratories is discussed.

  5. Rapid detection of Listeria monocytogenes in food using culture enrichment combined with real-time PCR.

    Science.gov (United States)

    O'Grady, Justin; Ruttledge, Margaret; Sedano-Balbás, Sara; Smith, Terry J; Barry, Thomas; Maher, Majella

    2009-02-01

    A rapid method for the detection of Listeria monocytogenes in foods combining culture enrichment and real-time PCR was compared to the ISO 11290-1 standard method. The culture enrichment component of the rapid method is based on the ISO standard and includes 24h incubation in half-Fraser broth, 4h incubation in Fraser broth followed by DNA extraction and real-time PCR detection of the ssrA gene of L. monocytogenes. An internal amplification control, which is co-amplified with the same primers as the L. monocytogenes DNA, was also included in the assay. The method has a limit of detection of 1-5CFU/25g food sample and can be performed in 2 working days compared to up to 7days for the ISO standard. A variety of food samples from retail outlets and food processing plants (n=175) and controls (n=31) were tested using rapid and conventional methods. The rapid method was 99.44% specific, 96.15% sensitive and 99.03% accurate when compared to the standard method. This method has the potential to be used as an alternative to the standard method for food quality assurance providing rapid detection of L. monocytogenes in food.

  6. Investigation of QF-PCR Application for Rapid Prenatal Diagnosis of Chromosomal Aneuploidies in Iranian Population.

    Science.gov (United States)

    Nasiri, Habib; Noori-Dalooi, Mohammad-Reza; Dastan, Jila; Ghaffari, Saeed-Reza

    2011-03-01

    G-Banding followed by standard chromosome analysis is routinely used for prenatal detection of chromosomal abnormalities. In recent years, molecular cytogenetic techniques have been developed for rapid diagnosis of chromosomal abnormalities. Among these methods Quantitative Florescence Polymerase Chain Reaction (QF-PCR) has been widely used for this purpose. Heterozygosity of short tandem repeat (STR) markers which leads to informativity is the most critical requirement for feasibility of QF-PCR. In this study we analyzed several short tandem repeats on chromosomes 13, 18, 21, X and Y on amniotic fluid samples obtained from PND candidates to diagnose conditions such as Down, Edward and Patau syndromes and also numerical sex chromosome abnormalities such as Klinefelter and Turner syndromes. Most of the analyzed STRs had acceptable heterozygosity (66.3-94.7) to be used in QF-PCR based prenatal diagnosis. Moreover, results obtained from both methods (standard karyotype and QF-PCR) for all samples were in accordance with each other. In case of using appropriate STR markers, and in certain clinical indications, QF-PCR could be used as useful technique for prenatal diagnosis even in consanguine populations such as Iranians.

  7. Rapid multiplex PCR assay to identify respiratory viral pathogens: moving forward diagnosing the common cold.

    Science.gov (United States)

    Layman, Clifton P; Gordon, Sarah M; Elegino-Steffens, Diane U; Agee, Willie; Barnhill, Jason; Hsue, Gunther

    2013-09-01

    Upper respiratory tract infections (URIs) can be a serious burden to the healthcare system. The majority of URIs are viral in etiology, but definitive diagnosis can prove difficult due to frequently overlapping clinical presentations of viral and bacterial infections, and the variable sensitivity, and lengthy turn-around time of viral culture. We tested new automated nested multiplex PCR technology, the FilmArray(®) system, in the TAMC department of clinical investigations, to determine the feasibility of replacing the standard viral culture with a rapid turn-around system. We conducted a feasibility study using a single-blinded comparison study, comparing PCR results with archived viral culture results from a convenience sample of cryopreserved archived nasopharyngeal swabs from acutely ill ED patients who presented with complaints of URI symptoms. A total of 61 archived samples were processed. Viral culture had previously identified 31 positive specimens from these samples. The automated nested multiplex PCR detected 38 positive samples. In total, PCR was 94.5% concordant with the previously positive viral culture results. However, PCR was only 63.4% concordant with the negative viral culture results, owing to PCR detection of 11 additional viral pathogens not recovered on viral culture. The average time to process a sample was 75 minutes. We determined that an automated nested multiplex PCR is a feasible alternative to viral culture in an acute clinical setting. We were able to detect at least 94.5% as many viral pathogens as viral culture is able to identify, with a faster turn-around time.

  8. Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

    Science.gov (United States)

    Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

    2017-05-01

    Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

  9. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    Endemic of avian influenza virus (AIV) in Asia and epizootics in some European regions have caused considerable public concern on a possible pandemic of AIV. A rapid method for virus detection and effective surveillance in wild avian, poultry production as well as in humans is required....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  10. Rapid detection of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromona gingivalis by multiplex PCR.

    Science.gov (United States)

    García, L; Tercero, J C; Legido, B; Ramos, J A; Alemany, J; Sanz, M

    1998-01-01

    The identification of specific periodontal pathogens by conventional methods, mainly anaerobic cultivation, is difficult, time consuming and even sometimes unreliable. Therefore, a multiplex PCR method for simultaneous detection of Actinobacillus actinomycetemcomitans (A.a.), Porphyromona gingivalis (P.g.) and Prevotella intermedia (P.i.) was developed for rapid and easy identification of these specific bacterial pathogens in subgingival plaque samples. In this paper, there is a detailed description of the oligonucleotide primer selection, DNA extraction and PCR conditions and the sequencing of the amplified products. The locus chosen to be amplified is a highly variable region in the 16S ribosomal DNA. For the development of this technique ATCC cultures and pure cultures from subgingival plaque samples taken from periodontitis patients were used. As an internal positive control a recombinant plasmid was developed. This simple DNA extraction procedure and the DNA amplification and visualization of the amplified product permits the detection of the bacteria in a working day. Thus, this multiplex PCR method is a rapid and effective detection method for specific periodontal pathogens.

  11. Rapid identification and differentiation of Saccharomyces cerevisiae, Saccharomyces bayanus and their hybrids by multiplex PCR.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Malacrinò, P; Suzzi, G; Dellaglio, F

    2004-01-01

    To develop a multiplex PCR assay for the specific identification and differentiation of Saccharomyces cerevisiae, S. bayanus and their hybrids. Two sets of primers with sequences complementary to the region YBR033w were used. A single amplicon of 1710 bp or 329 bp was obtained with species S. cerevisiae and S. bayanus, respectively, while the presence of both bands was observed in S. pastorianus because of its hybrid nature. Both amplification products were also obtained after amplification from DNA of several laboratory S. cerevisiae x S. bayanus hybrid strains. Multiplex PCR was optimized for the rapid and reliable identification of S. cerevisiae, S. bayanus and their hybrids. The procedure may be used for routine detection of the most common Saccharomyces sensu stricto yeasts involved in industrial fermentation processes, overcoming the problems of conventional techniques.

  12. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis.

    Science.gov (United States)

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; Garcia, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; Hermoso de Mendoza, Javier

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was used to evaluate clinical samples collected from naturally infected animals with D. congolensis. The results showed that this assay is a fast and reliable method for diagnosing dermatophilosis.

  13. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis

    OpenAIRE

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; García, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; de Mendoza, Javier Hermoso

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was ...

  14. Rapid and sensitive detection of salmonid alphavirus using TaqMan real-time PCR.

    Science.gov (United States)

    Shi, Wen; Song, Aochen; Gao, Shuai; Wang, Yuting; Tang, Lijie; Xu, Yigang; Ren, Tong; Li, Yijing; Liu, Min

    2017-08-01

    Salmonid alphavirus (SAV) infection has led to the spread of salmon pancreas disease (PD) and sleeping disease (SD) to salmonids in several countries in Europe, resulting in tremendous economic losses to the fish farming industry. Recently, with increases in the fish import trade, many countries in which SAV has been unreported, such as China, may be seriously threatened by these diseases. It is therefore necessary to develop efficient detection methods for the prevention and diagnosis of SAV infection. In this study, a rapid and sensitive TaqMan real-time PCR method was established and assessed for this purpose. A specificity assay showed no cross-reactions with other common RNA viruses. Regression analysis and standard curves calculated from the Ct values of 10-fold serial dilutions of the standard plasmid showed that the assay was highly reproducible over a wide range of RNA input concentrations. The real-time PCR assay was able to detect SAV at a concentration as low as 1.5 × 10 1 copies, indicating that it is 10 7 times more sensitive than the approved conventional RT-PCR method (detection limit, 1.5 × 10 7 copies) after use on the same samples. Assessment of infected fish samples showed that this assay has a higher sensitivity than the previously reported Q_nsP1 assay. Thus, this TaqMan real-time PCR assay provides a rapid, sensitive, and specific detection method for SAV, offering improved technical support for the clinical diagnosis and epidemiology of SAV. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

    Science.gov (United States)

    Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

    2010-04-01

    Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

  16. Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR

    Science.gov (United States)

    Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich

    2012-06-01

    To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.

  17. Rapid Preclinical Detection of Sheeppox Virus by a Real-Time PCR Assay▿

    Science.gov (United States)

    Balinsky, C. A.; Delhon, G.; Smoliga, G.; Prarat, M.; French, R. A.; Geary, S. J.; Rock, D. L.; Rodriguez, L. L.

    2008-01-01

    Sheeppox virus (SPPV) is a member of the Capripoxvirus (CaPV) genus of the Poxviridae family. Members of this genus, which also include goatpox and lumpy skin disease viruses, cause economically significant disease in sheep, goats, and cattle. A rapid diagnostic assay for CaPV would be useful for disease surveillance as well as for detection of CaPV in clinical samples and for outbreak management. Here we describe a fluorogenic probe hydrolysis (TaqMan) PCR assay designed for rapid detection of CaPV and tested on sheep experimentally infected with a virulent strain of SPPV. This assay can detect SPPV in buffy coats, nasal swabs, oral swabs, scabs, and skin lesions as well as in lung and lymph nodes collected at necropsy. This single-tube diagnostic assay can be performed in 2 h or less and can detect viral DNA in preclinical, clinical, and postmortem samples. PMID:18032617

  18. Rapid preclinical detection of sheeppox virus by a real-time PCR assay.

    Science.gov (United States)

    Balinsky, C A; Delhon, G; Smoliga, G; Prarat, M; French, R A; Geary, S J; Rock, D L; Rodriguez, L L

    2008-02-01

    Sheeppox virus (SPPV) is a member of the Capripoxvirus (CaPV) genus of the Poxviridae family. Members of this genus, which also include goatpox and lumpy skin disease viruses, cause economically significant disease in sheep, goats, and cattle. A rapid diagnostic assay for CaPV would be useful for disease surveillance as well as for detection of CaPV in clinical samples and for outbreak management. Here we describe a fluorogenic probe hydrolysis (TaqMan) PCR assay designed for rapid detection of CaPV and tested on sheep experimentally infected with a virulent strain of SPPV. This assay can detect SPPV in buffy coats, nasal swabs, oral swabs, scabs, and skin lesions as well as in lung and lymph nodes collected at necropsy. This single-tube diagnostic assay can be performed in 2 h or less and can detect viral DNA in preclinical, clinical, and postmortem samples.

  19. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs

    National Research Council Canada - National Science Library

    Rajkhowa, S

    2015-01-01

    Significance and Impact of the Study: The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs...

  20. The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

    Science.gov (United States)

    Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

    2015-01-01

    Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

  1. Rapid and high-throughput pan-Orthopoxvirus detection and identification using PCR and mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Mark W Eshoo

    2009-07-01

    Full Text Available The genus Orthopoxvirus contains several species of related viruses, including the causative agent of smallpox (Variola virus. In addition to smallpox, several other members of the genus are capable of causing human infection, including monkeypox, cowpox, and other zoonotic rodent-borne poxviruses. Therefore, a single assay that can accurately identify all orthopoxviruses could provide a valuable tool for rapid broad orthopovirus identification. We have developed a pan-Orthopoxvirus assay for identification of all members of the genus based on four PCR reactions targeting Orthopoxvirus DNA and RNA helicase and polymerase genes. The amplicons are detected using electrospray ionization-mass spectrometry (PCR/ESI-MS on the Ibis T5000 system. We demonstrate that the assay can detect and identify a diverse collection of orthopoxviruses, provide sub-species information and characterize viruses from the blood of rabbitpox infected rabbits. The assay is sensitive at the stochastic limit of PCR and detected virus in blood containing approximately six plaque-forming units per milliliter from a rabbitpox virus-infected rabbit.

  2. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples.

    Science.gov (United States)

    Antikainen, J; Tarkka, E; Haukka, K; Siitonen, A; Vaara, M; Kirveskari, J

    2009-08-01

    A rapid 16-plex polymerase chain reaction (PCR) suitable for routine diagnostics of diarrheagenic Escherichia coli (EHEC, EIEC, EAEC, ETEC, and EPEC) was developed, validated with control strains, and tested with 250 diarrhoeal stool samples. The specificity was 100% when tested with 289 control bacterial strains, and the analytical sensitivity of automated DNA extraction directly from stool samples was made by boiling the bacterial culture (10(4)-10(5) colony forming units/ml). The assay design starting directly from extraction of stool DNA allowed same day analysis without compromising sensitivity and specificity, which makes it superior compared to PCR after culturing the bacteria. The 16-plex PCR method demonstrated high prevalence of diarrheagenic E. coli in stool samples of patients returning from abroad (39.0%) in contrast to the patients with no travel history (8.7%; p < 0.001). The high prevalence of diarrheagenic E. coli suggests that their screening should be part of normal diarrhoea diagnostics, at least in the leading diagnostic laboratories.

  3. Rapid PCR-based assay for Sclerotinia sclerotiorum detection on soybean seeds

    Directory of Open Access Journals (Sweden)

    Edilaine Mauricia Gelinski Grabicoski

    2015-02-01

    Full Text Available Caused by Sclerotinia sclerotiorum, white mold is an important seed-transmitted disease of soybean (Glycine max. Incubation-based methods available for the detection and quantification of seed-borne inoculum such as the blotter test, paper roll and Neon-S assay are time-consuming, laborious, and not always sensitive. In this study, we developed and evaluated a molecular assay for the detection of S. sclerotiorum in soybean seeds using a species-specific PCR (polymerase chain reaction primer set and seed soaking (without DNA extraction for up to 72 h. The PCR products were amplified in all the samples infected with the pathogen, but not in the other samples of plant material or the other seed-borne fungi DNA. The minimum amount of DNA detected was 10 pg, or one artificially infested seed in a 400-seed sample (0.25 % fungal incidence and one naturally infected seed in a 300-seed sample (0.33 % incidence. The PCR-based assay was rapid (< 9 h, did not require DNA extraction and was very sensitive.

  4. The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

    Directory of Open Access Journals (Sweden)

    Michael S Bartsch

    Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

  5. Real time PCR for the rapid identification and drug susceptibility of Mycobacteria present in Bronchial washings

    Directory of Open Access Journals (Sweden)

    Thilini Piushani Keerthirathne

    2016-10-01

    Full Text Available Abstract Background Mycobacteria have a spectrum of virulence and different susceptibilities to antibiotics. Distinguishing mycobacterial species is vital as patients with non-tuberculous mycobacterial (NTM infections present clinical features that are similar to those of patients with tuberculosis. Thus, rapid differentiation of Mycobacterium tuberculosis complex from NTM is critical to administer appropriate treatment. Hence the aim of the study was to rapid identification of mycobacterial species present in bronchial washings using multiplex real time Polymerase Chain Reaction (PCR and to determine the drug susceptibility in identified mycobacterial species. Methods Sputum smear negative bronchoscopy specimens (n = 150 were collected for a period of one year, from patients attending the General Hospital Kandy, Sri Lanka. The specimens were processed with modified Petroff’s method and were cultured on Löwenstein– Jensen medium. DNA, extracted from the mycobacterial isolates were subjected to a SYBR green mediated real time multiplex, PCR assay with primers specific for the M. tuberculosis complex, M. avium complex, M. chelonae-M.abscessus group and M. fortuitum group. DNA sequencing was performed for the species confirmation, by targeting the 16S rRNA gene and the drug susceptibility testing was performed for the molecularly identified isolates of M. tuberculosis and NTM. Results The optimized SYBR Green mediated multiplex real-time PCR assay was able to identify the presence of genus Mycobacterium in 25 out of 26 AFB positive isolates, two M. tuberculosis complex, three M. avium complex and two isolates belonging to M. chelonae-M. abscessus group. DNA sequencing confirmed the presence of M. tuberculosis, M. chelonae-M. abscessus, M. intracellulare, M. avium, Rhodococcus sp. and M. celatum. Remaining isolates were identified as Mycobacterium sp. All the NTM isolates were sensitive to amikacin and seven were resistant to ciproflaxacin

  6. Rapid differentiation of mycobacteria by simplex real-time PCR with melting temperature calling analysis.

    Science.gov (United States)

    Lin, L; Yin, X; Wang, Q

    2015-09-01

    This study aimed to develop a rapid, simple and cost-effective method for the differentiation of Mycobacterium species. A total of 80 clinical mycobacterial isolates belonging to 12 different species and 16 reference strains of 16 different species were differentiated by the simplex real-time PCR coupled with melting temperature calling analysis. By comparing their melting profiles with those of the reference strains, all clinical mycobacterial isolates were differentiated as Mycobacterium tuberculosis complex or nontuberculous mycobacteria, and the latter were further divided into five groups. In comparison with 16S-23S internal transcribed spacer sequencing method as the gold standard method, both sensitivity and specificity of the assay were 100% when it was used for the differentiation between Myco. tuberculosis complex and nontuberculous mycobacteria. The simplex real-time PCR coupled with melting temperature calling analysis could be an alternative method for the differentiation between Myco. tuberculosis complex and nontuberculous mycobacteria. Rapid differentiation of mycobacteria could shorten the diagnostic time of mycobacterial diseases. It is also helpful for achieving optimal therapy and appropriate patient management. © 2015 The Society for Applied Microbiology.

  7. Real-time PCR using mycobacteriophage DNA for rapid phenotypic drug susceptibility results for Mycobacterium tuberculosis.

    Science.gov (United States)

    Pholwat, Suporn; Ehdaie, Beeta; Foongladda, Suporn; Kelly, Kimberly; Houpt, Eric

    2012-03-01

    Managing drug-resistant Mycobacterium tuberculosis requires drug susceptibility testing, yet conventional drug susceptibility testing is slow, and molecular testing does not yield results for all antituberculous drugs. We addressed these challenges by utilizing real-time PCR of mycobacteriophage D29 DNA to evaluate the drug resistance of clinical M. tuberculosis isolates. Mycobacteriophages infect and replicate in viable bacterial cells faster than bacterial cells replicate and have been used for detection and drug resistance testing for M. tuberculosis either by using reporter cells or phages with engineered reporter constructs. Our primary protocol involved culturing M. tuberculosis isolates for 48 h with and without drugs at critical concentrations, followed by incubation with 10(3) PFU/ml of D29 mycobacteriophage for 24 h and then real-time PCR. Many drugs could be incubated instantly with M. tuberculosis and phage for 24 h alone. The change in phage DNA real-time PCR cycle threshold (C(T)) between control M. tuberculosis and M. tuberculosis treated with drugs was calculated and correlated with conventional agar proportion drug susceptibility results. Specifically, 9 susceptible clinical isolates, 22 multidrug-resistant (MDR), and 1 extensively drug-resistant (XDR) M. tuberculosis strains were used and C(T) control-C(T) drug cutoffs of between +0.3 and -6.0 yielded 422/429 (98%) accurate results for isoniazid, rifampin, streptomycin, ethambutol, amikacin, kanamycin, capreomycin, ofloxacin, moxifloxacin, ethionamide, para-aminosalicylic acid, cycloserine, and linezolid. Moreover, the ΔC(T) values correlated with isolate MIC for most agents. This D29 quantitative PCR assay offers a rapid, accurate, 1- to 3-day phenotypic drug susceptibility test for first- and second-line drugs and may suggest an approximate MIC.

  8. Comparison of PCR-DGGE and Nested-PCR-DGGE Approach for Ammonia Oxidizers Monitoring in Membrane Bioreactors’ Activated Sludge

    Directory of Open Access Journals (Sweden)

    Ziembińska-Buczyńska Aleksandra

    2014-12-01

    Full Text Available Nitritation, the first stage of ammonia removal process is known to be limiting for total process performance. Ammonia oxidizing bacteria (AOB which perform this process are obligatory activated sludge habitants, a mixture consisting of Bacteria, Protozoa and Metazoa used for biological wastewater treatment. Due to this fact they are an interesting bacterial group, from both the technological and ecological point of view. AOB changeability and biodiversity analyses both in wastewater treatment plants and lab-scale reactors are performed on the basis of 16S rRNA gene sequences using PCR-DGGE (Polymerase Chain Reaction – Denaturing Gradient Gel Electrophoresis as a molecular biology tool. AOB researches are usually led with nested PCR. Because the application of nested PCR is laborious and time consuming, we have attempted to check the possibility of using only first PCR round to obtain DGGE fingerprinting of microbial communities. In this work we are comparing the nested and non-nested PCR-DGGE monitoring of an AOB community and presenting advantages and disadvantages of both methods used. The experiment revealed that PCR technique is a very sensitive tool for the amplification of even a minute amount of DNA sample. But in the case of nested-PCR, the sensitivity is higher and the template amount could be even smaller. The nested PCR-DGGE seems to be a better tool for AOB community monitoring and complexity research in activated sludge, despite shorter fragments of DNA amplification which seems to be a disadvantage in the case of bacteria identification. It is recommended that the sort of analysis approach should be chosen according to the aim of the study: nested-PCR-DGGE for community complexity analysis, while PCR-DGGE for identification of the dominant bacteria.

  9. A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

    Science.gov (United States)

    Gallaher, Sean D.; Berk, Arnold J.

    2013-01-01

    Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

  10. Use of TaqMan® real-time PCR for rapid detection of Salmonella enterica serovar Typhi.

    Science.gov (United States)

    Ranjbar, Reza; Naghoni, Ali; Farshad, Shohreh; Lashini, Hadi; Najafi, Ali; Sadeghifard, Nourkhoda; Mammina, Caterina

    2014-06-01

    We evaluated the performances of a newly designed real-time polymerase chain reaction (PCR) assay using TaqMan® probes to detect Salmonella Typhi. TaqMan® real-time PCR assays were performed by designed primers and probe based on the staG gene for detecting S. Typhi. The specificity of the assay was evaluated on 15 Salmonella serovars. The analytical specificity was evaluated on 20 non-Salmonella microorganisms. The analytical sensitivity was assessed using decreasing DNA quantities of S. Typhi ATCC 19430. Finally the detection capability of the TaqMan® real-time PCR assay on isolates recovered from patients with Salmonella infections was compared to the conventional PCR assay. Only S. Typhi strain had positive results when subjected to the assay using Typhi-specific real-time PCR. No amplification products were observed in real-time PCR with any of the non-Salmonella microorganisms tested. The TaqMan® real-time PCR was more sensitive than the conventional PCR. In conclusion, we found that the easy-to-use real-time PCR assays were faster than conventional PCR systems. The staG-based TaqMan® real-time PCR assay showed to be specific and sensitive method for the safe and rapid detection of the S. Typhi.

  11. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Science.gov (United States)

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  12. Rapid detection of Mycobacterium avium in stool samples from AIDS patients by immunomagnetic PCR.

    OpenAIRE

    Li, Z; Bai, G H; von Reyn, C. F.; Marino, P.; Brennan, M J; Gine, N; Morris, S. L.

    1996-01-01

    Direct PCR detection of bacteria in clinical samples is often hindered by the presence of compounds that inhibit the PCR. To improve and accelerate the diagnosis of Mycobacterium avium-M. intracellulare complex infections, an immunomagnetic PCR (IM-PCR) assay was developed. This IM-PCR procedure combines the separation of mycobacteria by antimycobacterial monoclonal antibody coupled to magnetic beads with an M. avium-M. intracellulare complex-specific PCR protocol based on 16S rRNA gene seque...

  13. Rapid Purification of Salmonella DNA in Minced Meat and Detection by Real-time PCR

    DEFF Research Database (Denmark)

    Jenikova, G.; Jensen, Annette Nygaard; Demnerova, K.

    2001-01-01

    of DNeasy was found to be 6-8 CFU in just 19 end-point fluorescence (C-t) values, while this was 22 C-t for a combination of DNeasy and BactXtractor. Extraction by DNeasy resulted in C-t cells per 25 g, when the samples were inoculated with Salmonella......Four rapid and simple DNA purification and sample treatment protocols were evaluated for detection of Salmonella enterica in spiked minced meat, using a fluorogenic 5' nuclease (TaqMan) PCR assay in an ABI-Prism 7700 Sequence Detector. The detection limit with the single separation treatment...... before the overnight preenrichment. The method is currently being adapted to a BioRobot 3000 platform. However, the use of paramagnetic beads (DNA Direct) resulted in poor and variable detection limit....

  14. Rapid detection of Ceratocystis platani inoculum by quantitative real-time PCR assay.

    Science.gov (United States)

    Luchi, Nicola; Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

    2013-09-01

    Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10(-2) to 1.4 × 10(-2) pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management.

  15. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  16. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-10-17

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Development a rapid and accurate multiplex real time PCR method for the detection Chlamydia trachomatis and Mycoplasma hominis.

    Science.gov (United States)

    Safarkar, Roya; Mehrabadi, Jalil Fallah; Noormohammadi, Zahra; Mirnejad, Reza

    2017-11-01

    Sexually transmitted diseases easily spread among sexually active people and often have no symptoms. Rapid and accurate method for detecting these infections are necessary in early stages. The traditional detection methods of them are difficult and time-consuming. In this study, multiplex real time PCR was optimized for rapid identification of Chlamydia trachomatis and Mycoplasma hominis in a single tube and was performed with our designed primers. The sensitivity test was carried out to designed primers with diluted genomic DNA. To defined the specificity, non STD bacteria were used as DNA template. This study indicated that the developed multiplex real time PCR can be an effective alternative procedure to the conventional methods for rapid and accurate identification of C Chlamydia trachomatis and Mycoplasma hominis. Multiplex real-time PCR Results of them were checked with melting curves. The sensitivity of our designed primer by multiplex real time PCR for Chlamydia trachomatis and Mycoplasma hominis were 4.78×1010 and 8.35×1010 , respectively, Which the primers did not amplify any product from a non-STD species. Multiplex real time PCR by our new primers and analysis of melting curves were successfully usable for rapid and accurate detection of Chlamydia trachomatis and Mycoplasma hominis. This assay instead of traditional culture method, has considerable potential to be rapid, accurate and highly sensitive molecular diagnostic tool for simultaneous and direct detection. © 2017 Wiley Periodicals, Inc.

  19. Rapid detection of equine influenza virus H3N8 subtype by insulated isothermal RT-PCR (iiRT-PCR) assay using the POCKIT™ Nucleic Acid Analyzer.

    Science.gov (United States)

    Balasuriya, Udeni B R; Lee, Pei-Yu Alison; Tiwari, Ashish; Skillman, Ashley; Nam, Bora; Chambers, Thomas M; Tsai, Yun-Long; Ma, Li-Juan; Yang, Pai-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-10-01

    Equine influenza (EI) is an acute, highly contagious viral respiratory disease of equids. Currently, equine influenza virus (EIV) subtype H3N8 continues to be the most important respiratory pathogen of horses in many countries around the world. The need to achieve a rapid diagnosis and to implement effective quarantine and movement restrictions is critical in controlling the spread of EIV. In this study, a novel, inexpensive and user-friendly assay based on an insulated isothermal RT-PCR (iiRT-PCR) method on the POCKIT™, a field-deployable device, was described and validated for point-of-need detection of EIV-H3N8 in clinical samples. The newly established iiRT-PCR assay targeting the EIV HA3 gene was evaluated for its sensitivity using in vitro transcribed (IVT) RNA, as well as ten-fold serial dilutions of RNA extracted from the prototype H3N8 strain A/equine/Miami/1/63. Inclusivity and exclusivity panels were tested for specificity evaluation. Published real-time RT-PCR (rRT-PCR) assays targeting the NP and HA3 genes were used as the reference standards for comparison of RNA extracted from field strains and from nasal swab samples collected from experimentally infected horses, respectively. Limit of detection with a 95% probability (LoD95%) was estimated to be 11copies of IVT RNA. Clinical sensitivity analysis using RNA prepared from serial dilutions of a prototype EIV (Miami 1/63/H3N8) showed that the iiRT-PCR assay was about 100-fold more sensitive than the rRT-PCR assay targeting the NP gene of EIV subtype H3N8. The iiRT-PCR assay identified accurately fifteen EIV H3N8 strains and two canine influenza virus (CIV) H3N8 strains, and did not cross-react with H6N2, H7N7, H1N1 subtypes or any other equine respiratory viral pathogens. Finally, 100% agreement was found between the iiRT-PCR assay and the universal influenza virus type A rRT-PCR assay in detecting the EIV A/equine/Kentucky/7/07 strain in 56 nasal swab samples collected from experimentally inoculated

  20. Occurrence of Fungal DNA Contamination in PCR Reagents: Approaches to Control and Decontamination.

    Science.gov (United States)

    Czurda, S; Smelik, S; Preuner-Stix, S; Nogueira, F; Lion, T

    2016-01-01

    Nucleic acid amplification techniques permitting sensitive and rapid screening in patients at risk for invasive fungal infections are an important addition to conventional fungal diagnostic methods. However, contamination with fungal DNA may be a serious threat to the validity of fungal amplification-based assays. Besides rigorous handling procedures to avoid false-positive test results from exogenous sources, we have implemented protocols for comprehensive assessment of fungal contamination in all materials involved in the analytical process. Traces of fungal DNA were found in different commercially available PCR reagents, including lyophilized primers, TaqMan probes, and master mix solutions. These contaminants resulted in a considerable rate of false-positive tests in panfungal real-time PCR analysis. To address this problem, we have established a decontamination protocol based on the activity of a double-strand specific DNase. Using this approach, we have significantly reduced the frequency of false-positive test results attributable to contaminated reagents. On the basis of our findings, we strongly recommend routine monitoring of all reagents used in fungal PCR assays for the presence of relevant contaminants. As long as fungal-grade reagents are not readily available, pretreatment methods facilitating elimination of fungal DNA are critical for reducing the risk of false-positive results in highly sensitive molecular fungal detection assays. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Occurrence of Fungal DNA Contamination in PCR Reagents: Approaches to Control and Decontamination

    Science.gov (United States)

    Czurda, S.; Smelik, S.; Preuner-Stix, S.; Nogueira, F.

    2015-01-01

    Nucleic acid amplification techniques permitting sensitive and rapid screening in patients at risk for invasive fungal infections are an important addition to conventional fungal diagnostic methods. However, contamination with fungal DNA may be a serious threat to the validity of fungal amplification-based assays. Besides rigorous handling procedures to avoid false-positive test results from exogenous sources, we have implemented protocols for comprehensive assessment of fungal contamination in all materials involved in the analytical process. Traces of fungal DNA were found in different commercially available PCR reagents, including lyophilized primers, TaqMan probes, and master mix solutions. These contaminants resulted in a considerable rate of false-positive tests in panfungal real-time PCR analysis. To address this problem, we have established a decontamination protocol based on the activity of a double-strand specific DNase. Using this approach, we have significantly reduced the frequency of false-positive test results attributable to contaminated reagents. On the basis of our findings, we strongly recommend routine monitoring of all reagents used in fungal PCR assays for the presence of relevant contaminants. As long as fungal-grade reagents are not readily available, pretreatment methods facilitating elimination of fungal DNA are critical for reducing the risk of false-positive results in highly sensitive molecular fungal detection assays. PMID:26560539

  2. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2013-01-01

    Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

  3. Evaluation of a quantitative real-time PCR for rapid detection of Riemerella Anatipestifer infection in birds.

    Science.gov (United States)

    Zhang, Qingshan; Wan, Chunhe; Li, Chenxi; Bai, Xiaofei; Liu, Ming; Liu, Siguo; Zhang, Yun

    2017-08-05

    To establish an accurate, rapid, and a quantifiable method for the detection of Riemerella anatipestifer infection, a widespread infectious disease in birds, we developed a TaqMan-based real-time PCR assay by using DtxR gene-specific primers and a TaqMan probe. The standard curve established with a linear correlation (R2) of 0.998 and efficiency of 99% between the Ct value and the logarithm of the plasmid copy number. The reproducibility and specificity of the real-time PCR assay were confirmed by using plasmids containing DtxR genes or DNAs extracted from well-known bacteria or viruses causing duck diseases. The real-time PCR assay was 100 times more sensitive than the conventional PCR. The results reveal that the established real-time PCR assay might be a useful method for diagnosis and quantitative detection of Riemerella anatipestifer in birds.

  4. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Science.gov (United States)

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  5. Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates.

    NARCIS (Netherlands)

    Mohammadi, T.; Reesink, H.W.; Vandenbroucke-Grauls, C.M.J.E.; Savelkoul, P.H.M.

    2003-01-01

    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating

  6. A New Method for Rapid Screening of End-Point PCR Products: Application to Single Genome Amplified HIV and SIV Envelope Amplicons.

    Directory of Open Access Journals (Sweden)

    Laurent Houzet

    Full Text Available PCR is the most widely applied technique for large scale screening of bacterial clones, mouse genotypes, virus genomes etc. A drawback of large PCR screening is that amplicon analysis is usually performed using gel electrophoresis, a step that is very labor intensive, tedious and chemical waste generating. Single genome amplification (SGA is used to characterize the diversity and evolutionary dynamics of virus populations within infected hosts. SGA is based on the isolation of single template molecule using limiting dilution followed by nested PCR amplification and requires the analysis of hundreds of reactions per sample, making large scale SGA studies very challenging. Here we present a novel approach entitled Long Amplicon Melt Profiling (LAMP based on the analysis of the melting profile of the PCR reactions using SYBR Green and/or EvaGreen fluorescent dyes. The LAMP method represents an attractive alternative to gel electrophoresis and enables the quick discrimination of positive reactions. We validate LAMP for SIV and HIV env-SGA, in 96- and 384-well plate formats. Because the melt profiling allows the screening of several thousands of PCR reactions in a cost-effective, rapid and robust way, we believe it will greatly facilitate any large scale PCR screening.

  7. Real-time PCR assays compared to culture-based approaches for identification of aerobic bacteria in chronic wounds.

    Science.gov (United States)

    Melendez, J H; Frankel, Y M; An, A T; Williams, L; Price, L B; Wang, N-Y; Lazarus, G S; Zenilman, J M

    2010-12-01

    Chronic wounds cause substantial morbidity and disability. Infection in chronic wounds is clinically defined by routine culture methods that can take several days to obtain a final result, and may not fully describe the community of organisms or biome within these wounds. Molecular diagnostic approaches offer promise for a more rapid and complete assessment. We report the development of a suite of real-time PCR assays for rapid identification of bacteria directly from tissue samples. The panel of assays targets 14 common, clinically relevant, aerobic pathogens and demonstrates a high degree of sensitivity and specificity using a panel of organisms commonly associated with chronic wound infection. Thirty-nine tissue samples from 29 chronic wounds were evaluated and the results compared with those obtained by culture. As revealed by culture and PCR, the most common organisms were methicillin-resistant Staphylococcus aureus (MRSA) followed by Streptococcus agalactiae (Group B streptococcus) and Pseudomonas aeruginosa. The sensitivities of the PCR assays were 100% and 90% when quantitative and qualitative culture results were used as the reference standard, respectively. The assays allowed the identification of bacterial DNA from ten additional organisms that were not revealed by quantitative or qualitative cultures. Under optimal conditions, the turnaround time for PCR results is as short as 4-6 h. Real-time PCR is a rapid and inexpensive approach that can be easily introduced into clinical practice for detection of organisms directly from tissue samples. Characterization of the anaerobic microflora by real-time PCR of chronic wounds is warranted. © 2010 The Authors. Journal Compilation © 2010 European Society of Clinical Microbiology and Infectious Diseases.

  8. Universal Probe Library based real-time PCR for rapid detection of bacterial pathogens from positive blood culture bottles.

    Science.gov (United States)

    Zhu, Lingxiang; Shen, Ding-Xia; Zhou, Qiming; Liu, Chao-Jun; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2014-03-01

    A set of real-time PCR based assays using the locked nucleic acid probes from Roche Universal ProbeLibrary were developed for rapid detection of eight bacterial species from positive blood culture bottles. Four duplex real-time PCR reactions targeting to one Gram-positive bacterium and one Gram-negative bacterium were optimized for species identification according to Gram stain results. We also included mecA-specific primers and probes in the assays to indicate the presence of methicillin resistance in the bacterial species. The analytical sensitivity was in the range of 1-10 CFU per PCR reaction mixture. The specificity and cross reactivity of the assay was validated by 28 ATCC reference strains and 77 negative blood culture specimens. No cross-reactivity was observed in these samples thus demonstrating 100 % specificity. 72 previously characterized clinical isolates were tested by the real-time PCR assay and validated the accuracy and feasibility of the real-time PCR assay. Furthermore, 55 positive blood culture samples were tested using real-time PCR and 50 (90.9 %) of them were identified as the same species as judged by biochemical analysis. In total, real-time PCR showed 98.2 % consistent to that of traditional methods. Real-time PCR can be used as a supplement for early detection of the frequently-occurred pathogens from the positive blood cultures.

  9. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  10. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  11. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    African Journals Online (AJOL)

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  12. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs.

    Science.gov (United States)

    Rajkhowa, S

    2015-09-01

    As the pathogenicity of Pasteurella multocida is associated with various virulence factors (VFs), the aim of the study was to develop a novel multiplex PCR (m-PCR) assay for the rapid detection of important virulence associated genes (VAGs) of P. multocida isolates from pigs. The target recognized VFs used in the study were diverse adhesins (ptfA and pfhA), toxins (toxA), siderophores (tonB and hgbA), sialidases (nanB, nanH) and outer membrane proteins (ompA, ompH, oma87 and plpB). The primers for the genes encoding these VFs were designed by primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) using gene sequences available in Genbank. The detection limit of the developed assay was 10(2)  CFU ml(-1) . The m-PCR did not produce any nonspecific amplification products when tested against Bordetella bronchiseptica which also commonly infects pigs. We applied m-PCR to the field samples, and the results obtained were the same as the single PCR results. The developed assay would be very useful for veterinary diagnostic laboratories and for others interested in the rapid virulence profiling of porcine P. multocida isolates circulating in the piggeries. The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs. Rapid and simultaneous detection of recognized VFs of the organism are essential to know the virulo-types of P. multocida isolates circulating in the piggeries. The developed novel assay will be very useful for the rapid detection of VAGs of P. multocida isolates from pigs. © 2015 The Society for Applied Microbiology.

  13. Rapid identification and enumeration of Saccharomyces cerevisiae cells in wine by real-time PCR.

    Science.gov (United States)

    Martorell, P; Querol, A; Fernández-Espinar, M T

    2005-11-01

    Despite the beneficial role of Saccharomyces cerevisiae in the food industry for food and beverage production, it is able to cause spoilage in wines. We have developed a real-time PCR method to directly detect and quantify this yeast species in wine samples to provide winemakers with a rapid and sensitive method to detect and prevent wine spoilage. Specific primers were designed for S. cerevisiae using the sequence information obtained from a cloned random amplified polymorphic DNA band that differentiated S. cerevisiae from its sibling species Saccharomyces bayanus, Saccharomyces pastorianus, and Saccharomyces paradoxus. The specificity of the primers was demonstrated for typical wine spoilage yeast species. The method was useful for estimating the level of S. cerevisiae directly in sweet wines and red wines without preenrichment when yeast is present in concentrations as low as 3.8 and 5 CFU per ml. This detection limit is in the same order as that obtained from glucose-peptone-yeast growth medium (GPY). Moreover, it was possible to quantify S. cerevisiae in artificially contaminated samples accurately. Limits for accurate quantification in wine were established, from 3.8 x 10(5) to 3.8 CFU/ml in sweet wine and from 5 x 10(6) to 50 CFU/ml in red wine.

  14. A new PCR approach for the identification of Fusarium graminearum.

    Science.gov (United States)

    de Biazio, Gleison Ricardo; Leite, Gabriela Guimarães Sousa; Tessmann, Dauri José; Barbosa-Tessmann, Ione Parra

    2008-07-01

    The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3´coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO). This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.

  15. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    Science.gov (United States)

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococci. Hence, this study was done to develop a rapid triplex PCR for the detection of PVL positive MRSA and for the simultaneous differentiation of MRSA from Coagulase Negative Staphylococci (CoNS). Materials and Methods: We developed a triplex PCR for the specific detection of PVL positive Community Acquired (CA) – MRSA and for its simultaneous differentiation from the coagulase negative Staphylococci. We used PCR for targeting the fem A gene which is specific for S. aureus, mecA which is specific for methicillin-resistance and luk - PV which is specific for the PVL toxin. The method was evaluated with a total of 100 clinical isolates of Staphylococcus spp. Results: The triplex PCR was successfully standardized by using the reference strains and it was evaluated by using clinical strains. The method was found to be rapid, highly sensitive (100%), specific (99%) and cost effective. Conclusion: Triplex PCR can be used as a diagnostic tool for the detection of the highly pathogenic strains of CA-MRSA. PMID:23542876

  16. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  17. Rapid detection of Panton-Valentine leukocidin from clinical isolates of Staphylococcus aureus strains by real-time PCR

    NARCIS (Netherlands)

    Deurenberg, Ruud H; Vink, Cornelis; Driessen, Christel; Bes, Michèle; London, Nancy; Etienne, Jerome; Stobberingh, Ellen E

    2004-01-01

    To allow rapid identification of Panton-Valentine leukocidin (PVL)-producing Staphylococcus aureus strains, a real-time PCR assay for detection of PVL was developed. This assay is convenient, since it can be applied directly on bacterial suspensions and does not require previous DNA purification.

  18. Development of a multiplex PCR assay for rapid identification of Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex.

    Science.gov (United States)

    Koh, Seng Fook; Tay, Sun Tee; Sermswan, Rasana; Wongratanacheewin, Surasakdi; Chua, Kek Heng; Puthucheary, Savithri D

    2012-09-01

    We have developed a multiplex PCR assay for rapid identification and differentiation of cultures for Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex. The assay is valuable for use in clinical and veterinary laboratories, and in a deployable laboratory during outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  1. Giardia intestinalis: DNA extraction approaches to improve PCR results.

    Science.gov (United States)

    Babaei, Zahra; Oormazdi, Hormozd; Rezaie, Sasan; Rezaeian, Mostafa; Razmjou, Elham

    2011-06-01

    Difficulty in disrupting cysts of Giardia intestinalis, a cosmopolitan protozoan parasite, decreases the yield of DNA extracted and reduces the effectiveness of the polymerase chain reaction (PCR). To improve the detection of the Giardia Glutamate Dehydrogenase (gdh) gene, we re-evaluated the effects of deoxyribonucleic acid (DNA) extraction methods. Purified and concentrated cysts from 33 fecal samples were disrupted using conventional methods, and DNA extraction was conducted using two protocols: the QIAamp Stool Mini Kit and phenol/chloroform/isoamyl alcohol (PCI). PCR amplification was successful for 12 extracted DNA samples (36%) using PCI following a glass bead and freeze/thaw pretreatment and for all 33 samples (100%) using the QIAamp Stool Mini Kit following the aforementioned pretreatment. Consequently, the pretreatment of cysts with glass beads and freeze/thaw cycles followed by extraction of DNA with the QIAamp Stool Mini kit was the more effective protocol. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Rapid detection method for Bacillus anthracis using a combination of multiplexed real-time PCR and pyrosequencing and its application for food biodefense.

    Science.gov (United States)

    Janzen, Timothy W; Thomas, Matthew C; Goji, Noriko; Shields, Michael J; Hahn, Kristen R; Amoako, Kingsley K

    2015-02-01

    Bacillus anthracis, the causative agent of anthrax, has the capacity to form highly resilient spores as part of its life cycle. The potential for the dissemination of these spores using food as a vehicle is a huge public health concern and, hence, requires the development of a foodborne bioterrorism response approach. In this work, we address a critical gap in food biodefense by presenting a novel, combined, sequential method involving the use of real-time PCR and pyrosequencing for the rapid, specific detection of B. anthracis spores in three food matrices: milk, apple juice, and bottled water. The food samples were experimentally inoculated with 40 CFU ml(-1), and DNA was extracted from the spores and analyzed after immunomagnetic separation. Applying the combination of multiplex real-time PCR and pyrosequencing, we successfully detected the presence of targets on both of the virulence plasmids and the chromosome. The results showed that DNA amplicons generated from a five-target multiplexed real-time PCR detection using biotin-labeled primers can be used for single-plex pyrosequencing detection. The combined use of multiplexed real-time PCR and pyrosequencing is a novel, rapid detection method for B. anthracis from food and provides a tool for accurate, quantitative identification with potential biodefense applications.

  3. Rapid Detection of Enterotoxigenic Clostridium perfringens by Real-Time Fluorescence Resonance Energy Transfer PCR

    National Research Council Canada - National Science Library

    dela Cruz, Wilfred P; Gozum, Mary M.A; Lineberry, Sarah F; Stassen, Sarah D; Daughtry, Marianne; Stassen, Nicholas A; Jones, Morris S; Johnson, Oswald L

    2006-01-01

    ...) produced by some strains during sporulation. We developed a quantitative real-time PCR assay based on fluorescence resonance energy transfer hybridization chemistry that targets the C. perfringens...

  4. Rapid quantification of viable Campylobacter bacteria on chicken carcasses, using real-time PCR and propidium monoazide treatment, as a tool for quantitative risk assessment.

    Science.gov (United States)

    Josefsen, M H; Löfström, C; Hansen, T B; Christensen, L S; Olsen, J E; Hoorfar, J

    2010-08-01

    A number of intervention strategies against Campylobacter-contaminated poultry focus on postslaughter reduction of the number of cells, emphasizing the need for rapid and reliable quantitative detection of only viable Campylobacter bacteria. We present a new and rapid quantitative approach to the enumeration of food-borne Campylobacter bacteria that combines real-time quantitative PCR (Q-PCR) with simple propidium monoazide (PMA) sample treatment. In less than 3 h, this method generates a signal from only viable and viable but nonculturable (VBNC) Campylobacter bacteria with an intact membrane. The method's performance was evaluated by assessing the contributions to variability by individual chicken carcass rinse matrices, species of Campylobacter, and differences in efficiency of DNA extraction with differing cell inputs. The method was compared with culture-based enumeration on 50 naturally infected chickens. The cell contents correlated with cycle threshold (C(T)) values (R(2) = 0.993), with a quantification range of 1 x 10(2) to 1 x 10(7) CFU/ml. The correlation between the Campylobacter counts obtained by PMA-PCR and culture on naturally contaminated chickens was high (R(2) = 0.844). The amplification efficiency of the Q-PCR method was not affected by the chicken rinse matrix or by the species of Campylobacter. No Q-PCR signals were obtained from artificially inoculated chicken rinse when PMA sample treatment was applied. In conclusion, this study presents a rapid tool for producing reliable quantitative data on viable Campylobacter bacteria in chicken carcass rinse. The proposed method does not detect DNA from dead Campylobacter bacteria but recognizes the infectious potential of the VBNC state and is thereby able to assess the effect of control strategies and provide trustworthy data for risk assessment.

  5. A multiplex PCR for rapid identification of Brassica species in the triangle of U.

    Science.gov (United States)

    Koh, Joshua C O; Barbulescu, Denise M; Norton, Sally; Redden, Bob; Salisbury, Phil A; Kaur, Sukhjiwan; Cogan, Noel; Slater, Anthony T

    2017-01-01

    Within the Brassicaceae, six species from the genus Brassica are widely cultivated throughout the world as oilseed, condiment, fodder or vegetable crops. The genetic relationships among the six Brassica species are described by U's triangle model. Extensive shared traits and diverse morphotypes among Brassica species make identification and classification based on phenotypic data alone challenging and unreliable, especially when dealing with large germplasm collections. Consequently, a major issue for genebank collections is ensuring the correct identification of species. Molecular genotyping based on simple sequence repeat (SSR) marker sequencing or the Illumina Infinium Brassica napus 60K single nucleotide polymorphism (SNP) array has been used to identify species and assess genetic diversity of Brassica collections. However, these methods are technically challenging, expensive and time-consuming, making them unsuitable for routine or rapid screening of Brassica accessions for germplasm management. A cheaper, faster and simpler method for Brassica species identification is described here. A multiplex polymerase chain reaction (MPCR) consisting of new and existing primers specific to the Brassica A, B and C genomes was able to reliably distinguish all six Brassica species in the triangle of U with 16 control samples of known species identity. Further validation against 120 Brassica accessions previously genotyped showed that the MPCR is highly accurate and comparable to more advanced techniques such as SSR marker sequencing or the Illumina Infinium B. napus 60K SNP array. In addition, the MPCR was sensitive enough to detect seed contaminations in pooled seed samples of Brassica accessions. A cheap and fast multiplex PCR assay for identification of Brassica species in the triangle of U was developed and validated in this study. The MPCR assay can be readily implemented in any basic molecular laboratory and should prove useful for the management of Brassica

  6. Multiplex real-time PCR assay for rapid detection of methicillin-resistant staphylococci directly from positive blood cultures.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok; Uh, Young; Lee, Hyeyoung

    2014-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 10(3) CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Multiplex Real-Time PCR Assay for Rapid Detection of Methicillin-Resistant Staphylococci Directly from Positive Blood Cultures

    Science.gov (United States)

    Wang, Hye-young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 103 CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. PMID:24648566

  8. Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

    Science.gov (United States)

    Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

    2006-01-01

    Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

  9. Interlaboratory validation of a real-time PCR 24-hour rapid method for detection of Salmonella in foods.

    Science.gov (United States)

    Cheng, Chorng-Ming; Van Khanh, T; Lin, Wen; Ruby, Richard M

    2009-05-01

    The efficacy of a 24-h Salmonella real-time, or quantitative, PCR (qPCR) detection method was assessed through a collaborative effort involving eight Federal and state laboratories. Eleven foods including mashed potatoes, soft cheese, chili powder, chocolate, eggs, sprouts, apple juice, fish, shrimp, ground beef, and ground chicken were tested. For each food, seven blind samples were distributed to each participant for testing. These included six samples equivalently inoculated with 1 to 5 CFU/25 g of various serotypes of Salmonella (Gaminara, Weltevreden, Heidelberg, Senftenberg, Enteritidis, Newport, Typhimurium, and Kentucky for each food) and 10 to 50 CFU/25 g of the competitor Enterobacter cloacae. The seventh sample was inoculated with 10 to 50 CFU/25 g of the competitor, E. cloacae, only. These samples were tested for Salmonella by using four methods in parallel: (i) 24-h qPCR method detecting Salmonella from modified buffered peptone water enrichment medium; (ii) 48-h qPCR method detecting Salmonella from a secondary selective enrichment broth; (iii) modified Bacteriological Analytical Manual method; and (iv) VIDAS, an immunoassay system. The results of the statistical analysis showed there was no significant (P > or = 0.05) difference between either of the qPCR methods and the modified Bacteriological Analytical Manual method for 10 of 11 foods. For the one exception, sprouts, detection by qPCR required 48 h. Both qPCR methods showed a detection limit of 0.08 to 0.2 CFU/g. These results provide a solid basis for using this 24-h qPCR rapid screening method to detect Salmonella in foods.

  10. Nested PCR for Rapid Detection of Mumps Virus in Cerebrospinal Fluid from Patients with Neurological Diseases

    OpenAIRE

    Poggio, Gustavo Palacios; Rodriguez, Claudia; Cisterna, Daniel; Freire, María Cecilia; Cello, Jerónimo

    2000-01-01

    In this study, we have developed a reverse transcription (RT)-nested polymerase chain reaction (n-PCR) for the detection of mumps virus RNA in cerebrospinal fluid (CSF) from patients with neurological infections. A specific 112-bp fragment was amplified by this method with primers from the nucleoprotein of the mumps virus genome. The mumps virus RT–n-PCR was capable of detecting 0.001 PFU/ml and 0.005 50% tissue culture infective dose/ml. This method was found to be specific, since no PCR pro...

  11. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  12. Evaluation of PCR Approaches for Detection of Bartonella bacilliformis in Blood Samples.

    Directory of Open Access Journals (Sweden)

    Cláudia Gomes

    2016-03-01

    Full Text Available The lack of an effective diagnostic tool for Carrion's disease leads to misdiagnosis, wrong treatments and perpetuation of asymptomatic carriers living in endemic areas. Conventional PCR approaches have been reported as a diagnostic technique. However, the detection limit of these techniques is not clear as well as if its usefulness in low bacteriemia cases. The aim of this study was to evaluate the detection limit of 3 PCR approaches.We determined the detection limit of 3 different PCR approaches: Bartonella-specific 16S rRNA, fla and its genes. We also evaluated the viability of dry blood spots to be used as a sample transport system. Our results show that 16S rRNA PCR is the approach with a lowest detection limit, 5 CFU/μL, and thus, the best diagnostic PCR tool studied. Dry blood spots diminish the sensitivity of the assay.From the tested PCRs, the 16S rRNA PCR-approach is the best to be used in the direct blood detection of acute cases of Carrion's disease. However its use in samples from dry blood spots results in easier management of transport samples in rural areas, a slight decrease in the sensitivity was observed. The usefulness to detect by PCR the presence of low-bacteriemic or asymptomatic carriers is doubtful, showing the need to search for new more sensible techniques.

  13. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum.

    Science.gov (United States)

    Song, A; You, Y; Chen, F; Li, P; Jiang, J; Chen, S

    2013-01-01

    Chrysanthemum plants are subject to serious virus diseases, so detection and identification of virus pathogens is important to prevent the virus spread. A reliable one-step multiplex RT-PCR was developed to simultaneously detect two viruses and two viriods: chrysanthemum virus B, tomato Aspermy virus, chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. In addition, we investigated the detection limit and the efficiency of single and multiplex RT-PCR assays. The results showed that the multiplex RT-PCR assay proved to be as sensitive as the single one. In conclusion, this technique is potentially useful in routine diagnosis of chrysanthemum viruses and viroids. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in chrysanthemum, which provides a fast, convenient, cost-saving way to detect the virus and viroid mixed infections in plants. © 2012 The Society for Applied Microbiology.

  14. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    ) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

  15. A One-Step, Real-Time PCR Assay for Rapid Detection of Rhinovirus

    Science.gov (United States)

    Do, Duc H.; Laus, Stella; Leber, Amy; Marcon, Mario J.; Jordan, Jeanne A.; Martin, Judith M.; Wadowsky, Robert M.

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID50 (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform. PMID:19948820

  16. Rapid identification of Brucella isolates to the species level by real time PCR based single nucleotide polymorphism (SNP analysis

    Directory of Open Access Journals (Sweden)

    Smith Catherine J

    2008-06-01

    Full Text Available Abstract Background Brucellosis, caused by members of the genus Brucella, remains one of the world's major zoonotic diseases. Six species have classically been recognised within the family Brucella largely based on a combination of classical microbiology and host specificity, although more recently additional isolations of novel Brucella have been reported from various marine mammals and voles. Classical identification to species level is based on a biotyping approach that is lengthy, requires extensive and hazardous culturing and can be difficult to interpret. Here we describe a simple and rapid approach to identification of Brucella isolates to the species level based on real-time PCR analysis of species-specific single nucleotide polymorphisms (SNPs that were identified following a robust and extensive phylogenetic analysis of the genus. Results Seven pairs of short sequence Minor Groove Binding (MGB probes were designed corresponding to SNPs shown to possess an allele specific for each of the six classical Brucella spp and the marine mammal Brucella. Assays were optimised to identical reaction parameters in order to give a multiple outcome assay that can differentiate all the classical species and Brucella isolated from marine mammals. The scope of the assay was confirmed by testing of over 300 isolates of Brucella, all of which typed as predicted when compared to other phenotypic and genotypic approaches. The assay is sensitive being capable of detecting and differentiating down to 15 genome equivalents. We further describe the design and testing of assays based on three additional SNPs located within the 16S rRNA gene that ensure positive discrimination of Brucella from close phylogenetic relatives on the same platform. Conclusion The multiple-outcome assay described represents a new tool for the rapid, simple and unambiguous characterisation of Brucella to the species level. Furthermore, being based on a robust phylogenetic framework, the

  17. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  18. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  19. Rapid and specific detection of porcine parvovirus using real-time PCR and high resolution melting (HRM) analysis.

    Science.gov (United States)

    Yu, Hai-Qiong; Cai, Xian-Quan; Lin, Zhi-Xiong; Li, Xiang-Li; Yue, Qiao-Yun; Li, Rong; Zhu, Xing-Quan

    2015-02-28

    Porcine parvovirus (PPV) is the important causative agent for infectious infertility, which is a fairly tough virus that multiplies normally in the intestine of pigs without causing clinical signs in the world. We developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the detection of PPV. Primers targeting the VP gene were highly specific, as evidenced by the negative amplification of closely related viruses, such as porcine circovirus 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), classical swine fever virus (CSFV), or Japanese encephalitis virus (JEV). The performance of unlabeled real time PCR was compared to TaqMan real time PCR, and the detection limits of the two methods were nearly equal. Moreover, there was good correlation between Cp and diluted genomic DNA when tested with the two methods. The assay has the accuracy of 100% in reference to labeled real time PCR, when it was tested on 45 clinical samples. The present study demonstrated that the established assay integrating real-time PCR and HRM is relatively cost-effective and more stable, which provides an alternative tool for rapid, simple, specific and sensitive detection of PPV.

  20. A Rapid and Sensitive Diagnosis of Typhoid Fever Based On Nested PCR-Voltammetric DNA Biosensor Using Flagellin Gene Fragment

    Directory of Open Access Journals (Sweden)

    Yeni Wahyuni Hartati

    2016-03-01

    Full Text Available Typhoid fever caused by Salmonella typhi is an important issue for public health in the world. Laboratory methods for rapid and sensitive diagnosis are very important for disease management. The purpose of this study was to determine the performance of nested PCR–voltammetric DNA biosensor using flagellin gene (fla of S. typhi as a marker. The differential pulse voltammetry using pencil graphite electrode was applied to measure the guanine oxidation signal of probes vs synthetic target stDNA and probes vs fla PCR product hybridizations. The probe DNA selectivity was examined by hybridized probes vs non-complementary sequence. The result showed that the first round nested PCR product can not be visualized by agarose electrophoresis, whereas using the voltammetric biosensor methods can be detected both for the first or second round nested PCR product. The average peak current of hybridized probe vs first and second round of PCR product was 2.32 and 1.47 μA respectively, at 0.9 V. Detection of the DNA sequences of the infectious diseases from PCR amplified real sample was also carried out using this voltammetric DNA biosensor methods.

  1. A simple PCR-based method for the rapid genotyping of inherited fifth complement component (C5)-deficient mice.

    Science.gov (United States)

    Wang, Qingkai; Wang, Na; Zhang, Xin; Hu, Weiguo

    2015-01-01

    The fifth component of complement (C5) is considered to be the center of complement activation and function. However, there are no genetically engineered knockout mice for this gene, and the only commercially available inherited C5-deficient mice, in which a "TA" nucleotide deletion in the coding frame was previously identified, are in theC57BL/10Sn genetic background rather than the commonly used backgrounds C57BL/6 and BALB/c. Therefore, these mice must be backcrossed into the desired genetic background. Here, we developed an ARMS (amplification refractory mutation system) PCR method using a specific primer pair that was able to discriminate between the genotypes when the resulting product was analyzed by agarose gel electrophoresis. These results were supported by quantitative RT-PCR and semi-quantitative PCR and were consistent with the results from sequencing each backcrossed generation. Using ARMS-PCR method, we generated C5-deficient mice in the C57BL/6 background over 9 backcrossed generations and further verified the phenotype using complement-mediated hemolytic assays. In this study, we describe a simple, rapid and reliable PCR-based method for genotyping inherited C5-deficient mice that may be used to backcross C57BL/10Sn mice into other genetic backgrounds.

  2. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  3. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  4. Effect on MRSA transmission of rapid PCR testing of patients admitted to critical care.

    Science.gov (United States)

    Cunningham, R; Jenks, P; Northwood, J; Wallis, M; Ferguson, S; Hunt, S

    2007-01-01

    We report a significant reduction in the rate of meticillin-resistant Staphylococcus aureus (MRSA) transmission on a critical care unit when admission screening by culture was replaced with a same-day polymerase chain reaction (PCR) test. This was an observational cohort study, set in a 19-bed mixed medical and surgical adult critical care unit in southwest England. We studied 1305 patients admitted between April 2005 and February 2006. Standard MRSA culture methods were used to screen 612 patients between April 2005 and August 2005, and the IDI MRSA PCR test was used to screen 693 patients between September 2005 and February 2006. Standard infection control precautions were instituted when positive results were obtained by either method. Outcome measures included carriage rate, turnaround time for results and rate of subsequent MRSA transmission on the unit. The overall carriage rate on admission to the unit was 7.0%. Culture results were available in three working days, PCR results within one working day. The mean incidence of MRSA transmission was 13.89/1000 patient days during the culture phase and 4.9/1000 patient days during the PCR phase (relative risk reduction 0.65, 95% CI 0.28-1.07). PCR screening for MRSA on admission to critical care units is feasible in routine clinical practice, provides quicker results than culture-based screening and is associated with a significant reduction in subsequent MRSA transmission.

  5. Evaluation of PCR-based approach for serotype determination of Streptococcus pneumoniae.

    Science.gov (United States)

    Shakrin, N N S M; Balasubramaniam, S D; Yusof, H A; Mastuki, M F; Masri, S N; Taib, N M; Nordin, S A; Jamal, F; Clarke, S C; Desa, M N M

    2013-06-01

    Determination of Streptococcus pneumoniae serotypes is essential for epidemiological surveillance. Therefore accurate, reliable and cost effective serotyping method is crucial. In this study, we determined the serotypes of 41 pneumococcal isolates recovered from human anterior nares by multiplex Polymerase Chain Reaction (PCR) utilizing published primers. The data was then compared with conventional serology using latex agglutination (LA) and the Quellung reaction. Based on the PCR-approach, 8 different serogroups/serotypes were detected with one isolate classified as non-typeable (cpsA-negative). In reference to the serology-based data, the results were in agreement except for one isolate. For the latter isolate, the LA and Quellung tests failed to show a reaction but the PCR-approach and sequencing identified the isolate as serogroup 15B/C. Based on this experimental setting, we found that the PCR-approach for pneumococcal serotypes determination is reliable to serve as the alternative for determining the pneumococcal serotyping.

  6. A rapid molecular approach for chromosomal phasing.

    Directory of Open Access Journals (Sweden)

    John F Regan

    Full Text Available Determining the chromosomal phase of pairs of sequence variants - the arrangement of specific alleles as haplotypes - is a routine challenge in molecular genetics. Here we describe Drop-Phase, a molecular method for quickly ascertaining the phase of pairs of DNA sequence variants (separated by 1-200 kb without cloning or manual single-molecule dilution. In each Drop-Phase reaction, genomic DNA segments are isolated in tens of thousands of nanoliter-sized droplets together with allele-specific fluorescence probes, in a single reaction well. Physically linked alleles partition into the same droplets, revealing their chromosomal phase in the co-distribution of fluorophores across droplets. We demonstrated the accuracy of this method by phasing members of trios (revealing 100% concordance with inheritance information, and demonstrate a common clinical application by phasing CFTR alleles at genomic distances of 11-116 kb in the genomes of cystic fibrosis patients. Drop-Phase is rapid (requiring less than 4 hours, scalable (to hundreds of samples, and effective at long genomic distances (200 kb.

  7. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  8. Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment

    Science.gov (United States)

    Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter

    2004-01-01

    A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627

  9. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR.

    Science.gov (United States)

    Sun, Yi; Dhumpa, Raghuram; Bang, Dang Duong; Høgberg, Jonas; Handberg, Kurt; Wolff, Anders

    2011-04-21

    The endemic of Avian Influenza Virus (AIV) in Asia and epizootics in some European regions have caused serious economic losses. Multiplex reverse-transcriptase (RT) PCR has been developed to detect and subtype AIV. However, the number of targets that can be amplified in a single run is limited because of uncontrollable primer-primer interferences. In this paper, we describe a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip. A simple UV cross-linking method was used to immobilize the DNA probes on unmodified glass surface, which makes it convenient to integrate microarray with microfluidics. This solid-phase RT-PCR method combined RT amplification of extracted RNA in the liquid phase and species-specific nested PCR on the solid phase. Using the developed approach, AIV viruses and their subtypes were unambiguously identified by the distinct patterns of amplification products. The whole process was reduced to less than 1 hour and the sample volume used in the microfluidic chip was at least 10 times less than in the literature. By spatially separating the primers, highly multiplexed amplification can be performed in solid-phase PCR. Moreover, multiplex PCR and sequence detection were done in one step, which greatly simplified the assay and reduced the processing time. Furthermore, by incorporating the microarray into a microchamber-based PCR chip, the sample and the reagent consumption were greatly reduced, and the problems of bubble formation and solution evaporation were effectively prevented. This microarray-based PCR microchip can be widely employed for virus detection and effective surveillance in wild avian and in poultry productions.

  10. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  11. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  12. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  13. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories...

  14. Rapid detection of carbapenemase genes by multiplex real-time PCR.

    Science.gov (United States)

    Monteiro, Jussimara; Widen, Raymond H; Pignatari, Antonio C C; Kubasek, Carly; Silbert, Suzane

    2012-04-01

    To develop a single multiplex real-time PCR assay to detect six different genetic types of carbapenemases already identified in Enterobacteriaceae (KPC, GES, NDM, IMP, VIM and OXA-48). A total of 58 bacterial isolates were tested. Thirty were previously characterized as resistant to carbapenems and documented by PCR and sequencing analysis to carry the following genes: bla(KPC) type, bla(GES) type, bla(IMP) type, bla(VIM) type, bla(OXA-48) and bla(NDM-1). These positive strains included 21 Enterobacteriaceae, 1 Acinetobacter baumannii and 8 Pseudomonas aeruginosa isolates. The remaining 28 isolates previously tested susceptible to carbapenems and were negative for these genes. Bacterial DNA was extracted using the easyMag extractor (bioMérieux, France). The real-time PCR was performed using the Rotor-Gene 6000 instrument (Corbett Life Science, Australia) and specific primers for each carbapenemase target were designed using the DNAStar software (Madison, WI, USA). Each one of the six carbapenemase genes tested presented a different melting curve after PCR amplification. The melting temperature (T(m)) analysis of the amplicons identified was as follows: bla(IMP) type (T(m) 80.1°C), bla(OXA-48) (T(m) 81.6°C), bla(NDM-1) (T(m) 84°C), bla(GES) type (T(m) 88.6°C), bla(VIM) type (T(m) 90.3°C) and bla(KPC) type (T(m) 91.6°C). No amplification was detected among the negative samples. The results showed 100% concordance with the genotypes previously identified. The new assay was able to detect the presence of six different carbapenemase gene types in a single 3 h PCR.

  15. Rapid and Efficient cDNA Library Screening by Self-Ligation ofInverse PCR Products (SLIP)

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Stapleton, Mark; George, Reed A.; Yu, Charles; Wan, Kenneth H.; Carlson, Joseph W.; Celniker, Susan E.

    2005-04-22

    The production of comprehensive cDNA clone collections is an important goal of the human and model organism genome projects. cDNA sequences are used to determine the structures of transcripts, including splice junctions, polyadenylation sites, and 5' and 3' untranslated regions (UTRs). cDNA collections are also valuable resources for functional studies of genes and proteins. Expressed Sequence Tag (EST)sequencing is the method of choice for recovering cDNAs representing a majority of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a library at random, so it realizes diminishing returns as the project progresses. To drive cDNA collections toward completion new methods are needed to recover cDNAs representing specific genes and alternative transcripts, including transcripts with low expression levels. We describe a simple and effective inverse-PCR-based method for screening plasmid libraries to recover intact cDNAs for specific transcripts. We tested the method by screening libraries used in our Drosophila EST projects for 153 transcription factor genes that were not yet represented by full-length cDNAs. We recovered target-specific clones for 104 of the genes: 46 exactly match, 30 improve and 28partially match current gene annotations. Successful application of the screening method depends on cDNA library complexity and quality of the gene models. The approach should be effective for improving cDNA collections for other model organisms and the human. It also provides a simple and rapid method for isolating cDNAs of interest in any system for which plasmid cDNA libraries and complete or partial gene sequences are available.

  16. Duplex real-time PCR assay for rapid identification of Staphylococcus aureus isolates from dairy cow milk.

    Science.gov (United States)

    Pilla, Rachel; Snel, Gustavo G M; Malvisi, Michela; Piccinini, Renata

    2013-05-01

    Staphylococcus aureus isolates from dairy cow mastitis are not always consistent with the characteristic morphology described, and molecular investigation is often needed. The aim of the study was to develop a duplex real-time PCR assay for rapid identification of Staph. aureus isolates, targeting both nuc and Sa442. Overall, 140 isolates collected from dairy cow mastitis in 90 different herds, were tested. All strains had been identified using morphological and biochemical characteristics. DNA from each strain was amplified in real-time PCR assay, to detect nuc or Sa442. Thereafter, a duplex real-time PCR assay was performed, and specificity of the amplified products was assessed by high resolution melting curve analysis. Out of 124 Staph. aureus isolates, 33 did not show the typical morphology or enzymic activity; in 118 strains, the two melt-curve peaks consistent with nuc and Sa442 were revealed, while 2 isolates showed only the peak consistent with Sa442. Four isolates bacteriologically identified as Staph. aureus, were PCR-negative and were further identified as Staph. pseudintermedius by sequencing. Staph. pseudintermedius and coagulase-negative staphylococci did not carry nuc or Sa442. The results showed the correct identification of all isolates, comprehending also coagulase-or nuc-negative Staph. aureus, while other coagulase-positive Staphylococci were correctly identified as non-Staph. aureus. Both sensitivity and specificity were 100%. High resolution melting analysis allowed easy detection of unspecific products. Finally, the duplex real-time PCR was applied directly to 40 milk samples, to detect infected mammary quarters. The assay confirmed the results of bacteriological analysis, on Staph. aureus-positive or-negative samples. Therefore, the proposed duplex real-time PCR could be used in laboratory routine as a cost-effective and powerful tool for high-throughput identification of atypical Staph. aureus isolates causing dairy cow mastitis. Also, it

  17. Development of a specific immunomagnetic capture-PCR for rapid detection of viable Mycoplasma agalactiae in sheep milk samples.

    Science.gov (United States)

    Sanna, G; Lecca, V; Foddai, A; Tola, S

    2014-12-01

    To develop an immunomagnetic capture (IMC) to detect viable Mycoplasma agalactiae in routine ovine milk samples. Polyclonal antibodies against two M. agalactiae membrane surface proteins (P80 and P55) were covalently conjugated to magnetic beads (MBs) to form MB-Ab80 and MB-Ab55. Mycoplasma agalactiae cells were captured by a specific antigen-antibody reaction and magnetic separation. Immunomagnetic capture (IMC) was used to isolate and concentrate M. agalactiae in serial decimal dilutions and in artificially contaminated milk to facilitate subsequent detection by PCR. A 375-bp fragment of M. agalactiae was amplified using a pair of M. agalactiae-specific primers in PCR. The limit of detection of IMC-PCR method ranged from 10 to 10(2)  CCU ml(-1) when mycoplasmas were resuspended in PBS and from 10(2) to 10(3)  CCU ml(-1) when mycoplasmas were resuspended in uncontaminated ovine milk. This study also describes the application of IMC-PCR method to test for M. agalactiae in 516 milk samples collected from sheep with suspected contagious agalactia. Its performance was evaluated relative to culture. This report has demonstrated for the first time, the effective use of rapid and reliable IMC combined with PCR assay for the detection of viable M. agalactiae. The method IMC-PCR provides an alternative to conventional microbiological detection, method and it could be applied to quick detection of M. agalactiae in routine sheep milk samples. © 2014 The Authors published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

  18. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  19. An experimental study for rapid detection and quantification of endodontic microbiota following photo-activated disinfection via new multiplex real-time PCR assay.

    Science.gov (United States)

    Pourhajibagher, Maryam; Raoofian, Reza; Ghorbanzadeh, Roghayeh; Bahador, Abbas

    2018-01-11

    The infected root canal system harbors one of the highest accumulations of polymicrobial infections. Since the eradication of endopathogenic microbiota is a major goal in endodontic infection therapy, photo-activated disinfection (PAD) can be used as an alternative therapeutic method in endodontic treatment. Compared to cultivation-based approaches, molecular techniques are more reliable for identifying microbial agents associated with endodontic infections. The purpose of this study was to evaluate the ability of designed multiplex real-time PCR protocol for the rapid detection and quantification of six common microorganisms involved in endodontic infection before and after the PAD. Samples were taken from the root canals of 50 patients with primary and secondary/persistent endodontic infections using sterile paper points. PAD with toluidine blue O (TBO) plus diode laser was performed on root canals. Resampling was then performed, and the samples were transferred to transport medium. Then, six target microorganisms were detected using multiplex real-time PCR before and after the PAD. Veillonella parvula was found using multiplex real-time PCR to have the highest frequency among samples collected before the PAD (29.4%), followed by Porphyromonas. gingivalis (23.1%), Aggregatibacter actinomycetemcomitans (13.6%), Actinomyces naeslundii (13.0%), Enterococcus faecalis (11.5%), and Lactobacillus rhamnosus (9.4%). After TBO-mediated PAD, P. gingivalis strains, the most resistance microorganisms, were recovered in 41.7% of the samples using molecular approach (P > 0.05). As the results shown, multiplex real-time PCR as an accurate detection approach with high-throughput and TBO-mediated PAD as an efficient antimicrobial strategy due to the significant reduction of the endopathogenic count can be used for detection and treatment of microbiota involved in infected root canals, respectively. Copyright © 2018. Published by Elsevier B.V.

  20. Rapid in vitro splicing of coding sequences from genomic DNA by isothermal recombination reaction-based PCR

    Directory of Open Access Journals (Sweden)

    Wenxuan Chen

    2016-09-01

    Full Text Available Cloning of coding sequence (CDS is an important step for gene function research. Here, we reported a simple and efficient strategy for assembling multiple-exon into an intron-free CDS from genomic DNA (gDNA by an isothermal recombination reaction-based PCR (IRR-PCR method. As an example, a 2067-bp full-length CDS of the anther-specific expression gene OsABCG15, which is composed of seven exons and six introns, was generated by IRR-PCR using genomic DNA of rice leaf as the template. Actually, this approach can be wildly applied to any DNA sequences assembly to achieve CDS cloning, gene fusion and multiple site-directed mutagenesis in functional genomics studies in vitro.

  1. Rapid detection of Orthopoxvirus by semi-nested PCR directly from clinical specimens: a useful alternative for routine laboratories.

    Science.gov (United States)

    Abrahão, Jônatas Santos; Drumond, Betânia Paiva; Trindade, Giliane de Souza; da Silva-Fernandes, André Tavares; Ferreira, Jaqueline Maria Siqueira; Alves, Pedro Augusto; Campos, Rafael Kroon; Siqueira, Larissa; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien

    2010-04-01

    Orthopoxvirus (OPV) has been associated with worldwide exanthematic outbreaks, which have resulted in serious economic losses as well as impact on public health. Although the current classical and molecular methods are useful for the diagnosis of OPV, they are largely inaccessible to unsophisticated clinical laboratories. The major reason for the inaccessibility is that they require both virus isolation and DNA manipulation. In this report, a rapid, sensitive and low-cost semi-nested PCR method is described for the detection of OPV DNA directly from clinical specimens. A set of primers was designed to amplify the conserved OPV vgf gene. The most useful thermal and chemical conditions were selected and minimum non-inhibitory dilutions were determined. More than 100 Brazilian Vaccinia virus (VACV) field clinical specimens were tested using this semi-nested PCR in order to confirm its applicability. Cowpox virus was also detected by PCR from the ear scabs of scarified Balb/c mice. In addition, the method was highly sensitive for the detection of VACV DNA in murine blood and excreta, which are among the suggested reservoirs of OPV. Together, these data suggest that semi-nested PCR can be used for initial screening for OPV and as a routine diagnostic laboratory method. 2010 Wiley-Liss, Inc.

  2. Rapid Detection of Species of the Opportunistic Yeast Trichosporon by PCR

    Science.gov (United States)

    Sugita, Takashi; Nishikawa, Akemi; Shinoda, Takako

    1998-01-01

    Trichosporon species are opportunistic pathogens, associated with a high mortality rate in immunocompromised patients. Oligonucleotide primers were used to amplify a 170-bp fragment of small-subunit ribosomal DNA of all species in the genus Trichosporon by PCR. The primers amplify DNAs of all species in the genus Trichosporon, including six causative agents of trichosporonosis. DNAs of other medically important yeasts, such as Candida albicans and Cryptococcus neoformans, are not amplified by this detection system. PMID:9574732

  3. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples.

    Science.gov (United States)

    Zhou, Liqing; Jones, Claire; Gibani, Malick M; Dobinson, Hazel; Thomaides-Brears, Helena; Shrestha, Sonu; Blohmke, Christoph J; Darton, Thomas C; Pollard, Andrew J

    2016-01-01

    Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day. Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C) before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A. An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1-6.9) CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood), but utilized only half the volume of specimens. The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a lower limit of detection equal to 0.3 CFU

  4. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples.

    Directory of Open Access Journals (Sweden)

    Liqing Zhou

    Full Text Available Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day.Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A.An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1-6.9 CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood, but utilized only half the volume of specimens.The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a lower limit of detection

  5. Systematic review and meta-analysis: rapid diagnostic tests versus placental histology, microscopy and PCR for malaria in pregnant women

    Directory of Open Access Journals (Sweden)

    Kattenberg Johanna H

    2011-10-01

    Full Text Available Abstract Background During pregnancy, malaria infection with Plasmodium falciparum or Plasmodium vivax is related to adverse maternal health and poor birth outcomes. Diagnosis of malaria, during pregnancy, is complicated by the absence or low parasite densities in peripheral blood. Diagnostic methods, other than microscopy, are needed for detection of placental malaria. Therefore, the diagnostic accuracy of rapid diagnostic tests (RDTs, detecting antigen, and molecular techniques (PCR, detecting DNA, for the diagnosis of Plasmodium infections in pregnancy was systematically reviewed. Methods MEDLINE, EMBASE and Web of Science were searched for studies assessing the diagnostic accuracy of RDTs, PCR, microscopy of peripheral and placental blood and placental histology for the detection of malaria infection (all species in pregnant women. Results The results of 49 studies were analysed in metandi (Stata, of which the majority described P. falciparum infections. Although both placental and peripheral blood microscopy cannot reliably replace histology as a reference standard for placental P. falciparum infection, many studies compared RDTs and PCR to these tests. The proportion of microscopy positives in placental blood (sensitivity detected by peripheral blood microscopy, RDTs and PCR are respectively 72% [95% CI 62-80], 81% [95% CI 55-93] and 94% [95% CI 86-98]. The proportion of placental blood microscopy negative women that were negative in peripheral blood microscopy, RDTs and PCR (specificity are 98% [95% CI 95-99], 94% [95% CI 76-99] and 77% [95% CI 71-82]. Based on the current data, it was not possible to determine if the false positives in RDTs and PCR are caused by sequestered parasites in the placenta that are not detected by placental microscopy. Conclusion The findings suggest that RDTs and PCR may have good performance characteristics to serve as alternatives for the diagnosis of malaria in pregnancy, besides any other limitations and

  6. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples

    Science.gov (United States)

    Zhou, Liqing; Jones, Claire; Gibani, Malick M.; Dobinson, Hazel; Thomaides-Brears, Helena; Shrestha, Sonu; Blohmke, Christoph J.; Darton, Thomas C.; Pollard, Andrew J.

    2016-01-01

    Background Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day. Methods Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C) before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A. Results An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1–6.9) CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood), but utilized only half the volume of specimens. Conclusions The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a

  7. Rapid detection and differentiation of mycobacterial species using a multiplex PCR system

    Directory of Open Access Journals (Sweden)

    Andrea Santos Lima

    2013-07-01

    Full Text Available Introduction The early diagnosis of mycobacterial infections is a critical step for initiating treatment and curing the patient. Molecular analytical methods have led to considerable improvements in the speed and accuracy of mycobacteria detection. Methods The purpose of this study was to evaluate a multiplex polymerase chain reaction system using mycobacterial strains as an auxiliary tool in the differential diagnosis of tuberculosis and diseases caused by nontuberculous mycobacteria (NTM Results Forty mycobacterial strains isolated from pulmonary and extrapulmonary origin specimens from 37 patients diagnosed with tuberculosis were processed. Using phenotypic and biochemical characteristics of the 40 mycobacteria isolated in LJ medium, 57.5% (n=23 were characterized as the Mycobacterium tuberculosis complex (MTBC and 20% (n=8 as nontuberculous mycobacteria (NTM, with 22.5% (n=9 of the results being inconclusive. When the results of the phenotypic and biochemical tests in 30 strains of mycobacteria were compared with the results of the multiplex PCR, there was 100% concordance in the identification of the MTBC and NTM species, respectively. A total of 32.5% (n=13 of the samples in multiplex PCR exhibited a molecular pattern consistent with NTM, thus disagreeing with the final diagnosis from the attending physician. Conclusions Multiplex PCR can be used as a differential method for determining TB infections caused by NTM a valuable tool in reducing the time necessary to make clinical diagnoses and begin treatment. It is also useful for identifying species that were previously not identifiable using conventional biochemical and phenotypic techniques.

  8. A rapid PCR-SSP assay for the hemochromatosis-associated Tyr250Stop mutation in the TFR2 gene.

    Science.gov (United States)

    Rivers, C A; Barton, J C; Acton, R T

    2001-01-01

    Several genes associated with hemochromatosis and primary iron overload have been identified. Mutations in the HFE gene have been detected in 60-100% of hemochromatosis patients of northern, central, and western European descent, although the frequencies of these mutations vary among racial and ethnic groups. Recently, a mutation in the gene encoding transferrin receptor-2 (exon 6, nucleotide 750 C --> G; Y250X) was detected by a PCR-restriction fragment length polymorphism (RFLP) method in Sicilians with hemochromatosis. We describe a modification of the original assay in which the sequence-specific priming PCR assay does not require the use of restriction endonuclease. The modified assay is robust and cost-efficient, and may be more useful for large-scale population studies because it can be performed rapidly on DNA extracted from buccal swabs.

  9. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  10. Nested PCR for Rapid Detection of Mumps Virus in Cerebrospinal Fluid from Patients with Neurological Diseases

    Science.gov (United States)

    Poggio, Gustavo Palacios; Rodriguez, Claudia; Cisterna, Daniel; Freire, María Cecilia; Cello, Jerónimo

    2000-01-01

    In this study, we have developed a reverse transcription (RT)-nested polymerase chain reaction (n-PCR) for the detection of mumps virus RNA in cerebrospinal fluid (CSF) from patients with neurological infections. A specific 112-bp fragment was amplified by this method with primers from the nucleoprotein of the mumps virus genome. The mumps virus RT–n-PCR was capable of detecting 0.001 PFU/ml and 0.005 50% tissue culture infective dose/ml. This method was found to be specific, since no PCR product was detected in each of the CSF samples from patients with proven non-mumps virus-related meningitis or encephalitis. Mumps virus RNA was detected in all 18 CSF samples confirmed by culture to be infected with mumps virus. Positive PCR results were obtained for the CSF of 26 of 28 patients that were positive for signs of mumps virus infection (i.e., cultivable virus from urine or oropharyngeal samples or positivity for anti-mumps virus immunoglobulin M) but without cultivable virus in their CSF. Overall, mumps virus RNA was detected in CSF of 96% of the patients with a clinical diagnosis of viral central nervous system (CNS) disease and confirmed mumps virus infection, while mumps virus was isolated in CSF of only 39% of the patients. Furthermore, in a retrospective study, we were able to detect mumps virus RNA in 25 of 55 (46%) CSF samples from patients with a clinical diagnosis of viral CNS disease and negative laboratory evidence of viral infection including mumps virus infection. The 25 patients represent 12% of the 236 patients who had a clinical diagnosis of viral CNS infections and whose CSF was examined at our laboratory for a 2-year period. The findings confirm the importance of mumps virus as a causative agent of CNS infections in countries with low vaccine coverage rates. In summary, our study demonstrates the usefulness of the mumps virus RT–n-PCR for the diagnosis of mumps virus CNS disease and suggests that this assay may soon become the “gold standard

  11. Rapid identification of Campylobacter jejuni from poultry carcasses and slaughtering environment samples by real-time PCR.

    Science.gov (United States)

    Ivanova, Mirena; Singh, Randhir; Dharmasena, Muthu; Gong, Chao; Krastanov, Albert; Jiang, Xiuping

    2014-06-01

    The objective of this study was to develop a real-time PCR assay for rapid identification of Campylobacter jejuni and to apply the method in analyzing samples from poultry processing. A C. jejuni-specific primer set targeting a portion of the C. jejuni hippuricase gene was developed. The specificity of the newly designed primer pair was verified using 5 C. jejuni strains and 20 other bacterial strains. Sensitivity was determined to be as low as 1 genome copy per reaction. A total of 73 samples were collected at different sites along the processing line during 2 visits to a poultry slaughterhouse and were examined by direct plating onto modified charcoal cefoperazone deoxycholate agar or after enrichment in Bolton broth followed by plating on modified charcoal cefoperazone deoxycholate agar. The newly developed real-time PCR assay was used to identify the presumptive colonies as belonging to C. jejuni. A real-time PCR assay targeting 16S ribosomal RNA was also applied to determine Campylobacter spp. prevalence. Results from the real-time PCR analysis indicated considerable variability in Campylobacter contamination, with incidence rates of 72.7 and 27.6% for sampling days A and B, respectively. Campylobacter was isolated from 100% of prescalded and preeviscerated carcasses on sampling day A. In contrast, on sampling day B, the highest number of Campylobacter-positive carcasses was recovered after evisceration (60%). The chilling process significantly reduced (P Campylobacter population, but the percentage of positive samples on sampling day A increased to 80%. All samples collected from the processing environment, except scalding tank 3 and the prechiller and chiller tanks, were 100% positive on day A, whereas no campylobacters were isolated from machinery on sampling day B. Our results revealed the widespread of C. jejuni in poultry processing and proved that the newly developed real-time PCR assay is a simple, specific, and inexpensive method for rapid C. jejuni

  12. RAPID Outcome Mapping Approach Guide now online | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-04-27

    RAPID Outcome Mapping Approach Guide now online. April 27, 2016. Image. Roma Book Cover. After a decade of work developing the Outcome Mapping Approach, IDRC has played an important role in the development of ROMA, an adaptation of IDRC's original outcome mapping research. ROMA: A guide to policy ...

  13. Rapid detection and differentiation of important Campylobacter spp. in poultry samples by dot blot and PCR.

    Science.gov (United States)

    Fontanot, Marco; Iacumin, Lucilla; Cecchini, Francesca; Comi, Giuseppe; Manzano, Marisa

    2014-10-01

    The detection of Campylobacter, the most commonly reported cause of foodborne gastroenteritis in the European Union, is very important for human health. The most commonly recognised risk factor for infection is the handling and/or consumption of undercooked poultry meat. The methods typically applied to evaluate the presence/absence of Campylobacter in food samples are direct plating and/or enrichment culture based on the Horizontal Method for Detection and Enumeration of Campylobacter spp. (ISO 10272-1B: 2006) and PCR. Molecular methods also allow for the detection of cells that are viable but cannot be cultivated on agar media and that decrease the time required for species identification. The current study proposes the use of two molecular methods for species identification: dot blot and PCR. The dot blot method had a sensitivity of 25 ng for detection of DNA extracted from a pure culture using a digoxigenin-labelled probe for hybridisation; the target DNA was extracted from the enrichment broth at 24 h. PCR was performed using a pair of sensitive and specific primers for the detection of Campylobacter jejuni and Campylobacter coli after 24 h of enrichment in Preston broth. The initial samples were contaminated by 5 × 10 C. jejuni cells/g and 1.5 × 10(2)C. coli cells/g, thus the number of cells present in the enrichment broth at 0 h was 1 or 3 cell/g, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order...

  15. Rapid detection of human parechoviruses in clinical samples by real-time PCR

    NARCIS (Netherlands)

    Benschop, Kimberley; Molenkamp, Richard; van der Ham, Alwin; Wolthers, Katja; Beld, Marcel

    2008-01-01

    BACKGROUND: Human parechoviruses (HPeVs) have been associated with severe conditions such as neonatal sepsis and meningitis in young children. Rapid identification of an infectious agent in such serious conditions in these patients is essential for adequate decision making regarding treatment and

  16. Rapid detection and simultaneous genotyping of Cronobacter spp. (formerly Enterobacter sakazakii) in powdered infant formula using real-time PCR and high resolution melting (HRM) analysis

    National Research Council Canada - National Science Library

    Cai, Xian-Quan; Yu, Hai-Qiong; Ruan, Zhou-Xi; Yang, Lei-Liang; Bai, Jian-Shan; Qiu, De-Yi; Jian, Zhi-Hua; Xiao, Yi-Qian; Yang, Jie-Yang; Le, Thanh Hoa; Zhu, Xing-Quan

    2013-01-01

    .... The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis targeting the OmpA gene for the specific detection and rapid identification of Cronobacter spp...

  17. Rapid Detection and Simultaneous Genotyping of Cronobacter spp. (formerly Enterobacter sakazakii) in Powdered Infant Formula Using Real-time PCR and High Resolution Melting (HRM) Analysis: e67082

    National Research Council Canada - National Science Library

    Xian-Quan Cai; Hai-Qiong Yu; Zhou-Xi Ruan; Lei-Liang Yang; Jian-Shan Bai; De-Yi Qiu; Zhi-Hua Jian; Yi-Qian Xiao; Jie-Yang Yang; Thanh Hoa Le; Xing-Quan Zhu

    2013-01-01

    .... The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis targeting the OmpA gene for the specific detection and rapid identification of Cronobacter spp...

  18. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  19. Rapid and Accurate Identification by Real-Time PCR of Biotoxin-Producing Dinoflagellates from the Family Gymnodiniaceae

    Directory of Open Access Journals (Sweden)

    Kirsty F. Smith

    2014-03-01

    Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  20. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay.

    Science.gov (United States)

    Kim, Suk Ran; Ki, Chang-Seok; Lee, Nam Yong

    2009-03-01

    Acute viral respiratory infections are among the most common causes of human disease. Rapid and accurate diagnosis of viral respiratory infections is important for providing timely therapeutic interventions. This study evaluated a new multiplex PCR assay (Seegene Inc., Seoul, Korea) for simultaneous detection and identification of 12 respiratory viruses using two primer mixes. The viruses included parainfluenza viruses 1, 2, and 3, human metapneumovirus, human coronavirus 229E/NL63 and OC43, adenovirus, influenza viruses A and B, human respiratory syncytial viruses A and B, and human rhinovirus A. The analytical sensitivity of the assay was 10-100 copies per reaction for each type of virus. There was no cross-reactivity with common bacterial or viral pathogens. A comparison with conventional viral culture and immunofluorescence was carried out using 101 respiratory specimens from 92 patients. Using viral culture, 57 specimens (56.4%) were positive without co-infection. The same viruses were identified in all 57 specimens using the multiplex PCR. Seven of the 57 specimens (12.3%) were found to be co-infected with other respiratory viruses, and 19 of 44 (43.2%) specimens which were negative by culture were positive by the multiplex PCR. The Seeplex Respiratory Virus Detection assay represents a significant improvement over the conventional methods for the detection of a broad spectrum of respiratory viruses.

  2. Rapid detection and identification of Wuchereria bancrofti, Brugia malayi, B. pahangi, and Dirofilaria immitis in mosquito vectors and blood samples by high resolution melting real-time PCR.

    Science.gov (United States)

    Thanchomnang, Tongjit; Intapan, Pewpan M; Tantrawatpan, Chairat; Lulitanond, Viraphong; Chungpivat, Sudchit; Taweethavonsawat, Piyanan; Kaewkong, Worasak; Sanpool, Oranuch; Janwan, Penchom; Choochote, Wej; Maleewong, Wanchai

    2013-12-01

    A simple, rapid, and high-throughput method for detection and identification of Wuchereria bancrofti, Brugia malayi, Brugia pahangi, and Dirofilaria immitis in mosquito vectors and blood samples was developed using a real-time PCR combined with high-resolution melting (HRM) analysis. Amplicons of the 4 filarial species were generated from 5S rRNA and spliced leader sequences by the real-time PCR and their melting temperatures were determined by the HRM method. Melting of amplicons from W. bancrofti, B. malayi, D. immitis, and B. pahangi peaked at 81.5±0.2℃, 79.0±0.3℃, 76.8±0.1℃, and 79.9±0.1℃, respectively. This assay is relatively cheap since it does not require synthesis of hybridization probes. Its sensitivity and specificity were 100%. It is a rapid and technically simple approach, and an important tool for population surveys as well as molecular xenomonitoring of parasites in vectors.

  3. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Directory of Open Access Journals (Sweden)

    Vijay K Chaudhary

    Full Text Available Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  4. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  5. A new real-time PCR method for rapid and specific detection of ling (Molva molva).

    Science.gov (United States)

    Taboada, Ledicia; Sánchez, Ana; Sotelo, Carmen G

    2017-08-01

    Seafood fraud - often involving substitution of one species by another - has attracted much attention as it is prevalent worldwide. Whilst DNA analysis has helped to combat this type of fraud some of the methods currently in use are time-consuming and require sophisticated equipment or highly-trained personnel. This work describes the development of a new, real-time PCR TaqMan assay for the detection of ling (Molva molva) in seafood products. For this purpose, specific primers and a minor groove binding (MGB) TaqMan probe were designed to amplify the 81bp region on the cyt b gene. Efficiency, specificity and cross-reactivity assays showed statistically significant differences between the average Ct value obtained for Molva molva DNA (19.45±0.65) and the average Ct for non-target species DNA (38.3±2.8), even with closely related species such as Molva dypterygia (34.9±0.09). The proposed methodology has been validated with 31 commercial samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Rapid concentration and sensitive detection of hookworm ova from wastewater matrices using a real-time PCR method.

    Science.gov (United States)

    Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

    2015-12-01

    The risk of human hookworm infections from land application of wastewater matrices could be high in regions with high hookworm prevalence. A rapid, sensitive and specific hookworm detection method from wastewater matrices is required in order to assess human health risks. Currently available methods used to identify hookworm ova to the species level are time consuming and lack accuracy. In this study, a real-time PCR method was developed for the rapid, sensitive and specific detection of canine hookworm (Ancylostoma caninum) ova from wastewater matrices. A. caninum was chosen because of its morphological similarity to the human hookworm (Ancylostoma duodenale and Necator americanus). The newly developed PCR method has high detection sensitivity with the ability to detect less than one A. caninum ova from 1 L of secondary treated wastewater at the mean threshold cycle (CT) values ranging from 30.1 to 34.3. The method is also able to detect four A. caninum ova from 1 L of raw wastewater and from ∼4 g of treated sludge with mean CT values ranging from 35.6 to 39.8 and 39.8 to 39.9, respectively. The better detection sensitivity obtained for secondary treated wastewater compared to raw wastewater and sludge samples could be attributed to sample turbidity. The proposed method appears to be rapid, sensitive and specific compared to traditional methods and has potential to aid in the public health risk assessment associated with land application of wastewater matrices. Furthermore, the method can be adapted to detect other helminth ova of interest from wastewater matrices. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  7. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  8. A novel approach for rapid micropropagation of maspine pineapple ...

    African Journals Online (AJOL)

    A novel approach for rapid micropropagation of maspine pineapple ( Ananas comosus L.) shoots using liquid shake culture system. ... Large quantities of plant materials are needed to fulfill the market demand which could not be obtained from the conventional breeding method. Hence, in vitro procedure was developed as ...

  9. ODI launches RAPID Outcome Mapping Approach online guide ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2014-06-17

    Jun 17, 2014 ... The UK-based Overseas Development Institute has released its online guide to understanding, engaging with, and influencing policy. ... The RAPID team's focus on learning and evolution remains a central part of the approach, with a chapter devoted to the design of monitoring and evaluation activities that ...

  10. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    which were probably infected with RA were chosen to identify the accuracy and sensitivity of this PCR method. Several other conventional detecting methods including bacteria isolating, differentiating culture, biochemical experiments and serotyping were used at the same time. The templates of PCR were extracted from brains or livers by boiling method with Chelex 100. Finally, 3 cases were identified as RA infection by the conventional methods and 4 by the PCR method, which proved the good accuracy and sensitivity of the PCR method. Thus, this PCR assay provides a rapid and accurate method for identification of Riemerella anatipestifer. It will help to make the final decision in clinical diagnose or species identification, especially when a new serotype or sub-serotype of RA comes up.

  11. Reverse transcription-PCR-electrospray ionization mass spectrometry for rapid detection of biothreat and common respiratory pathogens.

    Science.gov (United States)

    Jeng, Kevin; Hardick, Justin; Rothman, Richard; Yang, Samuel; Won, Helen; Peterson, Stephen; Hsieh, Yu-Hsiang; Masek, Billie Jo; Carroll, Karen C; Gaydos, Charlotte A

    2013-10-01

    Electrospray ionization mass spectrometry (ESI-MS) analysis of reverse transcription (RT)-PCR amplicons from human respiratory samples allows for broad pathogen identification approximately 8 h after collection. We investigated the performance characteristics of a high-throughput RT-PCR-coupled ESI-MS assay for distinguishing biothreat (BT) agents from common bacterial, fungal, and viral respiratory pathogens in bronchoalveolar lavage (BAL) fluid specimens from subjects with suspected respiratory infections. In a retrospective case series, 202 BAL fluid specimens were collected at the Johns Hopkins Hospital between August 2010 and February 2011 from patients with suspected acute respiratory infections. Samples were processed using standard bacterial, viral, and fungal testing in the clinical microbiology laboratory as part of routine care and then were blindly spiked with either water or nucleic acids from BT organisms (Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella spp., Burkholderia spp., and Rickettsia prowazekii) and tested by RT-PCR-ESI-MS. The sensitivities and specificities of RT-PCR-ESI-MS versus standard clinical methods were as follows: for mock BT DNA, 98.5% sensitivity (95% confidence interval [CI], 94.2 to 99.7%) and 100% specificity (95% CI, 93.1 to 100.0%); for bacterial pathogens, 81.8% sensitivity (95% CI, 74.3 to 87.6%) and 73.6% specificity (95% CI, 64.2 to 81.4%); for viral pathogens, 93.3% sensitivity (95% CI, 66.0 to 99.7%) and 97.3% specificity (95% CI, 89.7 to 99.5%); for fungal pathogens, 42.6% sensitivity (95% CI, 29.5 to 56.7%) and 97.8% specificity (95% CI, 91.8 to 99.6%). Our data suggest that RT-PCR-ESI-MS is a useful adjunct to standard culture protocols for rapid detection of both BT and common respiratory pathogens; further study is required for assay validation, especially for fungal detection, and potential implementation.

  12. Development and application of a reverse transcriptase droplet digital PCR (RT-ddPCR) for sensitive and rapid detection of Japanese encephalitis virus.

    Science.gov (United States)

    Wu, Xulong; Lin, Hua; Chen, Shijie; Xiao, Lu; Yang, Miao; An, Wei; Wang, Yin; Yao, Xueping; Yang, Zexiao

    2017-10-01

    Japanese encephalitis (JE) is one of the most common zoonoses caused by Japanese encephalitis virus (JEV). Droplet digital PCR (ddPCR) is a novel sensitive, accurate method that enables absolute quantitation without the need for calibration curves. The aim of this study was to develop a RT-ddPCR method to detect JEV, and to compare its sensitivity with real-time TaqMan RT-PCR by analysis of clinical samples. The methods of JEV real-time RT-PCR and RT-ddPCR were established and optimal reaction conditions were confirmed. Each method was evaluated for linearity, limit of detection and specificity. A total of 103 porcine samples were analysed by both methods and the detection rate was calculated. Both methods showed a high degree of linearity and positive correlation for standards (R(2)≥0.999). The assays indicated that the detection limit for RT-ddPCR was approximately 2 copies/20μL well, a 100-fold greater sensitivity than TaqMan real-time RT-PCR. The detection results for clinical samples showed that the positive detection rate of RT-ddPCR (27.2%) was higher than that of TaqMan real-time RT-PCR (16.5%). The cross-reaction was performed with other porcine pathogens, and negative amplification of the cross-reaction assay demonstrated the high specificity of this method. The novel JEV RT-ddPCR assay could be used as an efficient molecular biology tool to diagnose JEV, which would facilitate the surveillance of reproductive failure disease in swineries and would be beneficial for public health security. Copyright © 2017. Published by Elsevier B.V.

  13. Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments.

    Science.gov (United States)

    Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

    2017-01-01

    In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis.

  14. Rapid PCR Detection of Staphylococcus aureus Clonal Complex 398 by Targeting the Restriction-Modification System Carrying sau1-hsdS1

    NARCIS (Netherlands)

    Stegger, M.; Lindsay, J.A.; Moodley, A.; Skov, R.; Broens, E.M.; Guardabassi, L.

    2011-01-01

    A PCR targeting sau1-hsdS1 was developed for rapid detection of Staphylococcus aureus clonal complex 398 (CC398). High sensitivity (100%) and specificity (100%) were shown by evaluating the test on a large strain collection (n = 1,307). We recommend this test for accurate, rapid, and inexpensive

  15. A modified MS-PCR approach to diagnose patients with Prader-Willi and Angelman syndrome.

    Science.gov (United States)

    Dos Santos, Jéssica Fernandes; Mota, Laís R; Rocha, Pedro Henrique Silva Andrade; Ferreira de Lima, Renata Lúcia L

    2016-11-01

    Prader-Willi (PWS) and Angelman (AS) syndromes are clinically distinct neurodevelopmental genetic diseases with multiple phenotypic manifestations. They are one of the most common genetic syndromes caused by non-Mendelian inheritance in the form of genomic imprinting, and can be attributable to the loss of gene expression due to imprinting within the chromosomal region 15q11-q13. Clinical diagnosis of PWS and AS is challenging, and the use of molecular and cytomolecular studies is recommended to help in determining the diagnosis of these conditions. The methylation analysis is a sensible approach; however there are several techniques for this purpose, such as the methylation-sensitive polymerase chain reaction (MS-PCR). This study aims to optimize the MS-PCR assay for the diagnosis of potential PWS and AS patients using DNA modified by sodium bisulfite. We used the MS-PCR technique of PCR described by Kosaki et al. (1997) adapted with betaine. All different concentrations of betaine used to amplify the methylated and unmethylated chromosomal region 15q11-q13 on the gene SNRPN showed amplification results, which increased proportionally to the concentration of betaine. The methylation analysis is a technically robust and reproducible screening method for PWS and AS. The MS-PCR assures a faster, cheaper and more efficient method for the primary diagnosis of the SNRPN gene in cases with PWS and AS, and may detect all of the three associated genetic abnormalities: deletion, uniparental disomy or imprinting errors.

  16. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  18. Economic Impact of a New Rapid PCR Assay for Detecting Influenza Virus in an Emergency Department and Hospitalized Patients.

    Science.gov (United States)

    Soto, Marcelo; Sampietro-Colom, Laura; Vilella, Anna; Pantoja, Efraín; Asenjo, María; Arjona, Ruth; Hurtado, Juan Carlos; Trilla, Antoni; Alvarez-Martínez, Míriam José; Mira, Aurea; Vila, Jordi; Marcos, María Angeles

    2016-01-01

    Seasonal influenza causes significant morbidity and mortality and has a substantial economic impact on the healthcare system. The main objective of this study was to compare the cost per patient for a rapid commercial PCR assay (Xpert® Flu) with an in-house real-time PCR test for detecting influenza virus. Community patients with influenza like-illness attending the Emergency Department (ED) as well as hospitalized patients in the Hospital Clínic of Barcelona were included. Costs were evaluated from the perspective of the hospital considering the use of resources directly related to influenza testing and treatment. For the purpose of this study, 366 and 691 patients were tested in 2013 and 2014, respectively. The Xpert® Flu test reduced the mean waiting time for patients in the ED by 9.1 hours and decreased the mean isolation time of hospitalized patients by 23.7 hours. This was associated with a 103€ (or about $113) reduction in the cost per patient tested in the ED and 64€ ($70) per hospitalized patient. Sensitivity analyses showed that Xpert® Flu is likely to be cost-saving in hospitals with different contexts and prices.

  19. PCR approach for the detection of Trypanosoma brucei and T. equiperdum and their differentiation from T. evansi based on maxicircle kinetoplast DNA.

    Science.gov (United States)

    Li, Feng-Jun; Gasser, Robin B; Lai, De-Hua; Claes, Filip; Zhu, Xing-Quan; Lun, Zhao-Rong

    2007-02-01

    The goal of this study was to develop a PCR approach based on the sequence of maxicircle kinetoplast DNA (kDNA) of Trypanosoma brucei to distinguish T. brucei/T. equiperdum from T. evansi and to evaluate its diagnostic use for their detection in blood samples. Primers derived from the sequence of the maxicircle kDNA of T. brucei, encoding the NADH dehydrogenase subunit 5 (nad5) gene, were used to test the PCR-amplification from T. brucei (including T. b. brucei and T. b. rhodesiense), T. equiperdum, T. evansi, T. vivax and T. congolense. A primer pair to a nuclear DNA region incorporated into a separate PCR was employed to control for the presence of amplifiable genomic DNA (representing the subgenus Trypanozoon) in each sample subjected to the PCR. Products of approximately 395bp were amplified from all T. brucei and T. equiperdum samples tested using the nad5-PCR, but not from T. evansi DNA samples or any of the control samples representing T. vivax, T. congolense, or host. The current PCR approach allows the rapid differentiation of T. brucei/T.equiperdum from T. evansi and can detect the equivalent of 20-25 cells of T. brucei or T. equiperdum in purified genomic DNA or infected blood samples.

  20. Comparison of concentration methods for rapid detection of hookworm ova in wastewater matrices using quantitative PCR.

    Science.gov (United States)

    Gyawali, P; Ahmed, W; Jagals, P; Sidhu, J P S; Toze, S

    2015-12-01

    Hookworm infection contributes around 700 million infections worldwide especially in developing nations due to increased use of wastewater for crop production. The effective recovery of hookworm ova from wastewater matrices is difficult due to their low concentrations and heterogeneous distribution. In this study, we compared the recovery rates of (i) four rapid hookworm ova concentration methods from municipal wastewater, and (ii) two concentration methods from sludge samples. Ancylostoma caninum ova were used as surrogate for human hookworm (Ancylostoma duodenale and Necator americanus). Known concentration of A. caninum hookworm ova were seeded into wastewater (treated and raw) and sludge samples collected from two wastewater treatment plants (WWTPs) in Brisbane and Perth, Australia. The A. caninum ova were concentrated from treated and raw wastewater samples using centrifugation (Method A), hollow fiber ultrafiltration (HFUF) (Method B), filtration (Method C) and flotation (Method D) methods. For sludge samples, flotation (Method E) and direct DNA extraction (Method F) methods were used. Among the four methods tested, filtration (Method C) method was able to recover higher concentrations of A. caninum ova consistently from treated wastewater (39-50%) and raw wastewater (7.1-12%) samples collected from both WWTPs. The remaining methods (Methods A, B and D) yielded variable recovery rate ranging from 0.2 to 40% for treated and raw wastewater samples. The recovery rates for sludge samples were poor (0.02-4.7), although, Method F (direct DNA extraction) provided 1-2 orders of magnitude higher recovery rate than Method E (flotation). Based on our results it can be concluded that the recovery rates of hookworm ova from wastewater matrices, especially sludge samples, can be poor and highly variable. Therefore, choice of concentration method is vital for the sensitive detection of hookworm ova in wastewater matrices. Crown Copyright © 2015. Published by Elsevier

  1. Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

    Science.gov (United States)

    Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

    2017-10-27

    Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Hung, Tran Quang; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to increase the yield of the solid-phase amplification, we studied various parameters including the length, the density, as well as the annealing position of the solid support primer. A dramatic increase in the signal-to-noise (S/N) ratio was observed when increasing the length of solid support primers from 45 to 80 bp. The density of the primer on the surface was found to be important for the S/N ratio of the SP-PCR, and the optimal S/N was obtained with a density of 1.49 × 1011 molecules/mm2. In addition, the use of solid support primers with a short overhang at the 5' end would help improve the S/N ratio of the SP-PCR. With optimized conditions, SP-PCR can achieve amplification efficiency comparable to conventional PCR, with a limit of detection of 1.5 copies/μl (37.5 copies/reaction). These improvements will pave the way for wider applications of SP-PCR in various fields such as clinical diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR.

  3. PCR Strategies for Complete Allele Calling in Multigene Families Using High-Throughput Sequencing Approaches.

    Directory of Open Access Journals (Sweden)

    Elena Marmesat

    Full Text Available The characterization of multigene families with high copy number variation is often approached through PCR amplification with highly degenerate primers to account for all expected variants flanking the region of interest. Such an approach often introduces PCR biases that result in an unbalanced representation of targets in high-throughput sequencing libraries that eventually results in incomplete detection of the targeted alleles. Here we confirm this result and propose two different amplification strategies to alleviate this problem. The first strategy (called pooled-PCRs targets different subsets of alleles in multiple independent PCRs using different moderately degenerate primer pairs, whereas the second approach (called pooled-primers uses a custom-made pool of non-degenerate primers in a single PCR. We compare their performance to the common use of a single PCR with highly degenerate primers using the MHC class I of the Iberian lynx as a model. We found both novel approaches to work similarly well and better than the conventional approach. They significantly scored more alleles per individual (11.33 ± 1.38 and 11.72 ± 0.89 vs 7.94 ± 1.95, yielded more complete allelic profiles (96.28 ± 8.46 and 99.50 ± 2.12 vs 63.76 ± 15.43, and revealed more alleles at a population level (13 vs 12. Finally, we could link each allele's amplification efficiency with the primer-mismatches in its flanking sequences and show that ultra-deep coverage offered by high-throughput technologies does not fully compensate for such biases, especially as real alleles may reach lower coverage than artefacts. Adopting either of the proposed amplification methods provides the opportunity to attain more complete allelic profiles at lower coverages, improving confidence over the downstream analyses and subsequent applications.

  4. Gastric Juice-Based Real-Time PCR for Tailored Helicobacter Pylori Treatment: A Practical Approach.

    Science.gov (United States)

    Peng, Xianhui; Song, Zhiqiang; He, Lihua; Lin, Sanren; Gong, Yanan; Sun, Lu; Zhao, Fei; Gu, Yixin; You, Yuanhai; Zhou, Liya; Zhang, Jianzhong

    2017-01-01

    A gastric juice-based real-time polymerase chain reaction (PCR) assay was established to identify Helicobacter pylori infection, clarithromycin susceptibility and human CYP2C19 genotypes and to guide the choice of proton pump inhibitor (PPI), clarithromycin and amoxicillin treatment for tailored H. pylori eradication therapy. From January 2013 to November 2014, 178 consecutive dyspeptic patients were enrolled for collection of gastric biopsy samples and gastric juice by endoscopy at the Peking University Third Hospital; 105 and 73 H. pylori-positive and -negative patients, respectively, were included in this study. H. pylori infection was defined as samples with both a strongly positive rapid urease test (RUT) and positive H. pylori histology. A series of primers and probes were distributed into four reactions for identifying the H. pylori cagH gene coupled with an internal control (Rnase P gene), A2142G and A2143G mutants of the H. pylori 23S rRNA gene, and single-nucleotide polymorphisms (SNPs) G681A of CYP2C19*2 and G636A of CYP2C19*3. The E-test and DNA sequencing were used to evaluate the H. pylori clarithromycin susceptibility phenotype and genotype. The SNPs CYP2C19*2 and CYP2C19*3 were also evaluated by nucleotide sequencing. The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of this gastric juice-based real-time PCR assay were evaluated by comparing with the same measures obtained through gastric biopsy-based PCR and culture. The H. pylori diagnostic sensitivities of the culture, PCR, and gastric biopsy- and gastric juice-based real-time PCR assays were 90.48% (95/105), 92.38% (97/105), 97.14% (102/105) and 100% (105/105), respectively; the specificities of the above methods were all 100%. Higher false-negative rates were found among the gastric biopsy samples assessed by culture (10.48%, 11/105), PCR (7.62%, 8/105) and real-time PCR (2.86%, 3/105) than in gastric juice by real-time PCR. Regarding

  5. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    Directory of Open Access Journals (Sweden)

    Xian-Quan Cai

    2014-01-01

    Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  6. Accurate and rapid identification of the Burkholderia pseudomallei near-neighbour, Burkholderia ubonensis, using real-time PCR.

    Science.gov (United States)

    Price, Erin P; Sarovich, Derek S; Webb, Jessica R; Ginther, Jennifer L; Mayo, Mark; Cook, James M; Seymour, Meagan L; Kaestli, Mirjam; Theobald, Vanessa; Hall, Carina M; Busch, Joseph D; Foster, Jeffrey T; Keim, Paul; Wagner, David M; Tuanyok, Apichai; Pearson, Talima; Currie, Bart J

    2013-01-01

    Burkholderia ubonensis is an environmental bacterium belonging to the Burkholderia cepacia complex (Bcc), a group of genetically related organisms that are associated with opportunistic but generally nonfatal infections in healthy individuals. In contrast, the near-neighbour species Burkholderia pseudomallei causes melioidosis, a disease that can be fatal in up to 95% of cases if left untreated. B. ubonensis is frequently misidentified as B. pseudomallei from soil samples using selective culturing on Ashdown's medium, reflecting both the shared environmental niche and morphological similarities of these species. Additionally, B. ubonensis shows potential as an important biocontrol agent in B. pseudomallei-endemic regions as certain strains possess antagonistic properties towards B. pseudomallei. Current methods for characterising B. ubonensis are laborious, time-consuming and costly, and as such this bacterium remains poorly studied. The aim of our study was to develop a rapid and inexpensive real-time PCR-based assay specific for B. ubonensis. We demonstrate that a novel B. ubonensis-specific assay, Bu550, accurately differentiates B. ubonensis from B. pseudomallei and other species that grow on selective Ashdown's agar. We anticipate that Bu550 will catalyse research on B. ubonensis by enabling rapid identification of this organism from Ashdown's-positive colonies that are not B. pseudomallei.

  7. Accurate and rapid identification of the Burkholderia pseudomallei near-neighbour, Burkholderia ubonensis, using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Erin P Price

    Full Text Available Burkholderia ubonensis is an environmental bacterium belonging to the Burkholderia cepacia complex (Bcc, a group of genetically related organisms that are associated with opportunistic but generally nonfatal infections in healthy individuals. In contrast, the near-neighbour species Burkholderia pseudomallei causes melioidosis, a disease that can be fatal in up to 95% of cases if left untreated. B. ubonensis is frequently misidentified as B. pseudomallei from soil samples using selective culturing on Ashdown's medium, reflecting both the shared environmental niche and morphological similarities of these species. Additionally, B. ubonensis shows potential as an important biocontrol agent in B. pseudomallei-endemic regions as certain strains possess antagonistic properties towards B. pseudomallei. Current methods for characterising B. ubonensis are laborious, time-consuming and costly, and as such this bacterium remains poorly studied. The aim of our study was to develop a rapid and inexpensive real-time PCR-based assay specific for B. ubonensis. We demonstrate that a novel B. ubonensis-specific assay, Bu550, accurately differentiates B. ubonensis from B. pseudomallei and other species that grow on selective Ashdown's agar. We anticipate that Bu550 will catalyse research on B. ubonensis by enabling rapid identification of this organism from Ashdown's-positive colonies that are not B. pseudomallei.

  8. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...... steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence...

  9. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...... steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence...

  10. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

    OpenAIRE

    fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-01-01

    Objective: To analyse molecular detection of coliforms and shorten the time of PCR. Methods: Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated...

  11. Development of a simplified RT-PCR without RNA isolation for rapid detection of RNA viruses in a single small brown planthopper (Laodelphax striatellus Fallén).

    Science.gov (United States)

    Xu, Qiufang; Liu, Haoqiu; Yuan, Pingping; Zhang, Xiaoxia; Chen, Qingqing; Jiang, Xuanli; Zhou, Yijun

    2017-05-03

    The small brown planthopper (SBPH) is an important pest of cereal crops and acts as a transmission vector for multiple RNA viruses. Rapid diagnosis of virus in the vector is crucial for efficient forecast and control of viral disease. Reverse transcription polymerase chain reaction (RT-PCR) is a rapid, sensitive and reliable method for virus detection. The traditional RT-PCR contains a RNA isolation step and is widely used for virus detection in insect. However, using the traditional RT-PCR for detecting RNA virus in individual SBPHs becomes challenging because of the expensive reagents and laborious procedure associated with RNA isolation when processing a large number of samples. We established a simplified RT-PCR method without RNA isolation for RNA virus detection in a single SBPH. This method is achieved by grinding a single SBPH in sterile water and using the crude extract directly as the template for RT-PCR. The crude extract containing the virus RNA can be prepared in approximately two minutes. Rice stripe virus (RSV), rice black streaked dwarf virus (RBSDV) and Himetobi P virus (HiPV) were successfully detected using this simplified method. The detection results were validated by sequencing and dot immunobinding assay, indicating that this simplified method is reliable for detecting different viruses in insects. The evaluation of the sensitivity of this method showed that both RSV and HiPV can be detected when the cDNA from the crude extract was diluted up to 10 3 fold. Compared to the traditional RT-PCR with RNA isolation, the simplified RT-PCR method greatly reduces the sample processing time, decreases the detection cost, and improves the efficiency by avoiding RNA isolation. A simplified RT-PCR method is developed for rapid detection of RNA virus in a single SBPH without the laborious RNA isolation step. It offers a convenient alternative to the traditional RT-PCR method.

  12. Rapid quantification of viable Campylobacter on chicken carcasses by real-time PCR and propidium monoazide as a tool for quantitative risk assessment

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

    2010-01-01

    of foodborne Campylobacter, combining real-time PCR (Q-PCR) with a simple propidium monoazide (PMA) sample treatment. In less than 3 hours, this method generates a signal from only viable and viable but non-culturable (VBNC) Campylobacter with an intact membrane. The method performance was evaluated......-values (R2 = 0.993), with a quantification range from 1×1021×107 CFU/ml. The correlation between the Campylobacter counts obtained by PMA-PCR and culture on naturally contaminated chickens was high (R2 = 0.844). The amplification efficiency of the Q-PCR method was not affected by chicken rinse matrix...... or by species of Campylobacter. No Q-PCR signals were obtained from artificially inoculated chicken rinse when PMA sample treatment was applied. In conclusion, this study presents a rapid tool for producing reliable quantitative data on viable Campylobacter in chicken carcass rinse. The proposed method does...

  13. Rapid Quantification of Viable Campylobacter Bacteria on Chicken Carcasses, Using Real-Time PCR and Propidium Monoazide Treatment, as a Tool for Quantitative Risk Assessment

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

    2010-01-01

    of foodborne Campylobacter, combining real-time PCR (Q-PCR) with a simple propidium monoazide (PMA) sample treatment. In less than 3 hours, this method generates a signal from only viable and viable but non-culturable (VBNC) Campylobacter with an intact membrane. The method performance was evaluated......-values (R(2) = 0.993), with a quantification range from 1x10(2)-1x10(7) CFU/ml. The correlation between the Campylobacter counts obtained by PMA-PCR and culture on naturally contaminated chickens was high (R(2) = 0.844). The amplification efficiency of the Q-PCR method was not affected by chicken rinse...... matrix or by species of Campylobacter. No Q-PCR signals were obtained from artificially inoculated chicken rinse when PMA sample treatment was applied. In conclusion, this study presents a rapid tool for producing reliable quantitative data on viable Campylobacter in chicken carcass rinse. The proposed...

  14. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  15. The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus

    Science.gov (United States)

    2010-01-01

    Background Prompt detection of PRRSV in the field samples is important for effective PRRS control, thereby reducing the potentially serious economic damage which can result from an outbreak. In this study, a rapid SYBR-based, one step real-time RT-PCR quantitative reverse transcription PCR (qRT-PCR) has been developed for the detection of porcine reproductive and respiratory syndrome virus (PRRSV). Primers were designed based on the sequence of highly conservative region of PRRSV N gene. Results The sensitivity of the real-time qRT-PCR assay was achieved through PRRSV ch-1a RNA for the generation of a standard curve. The detection limit of the assay was found to be 9.6 RNA copies per reaction mixture. This assay had excellent intra- and inter-assay reproducibility as in total 65 field samples were screened for the presence of PRRSV by conventional RT-PCR in parallel with qRT-PCR, and the detection rate increased from 60.0% to 76.9%. Moreover, the specificity result indicated that this assay could reliably differentiate PRRSV from the other swine viral diseases, such as classical swine fever virus (CSFV), swine vesicular disease virus (SVDV) and vesicular exanthema of swine virus (VESV). Conclusion The real-time qRT-PCR assay described in this report allows the rapid, specific and sensitive laboratory detection of PRRSV in field samples. PMID:20459705

  16. The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus

    Directory of Open Access Journals (Sweden)

    Liu XiangTao

    2010-05-01

    Full Text Available Abstract Background Prompt detection of PRRSV in the field samples is important for effective PRRS control, thereby reducing the potentially serious economic damage which can result from an outbreak. In this study, a rapid SYBR-based, one step real-time RT-PCR quantitative reverse transcription PCR (qRT-PCR has been developed for the detection of porcine reproductive and respiratory syndrome virus (PRRSV. Primers were designed based on the sequence of highly conservative region of PRRSV N gene. Results The sensitivity of the real-time qRT-PCR assay was achieved through PRRSV ch-1a RNA for the generation of a standard curve. The detection limit of the assay was found to be 9.6 RNA copies per reaction mixture. This assay had excellent intra- and inter-assay reproducibility as in total 65 field samples were screened for the presence of PRRSV by conventional RT-PCR in parallel with qRT-PCR, and the detection rate increased from 60.0% to 76.9%. Moreover, the specificity result indicated that this assay could reliably differentiate PRRSV from the other swine viral diseases, such as classical swine fever virus (CSFV, swine vesicular disease virus (SVDV and vesicular exanthema of swine virus (VESV. Conclusion The real-time qRT-PCR assay described in this report allows the rapid, specific and sensitive laboratory detection of PRRSV in field samples.

  17. Rapid PCR-Based Diagnosis of Septic Arthritis by Early Gram-Type Classification and Pathogen Identification▿

    Science.gov (United States)

    Yang, Samuel; Ramachandran, Padmini; Hardick, Andrew; Hsieh, Yu-Hsiang; Quianzon, Celeste; Kuroki, Marcos; Hardick, Justin; Kecojevic, Aleksandar; Abeygunawardena, Avanthi; Zenilman, Jonathan; Melendez, Johan; Doshi, Vishal; Gaydos, Charlotte; Rothman, Richard E.

    2008-01-01

    Septic arthritis (SA) is a rheumatologic emergency associated with significant morbidity and mortality. Delayed or inadequate treatment of SA can lead to irreversible joint destruction and disability. Current methods of diagnosing SA rely on synovial fluid analysis and culture which are known to be imprecise and time-consuming. We report a novel adaptation of a probe-based real-time PCR assay targeting the 16S rRNA gene for early and accurate diagnosis of bacterial SA. The assay algorithm consists of initial broad-range eubacterial detection, followed by Gram typing and species characterization of the pathogen. The platform demonstrated a high analytical sensitivity with a limit of detection of 101 CFU/ml with a panel of SA-related organisms. Gram typing and pathogen-specific probes correctly identified their respective targets in a mock test panel of 36 common clinically relevant pathogens. One hundred twenty-one clinical synovial fluid samples from patients presenting with suspected acute SA were tested. The sensitivity and specificity of the assay were 95% and 97%, respectively, versus synovial fluid culture results. Gram-typing probes correctly identified 100% of eubacterial positive samples as to gram-positive or gram-negative status, and pathogen-specific probes correctly identified the etiologic agent in 16/20 eubacterial positive samples. The total assay time from sample collection to result is 3 h. We have demonstrated that a real-time broad-based PCR assay has high analytical and clinical performance with an improved time to detection versus culture for SA. This assay may be a useful diagnostic adjunct for clinicians, particularly those practicing in the acute care setting where rapid pathogen detection and identification would assist in disposition and treatment decisions. PMID:18305128

  18. Rapid and sensitive detection of cytokines using functionalized gold nanoparticle-based immuno-PCR, comparison with immuno-PCR and ELISA

    Czech Academy of Sciences Publication Activity Database

    Potůčková, Lucie; Franko, Filip; Bambousková, Monika; Dráber, Petr

    2011-01-01

    Roč. 371, 1-2 (2011), s. 38-47 ISSN 0022-1759 R&D Projects: GA AV ČR KAN200520701; GA MŠk 1M0506; GA MŠk LC545; GA ČR GA301/09/1826; GA ČR GAP302/10/1759; GA ČR(CZ) GD204/05/H023 Grant - others:AV ČR(CZ) M200520901 Institutional research plan: CEZ:AV0Z50520514 Keywords : immuno-PCR * nano-iPCR * nanogold particles Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.203, year: 2011

  19. Primer Based Approach for PCR Amplification of High GC Content Gene: Mycobacterium Gene as a Model

    Directory of Open Access Journals (Sweden)

    Arbind Kumar

    2014-01-01

    Full Text Available The genome of Mycobacterium is rich in GC content and poses problem in amplification of some genes, especially those rich in the GC content in terminal regions, by standard/routine PCR procedures. Attempts have been made to amplify three GC rich genes of Mycobacterium sp. (Rv0519c and Rv0774c from M. tuberculosis and ML0314c from M. leprae. Out of these three genes, Rv0774c gene was amplified with normal primers under standard PCR conditions, while no amplification was observed in case of Rv0519c and ML0314c genes. In the present investigation a modified primer based approach was successfully used for amplification of GC rich sequence of Rv0519c through codon optimization without changing the native amino acid sequence. The strategy was successfully confirmed by redesigning the standard primers with similar modifications followed by amplification of ML0314c gene.

  20. Rapid identification viruses from nasal pharyngeal aspirates in acute viral respiratory infections by RT-PCR and electrospray ionization mass spectrometry.

    Science.gov (United States)

    Chen, Kuan-Fu; Rothman, Richard E; Ramachandran, Padmini; Blyn, Lawrence; Sampath, Rangarajan; Ecker, David J; Valsamakis, Alexandra; Gaydos, Charlotte A

    2011-04-01

    Diagnosis of the etiologic agent of respiratory viral infection relies traditionally on culture or antigen detection. This pilot evaluation compared performance characteristics of the RT-PCR and electrospray ionization mass spectrometry (RT-PCR/ESI-MS) platform to conventional virologic methods for identifying multiple clinically relevant respiratory viruses in nasopharyngeal aspirates. The RT-PCR/ESI-MS respiratory virus surveillance kit was designed to detect respiratory syncytial virus, influenza A and B, parainfluenza types 1-4, adenoviridae types A-F, coronaviridae, human bocavirus, and human metapneumovirus. Patients (N=192) attending an emergency department during the 2007-2008 respiratory season consented, and "excess" frozen archived nasopharyngeal aspirates were analysed; 46 were positive by conventional virology and 69 by RT-PCR/ESI-MS, among which there were six samples with multiple viral pathogens detected. The sensitivity and specificity of the assay were 89.1% and 80.3%, respectively. Additional viruses that were not identified by conventional virology assays were detected (4 human bocaviruses and 7 coronaviruses). Samples in which the RT-PCR/ESI-MS results disagreed with conventional virology were sent for analysis by a third method using a commercial RT-PCR-based assay, which can identify viruses not detectable by conventional virologic procedures. Time to first result of RT-PCR/ESI-MS was 8h. RT-PCR/ESI-MS demonstrated capacity to detect respiratory viruses identifiable and unidentifiable by conventional methods rapidly. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Rapid virological diagnosis of central nervous system infections by use of a multiplex reverse transcription-PCR DNA microarray.

    Science.gov (United States)

    Leveque, Nicolas; Van Haecke, Adrien; Renois, Fanny; Boutolleau, David; Talmud, Deborah; Andreoletti, Laurent

    2011-11-01

    Viruses are the main etiological cause of central nervous system (CNS) infections. A rapid molecular diagnosis is recommended to improve the therapeutic management of patients. The aim of this study was to evaluate the performances of a DNA microarray, the Clart Entherpex kit (Genomica, Coslada, Spain), allowing the rapid and simultaneous detection of 9 DNA and RNA neurotropic viruses: herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, and the human enteroviruses (HEVs). This evaluation was performed with 28 samples from the European proficiency panels (Quality Control for Molecular Diagnostics [QCMD]; Glasgow, Scotland) and then with 78 cerebrospinal fluid (CSF) specimens. The majority of the QCMD results obtained by the DNA microarray were similar to those recorded by the overall QCMD participants. The main discrepant results were observed for low concentrations of HSV-2 and HEVs. From the clinical samples, the kit detected 27 of the 28 herpesvirus CNS infections and all of the 30 HEV-positive CSF samples. No false-positive result was observed among the 20 virus-negative CSF samples. The clinical sensitivity, specificity, and negative and positive predictive values of the assay were 98.3, 100, 95.2, and 100%, respectively, when the results were compared to those of commercially available PCR assays. Interestingly, HHV-7 was detected in 11 (37%) of the 30 HEV-positive CSF samples from children suffering from aseptic meningitis causing significantly longer lengths of stay at the hospital than infection with HEVs alone (2.4 versus 1.4 days; P = 0.038). In conclusion, this preliminary study showed that this DNA microarray could be a valuable molecular diagnostic tool for single and mixed DNA and RNA virus infections of the CNS.

  2. Comparison of multiplex real-time PCR and PCR-reverse blot hybridization assay for the direct and rapid detection of bacteria and antibiotic resistance determinants in positive culture bottles.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Seoyong; Kim, Jungho; Park, Soon Deok; Kim, Hyo Youl; Uh, Young; Lee, Hyeyoung

    2016-09-01

    The aim of this study was to evaluate the performance of a commercially available multiplex real-time PCR assay and a PCR-reverse blot hybridization assay (PCR-REBA) for the rapid detection of bacteria and identification of antibiotic resistance genes directly from blood culture bottles and to compare the results of these molecular assays with conventional culture methods. The molecular diagnostic methods were used to evaluate 593 blood culture bottles from patients with bloodstream infections. The detection positivity of multiplex real-time PCR assay for Gram-positive bacteria, Gram-negative bacteria and Candida spp. was equivalent to PCR-REBA as 99.6 %, 99.1 % and 100 %, respectively. Using conventional bacterial cultures as the gold standard, the sensitivity, specificity, positive predictive value and negative predictive value of these two molecular methods were 99.5 % [95 % confidence interval (CI), 0.980-1.000; PReal-methicillin-resistant Staphylococcusaureus multiplex real-time PCR assay targeting the mecA gene to detect methicillin resistance was lower than that of the PCR-REBA method, detecting an overall positivity of 98.4 % (n=182; 95 % CI, 0.964-1.000; P<0.009) and 99.5 % (n=184; 95 % CI, 0.985-1.000; P<0.0001), respectively. The entire two methods take about 3 h, while results from culture can take up to 48-72 h. Therefore, the use of these two molecular methods was rapid and reliable for the characterization of causative pathogens in bloodstream infections.

  3. Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR

    Directory of Open Access Journals (Sweden)

    Zhang Chunling

    2010-12-01

    Full Text Available Abstract Porcine circovirus type 2 (PCV2 and the associated disease postweaning multisystemic wasting syndrome (PMWS have caused heavy losses in global agriculture in recent decades. Rapid detection of PCV2 is very important for the effective prophylaxis and treatment of PMWS. To establish a sensitive, specific assay for the detection and quantitation of PCV2, we designed and synthesized specific primers and a probe in the open reading frame 2. The assay had a wide dynamic range with excellent linearity and reliable reproducibility, and detected between 102 and 1010 copies of the genomic DNA per reaction. The coefficient of variation for Ct values varied from 0.59% to 1.05% in the same assay and from 1.9% to 4.2% in 10 different assays. The assay did not cross-react with porcine circovirus type 1, porcine reproductive and respiratory, porcine epidemic diarrhea, transmissible gastroenteritis of pigs and rotavirus. The limits of detection and quantitation were 10 and 100 copies, respectively. Using the established real-time PCR system, 39 of the 40 samples we tested were detected as positive.

  4. Rapid and accurate species and genomic species identification and exhaustive population diversity assessment of Agrobacterium spp. using recA-based PCR.

    Science.gov (United States)

    Shams, M; Vial, L; Chapulliot, D; Nesme, X; Lavire, C

    2013-07-01

    Agrobacteria are common soil bacteria that interact with plants as commensals, plant growth promoting rhizobacteria or alternatively as pathogens. Indigenous agrobacterial populations are composites, generally with several species and/or genomic species and several strains per species. We thus developed a recA-based PCR approach to accurately identify and specifically detect agrobacteria at various taxonomic levels. Specific primers were designed for all species and/or genomic species of Agrobacterium presently known, including 11 genomic species of the Agrobacterium tumefaciens complex (G1-G9, G13 and G14, among which only G2, G4, G8 and G14 still received a Latin epithet: pusense, radiobacter, fabrum and nepotum, respectively), A. larrymoorei, A. rubi, R. skierniewicense, A. sp. 1650, and A. vitis, and for the close relative Allorhizobium undicola. Specific primers were also designed for superior taxa, Agrobacterium spp. and Rhizobiaceace. Primer specificities were assessed with target and non-target pure culture DNAs as well as with DNAs extracted from composite agrobacterial communities. In addition, we showed that the amplicon cloning-sequencing approach used with Agrobacterium-specific or Rhizobiaceae-specific primers is a way to assess the agrobacterial diversity of an indigenous agrobacterial population. Hence, the agrobacterium-specific primers designed in the present study enabled the first accurate and rapid identification of all species and/or genomic species of Agrobacterium, as well as their direct detection in environmental samples. Copyright © 2013 Elsevier GmbH. All rights reserved.

  5. PCR and PCR-RFLP of the 5S-rRNA-NTS region and salvinorin A analyses for the rapid and unequivocal determination of Salvia divinorum.

    Science.gov (United States)

    Bertea, Cinzia M; Luciano, Pino; Bossi, Simone; Leoni, Francesca; Baiocchi, Claudio; Medana, Claudio; Azzolin, Chiara M M; Temporale, Giovanni; Lombardozzi, Maria Antonietta; Maffei, Massimo E

    2006-02-01

    Salvia divinorum Epling & Játiva-M. is a perennial herb belonging to the Lamiaceae family; its active ingredient, the neoclerodane diterpene salvinorin A, is a psychotropic molecule that produces hallucinations. A comparative evaluation of S. divinorum fresh and dried leaves, S. officinalis fresh leaves, and dried powdered leaves claimed to be S. divinorum was done. HPLC-MS data confirmed the presence of salvinorin A in both S. divinorun leaf extracts and the powdered leaves, whereas no salvinorin A was found in S. officinalis. The non-transcribed spacer (NTS) in the 5S-rRNA gene of all leaf samples and the dried powdered leaves was amplified by PCR using a pair of primers located at the 3' and 5' ends of the coding sequence of 5S-rRNA gene. The resulting PCR products (about 500bp for S. divinorum and 300bp for S. officinalis) were gel purified, subcloned into pGEM-T Easy vector and sequenced. By aligning the isolated nucleotide sequences, great diversities were found in the spacer region of the two species. Specific S. divinorum primers were designed on the sequence of the 5S-rRNA gene spacer region. In addition, a PCR-restriction fragment length polymorphism (PCR-RFLP) method was applied using NdeI and TaqI restriction enzymes. An NdeI site, absent in S. officinalis, was found in S. divinorum NTS region at 428-433bp. For TaqI, multiple sites (161-164, 170-173, and 217-220bp) were found in S. officinalis, whereas a unique site was found in S. divinorum (235-238bp). The results of this work show that the combined use of analytical chemical (HPLC-MS) and molecular (DNA fingerprinting) methods lead to the precise and unequivocal identification of S. divinorum.

  6. Multiplex one-step Real-time PCR by Taqman-MGB method for rapid detection of pan and H5 subtype avian influenza viruses.

    Directory of Open Access Journals (Sweden)

    Zhujun Zhang

    Full Text Available Avian influenza virus (AIV can infect a variety of avian species and mammals, leading to severe economic losses in poultry industry and posing a substantial threat to public health. Currently, traditional virus isolation and identification is inadequate for the early diagnosis because of its labor-intensive and time-consuming features. Real-time RT-PCR (RRT-PCR is an ideal method for the detection of AIV since it is highly specific, sensitive and rapid. In addition, as the new quencher MGB is used in RRT-PCR, it only needs shorter probe and helps the binding of target gene and probe. In this study, a pan-AIV RRT-PCR for the detection of all AIVs and H5-AIV RRT-PCR for detection of H5 AIV based on NP gene of AIV and HA gene of H5 AIV were successfully established using Taqman-MGB method. We tested 14 AIV strains in total and the results showed that the pan-AIV RRT-PCR can detect AIV of various HA subtypes and the H5-AIV RRT-PCR can detect H5 AIV circulating in poultry in China in recent three years, including H5 viruses of clade 7.2, clade 2.3.4.4 and clade 2.3.2.1. Furthermore, the multiplex detection limit for pan-AIV and H5-AIV RRT-PCR was 5 copies per reaction. When this multiplex method was applied in the detection of experimental and live poultry market samples, the detection rates of pan-AIV and H5 AIV in RRT-PCR were both higher than the routine virus isolation method with embryonated chicken eggs. The multiplex RRT-PCR method established in our study showed high sensitivity, reproducibility and specificity, suggesting the promising application of our method for surveillance of both pan AIV and prevalent H5 AIV in live poultry markets and clinical samples.

  7. Trisomy 7 mosaicism at amniocentesis: Interphase FISH, QF-PCR, and aCGH analyses on uncultured amniocytes for rapid distinguishing of true mosaicism from pseudomosaicism

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2012-03-01

    Conclusion: Interphase FISH, QF-PCR, and aCGH analyses on uncultured amniocytes are useful for rapid distinguishing of true mosaicism from pseudomosaicism for trisomy 7 at amniocentesis. Cord blood sampling for confirmation of fetal trisomy 7 mosaicism is not practical.

  8. Development of a rapid, cost-effective TaqMan Real-Time PCR Assay for identification and differentiation of Coccidioides immitis and Coccidioides posadasii.

    Science.gov (United States)

    Sheff, Kelly W; York, Emily R; Driebe, Elizabeth M; Barker, Bridget M; Rounsley, Steven D; Waddell, Victor G; Beckstrom-Sternberg, Stephen M; Beckstrom-Sternberg, James S; Keim, Paul S; Engelthaler, David M

    2010-05-01

    Coccidioidomycosis is an infection caused by Coccidioides immitis or C. posadasii. We developed a TaqMan real-time PCR assay that rapidly and accurately differentiates the species. This assay can be used as a tool to improve disease surveillance, increase understanding of the natural history of the infection, and assist in clinical differentiation studies.

  9. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  10. An efficient and rapid DNA minipreparation procedure suitable for PCR/SSR and RAPD analyses in tropical forest tree species

    Directory of Open Access Journals (Sweden)

    Ana Lilia Alzate-Marin

    2009-10-01

    Full Text Available An efficient and rapid DNA minipreparation modified method for frozen samples was developed for five tropical tree species: Copaifera langsdorffii, Hymenaea courbaril, Eugenia uniflora, Tabebuia roseo alba and Cariniana estrellensis. This procedure that dispenses the use of liquid nitrogen, phenol and the addition of proteinase K, is an adaptation of the CTAB-based DNA extraction method. The modifications included the use of PVP to eliminate the polyphenols, only one chloroform-isoamyl alcohol step and the addition of RNase immediately after extraction with chloroform. The yields of the DNA samples ranged from 25.7 to 42.1 µg from 100 mg leaf tissue. The DNA samples extracted by this method were successfully used for PCR (SSR and RAPD analyses in these five and other twelve tropical tree species.Este trabalho teve como objetivo otimizar um protocolo econômico, rápido e eficaz de minipreparação de DNA genômico, para as espécies florestais Copaifera langsdorffii (Óleo de Copaíba, Hymenaea courbaril (Jatobá, Eugenia uniflora (Pitanga, Tabebuia roseo alba (Ipê Branco e Cariniana estrellensis (Jequitibá Branco. Este método é uma adaptação da técnica de extração CTAB de Doyle e Doyle (1990, o qual consiste principalmente na adição de PVP para eliminar polifenoles, somente uma etapa de extração com clorofórmio-álcool isoamílico e a adição da RNase A imediatamente após a extração com clorofórmio. O método também dispensa o uso de nitrogênio líquido, o uso do fenol e a adição de proteinase K. Os DNAs das espécies florestais extraídos apresentaram alto rendimento e boa qualidade, com rendimento de 25.7 a 42.1 µg de DNA a partir de 100 mg de tecido foliar congelado. Com este protocolo, em apenas 1 dia de trabalho, uma pessoa pode completar o isolamento do DNA de aproximadamente 50 amostras de folhas (dependendo da capacidade da centrífuga. O DNA obtido pode ser usado para métodos de análise baseados em PCR (SSR e

  11. Comparison of false negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture.

    Science.gov (United States)

    Hutchison, Janine R; Piepel, Greg F; Amidan, Brett G; Hess, Becky M; Sydor, Michael A; Deatherage Kaiser, Brooke L

    2018-01-21

    We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials, and assay methods on false-negative rate (FNR) and limit of detection (LOD 95 ) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2 - 500 coupon -1 ) onto glass, stainless steel, vinyl tile, and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD 95 results. Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD 95 was lowest for glass and highest for vinyl tile. LOD 95 values overall were lower for mRV-PCR than for the culture method. This study adds to the limited data on FNR and LOD 95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  12. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-01-01

    Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727

  13. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number).

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-05-01

    To analyse molecular detection of coliforms and shorten the time of PCR. Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  14. Evaluation of a field-deployable reverse transcription-insulated isothermal PCR for rapid and sensitive on-site detection of Zika virus.

    Science.gov (United States)

    Carossino, Mariano; Li, Yanqiu; Lee, Pei-Yu A; Tsai, Chuan-Fu; Chou, Pin-Hsing; Williams, Dennis; Skillman, Ashley; Frank Cook, R; Brown, Grayson; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Balasuriya, Udeni B R

    2017-12-19

    The recent emergence of Zika virus (ZIKV) in Brazil and its precipitous expansion throughout the Americas has highlighted the urgent need for a rapid and reliable on-site diagnostic assay suitable for viral detection. Such point-of-need (PON), low-cost diagnostics are essential for ZIKV control in vulnerable areas with limited resources. We developed and evaluated a ZIKV-specific field-deployable RT-iiPCR reagent set targeting the E gene for rapid detection of ZIKV in ZIKV-spiked human and mosquito specimens, and compared its performance to the Center for Disease Control and Prevention (CDC) and Pan American Health Organization (PAHO) RT-qPCR assays targeting the E and NS2B genes, respectively. These assays demonstrated exclusive specificity for ZIKV (African and Asian lineages), had limits of detection ranging from 10 to 100 in vitro transcribed RNA copies/μl and detection endpoints at 10 plaque forming units/ml of infectious tissue culture fluid. Analysis of human whole blood, plasma, serum, semen, urine, and mosquito pool samples spiked with ZIKV showed an agreement of 90% (k = 0.80), 92% (k = 0.82), 95% (k = 0.86), 92% (k = 0.81), 90% (k = 0.79), and 100% (k = 1), respectively, between the RT-iiPCR assay and composite results from the reference RT-qPCR assays. Overall, the concurrence between the ZIKV RT-iiPCR and the reference RT-qPCR assays was 92% (k = 0.83). The ZIKV RT-iiPCR has a performance comparable to the reference CDC and PAHO RT-qPCR assays but provides much faster results (~1.5 h) with a field-deployable system that can be utilized as a PON diagnostic with the potential to significantly improve the quality of the health care system in vulnerable areas.

  15. A novel, multiplex, real-time PCR-based approach for the detection of the commonly occurring pathogenic fungi and bacteria.

    Science.gov (United States)

    Horváth, Ádám; Pető, Zoltán; Urbán, Edit; Vágvölgyi, Csaba; Somogyvári, Ferenc

    2013-12-23

    Polymerase chain reaction (PCR)-based techniques are widely used to identify fungal and bacterial infections. There have been numerous reports of different, new, real-time PCR-based pathogen identification methods although the clinical practicability of such techniques is not yet fully clarified.The present study focuses on a novel, multiplex, real-time PCR-based pathogen identification system developed for rapid differentiation of the commonly occurring bacterial and fungal causative pathogens of bloodstream infections. A multiplex, real-time PCR approach is introduced for the detection and differentiation of fungi, Gram-positive (G+) and Gram-negative (G-) bacteria. The Gram classification is performed with the specific fluorescence resonance energy transfer (FRET) probes recommended for LightCycler capillary real-time PCR. The novelty of our system is the use of a non-specific SYBR Green dye instead of labelled anchor probes or primers, to excite the acceptor dyes on the FRET probes. In conjunction with this, the use of an intercalating dye allows the detection of fungal amplicons.With the novel pathogen detection system, fungi, G + and G- bacteria in the same reaction tube can be differentiated within an hour after the DNA preparation via the melting temperatures of the amplicons and probes in the same tube. This modified FRET technique is specific and more rapid than the gold-standard culture-based methods. The fact that fungi, G + and G- bacteria were successfully identified in the same tube within an hour after the DNA preparation permits rapid and early evidence-based management of bloodstream infections in clinical practice.

  16. Rapid and not culture-dependent assay based on multiplex PCR-SSR analysis for monitoring inoculated yeast strains in industrial wine fermentations.

    Science.gov (United States)

    Cordero-Bueso, Gustavo; Rodríguez, María Esther; Garrido, Carlos; Cantoral, Jesús Manuel

    2017-01-01

    Wine industry needs a simple method for rapid diagnosis of the dominance of inoculated strains that could be performed routinely during the fermentation process. We present a suitable, high-throughput, and low-cost method to monitor rapidly the dominance of inoculated yeast strains in industrial fermentations of red and white wines using an activated carbon cleaning pretreatment, and a rapid DNA extraction method plus multiplex PCR-SSR analysis. We apply this technique directly to samples of fermenting wines without previously isolating yeast colonies. Results are obtained in a maximum time of 4.5 h.

  17. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR

    DEFF Research Database (Denmark)

    Krych, Lukasz; Kot, Witold; Bendtsen, Katja Maria Bangsgaard

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions...... including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase...

  18. Evaluation of a rapid and completely automated real-time reverse transcriptase PCR assay for diagnosis of enteroviral meningitis.

    Science.gov (United States)

    Nolte, Frederick S; Rogers, Beverly B; Tang, Yi-Wei; Oberste, M Steven; Robinson, Christine C; Kehl, K Sue; Rand, Kenneth A; Rotbart, Harley A; Romero, Jose R; Nyquist, Ann-Christine; Persing, David H

    2011-02-01

    Nucleic acid amplification tests (NAATs) for enterovirus RNA in cerebrospinal fluid (CSF) have emerged as the new gold standard for diagnosis of enteroviral meningitis, and their use can improve the management and decrease the costs for caring for children with enteroviral meningitis. The Xpert EV assay (Cepheid, Sunnyvale, CA) is a rapid, fully automated real-time PCR test for the detection of enterovirus RNA that was approved by the U.S. Food and Drug Administration for in vitro diagnostic use in March 2007. In this multicenter trial we established the clinical performance characteristics of the Xpert EV assay in patients presenting with meningitis symptoms relative to clinical truth. Clinical truth for enteroviral meningitis was defined as clinical evidence of meningitis, the absence of another detectable pathogen in CSF, and detection of enterovirus in CSF either by two reference NAATs or by viral culture. A total of 199 prospectively and 235 retrospectively collected specimens were eligible for inclusion in this study. The overall prevalence of enteroviral meningitis was 26.04%. The Xpert EV assay had a sensitivity of 94.69% (90% confidence interval [CI] = 89.79 to 97.66%), specificity of 100% (90% CI = 99.07 to 100%), positive predictive value of 100%, negative predictive value of 98.17, and an accuracy of 98.62% relative to clinical truth. The Xpert EV assay demonstrated a high degree of accuracy for diagnosis of enteroviral meningitis. The simplicity and on-demand capability of the Xpert EV assay should prove to be a valuable adjunct to the evaluation of suspected meningitis cases.

  19. Evaluation of a Rapid and Completely Automated Real-Time Reverse Transcriptase PCR Assay for Diagnosis of Enteroviral Meningitis▿

    Science.gov (United States)

    Nolte, Frederick S.; Rogers, Beverly B.; Tang, Yi-Wei; Oberste, M. Steven; Robinson, Christine C.; Kehl, K. Sue; Rand, Kenneth A.; Rotbart, Harley A.; Romero, Jose R.; Nyquist, Ann-Christine; Persing, David H.

    2011-01-01

    Nucleic acid amplification tests (NAATs) for enterovirus RNA in cerebrospinal fluid (CSF) have emerged as the new gold standard for diagnosis of enteroviral meningitis, and their use can improve the management and decrease the costs for caring for children with enteroviral meningitis. The Xpert EV assay (Cepheid, Sunnyvale, CA) is a rapid, fully automated real-time PCR test for the detection of enterovirus RNA that was approved by the U.S. Food and Drug Administration for in vitro diagnostic use in March 2007. In this multicenter trial we established the clinical performance characteristics of the Xpert EV assay in patients presenting with meningitis symptoms relative to clinical truth. Clinical truth for enteroviral meningitis was defined as clinical evidence of meningitis, the absence of another detectable pathogen in CSF, and detection of enterovirus in CSF either by two reference NAATs or by viral culture. A total of 199 prospectively and 235 retrospectively collected specimens were eligible for inclusion in this study. The overall prevalence of enteroviral meningitis was 26.04%. The Xpert EV assay had a sensitivity of 94.69% (90% confidence interval [CI] = 89.79 to 97.66%), specificity of 100% (90% CI = 99.07 to 100%), positive predictive value of 100%, negative predictive value of 98.17, and an accuracy of 98.62% relative to clinical truth. The Xpert EV assay demonstrated a high degree of accuracy for diagnosis of enteroviral meningitis. The simplicity and on-demand capability of the Xpert EV assay should prove to be a valuable adjunct to the evaluation of suspected meningitis cases. PMID:21159942

  20. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  1. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    Science.gov (United States)

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  2. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    This paper describes a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip.......This paper describes a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip....

  3. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  4. Comparative evaluation of IS6110 PCR via conventional methods in rapid diagnosis of new and previously treated cases of extrapulmonary tuberculosis.

    Science.gov (United States)

    Maurya, Anand Kumar; Kant, Surya; Nag, Vijaya Lakshmi; Kushwaha, Ram Awadh Singh; Kumar, Manoj; Dhole, Tapan N

    2011-01-01

    In developing countries the diagnosis of extrapulmonary tuberculosis (EPTB) is a major burning challenge. EPTB encounters many problems like pauci-bacillary nature, inadequate specimen volume. All the limitations reflect in the poor contribution of conventional bacteriological technique in the establishment of diagnosis of EPTB. Nucleic acid amplification methods are rapid and sensitive has modified strategies for the detection of mycobacterial DNA. A fragment of DNA of 123 bp belonging to insertion sequence IS6110 based on specific gene of Mycobacterium tuberculosis complex was amplified by polymerase chain reaction (PCR) for the rapid diagnosis of EPTB. The present study was to comparative evaluation of IS6110 PCR via conventional methods in the rapid diagnosis of new and Previously treated cases of extra pulmonary tuberculosis. Four hundred fifty specimens were collected from suspected cases of EPTB were processed for Mycobacteria by Zeihl Neelson (ZN) staining and BACTEC culture for M. tuberculosis. All the specimens were also processed for IS6110 based PCR amplification with primers targeting 123 bp fragment of insertion element IS6110 of M. tuberculosis complex. We found significant difference was seen in sensitivities of different tests. Of these 450 specimens, 60 (13.4%) were positive for AFB by ZN staining, 202 (45%) for BACTEC culture and IS6110 PCR were positive for M. tuberculosis complex in 283 (63%) specimens (pEPTB. It may facilitate therapeutic decisions for those with suspected of EPTB.

  5. Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

    Science.gov (United States)

    Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

    2012-11-01

    Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

  6. Phenylketonuria mutation analysis in Northern Ireland: A rapid stepwise approach

    Energy Technology Data Exchange (ETDEWEB)

    Zschocke, J.; Graham, C.A.; Nevin, N.C. [Queen`s Univ., Belfast (Australia)] [and others

    1995-12-01

    We present a multistep approach for the rapid analysis of phenylketonuria (PKU) mutations. In the first step, three common mutations and a polymorphic short tandem repeat (STR) system are rapidly analyzed with a fluorescent multiplex assay. In the second step, minihaplotypes combining STR and VNTR data are used to determine rare mutations likely to be present in an investigated patient, which are then confirmed by restriction enzyme analysis. The remaining mutations are analyzed with denaturant gradient-gel electrophoresis and sequencing. The first two steps together identify both mutations in 90%-95% of PKU patients, and results can be obtained within 2 d. We have investigated 121 Northern Irish families with hyperphenylalaninemia, including virtually all patients born since 1972, and have found 34 different mutations on 241 of the 242 mutant alleles. Three mutations (R408W, 165T, and F39L) account for 57.5% of mutations, while 14 mutations occur with a frequency of 1%-6%. The present analysis system is efficient and inexpensive and is particularly well suited to routine mutation analysis in a diagnostic setting. 19 refs., 5 tabs.

  7. Detection and differentiation of Plum pox virus using real-time multiplex PCR with SYBR Green and melting curve analysis: a rapid method for strain typing.

    Science.gov (United States)

    Varga, Aniko; James, Delano

    2005-02-01

    A real-time multiplex PCR procedure with melting curve analysis, using the green fluorescence dye SYBR Green I, was developed for rapid and reliable identification of Plum pox virus (PPV) isolates of strains D and M. Members of the different strains were identified by their distinctive melting temperatures (T(m)s); 84.3-84.43 degrees C for D isolates, and 85.34-86.11 degrees C for M isolates. The associated amplicon sizes were 114 and 380 bp, respectively. The procedure was used for detection and identification of PPV in both herbaceous and woody hosts. The Tm for members of a particular strain was very similar, with a host effect that did not hinder strain identification. Universal primers included in the study detected all isolates of PPV tested, amplifying a 74 bp fragment. The Tm of this fragment varied from 80.12 to 81.52 degrees C and may have supplementary value for PPV identification. SYBR Green-based detection was compared to detection using a hybridization LUX fluorogenic primer. Better resolution of the melting peaks was observed with SYBR Green I, than with the LUX primers, hence strain identification with SYBR Green I was more reliable. This is a simple approach to PPV strain identification with the relatively inexpensive dye SYBR Green I, and eliminates any need for electrophoretic analysis of amplicons or RFLP patterns using ethidium bromide.

  8. Rapidly discriminate commercial medicinal Pulsatilla chinensis (Bge.) Regel from its adulterants using ITS2 barcoding and specific PCR-RFLP assay.

    Science.gov (United States)

    Shi, Yuhua; Zhao, Mingming; Yao, Hui; Yang, Pei; Xin, Tianyi; Li, Bin; Sun, Wei; Chen, Shilin

    2017-01-06

    Pulsatillae radix is a conventional traditional Chinese medicine (TCM) with common name Baitouweng, and has notable effects on inflammation and dysentery. Pulsatilla chinensis (Bge.) Regel is the only source plant of Baitouweng recorded in Chinese Pharmacopoeia, but its adulteration often occurs in the market that possibly affects medicinal efficacy and safety. We have established an internal transcribed spacer 2 (ITS2) barcode library based on 105 plant samples from 12 Pulsatilla species and 10 common adulterants. Results indicate that ITS2 barcoding can accurately distinguish Pulsatilla species from their adulterants. Pulsatilla chinensis can be discriminated from 11 congeneric species by two stable single nucleotide polymorphisms (SNPs) in the ITS2 region. Additionally, a quick specific PCR-RFLP identification assay based on the ITS2 barcode was developed. Using specific primers ITS2/PR1 combined with restriction enzyme Bgl I, Pu. chinensis can rapidly be differentiated from other species via simple and low-cost test procedures. Furthermore, 30 commercial Baitouweng products were tested and only two products were derived from authentic Pu. chinensis. Thus, these two molecular approaches provide practical tools for quick identification of commercial Baitouweng products and can help ensure the safe use of this TCM product.

  9. Development of a multiplex real-time PCR assay for the rapid diagnosis of neonatal late onset sepsis.

    Science.gov (United States)

    van den Brand, Marre; Peters, Remco P H; Catsburg, Arnold; Rubenjan, Anna; Broeke, Ferdi J; van den Dungen, Frank A M; van Weissenbruch, Mirjam M; van Furth, A Marceline; Kõressaar, Triinu; Remm, Maido; Savelkoul, Paul H M; Bos, Martine P

    2014-11-01

    The diagnosis of late onset sepsis (LOS), a severe condition with high prevalence in preterm infants, is hampered by the suboptimal sensitivity and long turnaround time of blood culture. Detection of the infecting pathogen directly in blood by PCR would provide a much more timely result. Unfortunately, PCR-based assays reported so far are labor intensive and often lack direct species identification. Therefore we developed a real-time multiplex PCR assay tailored to LOS diagnosis which is easy-to-use, is applicable on small blood volumes and provides species-specific results within 4h. Species-specific PCR assays were selected from literature or developed using bioinformatic tools for the detection of the most prevalent etiologic pathogens: Enterococcus faecalis, Staphylococcus aureus, Staphylococcus spp., Streptococcus agalactiae, Escherichia coli, Pseudomonas aeruginosa, Klebsiella spp. and Serratia marcescens. The PCR assays showed 100% specificity, full coverage of the target pathogens and a limit of detection (LOD) of ≤10CFUeq./reaction. These LOD values were maintained in the multiplex format or when bacterial DNA was isolated from blood. Clinical evaluation showed high concordance between the multiplex PCR and blood culture. In conclusion, we developed a multiplex PCR that allows the direct detection of the most important bacterial pathogens causing LOS in preterm infants. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Real-Time PCR and High-Resolution Melt Analysis for Rapid Detection of Mycobacterium leprae Drug Resistance Mutations and Strain Types

    Science.gov (United States)

    Li, Wei; Matsuoka, Masanori; Kai, Masanori; Thapa, Pratibha; Khadge, Saraswoti; Hagge, Deanna A.; Brennan, Patrick J.

    2012-01-01

    Drug resistance surveillance and strain typing of Mycobacterium leprae are necessary to investigate ongoing transmission of leprosy in regions of endemicity. To enable wider implementation of these molecular analyses, novel real-time PCR–high-resolution melt (RT-PCR-HRM) assays without allele-specific primers or probes and post-PCR sample handling were developed. For the detection of mutations within drug resistance-determining regions (DRDRs) of folP1, rpoB, and gyrA, targets for dapsone, rifampin, and fluoroquinolones, real-time PCR-HRM assays were developed. Wild-type and drug-resistant mouse footpad-derived strains that included three folP1, two rpoB, and one gyrA mutation types in a reference panel were tested. RT-PCR-HRM correctly distinguished the wild type from the mutant strains. In addition, RT-PCR-HRM analyses aided in recognizing samples with mixed or minor alleles and also a mislabeled sample. When tested in 121 sequence-characterized clinical strains, HRM identified all the folP1 mutants representing two mutation types, including one not within the reference panel. The false positives (PCR inhibition. A second set of RT-PCR-HRM assays for identification of three previously reported single nucleotide polymorphisms (SNPs) that have been used for strain typing were developed and validated in 22 reference and 25 clinical strains. Real-time PCR-HRM is a sensitive, simple, rapid, and high-throughput tool for routine screening known DRDR mutants in new and relapsed cases, SNP typing, and detection of minor mutant alleles in the wild-type background at lower costs than current methods and with the potential for quality control in leprosy investigations. PMID:22170923

  11. PCR-based approach to SINE isolation: simple and complex SINEs.

    Science.gov (United States)

    Borodulina, Olga R; Kramerov, Dmitri A

    2005-04-11

    Highly repeated copies of short interspersed elements (SINEs) occur in eukaryotic genomes. The distribution of each SINE family is usually restricted to some genera, families, or orders. SINEs have an RNA polymerase III internal promoter, which is composed of boxes A and B. Here we propose a method for isolation of novel SINE families based on genomic DNA PCR with oligonucleotide identical to box A as a primer. Cloning of the size-heterogeneous PCR-products and sequencing of their terminal regions allow determination of SINE structure. Using this approach, two novel SINE families, Rhin-1 and Das-1, from the genomes of great horseshoe bat (Rhinolophus ferrumequinum) and nine-banded armadillo (Dasypus novemcinctus), respectively, were isolated and studied. The distribution of Rhin-1 is restricted to two of six bat families tested. Copies of this SINE are characterized by frequent internal insertions and significant length (200-270 bp). Das-1 being only 90 bp in length is one of the shortest SINEs known. Most of Das-1 nucleotide sequences demonstrate significant similarity to alanine tRNA which appears to be an evolutionary progenitor of this SINE. Together with three other known SINEs (ID, Vic-1, and CYN), Das-1 constitutes a group of simple SINEs. Interestingly, three SINE families of this group are alanine tRNA-derived. Most probably, this tRNA gave rise to short and simple but successful SINEs several times during mammalian evolution.

  12. Rapid Discrimination between Candida glabrata, Candida nivariensis, and Candida bracarensis by Use of a Singleplex PCR

    OpenAIRE

    Enache-Angoulvant, A.; Guitard, J.; Grenouillet, F.; Martin, T; Durrens, P.; Fairhead, C.; Hennequin, C.

    2011-01-01

    We report here a PCR-based assay using a single primer pair targeting the RPL31 gene that allows discrimination between Candida glabrata, Candida bracarensis, and Candida nivariensis according to the size of the generated amplicon.

  13. Duplex real-time PCR for rapid simultaneous detection of Batrachochytrium dendrobatidis and Batrachochytrium salamandrivorans in Amphibian samples.

    Science.gov (United States)

    Blooi, M; Pasmans, F; Longcore, J E; Spitzen-van der Sluijs, A; Vercammen, F; Martel, A

    2013-12-01

    Chytridiomycosis is a lethal fungal disease contributing to declines and extinctions of amphibian species worldwide. The currently used molecular screening tests for chytridiomycosis fail to detect the recently described species Batrachochytrium salamandrivorans. In this study, we present a duplex real-time PCR that allows the simultaneous detection of B. salamandrivorans and Batrachochytrium dendrobatidis. With B. dendrobatidis- and B. salamandrivorans-specific primers and probes, detection of the two pathogens in amphibian samples is possible, with a detection limit of 0.1 genomic equivalent of zoospores of both pathogens per PCR. The developed real-time PCR shows high degrees of specificity and sensitivity, high linear correlations (r(2) > 0.995), and high amplification efficiencies (>94%) for B. dendrobatidis and B. salamandrivorans. In conclusion, the described duplex real-time PCR can be used to detect DNA of B. dendrobatidis and B. salamandrivorans with highly reproducible and reliable results.

  14. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  15. Detection of malaria infection in blood transfusion: a comparative study among real-time PCR, rapid diagnostic test and microscopy: sensitivity of Malaria detection methods in blood transfusion.

    Science.gov (United States)

    Hassanpour, Gholamreza; Mohebali, Mehdi; Raeisi, Ahmad; Abolghasemi, Hassan; Zeraati, Hojjat; Alipour, Mohsen; Azizi, Ebrahim; Keshavarz, Hossein

    2011-06-01

    The transmission of malaria by blood transfusion was one of the first transfusion-transmitted infections recorded in the world. Transfusion-transmitted malaria may lead to serious problems because infection with Plasmodium falciparum may cause rapidly fatal death. This study aimed to compare real-time polymerase chain reaction (real-time PCR) with rapid diagnostic test (RDT) and light microscopy for the detection of Plasmodium spp. in blood transfusion, both in endemic and non-endemic areas of malaria disease in Iran. Two sets of 50 blood samples were randomly collected. One set was taken from blood samples donated in blood bank of Bandar Abbas, a city located in a malarious-endemic area, and the other set from Tehran, a non-endemic one. Light microscopic examination on both thin and thick smears, RDTs, and real-time PCR were performed on the blood samples and the results were compared. Thin and thick light microscopic examinations of all samples as well as RDT results were negative for Plasmodium spp. Two blood samples from endemic area were positive only with real-time PCR. It seems that real-time PCR as a highly sensitive method can be helpful for the confirmation of malaria infection in different units of blood transfusion organization especially in malaria-endemic areas where the majority of donors may be potentially infected with malaria parasites.

  16. Development of a rapid, simple, and specific real-time PCR assay for detection of pseudorabies viral DNA in domestic swine herds.

    Science.gov (United States)

    Sayler, Katherine A; Bigelow, Troy; Koster, Leo G; Swenson, Sabrina; Bounds, Courtney; Hernández, Felipe; Wisely, Samantha M

    2017-07-01

    Despite successful eradication of pseudorabies virus (PRV) from the commercial pig industry in the United States in 2004, large populations of feral swine in certain regions act as wildlife reservoirs for the virus. Given the threat of reintroduction of the virus into domestic herds, a rapid, reliable, easily implemented assay is needed for detection of PRV. Although a real-time PCR (rtPCR) assay exists, improvements in rtPCR technology and a greater understanding of the diversity of PRV strains worldwide require an assay that would be easier to implement, more cost effective, and more specific. We developed a single-tube, rapid rtPCR that is capable of detecting 10 copies of PRV glycoprotein B ( gB) DNA per 20-µL total volume reaction. The assay did not produce a false-positive in samples known to be negative for the virus. The assay was negative for genetically similar herpesviruses and other porcine viruses. Our assay is a highly specific and sensitive assay that is also highly repeatable and reproducible. The assay should be a useful tool for early detection of PRV in pigs in the case of a suspected introduction or outbreak situation.

  17. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Directory of Open Access Journals (Sweden)

    Stefano Minguzzi

    Full Text Available Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum' detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV in Prunus.

  18. [Usefulness of a rapid intrapartum real-time PCR assay in comparison with the group B Streptococcus culture screening at the end of pregnancy in pregnant women].

    Science.gov (United States)

    Defez, M; Khizar, F; Maurin, M; Biot, F; Pons, J-C; Sergent, F

    2016-11-01

    The objectives were to evaluate and compare the diagnostic accuracy of a rapid real-time PCR assay at the onset of labor with those of the current antenatal culture-based test at 34-38 weeks gestation for group B Streptococcus (GBS) screening. A prospective study including all pregnant women admitted for delivery after a 34-week gestation period was conducted in October 2012 at the Grenoble University Hospital Centre. A first culture-based GBS screening test was performed between 34 and 38 weeks of gestation followed by a second screening test at the onset of labor, using a real-time PCR Assay and a culture-based method (gold standard) in order to calculate the diagnostic accuracy. One hundred an fifty-seven patients were enrolled. The sensitivity was 94.4% (95% CI, 72.7-99.9%) with intrapartum PCR assay and 50% (95% CI, 26-74%) with antepartum culture. Prevalence of GBS colonization was 7.6% with the antepartum culture method, 11.5% with intrapartum culture and 16.6% by using PCR-test. Intrapartum PCR shows a much higher sensitivity compared to the antepartum culture-based screening mainly due to variations in GBS colonization and could allow us to target patients requiring intrapartum antibiotic prophylaxis more effectively. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

    Directory of Open Access Journals (Sweden)

    Da-Sheng Lee

    2010-01-01

    Full Text Available Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

  20. Real-time PCR machine system modeling and a systematic approach for the robust design of a real-time PCR-on-a-chip system.

    Science.gov (United States)

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

  1. Detection of enteroviruses ribonucleic acid sequences in endomyocardial tissue from adult patients with chronic dilated cardiomyopathy by a rapid RT-PCR and hybridization assay.

    Science.gov (United States)

    Rey, L; Lambert, V; Wattré, P; Andréoletti, L

    2001-06-01

    A rapid reverse transcription polymerase chain reaction (RT-PCR) and microwell capture hybridisation assay with general specificity for enteroviruses was developed and compared with an improved nested RT-PCR for the detection of enteroviral RNA sequences in endomyocardial tissue from patients with chronic dilated cardiomyopathy. This method could detect as few as 20 genomic RNA copies per 100 mg of heart tissue homogenate and results could be obtained within 8 hours. Of the 55 biopsy specimens aseptically collected from the explanted hearts of 55 patients, 21 (38.2%) were positive by RT-PCR microplate assay, whereas only 19 (34.5%) were positive by nested RT-PCR assay and none were positive by classical cell culture assays. No enterovirus was detectable by RT-PCR or classical cell culture assays in any of the 55 heart biopsy specimens taken from organ donors without any known heart disease. Moreover, the nucleotide sequences of EV nested RT-PCR products showed greatest similarity to group B Coxsackieviruses [CVB3 (n = 12) or CVB5 (n = 3)], but also to group A Coxsackieviruses (CVA21 (n = 1) or CVA9 ( n= 3)]. The described RT-PCR and microwell capture hybridisation assay can be applied to the virological diagnosis of human enteroviral cardiac infections. Moreover our findings suggest that group B and group A Coxsackieviruses can persist in heart tissue from patients with end-stage chronic cardiomyopathy, supporting the hypothesis that these viruses could be implicated in the etiology of idiopathic dilated cardiomyopathy. Copyright 2001 Wiley-Liss, Inc.

  2. Sap-direct RT-PCR for the rapid detection of coleus blumei viroids of the genus Coleviroid from natural host plants.

    Science.gov (United States)

    Jiang, Dongmei; Wu, Zujian; Xie, Lianhui; Sano, Teruo; Li, Shifang

    2011-06-01

    A simple and fast sap-direct RT-PCR (reverse transcription-polymerase chain reaction) for the rapid detection of 3 viroids of the genus Coleviroid is presented. The templates for cDNA synthesis were obtained directly from the sap of coleus using a pipettor, a common tool in molecular biology laboratories, and 3 coleus blumei viroids (CbVds) were detected simultaneously using a pair of universal primers designed according to sequences in the central conserved region (CCR) of CbVds. RT-PCR results demonstrated that CbVd-1, CbVd-5, and CbVd-6 can be detected accurately in viroid-infected plants but not in viroid-free plants. The results of RT-PCR, dot-blot, sequencing, and batch-detection revealed that this method can be used to identify CbVds rapidly. The method also reduces cross-contamination among different samples to a minimum. It is considered that this rapid and simple technique is an effective method for the identification and cloning of CbVds. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  3. Rapid molecular identification of human taeniid cestodes by pyrosequencing approach.

    Directory of Open Access Journals (Sweden)

    Tongjit Thanchomnang

    Full Text Available Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1 gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse.

  4. Rapid Molecular Identification of Human Taeniid Cestodes by Pyrosequencing Approach

    Science.gov (United States)

    Thanchomnang, Tongjit; Tantrawatpan, Chairat; Intapan, Pewpan M.; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Tourtip, Somjintana; Yamasaki, Hiroshi; Maleewong, Wanchai

    2014-01-01

    Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse. PMID:24945530

  5. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  6. Rapid detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in food, using multiplex real-time PCR.

    Science.gov (United States)

    Mayr, A M; Lick, S; Bauer, J; Thärigen, D; Busch, U; Huber, I

    2010-02-01

    A multiplex real-time PCR assay based on four differently labeled TaqMan probes for detection and differentiation of the thermophilic Campylobacter species C. jejuni, C. coli, and C. lari was established and validated in food products. This assay combines two previously published PCR assays for C. jejuni and C. coli with a newly developed detection assay for C. lari and an internal amplification control system. The selectivity of the method was determined by analyzing 70 Campylobacter strains and 43 strains of other bacteria. The sensitivity was 50 fg of C. jejuni and C. lari DNA and 500 fg of C. coli DNA per PCR. It was possible to detect 1 to 10 CFU/25 g of food before preenrichment of all three species. More than 400 samples of various foods (poultry, seafood, and meat) were analyzed after 48 h of preenrichment parallel to the conventional diagnostic method of culture and biochemical identification. Using the established real-time PCR assay, 55.4% of the samples were recognized as positive for thermophilic Campylobacter species, whereas with the conventional method only 40.3% of the samples were positive. The real-time PCR assay also detected contaminations with two different Campylobacter species in 32.6% of the analyzed poultry samples, a finding of epidemiological interest. Compared with the original PCR method, which was established for the differentiation of bacterial isolates of C. jejuni and C. coli, this new method also detects and distinguishes C. lari, was validated as an analytical tool for food analysis, and provides reliable and extensive results within 2 days.

  7. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  8. Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis.

    Science.gov (United States)

    Rajan-Babu, Indhu-Shree; Law, Hai-Yang; Yoon, Chui-Sheun; Lee, Caroline G; Chong, Samuel S

    2015-05-04

    Premutation and full-mutation hyperexpansion of CGG-triplets in the X-linked Fragile X Mental Retardation 1 (FMR1) gene have been implicated in fragile X-associated tremor/ataxia syndrome, fragile X-associated primary ovarian insufficiency, and fragile X syndrome (FXS), respectively. The currently available molecular diagnostic tests are either costly or labour-intensive, which prohibits their application as a first-line FMR1 test in large-scale population-based screening programs. In this study, we demonstrate the utility of a simplified closed-tube strategy for rapid first-line screening of FXS based on melt peak temperature (Tm) analysis of direct triplet-primed polymerase chain reaction amplicons (dTP-PCR MCA). In addition, we also evaluated the correlation between Tm and CGG-repeat size based on capillary electrophoresis (CE) of dTP-PCR amplicons. The assays were initially tested on 29 FMR1 reference DNA samples, followed by a blinded validation on 107 previously characterised patient DNA samples. The dTP-PCR MCA produced distinct melt profiles of higher Tm for samples carrying an expanded allele. Among the samples tested, we also observed a good correlation between Tm and CGG-repeat size. In the blinded validation study, dTP-PCR MCA accurately classified all normal and expansion carriers, and the FMR1 genotypic classification of all samples was completely concordant with the previously determined genotypes as well as the dTP-PCR CE results. This simple and cost-effective MCA-based assay may be useful as a first-line FXS screening tool that could rapidly screen out the large majority of unaffected individuals, thus minimising the number of samples that need to be analysed by Southern blot analysis.

  9. Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

    Science.gov (United States)

    Schoener, E R; Hunter, S; Howe, L

    2017-07-01

    Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

  10. Performance of a PCR assay for the rapid identification of the Klebsiella pneumoniae ST258 epidemic clone in Latin American clinical isolates.

    Science.gov (United States)

    Gomez, S A; Rapoport, M; Piergrossi, N; Faccone, D; Pasteran, F; De Belder, D; ReLAVRA-Group; Petroni, A; Corso, A

    2016-10-01

    The worldwide dissemination of Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae ST258 demands a rapid PCR-based typing method to detect unique genes of the ST258 clone. This study evaluates a PCR developed by Adler et al. (2014) for the detection of ST258 in K. pneumoniae clinical isolates centered on the identification of the pilv-I and prp genes. We tested 143 clinical isolates from Argentina (n=109), Chile (n=1), Colombia (n=1), Costa Rica (n=2), Ecuador (n=5), El Salvador (n=2), Nicaragua (n=5), Panamá (n=2), Paraguay (n=2), Perú (n=3) and Trinidad and Tobago (n=11) recovered from 2006 to 2015. blaKPC, pilv-l and prp genes were detected by PCR and sequenced by standard procedures. ST258 and non-ST258 were defined by PFGE and/or MLST. Isolates were grouped according to PFGE patterns: 58 were compatible with ST258 (group 1) and 85 with non-ST258 (group 2). MLST study was done on an arbitrary selection of isolates. The pilv-l gene was present only in ST258 isolates, regardless of the presence of the blaKPC gene. Results for the prp gene were variable. Its presence did not define ST258. The pilv-I PCR had a sensitivity and specificity of 100%, respectively, for the detection of ST258 in the isolates under investigation. Given our findings, the pilv-I PCR could replace more time and resource consuming methods, allowing for more rapid detection of the circulating high risk K. pneumoniae clone ST258 in Latin American (LA) countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method.

    Science.gov (United States)

    Ohshiro, Takeya; Miyagi, Chihiro; Tamaki, Yoshikazu; Mizuno, Takuya; Ezaki, Takayuki

    2016-06-01

    Blood culturing and the rapid reporting of results are essential for infectious disease clinics to obtain bacterial information that can affect patient prognosis. When gram-positive coccoid cells are observed in blood culture bottles, it is important to determine whether the strain is Staphylococcus aureus and whether the strain has resistance genes, such as mecA and blaZ, for proper antibiotic selection. Previous work led to the development of a PCR method that is useful for rapid identification of bacterial species and antimicrobial susceptibility. However, that method has not yet been adopted in community hospitals due to the high cost and methodological complexity. We report here the development of a quick PCR and DNA-chromatography test, based on single-tag hybridization chromatography, that permits detection of S. aureus and the mecA and blaZ genes; results can be obtained within 1 h for positive blood culture bottles. We evaluated this method using 42 clinical isolates. Detection of S. aureus and the resistance genes by the PCR-DNA-chromatography method was compared with that obtained via the conventional identification method and actual antimicrobial susceptibility testing. Our method had a sensitivity of 97.0% and a specificity of 100% for the identification of the bacterial species. For the detection of the mecA gene of S. aureus, the sensitivity was 100% and the specificity was 95.2%. For the detection of the blaZ gene of S. aureus, the sensitivity was 100% and the specificity was 88.9%. The speed and simplicity of this PCR-DNA-chromatography method suggest that our method will facilitate rapid diagnoses. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. A multiplex PCR assay for the rapid and sensitive detection of methicillin-resistant Staphylococcus aureus and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci.

    Science.gov (United States)

    Xu, Benjin; Liu, Ling; Liu, Li; Li, Xinping; Li, Xiaofang; Wang, Xin

    2012-11-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a global health concern, which had been detected in food and food production animals. Conventional testing for detection of MRSA takes 3 to 5 d to yield complete information of the organism and its antibiotic sensitivity pattern. So, a rapid method is needed to diagnose and treat the MRSA infections. The present study focused on the development of a multiplex PCR assay for the rapid and sensitive detection of MRSA. The assay simultaneously detected 4 genes, namely, 16S rRNA of the Staphylococcus genus, femA of S. aureus, mecA that encodes methicillin resistance, and one internal control. It was rapid and yielded results within 4 h. The analytical sensitivity and specificity of the multiplex PCR assay was evaluated by comparing it with the conventional method. The analytical sensitivity of the multiplex PCR assay at the DNA level was 10 ng DNA. The analytical specificity was evaluated with 10 reference staphylococci strains and was 100%. The diagnostic evaluation of MRSA was carried out using 360 foodborne staphylococci isolates, and showed 99.1% of specificity, 96.4% of sensitivity, 97.5% of positive predictive value, and 97.3% of negative predictive value compared to the conventional method. The inclusion of an internal control in the multiplex PCR assay is important to exclude false-negative cases. This test can be used as an effective diagnostic and surveillance tool to investigate the spread and emergence of MRSA. © 2012 Institute of Food Technologists®

  13. Design of a biological method for rapid detection of presence of PCR inhibitors in aged bone DNA.

    Science.gov (United States)

    Ghasemi, Akram; Mahdieh, Nejat; Tavallaei, Mahmood; Aslani, Mohammad Mehdi; Zafari, Zahra; Shirkavand, Atefeh; Farzad, Maryam Sharafi; Naderi, Mahdi; Azariyan, Sajjad Habibi; Zeinali, Sirous

    2012-01-01

    Molecular human identification is one of the most important tests performed in forensic laboratories. Some of these tests are applied for identification of human remains from natural disasters, wars, etc., but problems may occur as a result of DNA degradation and external DNA contamination. We investigated effects of bacterial DNA on identifying the presence or absence of PCR inhibitors in aged bone DNA. DNA samples were extracted from blood, bone remains and Escherichia coli. These DNA were amplified using human and bacterial specific primers. Using different blood, aged bone, and bacterial DNA dilutions along with PCR based methods; we checked their positive, negative effects, or detecting presence of inhibitors in aged bone DNA by PCR method. Our observation indicated that the addition of bacterial DNA could be a valid biological method for testing the quality of bone DNA to enable us to obtain a usable profile for the identification of human remains. This method will help to test the presence of inhibitors, quantity or even quality of DNA which are of importance in profiling archeological remains. Our method will help to determine if PCR failure is due to presence of inhibitors or lack of amplifiable DNA either because of degradation, minute amount or absence of human DNA.

  14. Quantification by real-time PCR assay of Staphylococcus aureus load: a useful tool for rapidly identifying persistent nasal carriers.

    Science.gov (United States)

    Verhoeven, Paul O; Grattard, Florence; Carricajo, Anne; Lucht, Frédéric; Cazorla, Céline; Garraud, Olivier; Pozzetto, Bruno; Berthelot, Philippe

    2012-06-01

    The Cepheid Xpert MRSA/SA nasal PCR assay was compared to culture for quantifying Staphylococcus aureus load from 104 nasal samples (r = 0.91, P < 0.0001). Using a bacterial load-based algorithm, the test was found able to predict the carrier state in 32 of 35 healthy volunteers (22 persistent and 13 nonpersistent carriers).

  15. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer...

  16. Rapid detection and grouping of porcine bocaviruses by an EvaGreen(®) based multiplex real-time PCR assay using melting curve analysis.

    Science.gov (United States)

    Zheng, Xiaowen; Liu, Gaopeng; Opriessnig, Tanja; Wang, Zining; Yang, Zongqi; Jiang, Yonghou

    2016-08-01

    Several novel porcine bocaviruses (PBoVs) have been identified in pigs in recent years and association of these viruses with respiratory signs or diarrhea has been suggested. In this study, an EvaGreen(®)-based multiplex real-time PCR (EG-mPCR) with melting curve analysis was developed for simultaneous detection and grouping of novel PBoVs into the same genogroups G1, G2 and G3. Each target produced a specific amplicon with a melting peak of 81.3 ± 0.34 °C for PBoV G1, 78.2 ± 0.37 °C for PBoV G2, and 85.0 ± 0.29 °C for PBoV G3. Non-specific reactions were not observed when other pig viruses were used to assess the EG-mPCR assay. The sensitivity of the EG-mPCR assay using purified plasmid constructs containing the specific viral target fragments was 100 copies for PBoV G1, 50 for PBoV G2 and 100 for PBoV G3. The assay is able to detect and distinguish three PBoV groups with intra-assay and inter-assay variations ranging from 0.13 to 1.59%. The newly established EG-mPCR assay was validated with 227 field samples from pigs. PBoV G1, G2 and G3 was detected in 15.0%, 25.1% and 41.9% of the investigated samples and coinfections of two or three PBoV groups were also detected in 25.1% of the cases, indicating that all PBoV groups are prevalent in Chinese pigs. The agreement of the EG-mPCR assay with an EvaGreen-based singleplex real-time PCR (EG-sPCR) assay was 99.1%. This EG-mPCR will serve as a rapid, sensitive, reliable and cost effective alternative for routine surveillance testing of multiple PBoVs in pigs and will enhance our understanding of the epidemiological features and possible also pathogenetic changes associated with these viruses in pigs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. A Parent-Oriented Approach to Rapid Toilet Training

    Science.gov (United States)

    Doan, Dai; Toussaint, Karen A.

    2016-01-01

    The current evaluation assessed the effectiveness of a rapid toilet training procedure for three young males with autism. The evaluation extended the research on rapid toilet training procedures by assessing parents' preference to include two common toilet training components, a urine alarm and positive practice. In addition, we assessed child…

  18. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina

    Directory of Open Access Journals (Sweden)

    Marco Jorge D

    2012-08-01

    Full Text Available Abstract Background The diagnosis of the leishmaniases poses enormous challenges in Argentina. The Polymorphism-Specific PCR (PS-PCR designed and validated in our laboratories has been proven effective for typifying the Leishmania genus from cultured material. Here we evaluated the performance of this method in the diagnosis of American tegumentary leishmaniasis (ATL and the rapid identification of Leishmania spp. directly from clinical specimens. Methods A total of 63 patients from northwestern Argentina, with cutaneous or mucocutaneous lesions, underwent an ATL diagnosis protocol which included clinical examination, Leishmanin skin test, and microscopic examination of dermal smears. In addition, we performed PS-PCR on DNA directly extracted from the specimens scraped from the lesions. Results Out of the 63 patients, 44 were classified as ATL cases and 19 as non-ATL cases. The diagnostic sensitivity of the microscopic analysis of dermal smears and PS-PCR individually were 70.5% and 81%, respectively. When performing both tests in parallel, this parameter increased significantly to 97.6% (p = 0.0018. The specificities, on the other hand, were 100%, 84.2%, and 83.3% for the combination, respectively (p > 0.05. Using the PS-PCR analysis we successfully identified the Leishmania spp. in 31 out of the 44 ATL cases. Twenty-eight (90.3% cases were caused by L. (V. braziliensis, two (6.5% by L. (V. guyanensis, and one (3.2% by L. (V. panamensis. Conclusions The efficacy of the ATL diagnosis was significantly improved by combining the dermal smear examination with a PS-PCR analysis. Our strategy allowed us to reach the diagnosis of ATL with high accuracy regarding the species of the etiological agent in 70.5% of the cases. Moreover, we diagnosed two cases of the disseminated cutaneous form caused by L. (V. braziliensis and a cutaneous case due to L. (V. panamensis infection, both findings reported for the first time in Argentina.

  19. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina.

    Science.gov (United States)

    Marco, Jorge D; Barroso, Paola A; Mimori, Tatsuyuki; Locatelli, Fabricio M; Tomatani, Ayako; Mora, María C; Cajal, S Pamela; Nasser, Julio R; Parada, Luis A; Taniguchi, Taketoshi; Korenaga, Masataka; Basombrío, Miguel A; Hashiguchi, Yoshihisa

    2012-08-15

    The diagnosis of the leishmaniases poses enormous challenges in Argentina. The Polymorphism-Specific PCR (PS-PCR) designed and validated in our laboratories has been proven effective for typifying the Leishmania genus from cultured material. Here we evaluated the performance of this method in the diagnosis of American tegumentary leishmaniasis (ATL) and the rapid identification of Leishmania spp. directly from clinical specimens. A total of 63 patients from northwestern Argentina, with cutaneous or mucocutaneous lesions, underwent an ATL diagnosis protocol which included clinical examination, Leishmanin skin test, and microscopic examination of dermal smears. In addition, we performed PS-PCR on DNA directly extracted from the specimens scraped from the lesions. Out of the 63 patients, 44 were classified as ATL cases and 19 as non-ATL cases. The diagnostic sensitivity of the microscopic analysis of dermal smears and PS-PCR individually were 70.5% and 81%, respectively. When performing both tests in parallel, this parameter increased significantly to 97.6% (p = 0.0018). The specificities, on the other hand, were 100%, 84.2%, and 83.3% for the combination, respectively (p > 0.05). Using the PS-PCR analysis we successfully identified the Leishmania spp. in 31 out of the 44 ATL cases. Twenty-eight (90.3%) cases were caused by L. (V.) braziliensis, two (6.5%) by L. (V.) guyanensis, and one (3.2%) by L. (V.) panamensis. The efficacy of the ATL diagnosis was significantly improved by combining the dermal smear examination with a PS-PCR analysis. Our strategy allowed us to reach the diagnosis of ATL with high accuracy regarding the species of the etiological agent in 70.5% of the cases. Moreover, we diagnosed two cases of the disseminated cutaneous form caused by L. (V.) braziliensis and a cutaneous case due to L. (V.) panamensis infection, both findings reported for the first time in Argentina.

  20. Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks.

    Science.gov (United States)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-Jacques; Dalgaard, Paw; Pilet, Marie-France; Dousset, Xavier

    2013-04-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R(2) of 0.99) was obtained between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU/g. A correlation coefficient (R(2)) of 0.963 was obtained between the PCR method and classic enumeration on MA, followed by identification of colonies (290 isolates identified by real-time PCR or by 16S rRNA gene sequencing). A good correlation with an R(2) of 0.940 was found between the new PCR method and an available specific conductance method for P. phosphoreum. This study presents a rapid tool for producing reliable quantitative data on viable P. phosphoreum bacteria in fresh salmon in 6 h. This new culture-independent method will be valuable for future fish inspection, the assessment of raw material quality in fish processing plants, and studies on the ecology of this important specific spoilage microorganism.

  1. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    Science.gov (United States)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-Jacques; Dalgaard, Paw; Pilet, Marie-France

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU/g. A correlation coefficient (R2) of 0.963 was obtained between the PCR method and classic enumeration on MA, followed by identification of colonies (290 isolates identified by real-time PCR or by 16S rRNA gene sequencing). A good correlation with an R2 of 0.940 was found between the new PCR method and an available specific conductance method for P. phosphoreum. This study presents a rapid tool for producing reliable quantitative data on viable P. phosphoreum bacteria in fresh salmon in 6 h. This new culture-independent method will be valuable for future fish inspection, the assessment of raw material quality in fish processing plants, and studies on the ecology of this important specific spoilage microorganism. PMID:23396343

  2. Development of 11-Plex MOL-PCR Assay for the Rapid Screening of Samples for Shiga Toxin-Producing Escherichia coli

    Directory of Open Access Journals (Sweden)

    Travis A Woods

    2016-08-01

    Full Text Available Strains of Shiga toxin-producing Escherichia coli (STEC are a serious threat to the public health, with approximately half of the STEC related food-borne illnesses attributable to contaminated beef. We developed an assay that was able to screen samples for several important STEC associated serogroups (O26, O45, O103, O104, O111, O121, O145, O157 and three major virulence factors (eae, stx1, stx2 in a rapid and multiplexed format using the Multiplex oligonucleotide ligation-PCR (MOL-PCR assay chemistry. This assay detected unique STEC DNA signatures and was meant to be used on samples from various sources related to beef production, providing a multiplex and high-throughput complement to the multiplex PCR assays currently in use. Multiplex oligonucleotide ligation-PCR (MOL-PCR is a nucleic acid-based assay chemistry that relies on flow cytometry/image cytometry and multiplex microsphere arrays for the detection of nucleic acid-based signatures present in target agents. The STEC MOL-PCR assay provided greater than 90% analytical specificity across all sequence markers designed when tested against panels of DNA samples that represent different STEC serogroups and toxin gene profiles. This paper describes the development of the 11-plex assay and the results of its validation. This highly multiplexed, but more importantly dynamic and adaptable screening assay allows inclusion of additional signatures as they are identified in relation to public health. As the impact of STEC associated illness on public health is explored additional information on classification will be needed on single samples; thus, this assay can serve as the backbone for a complex screening system.

  3. Development of a loop-mediated isothermal amplification technique and comparison with quantitative real-time PCR for the rapid visual detection of canine neosporosis.

    Science.gov (United States)

    Mahittikorn, Aongart; Thammasonthijarern, Nipa; Roobthaisong, Amonrattana; Udonsom, Ruenruetai; Popruk, Supaluk; Siri, Sukhontha; Mori, Hirotake; Sukthana, Yaowalark

    2017-08-23

    Dogs are the definitive hosts of Neospora caninum and play an important role in the transmission of the parasite. Despite the high sensitivity of existing molecular tools such as quantitative real-time PCR (qPCR), these techniques are not suitable for use in many countries because of equipment costs and difficulties in implementing them for field diagnostics. Therefore, we developed a simplified technique, loop-mediated isothermal amplification (LAMP), for the rapid visual detection of N. caninum. LAMP specificity was evaluated using a panel containing DNA from a range of different organisms. Sensitivity was evaluated by preparing 10-fold serial dilutions of N. caninum tachyzoites and comparing the results with those obtained using qPCR. Assessment of the LAMP results was determined by recognition of a colour change after amplification. The usefulness of the LAMP assay in the field was tested on 396 blood and 115 faecal samples from dogs, and one placenta from a heifer collected in Lopburi, Nakhon Pathom, Sa Kaeo, and Ratchaburi provinces, Thailand. Specificity of the LAMP technique was shown by its inability to amplify DNA from non-target pathogens or healthy dogs. The detection limit was the equivalent of one genome for both LAMP and qPCR. LAMP and qPCR detected positive N. caninum infection in 15 of 396 (3.8%) blood samples; LAMP detected 9/115 (7.8%) positive faecal samples, while qPCR detected 5/115 (4.3%) positive faecal samples. The placental tissue was shown to be positive by both techniques. Agreement between LAMP and qPCR was perfect in blood samples (kappa value, 1.00) and substantial in faecal samples (kappa value, 0.697). This is the first known LAMP assay developed for the amplification of N. caninum. The technique effectively and rapidly detected the parasite with high sensitivity and specificity and was cost-effective. This assay could be used in the field to confirm the diagnosis of canine or bovine neosporosis.

  4. Development and validation of a SYBR Green real-time PCR assay for rapid and quantitative detection of goose interferons and proinflammatory cytokines.

    Science.gov (United States)

    Zhou, Hao; Chen, Shun; Qi, Yulin; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun

    2015-10-01

    Real time quantitative polymerase chain reaction (RT-qPCR) based on SYBR-Green I binding is a quick, reliable, and easy method for analyzing small amounts of mRNA. Viral pathogens are recognized at the time of infection by pattern recognition receptors; thus, the inflammatory cytokines (IL1β, IL6, and IL18) and antiviral cytokines (IFNα, IFNγ) are secreted by innate immune cells and induced to respond to the pathogens. The objective of this study was to develop an effective and sensitive RT-qPCR assay for the rapid and accurate quantification of goose cytokines: IFNα, IFNγ, IL1β, IL6, and IL18. Subsequently, the established methods were employed to detect the immune response in agonist-stimulated goose spleen cells in vitro. These data indicated that the established RT-qPCR is a reliable method for determining relative gene expression. The results revealed that Imiquimod led to the significant upregulation of goose IFNα (P < 0.01), IFNγ (P < 0.01), IL1β (P < 0.01), IL6 (P < 0.01), and IL18 (P < 0.05). The established methods are important for scientific research and clinical applications, which require rapid and accurate results in a short period of time. The technique can potentially be used in the further research of goose molecular immunology, which will help us understand the interactions between hosts and pathogens. © 2015 Poultry Science Association Inc.

  5. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification.

    Science.gov (United States)

    Hyeon, Ji-Yeon; Deng, Xiangyu

    2017-05-01

    We presented the first attempt to combine immunomagnetic separation (IMS), whole genome amplification by multiple displacement amplification (MDA) and real-time PCR for detecting a bacterial pathogen in a food sample. This method was effective in enabling real-time PCR detection of low levels of Salmonella enterica Serotype Enteritidis (SE) (∼10 CFU/g) in raw chicken breast without culture enrichment. In addition, it was able to detect refrigeration-stressed SE cells at lower concentrations (∼0.1 CFU/g) in raw chicken breast after a 4-h culture enrichment, shortening the detection process from days to hours and displaying no statistical difference in detection rate in comparison with a culture-based detection method. By substantially improving performance in SE detection over conventional real-time PCR, we demonstrated the potential of IMS-MDA real-time PCR as a rapid, sensitive and affordable method for detecting Salmonella in food. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Rapid and sensitive detection of Cronobacter spp. (previously Enterobacter sakazakii) in food by duplex PCR combined with capillary electrophoresis-laser-induced fluorescence detector.

    Science.gov (United States)

    Ruan, Jia; Li, Ming; Liu, Ya-Pan; Li, Yuan-Qian; Li, Yong-Xin

    2013-03-15

    Cronobacter spp. (Enterobacter sakazakii) is an emerging opportunistic pathogen with a 40-80% mortality rate in infants and immunocompromised crowd resulting from the consumption of contaminated food. A novel method for detecting Cronobacter spp. in food samples by duplex polymerase chain reaction (PCR) in combination with capillary electrophoresis-laser induced fluorescence (CE-LIF) detector has been developed. The specific gene sequences of 16S-23S rDNA internal transcribed spacer (ITS) and the outer membrane protein A (OmpA) of Cronobacter spp. were amplified by duplex PCR. The PCR products were separated and determined sensitively by CE-LIF within 12min. The relative standard deviations of migration time for the detected DNA fragments were 2.01-2.91%. The detection limit was as low as 1.6×10(1)cfu/mL of Cronobacter spp. Besides, the specificity of the method was verified by 24 non-Cronobacter bacterial strains. A total of 120 commercial infant food formula were tested for the presence of Cronobacter spp. by using the proposed method. This current study demonstrates that the combination of CE-LIF method with duplex PCR is rapid, sensitive and environmental friendly, and has the potential to be adapted for the routine detection of Cronobacter spp. in food samples. To the best of our knowledge, this is the first use of CE-LIF for the detection of Cronobacter spp. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  7. Duplex Real-Time PCR for Rapid Simultaneous Detection of Batrachochytrium dendrobatidis and Batrachochytrium salamandrivorans in Amphibian Samples

    OpenAIRE

    Blooi, M.; Pasmans, F.; Longcore, J. E.; Spitzen-van der Sluijs, A.; Vercammen, F.; Martel, A.

    2013-01-01

    Chytridiomycosis is a lethal fungal disease contributing to declines and extinctions of amphibian species worldwide. The currently used molecular screening tests for chytridiomycosis fail to detect the recently described species Batrachochytrium salamandrivorans. In this study, we present a duplex real-time PCR that allows the simultaneous detection of B. salamandrivorans and Batrachochytrium dendrobatidis. With B. dendrobatidis- and B. salamandrivorans-specific primers and probes, detection ...

  8. Rapid Detection of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in Fresh Chicken Meat and By-Products in Bangkok, Thailand, Using Modified Multiplex PCR.

    Science.gov (United States)

    Saiyudthong, S; Phusri, K; Buates, S

    2015-07-01

    A multiplex PCR assay for simultaneous detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari was developed and validated to assess the occurrence of these bacteria in fresh chicken meat and by-products in Bangkok, Thailand, by using a new combination of four previously published PCR primers for C. jejuni, C. coli, C. lari, and a universal 16S rDNA gene as an internal control. The specificity was determined by using 13 strains of other bacteria. With pure culture DNA, the detection limit was 0.017 ng/PCR for C. jejuni and C. coli and was 0.016 ng/PCR for C. lari. It can detect 10 CFU of C. jejuni, C. coli, and C. lari in 2 g of chicken meat within a 16-h enrichment time. Our multiplex PCR assay was applied for identification of Campylobacter spp. in 122 supermarket samples and 108 fresh market samples. Of the 230 samples evaluated by multiplex PCR, 54.0, 3.3, and 10.7% of supermarket samples were positive for C. jejuni, C. coli, and mixed C. jejuni and C. coli, respectively, and 56.5 and 33.3% of fresh market samples were positive for C. jejuni and mixed C. jejuni and C. coli, respectively. No sample was positive for C. lari. Fresh market samples had significantly higher C. jejuni and C. coli contamination than those from supermarkets (relative risk: 1.3; P = 0.0001). Compared with the culture method (a gold standard), the sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of multiplex PCR were 97.7, 86.8, 96.1, 92.0, and 95.2%, respectively. No significant difference was observed between results from two methods (P = 0.55). Therefore, the established multiplex PCR was not only rapid and easy to perform but had a high sensitivity and specificity to distinguish between C. jejuni, C. coli, and C. lari, even in samples containing mixed contamination. Our study indicated that fresh chicken meat and by-products from fresh markets were significantly less hygienic than those

  9. Comparison of a PfHRP2-based rapid diagnostic test and PCR for malaria in a low prevalence setting in rural southern Zambia: implications for elimination.

    Science.gov (United States)

    Laban, Natasha M; Kobayashi, Tamaki; Hamapumbu, Harry; Sullivan, David; Mharakurwa, Sungano; Thuma, Philip E; Shiff, Clive J; Moss, William J

    2015-01-28

    Rapid diagnostic tests (RDTs) detecting histidine-rich protein 2 (PfHRP2) antigen are used to identify individuals with Plasmodium falciparum infection even in low transmission settings seeking to achieve elimination. However, these RDTs lack sensitivity to detect low-density infections, produce false negatives for P. falciparum strains lacking pfhrp2 gene and do not detect species other than P. falciparum. Results of a PfHRP2-based RDT and Plasmodium nested PCR were compared in a region of declining malaria transmission in southern Zambia using samples from community-based, cross-sectional surveys from 2008 to 2012. Participants were tested with a PfHRP2-based RDT and a finger prick blood sample was spotted onto filter paper for PCR analysis and used to prepare blood smears for microscopy. Species-specific, real-time, quantitative PCR (q-PCR) was performed on samples that tested positive either by microscopy, RDT or nested PCR. Of 3,292 total participants enrolled, 12 (0.4%) tested positive by microscopy and 42 (1.3%) by RDT. Of 3,213 (98%) samples tested by nested PCR, 57 (1.8%) were positive, resulting in 87 participants positive by at least one of the three tests. Of these, 61 tested positive for P. falciparum by q-PCR with copy numbers ≤ 2 x 10(3) copies/μL, 5 were positive for both P. falciparum and Plasmodium malariae and 2 were positive for P. malariae alone. RDT detected 32 (53%) of P. falciparum positives, failing to detect three of the dual infections with P. malariae. Among 2,975 participants enrolled during a low transmission period between 2009 and 2012, sensitivity of the PfHRP2-based RDT compared to nested PCR was only 17%, with specificity of >99%. The pfhrp gene was detected in 80% of P. falciparum positives; however, comparison of copy number between RDT negative and RDT positive samples suggested that RDT negatives resulted from low parasitaemia and not pfhrp2 gene deletion. Low-density P. falciparum infections not identified by currently

  10. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  11. Rapid detection of Salmonella in meat: Comparative and collaborative validation of a non-complex and cost effective pre-PCR protocol

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, F.; Mansdal, S.

    2011-01-01

    samples using a real-time PCR method. The protocol included incubation in buffered peptone water, centrifugation of an aliquot and a boiling procedure. The validation study included comparative and collaborative trials recommended by the Nordic Organization for Validation of Alternative Methods (Nord......Cost-effective and rapid monitoring of Salmonella in the meat production chain can contribute to food safety. The objective was, for the first time, to validate an easy-to-use pre-PCR sample preparation method based on a simple boiling protocol for screening of Salmonella in meat and carcass swab....../sample for the boiling, magnetic bead-based and NMKL187 methods, respectively. When comparing the boiling method with the magnetic beads, the relative accuracy (AC), relative sensitivity (SE) and relative specificity (SP) were found to be 98%, 102% and 98%, respectively (Cohen’s kappa index 0.95). When comparing results...

  12. A rapid method for the detection of representative coliforms in water samples: polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA).

    Science.gov (United States)

    Kuo, Jong-Tar; Cheng, Chiu-Yu; Huang, Hsiao-Han; Tsao, Chia-Fen; Chung, Ying-Chien

    2010-03-01

    Methods to detect the presence of coliform bacteria in drinking water usually involve a series of complex cultivating steps that are time-consuming and subject to external influences. For this reason, the new 16S rRNA probe has been developed in this study as an alternative detector PCR-ELISA technique that does not involve the culture of bacteria and that is able to detect, identify, and quantify the representative coliform species present in water samples. Our results indicate that this technique is both rapid (detection time of 4 h) and accurate (1.4% error rate). The limit of detection (LOD) was 5 CFU/100 ml for total coliforms, which meets the standards set by most countries for drinking water. Our comparative study demonstrated that this PCR-ELISA method is superior to current conventional methods in terms of detection time, LOD, and accuracy.

  13. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Methods: Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. Results: All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. Conclusion: This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers. PMID:18763310

  14. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR.

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-08-01

    Leber's hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers.

  15. Rapid and Accurate Determination of Lipopolysaccharide O-Antigen Types in Klebsiella pneumoniae with a Novel PCR-Based O-Genotyping Method

    Science.gov (United States)

    Shih, Yun-Jui; Cheong, Cheng-Man; Yi, Wen-Ching

    2015-01-01

    Klebsiella pneumoniae, a Gram-negative bacillus that causes life-threatening infections in both hospitalized patients and ambulatory persons, can be classified into nine lipopolysaccharide (LPS) O-antigen serotypes. The O-antigen type has important clinical and epidemiological significance. However, K. pneumoniae O serotyping is cumbersome, and the reagents are not commercially available. To overcome the limitations of conventional serotyping methods, we aimed to create a rapid and accurate PCR method for K. pneumoniae O genotyping. We sequenced the genetic determinants of LPS O antigen from serotypes O1, O2a, O2ac, O3, O4, O5, O8, O9, and O12. We established a two-step genotyping scheme, based on the two genomic regions associated with O-antigen biosynthesis. The first set of PCR primers, which detects alleles at the wzm-wzt loci of the wb gene cluster, distinguishes between O1/O2, O3, O4, O5, O8, O9, and O12. The second set of PCR primers, which detects alleles at the wbbY region, further differentiates between O1, O2a, and O2ac. We verified the specificity of O genotyping against the O-serotype reference strains. We then tested the sensitivity and specificity of O genotyping in K. pneumoniae, using the 56 K-serotype reference strains with known O serotypes determined by an inhibition enzyme-linked immunosorbent assay (iELISA). There is a very good correlation between the O genotypes and classical O serotypes. Three discrepancies were observed and resolved by nucleotide sequencing—all in favor of O genotyping. The PCR-based O genotyping, which can be easily performed in clinical and research microbiology laboratories, is a rapid and accurate method for determining the LPS O-antigen types of K. pneumoniae isolates. PMID:26719438

  16. A Quantitative Real-Time PCR Approach for Assessing Campylobacter jejuni and Campylobacter coli Colonization in Broiler Herds.

    Science.gov (United States)

    Haas, Katrin; Overesch, Gudrun; Kuhnert, Peter

    2017-04-01

    Human campylobacteriosis is a major public health concern in developed countries, with Campylobacter jejuni and Campylobacter coli from poultry recognized as the main source of human infection. Identification of Campylobacter-positive broiler herds before slaughter is essential for implementing measures to avoid carryover of pathogens via the slaughter process into the food chain. However, appropriate methods that have been validated for testing poultry flocks antemortem are lacking for Campylobacter. A quantitative real-time PCR (qPCR) that allows simultaneous detection and quantification of C. jejuni and C. coli was adapted and optimized to be applied on boot socks. The adjusted qPCR serves as an easy, sensitive, and quantitative method for Campylobacter detection in poultry flocks antemortem by analysis of boot socks. An adequate correlation was found between qPCR and culture, as well as between boot socks and cecal samples, which are regarded as the "gold standard." Therefore, boot sock sampling followed by qPCR analysis provides a reliable and simple method for assessing Campylobacter load within a flock prior to slaughter. The approach allows categorization of broiler herds into negative, low, moderate, or high Campylobacter colonization. Based on the results of this new approach, risk assessment models, such as evaluating the possible effect of sorting flocks before slaughter, can be easily implemented. Similarly, targeted identification of highly colonized flocks for improvement of biosecurity measures at the farm level will become feasible, presenting an opportunity to increase food safety.

  17. Novel approach for assessing performance of PCR cyclers used for diagnostic testing.

    Science.gov (United States)

    Schoder, D; Schmalwieser, A; Schauberger, G; Hoorfar, J; Kuhn, M; Wagner, M

    2005-06-01

    As part of a large international project for validation and standardization of PCR, the influence of thermocyclers on PCR was tested. Six brand-new, Peltier technology-driven 96-well thermocyclers were subjected to a novel and stringent in-tube (not block) physical testing. The temperature was directly monitored in PCR tubes containing 50 microl of distilled water at 13 different block positions. The certified temperature accuracy of the measurement system was +/-0.3 degrees C. Finally, the results of the physical testing were compared to those of an amplification efficiency study running an in-house PCR assay. The cyclers did not perform within the manufacturer's specification. Premature timing, under- and overshooting, and spatial variation of heat transfer were found to be the critical factors. The physical testing allowed us to distinguish accurate from less-accurate (2/6) cyclers. The lack of thermal homogeneities became most evident at the denaturation level during the first 15 s. At the time point zero, the accurate cyclers showed temperature deviations of 0.5 to 1.5 degrees C, whereas less-accurate cyclers failed to reach the set temperature by 13 to 20 degrees C. Consequently, the two less-accurate cyclers could not gain positive PCR results by running an in-house PCR assay. However, by modifying the original temperature protocol by increasing the denaturation temperature and time, the amplification efficiency of these two cyclers could be improved significantly. The results have implication for laboratories using diagnostic PCR testing.

  18. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania.

    Science.gov (United States)

    Mahende, Coline; Ngasala, Billy; Lusingu, John; Yong, Tai-Soon; Lushino, Paminus; Lemnge, Martha; Mmbando, Bruno; Premji, Zul

    2016-07-26

    Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. The study enrolled children aged 2-59 months with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. A total of 867 febrile patients were enrolled into the study. Malaria-positive samples were 85/867 (9.8 %, 95 % CI, 7.9-12.0 %) by RDT, 72/867 (8.3 %, 95 % CI, 6.5-10.1 %) by microscopy and 79/677 (11.7 %, 95 % CI, 9.3-14.3 %) by PCR. The performance of malaria RDT compared with microscopy results had sensitivity and positive predictive value (PPV) of 88.9 % (95 % CI, 79.3-95.1 %) and 75.3 % (95 % CI, 64.8-84.0 %), respectively. Confirmation of P. falciparum infection with PCR analysis provided lower sensitivity and PPV of 88.6 % (95 % CI, 79.5-94.7 %) and 84.3 % (95 % CI, 74.7-91.4 %) for RDT compared to microscopy. Diagnosis of malaria infection is still a challenge due to variation in results among diagnostic methods. HRP-2 malaria RDT and microscopy were less sensitive than PCR. Diagnostic tools with high sensitivity are required in areas of low malaria transmission.

  19. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Science.gov (United States)

    Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A

    2017-09-01

    With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  20. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Directory of Open Access Journals (Sweden)

    Irina N Riediger

    2017-09-01

    Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  1. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae.

    Directory of Open Access Journals (Sweden)

    Dongmei Li

    Full Text Available Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand's borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide.

  2. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae).

    Science.gov (United States)

    Li, Dongmei; Fan, Qing-Hai; Waite, David W; Gunawardana, Disna; George, Sherly; Kumarasinghe, Lalith

    2015-01-01

    Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand's borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP) protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS) 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq) value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide.

  3. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay

    Science.gov (United States)

    Stoddard, Robyn A.; Ribeiro, Guilherme S.; Nakatani, Sueli M.; Moreira, Suzana D. R.; Skraba, Irene; Biondo, Alexander W.; Reis, Mitermayer G.; Hoffmaster, Alex R.; Vinetz, Joseph M.; Ko, Albert I.; Wunder, Elsio A.

    2017-01-01

    Background With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5–10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Methodology Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. Principal findings The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. Conclusions These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making. PMID:28915243

  4. Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

    Directory of Open Access Journals (Sweden)

    Serrano Oscar K

    2008-10-01

    Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

  5. Development of a rapid PCR assay for screening of maternal colonization by group B streptococcus and neonatal invasive Escherichia coli during labor.

    Science.gov (United States)

    Martínez de Tejada, Begoña; Stan, Catalin M; Boulvain, Michel; Renzi, Gesuele; François, Patrice; Irion, Olivier; Schrenzel, Jacques

    2010-01-01

    Group B Streptococcus (GBS) and Escherichiacoli(E. coli) are the leading causes of early-onset neonatal disease (EOD). Intrapartum antibiotic prophylaxis of GBS-colonized women decreases vertical transmission and EOD due to GBS. Nevertheless, no intervention has been developed to reduce the risk of EOD related to E. coli. Timely and accurate identification of colonized mothers is necessary to implement preventive strategies against neonatal sepsis. To screen for colonization during labor, we developed a real-time PCR assay for the simultaneous detection of GBS and neonatal invasive strains of E. coli. Specific DNA targets for GBS are publicly available. For neonatal invasive E. coli, we analyzed candidate DNA targets by DNA hybridization on microarrays of invasive strains isolated from neonatal E. coli sepsis or meningitis (K1 and not K1 'invasive' serotypes). Specificity of DNA probes was tested against a panel of bacteria and by simulating clinical conditions (spiking vaginal samples from pregnant women). Then, the characteristics of the selected probes were evaluated in a pilot study including 200 women in labor. Prevalence of rectovaginal GBS and of vaginal and cervical E. coliserotype K1 colonization were 16.0, 3.5 and 3.5% by culture and 27, 10 and 8.5% by PCR, respectively. The prevalence of other invasive E. coli in the vagina and in the cervix, detected by PCR, was around 10%. Compared to the culture, considered as the gold standard, the sensitivities of the PCRs for the GBS and E. coli K1 were 97 and 71%, respectively. Specificities were 86 and 92%, respectively. Specificity is difficult to interpret, as a false-positive PCR result may in fact be a false-negative result of the culture. The turnaround time needed for PCR analysis was 2.5 h, compared to a minimum of 48 h for the culture. Our rapid PCR is reliable in detecting GBS in women in labor. Optimization of the PCR for invasive E. coli is needed before its implementation in clinical practice. More

  6. Real Time PCR for Dientamoeba fragilis: a comparison between molecular and microscopical approach

    Directory of Open Access Journals (Sweden)

    Ettore De Canale

    2009-09-01

    Full Text Available Introduction. Dientamoeba fragilis is an intestinal protozoan parasite that is attracting growing interest. Several authors have associated the presence of this faecal agent to numerous intestinal and systemic clinical symptoms, even though asymptomatic carriers have been reported.Actually, to perform the coproparasitology exam for the identification of D. fragilis it is necessary to recur to an expert microscopist. Recently, several real-time TaqMan assays for the detection of D. fragilis has been reported. In this work we validate an original real-time PCR (TaqMan, re-evaluating the traditional microscopic diagnosis. Moreover, the potential for quantitative information, intrinsic of this molecular technique, was preliminarly explored. Methods. Forty-six carriers of D. fragilis were selected from patients referred to the Service of Microbiology of Padova University Hospital. The parasite was preliminarily detected on several occasions in each patient using traditional microscopy. A control group included forty-two healthy volunteers. Real-time PCR was applied to a stool sample from each subject. On the same sample, gel-electrophoresis amplicon detection PCR and microscopic examination were also performed. Results. The sensitivity of real-time PCR was 100%, whereas microscopy showed 93% sensitivity (direct wet mount on fixed stools and trichrome stain, gel-electrophoresis PCR 76% and Giemsa stain 52%.The specificity of all methods was 100%. On the quantitative side, the frequency distribution of the protozoan load of the stools revealed a near to log-normal pattern is apparent for the data yielded by real-time PCR. Conclusions. The real-time PCR was clearly superior to either the gel electrophoresis PCR or the traditional microscopic examination. Just one unpreserved stool sample was adequate to find the parasite. The entire procedure could be performed within a few hours avoiding toxic dyes.

  7. Rapid quantitative PCR assays for the simultaneous detection of herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and human herpesvirus 6 DNA in blood and other clinical specimens

    NARCIS (Netherlands)

    Engelmann, I.; Petzold, D. R.; Kosinska, A.; Hepkema, B. G.; Schulz, T. F.; Heim, A.

    Rapid diagnosis of human herpesvirus primary infections or reactivations is facilitated by quantitative PCRs. Quantitative PCR assays with a standard thermal cycling profile permitting simultaneous detection of herpes simplex virus (HSV), varicella zoster virus (VZV), cytomegalovirus (CMV),

  8. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  9. Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

    Directory of Open Access Journals (Sweden)

    Adeline Bidault

    2015-12-01

    Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

  10. Rapid differentiation of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood by real-time PCR coupled to high resolution melting analysis.

    Science.gov (United States)

    Albonico, Francesca; Loiacono, Monica; Gioia, Gloria; Genchi, Claudio; Genchi, Marco; Mortarino, Michele

    2014-02-24

    Dirofilaria immitis and D. repens are the principal causative agents of canine filariosis and, although the number of dogs subjected to specific prevention is increasing, the prevalence of these parasites remains high in many areas of the world. The discrimination between the two Dirofilaria species using the classical diagnostic methods can be difficult and may lead to misdiagnosis especially on samples from areas where both Dirofilaria are present. Over the last years, several molecular methods with higher sensitivity and specificity compared to classical microscopy and ELISA assays were designed. Nevertheless, a need for simple, rapid, and cost-effective molecular protocols to accurately discriminate between D. immitis and D. repens still remains. High resolution melting analysis coupled to real-time PCR (real-time PCR-HRMA) is a widely used technique to target sequence polymorphisms of the same gene in different species without the need to perform DNA sequencing or to use species-specific probes. In this work, a fast and cost-effective real-time PCR-HRMA protocol to detect and differentiate simultaneously and unequivocally D. immitis and D. repens microfilarial DNA extracted from peripheral dog blood samples is described. The present method is simpler to use than most other DNA-based methods and provides comparable discrimination between the two sibling species. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Rapid and sustained clearance of circulating lymphoma cells after chemotherapy plus rituximab: clinical significance of quantitative t(14;18) PCR monitoring in advanced stage follicular lymphoma patients.

    Science.gov (United States)

    Hirt, Carsten; Schüler, Frank; Kiefer, Thomas; Schwenke, Cornelia; Haas, Antje; Niederwieser, Dietger; Neser, Sabine; Assmann, Michael; Srock, Stefanie; Rohrberg, Robert; Dachselt, Klaus; Leithäuser, Malte; Rabkin, Charles S; Herold, Michael; Dölken, Gottfried

    2008-05-01

    This study of first-line treatment in advanced-stage follicular lymphoma patients analysed the effects of MCP (mitoxantrone, chlorambucil and prednisolone) chemotherapy alone or in combination with rituximab (R-MCP) on circulating lymphoma cells (CLC) and assessed the prognostic value of a quantitative monitoring of CLC. CLC numbers were determined by quantitative polymerase chain reaction (PCR) for the t(14;18)-translocation or by allele-specific PCR for rearranged immunoglobulin heavy chain genes. We analysed blood samples from 43 patients treated in a randomized trial comparing eight cycles of MCP versus R-MCP. Clearance of CLC at the end of therapy was achieved in 21/25 patients (84%) treated with R-MCP compared with 0/18 after MCP alone (P or = 2 log CLC reduction was associated with a favourable clinical response (P = 0.0004) and prolonged event-free survival (P = 0.02). In R-MCP patients, stable CLC numbers or consistently PCR-negative blood samples were associated with a continuing clinical remission whereas in two patients a relapse was preceded by a > or = 2 log CLC increase. This study demonstrated that R-MCP led to a rapid and sustained eradication of CLC and a > or = 2 log CLC reduction was associated with a superior quality and duration of the clinical response.

  12. A parent-oriented approach to rapid toilet training

    Directory of Open Access Journals (Sweden)

    Dai Doan

    2016-12-01

    Full Text Available The current evaluation assessed the effectiveness of a rapid toilet training procedure for three young males with autism. The evaluation extended the research on rapid toilet training procedures by assessing parents’ preference to include two common toilet training components, a urine alarm and positive practice. In addition, we assessed child challenging behaviors during intervention. All parent participants’ elected not to use the urine alarm, and one parent elected to discontinue the implementation of positive practice techniques. All child participants engaged in challenging behavior with the initiation of toilet training. The toileting intervention was successful as all three participants increased successful self-initiations for the toilet and decreased accidents across home and clinic settings. All parents provided favorable social validity ratings of the treatment. Findings suggest that clinicians should partner with parents to develop individualized toileting interventions that are appropriate and effective.

  13. New multiplex real-time PCR approach to detect gene mutations for spinal muscular atrophy.

    Science.gov (United States)

    Liu, Zhidai; Zhang, Penghui; He, Xiaoyan; Liu, Shan; Tang, Shi; Zhang, Rong; Wang, Xinbin; Tan, Junjie; Peng, Bin; Jiang, Li; Hong, Siqi; Zou, Lin

    2016-08-17

    Spinal muscular atrophy (SMA) is the most common autosomal recessive disease in children, and the diagnosis is complicated and difficult, especially at early stage. Early diagnosis of SMA is able to improve the outcome of SMA patients. In our study, Real-time PCR was developed to measure the gene mutation or deletion of key genes for SMA and to further analyse genotype-phenotype correlation. The multiple real-time PCR for detecting the mutations of survival of motor neuron (SMN), apoptosis inhibitory protein (NAIP) and general transcription factor IIH, polypeptide 2 gene (GTF2H2) was established and confirmed by DNA sequencing and multiplex ligation-dependent probe amplification (MLPA). The diagnosis and prognosis of 141 hospitalized children, 100 normal children and further 2000 cases of dry blood spot (DBS) samples were analysed by this multiple real-time PCR. The multiple real-time PCR was established and the accuracy of it to detect the mutations of SMN, NAIP and GTF2H2 was at least 98.8 % comparing with DNA sequencing and MLPA. Among 141 limb movement disorders children, 75 cases were SMA. 71 cases of SMA (94.67 %) were with SMN c.840 mutation, 9 cases (12 %) with NAIP deletion and 3 cases (4 %) with GTF2H2 deletion. The multiple real-time PCR was able to diagnose and predict the prognosis of SMA patients. Simultaneously, the real-time PCR was applied to detect trace DNA from DBS and able to make an early diagnosis of SMA. The clinical and molecular characteristics of SMA in Southwest of China were presented. Our work provides a novel way for detecting SMA in children by using real-time PCR and the potential usage in newborn screening for early diagnosis of SMA.

  14. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  15. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  16. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Science.gov (United States)

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  17. Rapid Identification of Pathogens from Positive Blood Cultures by Multiplex PCR using the FilmArray System

    Science.gov (United States)

    Blaschke, Anne J.; Heyrend, Caroline; Byington, Carrie L.; Fisher, Mark A.; Barker, Elizabeth; Garrone, Nicholas F.; Thatcher, Stephanie A.; Pavia, Andrew T.; Barney, Trenda; Alger, Garrison D.; Daly, Judy A.; Ririe, Kirk M.; Ota, Irene; Poritz, Mark A.

    2012-01-01

    Sepsis is a leading cause of death. Rapid and accurate identification of pathogens and antimicrobial resistance directly from blood culture could improve patient outcomes. The FilmArray® (FA; Idaho Technology, Inc., Salt Lake City, UT) Blood Culture (BC) panel can identify > 25 pathogens and 4 antibiotic resistance genes from positive blood cultures in 1 hour. We compared a development version of the panel to conventional culture and susceptibility testing on 102 archived blood cultures from adults and children with bacteremia. Of 109 pathogens identified by culture, 95% were identified by FA. Among 111 prospectively collected blood cultures, the FA identified 84 of 92 pathogens (91%) covered by the panel. Among 25 Staphylococcus aureus and 21 Enterococcus species detected, FA identified all culture-proven MRSA and VRE. The FA BC panel is an accurate method for the rapid identification of pathogens and resistance genes from blood culture. PMID:22999332

  18. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    OpenAIRE

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococc...

  19. Rapid and Sensitive Detection of Yersinia pestis Using Amplification of Plague Diagnostic Bacteriophages Monitored by Real-Time PCR

    Science.gov (United States)

    2010-06-01

    plating test for bacteriophage l quantitation [43] and then successfully applied for the indirect detection of Bacillus anthracis [44] and the plant ...of Listeria monocytogenes in the peresence of Listeria innocua. In: Campbell AK, Kricka LJ, Stanley PE, eds. Bioluminescence and chemilumi- nescence...rapid and sensitive detection of viable Listeria cells. Appl Environ Microbiol 62: 1133–1140. 37. Banaiee N, Bobadilla-Del-Valle M, Bardarov S, Jr

  20. Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

    Science.gov (United States)

    Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

    2013-03-01

    Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  1. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples.

    Science.gov (United States)

    Leblanc-Maridor, Mily; Beaudeau, François; Seegers, Henri; Denis, Martine; Belloc, Catherine

    2011-05-22

    Campylobacter spp., especially Campylobacter jejuni (C. jejuni) and Campylobacter coli (C. coli), are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 10² CFU/g of faeces, 1.3 × 10² CFU/g of feed, and 1.0 × 10³ CFU/m² for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R² = 0.90 and R² = 0.93 respectively. The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new diagnostic tool for studying the epidemiology of

  2. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Directory of Open Access Journals (Sweden)

    Denis Martine

    2011-05-01

    Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

  3. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Science.gov (United States)

    2011-01-01

    Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni) and Campylobacter coli (C. coli), are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new diagnostic tool for studying

  4. Rapid detection of novel caprine parainfluenza virus type 3 (CPIV3) using a TaqMan-based RT-qPCR.

    Science.gov (United States)

    Li, Jizong; Li, Wenliang; Mao, Li; Hao, Fei; Yang, Leilei; Zhang, Wenwen; Jiang, Jieyuan

    2016-10-01

    Parainfluenza virus type 3 (PIV3) is one of the most important respiratory pathogens for humans and many animals. A novel caprine PIV3 (CPIV3) was recently identified and isolated from Chinese goat flocks with respiratory disease. In order to develop rapid and sensitive methods for CPIV3 detection in infected goats, a TaqMan RT-qPCR was established in this study based on the primers and probe designed to amplify a 150 nucleotide-long region located within the M gene of the virus. The method was able to detect about 1.0×10(1) DNA copies/μL with an efficiency of 99.6% and a R(2) value of 0.997. There were no cross-reaction observed using this technique against peste des petits ruminants virus (PPRV), border disease virus (BDV), bluetongue virus (BTV) and bovine viral diarrhea virus (BVDV). One hundred and fourteen samples, including nasal swabs, feces swabs, sera, hearts, livers, spleens, lungs, kidneys, tracheas and hilar lymph nodes (HLNs) from six challenged goats, were evaluated by this technique. Using TaqMan RT-qPCR, CPIV3 was positively detected in 51 of 114 samples (44.74%), which was higher than RT-PCR (27.19%, 31/114) and virus isolation (14.9%, 17/114), respectively. The method also gave higher positive detection rate (35%, 42/120) than RT-PCR (28.33%, 34/120) from clinical samples. These data indicated that this method could be used for faster and more accurate monitoring of viral load, disease progression and vaccination efficacy of CPIV3 in goat flocks. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Genotype-specific real-time PCR combined with high-resolution melting analysis for rapid identification of red-spotted grouper nervous necrosis virus.

    Science.gov (United States)

    Toubanaki, Dimitra K; Karagouni, Evdokia

    2017-08-01

    A real-time genotype-specific polymerase chain reaction (PCR) assay combined with high-resolution melting (HRM) analysis was developed to assess the most common genotypes of nervous necrosis viruses or nodaviruses. Nodaviruses are the causal agents of viral nervous necrosis infections, which have been wreaking havoc in the aquaculture industry worldwide, with fish mortality up to 100%. The four different genotypes of nodaviruses correlate with differences in viral pathogenicity. Therefore, rational development of effective vaccines and diagnostics requires analysis of genetic variation among viruses. The aim of the present study was to develop a real-time tetra-primer genotype-specific PCR assay for genotype identification. Four primers were utilized for simultaneous amplification of nodavirus genotype-specific products in a single closed-tube PCR after a reverse-transcription reaction using RNA isolated from fish samples. For high-throughput sample analysis, SYBR Green-based real-time PCR was used in combination with HRM analysis. The assay was evaluated in terms of specificity and sensitivity. The analysis resulted in melting curves that were indicative of each genotype. The detection limit when using reference plasmids was 100 ag/µL for both genotypes, while the sensitivity of the assays when testing a complex mixture was 10 fg/µL for red-spotted grouper nervous necrosis virus (RGNNV) and 100 fg/µL for striped jack nervous necrosis virus (SJNNV). To test the capability of this method under real-world conditions, 58 samples were examined. All samples belonged to the RGNNV genotype, which was fully validated. The results were in full agreement with genotyping by reference methods. The proposed methodology provides a rapid, sensitive, specific, robust and automatable assay for nodavirus genotyping, making it a useful tool for diagnosis and screening for epidemiological studies.

  6. Quantitative real-time PCR and fluorescence in situ hybridization approaches for enumerating Brevundimonas diminuta in drinking water.

    Science.gov (United States)

    Donofrio, Robert S; Bestervelt, Lorelle L; Saha, Ratul; Bagley, Susan T

    2010-09-01

    Brevundimonas diminuta is a small Gram-negative bacterium used for validation of membranes and filters used in the pharmaceutical and drinking water treatment industries. Current assays are time consuming, nonselective, and may be subject to interference by competing indigenous microorganisms. The focus of this study is to develop rapid and specific enumeration methodologies for B. diminuta. Quantitative real-time polymerase chain reaction (qPCR) and fluorescence in situ hybridization (FISH) assays were developed based on the gyrB (1,166 bp) and rpoD (829 bp) gene sequences of B. diminuta ATCC 19146. Species-specific primers and probes were designed, and a 100-200 bp segment of each gene was targeted in the qPCR studies. For both the qPCR and FISH assays, an internal 25 bp sequence was selected for use as a TaqMan probe (labeled with 6-FAM and a Black Hole Quencher). Probe specificity studies, conducted against Gram-negative and Gram-positive reference strains as well as environmental strains, revealed high specificity of the primer/probe pairs to B. diminuta. Sensitivities of the qPCR reactions using purified genomic DNA from B. diminuta were determined to be 0.89 pg for rpoD and 8.9 pg for gyrB. The feasibility of using whole-cell B. diminuta suspensions directly with the rpoD qPCR protocol was also evaluated. The greatest sensitivity observed for B. diminuta was 1 x 10(3) colony forming units (CFU) per mL when tryptic soy broth was used as the growth medium. When compared with direct microscopic enumeration using a 5' 6-FAM FISH probe, traditional plating methods showed significant underestimation of B. diminuta concentration (P = 0.01) when this organism was cultivated in saline lactose broth. The results of this investigation demonstrate that qPCR and FISH are effective methods for rapid (drinking water filtration systems.

  7. A novel, Q-PCR based approach to measuring endogenous retroviral clearance by capture protein A chromatography.

    Science.gov (United States)

    Zhang, Min; Lute, Scott; Norling, Lenore; Hong, Connie; Safta, Aurelia; O'Connor, Deborah; Bernstein, Lisa J; Wang, Hua; Blank, Greg; Brorson, Kurt; Chen, Qi

    2009-04-01

    Quantification of virus removal by the purification process during production is required for clinical use of biopharmaceuticals. The current validation approach for virus removal by chromatography steps typically involves time-consuming spiking experiments with expensive model viruses at bench scale. Here we propose a novel, alternative approach that can be applied in at least one instance: evaluating retroviral clearance by protein A chromatography. Our strategy uses a quantitative PCR (Q-PCR) assay that quantifies the endogenous type C retrovirus-like particle genomes directly in production Chinese Hamster Ovary (CHO) cell culture harvests and protein A pools. This eliminates the need to perform spiking with model viruses, and measures the real virus from the process. Using this new approach, clearance values were obtained that was comparable to those from the old model-virus spike/removal approach. We tested the concept of design space for CHO retrovirus removal using samples from a protein A characterization study, where a wide range of chromatographic operating conditions were challenged, including load density, flow rate, wash, pooling, temperature, and resin life cycles. Little impact of these variables on CHO retrovirus clearance was found, arguing for implementation of the design space approach for viral clearance to support operational ranges and manufacturing excursions. The viral clearance results from Q-PCR were confirmed by an orthogonal quantitative product-enhanced reverse transcriptase (Q-PERT) assay that quantifies CHO retrovirus by their reverse transcriptase (RT) enzyme activity. Overall, our results demonstrate that protein A chromatography is a robust retrovirus removal step and CHO retrovirus removal can be directly measured at large scale using Q-PCR assays.

  8. Novel approach for assessing performance of PCR cyclers used for diagnostic testing

    DEFF Research Database (Denmark)

    Schoder, D.; Schmalwieser, A.; Schauberger, G.

    2005-01-01

    -house PCR assay. The cyclers did not perform within the manufacturer's specification. Premature timing, under- and overshooting, and spatial variation of heat transfer were found to be the critical factors. The physical testing allowed us to distinguish accurate from less-accurate (2/6) cyclers. The lack...

  9. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  10. Development of quantitative PCR and metagenomics-based approaches for strain quantification of a defined mixed-strain starter culture.

    Science.gov (United States)

    Johansen, Pernille; Vindeløv, Jannik; Arneborg, Nils; Brockmann, Elke

    2014-05-01

    Although the strain composition of mixed cultures may hugely affect production of various fermented foods, such as e.g. cheese, tools for investigating it have so far been limited. In this study, two new approaches for quantification of seven Lactococcus lactis subsp. cremoris strains (S1-S7) in a defined mixed-strain starter culture were developed and verified. By mapping NGS reads from 47 sequenced L. lactis strains to de novo assembly contigs of the seven strains, two strain-specific sequence regions (SEQ1 and SEQ2) were identified for each strain for qPCR primer design (A1 and A2). The qPCR assays amplified their strain-specific sequence region target efficiently. Additionally, high reproducibility was obtained in a validation sample containing equal amounts of the seven strains, and assay-to-assay coefficients of variance (CVs) for six (i.e. S1, S2, S4-S7) of the seven strains correlated to the inter-plate CVs. Hence, at least for six strains, the qPCR assay design approach was successful. The metagenomics-based approach quantified the seven strains based on average coverage of SEQ1 and SEQ2 by mapping sequencing reads from the validation sample to the strain-specific sequence regions. Average coverages of the SEQ1 and SEQ2 in the metagenomics data showed CVs of ≤17.3% for six strains (i.e. S1-S4, S6, S7). Thus, the metagenomics-based quantification approach was considered successful for six strains, regardless of the strain-specific sequence region used. When comparing qPCR- and metagenomics-based quantifications of the validation sample, the identified strain-specific sequence regions were considered suitable and applicable for quantification at a strain level of defined mixed-strain starter cultures. Copyright © 2014 Elsevier GmbH. All rights reserved.

  11. New Approaches on Quantification of Campylobacter jejuni in Poultry Samples: The Use of Digital PCR and Real-time PCR against the ISO Standard Plate Count Method.

    Science.gov (United States)

    Papić, Bojan; Pate, Mateja; Henigman, Urška; Zajc, Urška; Gruntar, Igor; Biasizzo, Majda; Ocepek, Matjaž; Kušar, Darja

    2017-01-01

    Campylobacteriosis is the most frequently reported bacterial food-borne illness in the European Union and contaminated broiler meat is considered the most important source of infection in humans. The aim of the present study was to evaluate real-time PCR (qPCR) and digital PCR (dPCR) for quantification of Campylobacter jejuni in 75 broiler neck-skin samples collected from a poultry slaughterhouse, and to compare them with the ISO 10272-2 standard plate count method. For qPCR standard curve, C. jejuni-negative neck-skin samples were spiked with C. jejuni suspension with a known number of bacterial cells. The observed CFU/g values by qPCR correlated greatly with the expected values and qPCR showed good performance with the reliable limit of detection (rLOD) and limit of quantification (LOQ) of three and 31 target copies per reaction, respectively. However, both rLOD (1219 CFU/g) and LOQ (12,523 CFU/g) were beyond the EFSA-proposed critical limit of 500-1,000 CFU/g of neck skin. Although C. jejuni cell counts were ≤1,000 CFU/g in only 7/75 samples by plate counting, they were ≤LOQ in 60/75 and ≤rLOD in 26/75 (≤1,000 CFU/g in 24/75) samples by qPCR. A strong and statistically significant correlation was observed between qPCR and dPCR. Both PCR-based methods correlated significantly with the plate count method; however, the correlation was moderate. Using the Bland-Altman analysis, an average agreement was noted between all three methods, although with a large standard deviation. A significant bias toward overestimation in dPCR was observed, probably due to the relatively high number of false positive calls. The linear dynamic range was comparable in both PCR-based methods; however, qPCR proved to be more suitable for routine use. In the future, the establishment of a reliable molecular quantification of C. jejuni in poultry samples showing a wide range of contamination levels down to the proposed critical limit is needed to enable time- and cost

  12. Performance of a real-time PCR-based approach and droplet digital PCR in detecting human parechovirus type 3 RNA.

    Science.gov (United States)

    Aizawa, Yuta; Koyama, Akihide; Ishihara, Tomohiko; Onodera, Osamu; Saitoh, Akihiko

    2016-11-01

    Human parechovirus type 3 (HPeV3) is an emerging virus that causes sepsis and meningoencephalitis in neonates and young infants. Correct diagnosis of HPeV3 infection is critical in determining appropriate management and predicting patients' clinical course. Real-time reverse transcription PCR (RT-PCR) analysis of serum and/or cerebrospinal fluid (CSF) has been used to diagnose HPeV3 infection; however, the assay detection limits have not been fully evaluated. We tested the hypothesis that droplet digital RT-PCR (RT-ddPCR)-a novel technique that precisely quantitates low-copy target genes by diluting and partitioning samples into compartments-increases the detection rate of HPeV3 RNA as compared with real-time RT-PCR. Using samples with predetermined HPeV3 copy numbers, we evaluated one-step and two-step RT-ddPCR. Then, we tested two-step RT-ddPCR and real-time RT-PCR, using clinical samples with low copy numbers. Finally, we used two-step RT-ddPCR to evaluate clinical samples obtained from HPeV3-infected patients with positive serum but negative CSF, as determined by real-time RT-PCR. Two-step RT-ddPCR was less variable and more specific than one-step RT-ddPCR. Two-step RT-ddPCR detected HPeV3 RNA in all six CSF samples; four samples (67%) were reproducibly positive and the other two samples (33%) were positive at least once in four replicates. Finally, no nonspecific droplet was positive by two-step RT-ddPCR. Two-step RT-ddPCR may enhance the rate of HPeV3 RNA detection from samples with low viral loads, thereby improving diagnosis and management of HPeV3-infected patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Multiplex PCR system for the rapid diagnosis of respiratory virus infection: systematic review and meta-analysis.

    Science.gov (United States)

    Huang, H-S; Tsai, C-L; Chang, J; Hsu, T-C; Lin, S; Lee, C-C

    2017-12-05

    To provide a summary of evidence for the diagnostic accuracies of three multiplex PCR systems (mPCRs)-BioFire FilmArray RP (FilmArray), Nanosphere Verigene RV+ test (Verigene RV+) and Hologic Gen-Probe Prodesse assays-on the detection of viral respiratory infections. A comprehensive search up to 1 July 2017 was conducted on Medline and Embase for studies that utilized FilmArray, Verigene RV+ and Prodesse for diagnosis of viral respiratory infections. A summary of diagnostic accuracies for the following five viruses were calculated: influenza A virus (FluA), influenza B virus, respiratory syncytial virus, human metapneumovirus and adenovirus. Hierarchical summary receiver operating curves were used for estimating the viral detection performance per assay. Twenty studies of 5510 patient samples were eligible for analysis. Multiplex PCRs demonstrated high diagnostic accuracy, with area under the receiver operating characteristic curve (AUROC) equal to or more than 0.98 for all the above viruses except for adenovirus (AUROC 0.89). FilmArray, Verigene RV+ and ProFlu+ (the only Prodesse assay with enough data) demonstrated a summary sensitivity for FluA of 0.911 (95% confidence interval, 0.848-0.949), 0.949 (95% confidence interval, 0.882-0.979) and 0.954 (95% confidence interval, 0.871-0.985), respectively. The three mPCRs were comparable in terms of detection of FluA. Point estimates calculated from eligible studies showed that the three mPCRs (FilmArray, Verigene RV+ and ProFlu+) are highly accurate and may provide important diagnostic information for early identification of respiratory virus infections. In patients with low pretest probability for FluA, these three mPCRs can predict a low possibility of infection and may justify withholding empirical antiviral treatments. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  14. Rapid Diagnosis of Staphylococcal Catheter-Related Bacteraemia in Direct Blood Samples by Real-Time PCR.

    Science.gov (United States)

    Zboromyrska, Yuliya; De la Calle, Cristina; Soto, Marcelo; Sampietro-Colom, Laura; Soriano, Alex; Alvarez-Martínez, Míriam José; Almela, Manel; Marco, Francesc; Arjona, Ruth; Cobos-Trigueros, Nazaret; Morata, Laura; Mensa, José; Martínez, José Antonio; Mira, Aurea; Vila, Jordi

    2016-01-01

    Catheter-related bacteremia (CRB) is an important cause of morbidity and mortality among hospitalized patients, being staphylococci the main etiologic agents. The objective of this study was to assess the use of a PCR-based assay for detection of staphylococci directly from blood obtained through the catheter to diagnose CRB caused by these microorganisms and to perform a cost-effectiveness analysis. A total of 92 patients with suspected CRB were included in the study. Samples were obtained through the catheter. Paired blood cultures were processed by standard culture methods and 4 ml blood samples were processed by GeneXpert-MRSA assay for the detection of methicillin-susceptible (MSSA) or methicillin-resistant (MRSA) Staphylococcus aureus, and methicillin-resistant coagulase-negative staphylococci (MR-CoNS). Sixteen CRB caused by staphylococci were diagnosed among 92 suspected patients. GeneXpert detected 14 out of 16 cases (87.5%), including 4 MSSA and 10 MR-CoNS in approximately 1 hour after specimen receipt. The sensitivity and specificity of GeneXpert were 87.5% (CI 95%: 60.4-97.8) and 92.1% (CI 95%: 83-96.7), respectively, compared with standard culture methods. The sensitivity of GeneXpert for S. aureus was 100%. Regarding a cost-effectiveness analysis, the incremental cost of using GeneXpert was of 31.1€ per patient while the incremental cost-effectiveness ratio of GeneXpert compared with blood culture alones was about 180€ per life year gained. In conclusion, GeneXpert can be used directly with blood samples obtained through infected catheters to detect S. aureus and MR-CoNS in approximately 1h after sampling. In addition, it is cost-effective especially in areas with high prevalence of staphylococcal CRB.

  15. Rapid identification of Iranian Acinetobacter baumannii strains by single PCR assay using BLA oxa-51 -like carbapenemase and evaluation of the antimicrobial resistance profiles of the isolates.

    Science.gov (United States)

    Akbari, Mahdi; Mahdi, Akbari; Niakan, Mohammad; Mohammad, Niakan; Taherikalani, Morovat; Morovat, Taherikalani; Feizabadi, Mohammad Mehdi; Mhammad-Mahdi, Feizabadi; Azadi, Namam Ali; Namam-Ali, Azadi; Soroush, Setareh; Setareh, Soroush; Emaneini, Mohammad; Mohammad, Emaneini; Abdolkarimi, Amir; Amir, Abdolkarimi; Maleki, Abbas; Abbas, Maleki; Hematian, Ali; Ali, Hematian

    2010-06-01

    The rapid identification of relevant bacterial pathogens is of utmost importance in clinical settings. The aim of this study was to test a rapid identification technique for A. baumannii strains from Tehran Hospitals and to determine the antibiotic resistance profiles of the isolates. A hundred strains of Acinetobacter spp. grown from clinical specimens were identified as A. baumannii by conventional methods. Using PCR a bla OXA-51 -like gene was detected in all A. baumannii isolates but not in other species of acinetobacter. More than half of the isolates proved resistant to a variety of antibiotics by the disk diffusion technique. The rate of resistance to gentamicin, imipenem, ampicillin-sulbactam and amikacin was determined to be 45%, 53%, 62% and 62%, respectively. Moreover, most isolates (more than 90%) showed resistance to cephalosporins. This study shows that the demonstration of the bla OXA-51-like gene is a reliable and rapid way for the presumptive identification of A. baumannii and reveals that the rate of antibiotic resistance is high in Iranian A. baumannii isolates to a variety of antibiotics.

  16. Pediatric Dispersible Tablets: a Modular Approach for Rapid Prototyping.

    Science.gov (United States)

    Buck, Jonas; Huwyler, Jörg; Kühl, Peter; Dischinger, Angela

    2016-08-01

    The design of pediatric formulations is challenging. Solid dosage forms for children have to meet the needs of different ages, e.g. high number of dosing increments and strengths. A modular formulation strategy offering the possibility of rapid prototyping was applied. Different tablet compositions and the resulting tablet characteristics were investigated for dispersible tablets using customized analytical methods. Fluid bed granules were blended with extragranular components, and compressed to tablets. Disintegration behavior was studied with a Texture Analyzer and a Tensiometer. Methods for determination of disintegration time and water uptake of tablets were developed with a Texture Analyzer, and a Tensiometer, respectively. Twenty-two different tablet formulations were prepared and analyzed with respect to disintegration time, hardness, friability, and viscosity. Multivariate data analysis revealed a high impact of type and amount of viscosity enhancer on the disintegration behavior of tablets. An optimized formulation was selected with a disintegration time of 24 s. Methods providing additional information on the disintegration behavior of dispersible tablets compared to standard pharmacopoeia methods were established. Selecting the right type and level of viscosity enhancer and superdisintegrant was critical for developing pediatric tablets with a disintegration time of less than 30 s but still pleasant mouth feel.

  17. An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

  18. A Multiplex-PCR approach to identification of the Brazilian intermediate hosts of Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    THDA Vidigal

    2002-10-01

    Full Text Available Due to difficulties concerning morphological identification of planorbid snails of the genus Biomphalaria, and given a high variation of characters and in the organs with muscular tissue, we designed specific polymerase chain reaction (PCR primers for Brazilian snail hosts of Schistosoma mansoni from available sequences of internal transcribed spacer 2 (ITS2 of the ribosomal RNA gene. From the previous sequencing of the ITS2 region, one primer was designed to anchor in the 5.8S conserved region and three other species-specific primers in the 28S region, flanking the ITS2 region. These four primers were simultaneously used in the same reaction (Multiplex-PCR, under high stringency conditions. Amplification of the ITS2 region of Biomphalaria snails produced distinct profiles (between 280 and 350 bp for B. glabrata, B. tenagophila and B. straminea. The present study demonstrates that Multiplex-PCR of ITS2-DNAr showed to be a promising auxiliary tool for the morphological identification of Biomphalaria snails, the intermediate hosts of S. mansoni.

  19. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  20. A broadly reactive one-step SYBR Green I real-time RT-PCR assay for rapid detection of murine norovirus.

    Directory of Open Access Journals (Sweden)

    Ken-Ichi Hanaki

    Full Text Available A one-step SYBR Green I real-time RT-PCR assay was developed for the detection and quantification of a broad range of murine noroviruses (MNVs. The primer design was based on the multiple sequence alignments of 101 sequences of the open reading frame (ORF1-ORF2 junction of MNV. The broad reactivity and quantitative capacity of the assay were validated using 7 MNV plasmids. The assay was completed within 1 h, and the reliable detection limit was 10 copies of MNV plasmid or 0.063 median tissue culture infective doses per milliliter of RAW264 cell culture-propagated viruses. The diagnostic performance of the assay was evaluated using 158 mouse fecal samples, 91 of which were confirmed to be positive. The melting curve analysis demonstrated the diversity of MNV in the samples. This is the first report of a broadly reactive one-step SYBR Green I real-time RT-PCR assay for detecting of MNVs. The rapid and sensitive performance of this assay makes it a powerful tool for diagnostic applications.

  1. Novel quantitative real-time PCR approach to determine safflower (Carthamus tinctorius) adulteration in saffron (Crocus sativus).

    Science.gov (United States)

    Villa, Caterina; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel

    2017-08-15

    This work intended to develop DNA-based methods to detect and quantify safflower as an adulterant in saffron. Species-specific PCR and real-time PCR with EvaGreen dye targeting the ITS region of Carthamus tinctorius L. (safflower) were successfully proposed. The assays allowed absolute and relative sensitivities of 2pg of safflower DNA (∼1.4 DNA copies) and 0.1% of safflower in saffron (Crocus sativus L.), respectively. A normalised real-time PCR approach was also proposed in the range of 0.1-20% (w/w) of safflower in saffron, which was successfully validated and applied to commercial saffron samples (stigmas, powders and seasonings). From 19 samples, three were positive to safflower, though at levels below the limit of detection, suggesting cross-contamination rather than adulteration. In this work, specific, sensitive and accurate tools were proposed to authenticate saffron. To the best of our knowledge, this is the first successful attempt to quantify safflower by a DNA-based approach. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. A real time metabolomic profiling approach to detecting fish fraud using rapid evaporative ionisation mass spectrometry.

    Science.gov (United States)

    Black, Connor; Chevallier, Olivier P; Haughey, Simon A; Balog, Julia; Stead, Sara; Pringle, Steven D; Riina, Maria V; Martucci, Francesca; Acutis, Pier L; Morris, Mike; Nikolopoulos, Dimitrios S; Takats, Zoltan; Elliott, Christopher T

    2017-01-01

    Fish fraud detection is mainly carried out using a genomic profiling approach requiring long and complex sample preparations and assay running times. Rapid evaporative ionisation mass spectrometry (REIMS) can circumvent these issues without sacrificing a loss in the quality of results. To demonstrate that REIMS can be used as a fast profiling technique capable of achieving accurate species identification without the need for any sample preparation. Additionally, we wanted to demonstrate that other aspects of fish fraud other than speciation are detectable using REIMS. 478 samples of five different white fish species were subjected to REIMS analysis using an electrosurgical knife. Each sample was cut 8-12 times with each one lasting 3-5 s and chemometric models were generated based on the mass range m/z 600-950 of each sample. The identification of 99 validation samples provided a 98.99% correct classification in which species identification was obtained near-instantaneously (≈ 2 s) unlike any other form of food fraud analysis. Significant time comparisons between REIMS and polymerase chain reaction (PCR) were observed when analysing 6 mislabelled samples demonstrating how REIMS can be used as a complimentary technique to detect fish fraud. Additionally, we have demonstrated that the catch method of fish products is capable of detection using REIMS, a concept never previously reported. REIMS has been proven to be an innovative technique to help aid the detection of fish fraud and has the potential to be utilised by fisheries to conduct their own quality control (QC) checks for fast accurate results.

  3. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  4. Rapid diagnosis of avian influenza virus in wild birds: use of a portable rRT-PCR and freeze-dried reagents in the field.

    Science.gov (United States)

    Takekawa, John Y; Hill, Nichola J; Schultz, Annie K; Iverson, Samuel A; Cardona, Carol J; Boyce, Walter M; Dudley, Joseph P

    2011-08-02

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  5. ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases.

    Science.gov (United States)

    Bellemain, Eva; Carlsen, Tor; Brochmann, Christian; Coissac, Eric; Taberlet, Pierre; Kauserud, Håvard

    2010-07-09

    During the last 15 years the internal transcribed spacer (ITS) of nuclear DNA has been used as a target for analyzing fungal diversity in environmental samples, and has recently been selected as the standard marker for fungal DNA barcoding. In this study we explored the potential amplification biases that various commonly utilized ITS primers might introduce during amplification of different parts of the ITS region in samples containing mixed templates ('environmental barcoding'). We performed in silico PCR analyses with commonly used primer combinations using various ITS datasets obtained from public databases as templates. Some of the ITS primers, such as ITS1-F, were hampered with a high proportion of mismatches relative to the target sequences, and most of them appeared to introduce taxonomic biases during PCR. Some primers, e.g. ITS1-F, ITS1 and ITS5, were biased towards amplification of basidiomycetes, whereas others, e.g. ITS2, ITS3 and ITS4, were biased towards ascomycetes. The assumed basidiomycete-specific primer ITS4-B only amplified a minor proportion of basidiomycete ITS sequences, even under relaxed PCR conditions. Due to systematic length differences in the ITS2 region as well as the entire ITS, we found that ascomycetes will more easily amplify than basidiomycetes using these regions as targets. This bias can be avoided by using primers amplifying ITS1 only, but this would imply preferential amplification of 'non-dikarya' fungi. We conclude that ITS primers have to be selected carefully, especially when used for high-throughput sequencing of environmental samples. We suggest that different primer combinations or different parts of the ITS region should be analyzed in parallel, or that alternative ITS primers should be searched for.

  6. ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases

    Directory of Open Access Journals (Sweden)

    Taberlet Pierre

    2010-07-01

    Full Text Available Abstract Background During the last 15 years the internal transcribed spacer (ITS of nuclear DNA has been used as a target for analyzing fungal diversity in environmental samples, and has recently been selected as the standard marker for fungal DNA barcoding. In this study we explored the potential amplification biases that various commonly utilized ITS primers might introduce during amplification of different parts of the ITS region in samples containing mixed templates ('environmental barcoding'. We performed in silico PCR analyses with commonly used primer combinations using various ITS datasets obtained from public databases as templates. Results Some of the ITS primers, such as ITS1-F, were hampered with a high proportion of mismatches relative to the target sequences, and most of them appeared to introduce taxonomic biases during PCR. Some primers, e.g. ITS1-F, ITS1 and ITS5, were biased towards amplification of basidiomycetes, whereas others, e.g. ITS2, ITS3 and ITS4, were biased towards ascomycetes. The assumed basidiomycete-specific primer ITS4-B only amplified a minor proportion of basidiomycete ITS sequences, even under relaxed PCR conditions. Due to systematic length differences in the ITS2 region as well as the entire ITS, we found that ascomycetes will more easily amplify than basidiomycetes using these regions as targets. This bias can be avoided by using primers amplifying ITS1 only, but this would imply preferential amplification of 'non-dikarya' fungi. Conclusions We conclude that ITS primers have to be selected carefully, especially when used for high-throughput sequencing of environmental samples. We suggest that different primer combinations or different parts of the ITS region should be analyzed in parallel, or that alternative ITS primers should be searched for.

  7. A novel approach for rapid screening of mitochondrial D310 polymorphism

    Directory of Open Access Journals (Sweden)

    Güllüoğlu Bahadır M

    2006-01-01

    Full Text Available Abstract Background Mutations in the mitochondrial DNA (mtDNA have been reported in a wide variety of human neoplasms. A polynucleotide tract extending from 303 to 315 nucleotide positions (D310 within the non-coding region of mtDNA has been identified as a mutational hotspot of primary tumors. This region consists of two polycytosine stretches interrupted by a thymidine nucleotide. The number of cytosines at the first and second stretches are 7 and 5 respectively, according to the GeneBank sequence. The first stretch exhibits a polymorphic length variation (6-C to 9-C among individuals and has been investigated in many cancer types. Large-scale studies are needed to clarify the relationship between cytosine number and cancer development/progression. However, time and money consuming methods such as radioactivity-based gel electrophoresis and sequencing, are not appropriate for the determination of this polymorphism for large case-control studies. In this study, we conducted a rapid RFLP analysis using a restriction enzyme, BsaXI, for the single step simple determination of 7-C carriers at the first stretch in D310 region. Methods 25 colorectal cancer patients, 25 breast cancer patients and 41 healthy individuals were enrolled into the study. PCR amplification followed by restriction enzyme digestion of D310 region was performed for RFLP analysis. Digestion products were analysed by agarose gel electrophoresis. Sequencing was also applied to samples in order to confirm the RFLP data. Results Samples containing 7-C at first stretch of D310 region were successfully determined by the BsaXI RFLP method. Heteroplasmy and homoplasmy for 7-C content was also determined as evidenced by direct sequencing. Forty-one percent of the studied samples were found to be BsaXI positive. Furthermore, BsaXI status of colorectal cancer samples were significantly different from that of healthy individuals. Conclusion In conclusion, BsaXI RFLP analysis is a simple and

  8. Real-time PCR approach in dermatophyte detection and Trichophyton rubrum identification.

    Science.gov (United States)

    Kobylak, Natalia; Bykowska, Barbara; Nowicki, Roman; Brillowska-Dąbrowska, Anna

    2015-01-01

    Dermatophytes are keratinophilic molds that infect human hair, nails and skin. Diagnosis of dermatophytosis is based on morphological, serological and biochemical features. However, identification is difficult and laborious due to similarities between microorganisms. Thus, there is considerable interest to develop mycological diagnostic procedures based on molecular biology methods. In this study, fast, two-step DNA extraction method and real-time PCR was used for detection of dermatophytes DNA using pan-dermatophyte primers and identification of Trichophyton rubrum from pure cultures. The applied method allowed correct detection of all dermatophytes and correct identification of Trichophyton rubrum in less than 2 hours.

  9. A Rapid Multiplex Real-Time PCR High-Resolution Melt Curve Assay for the Simultaneous Detection of Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus in Food.

    Science.gov (United States)

    Forghani, Fereidoun; Wei, Shuai; Oh, Deog-Hwan

    2016-05-01

    Three important foodborne pathogens, Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus, are of great concern for food safety. They may also coexist in food matrices and, in the case of B. cereus and S. aureus, the resulting illnesses can resemble each other owing to similar symptoms. Therefore, their simultaneous detection may have advantages in terms of cost savings and rapidity. Given this context, a rapid multiplex real-time PCR high-resolution melt curve assay for the simultaneous detection of these three pathogens in food was developed. The assay successfully detected B. cereus (gyrB), L. monocytogenes (hly), and S. aureus (nuc) in a single reaction, and the average melting temperatures were 76.23, 80.19, and 74.01°C, respectively. The application of SYTO9 dye and a slow melt curve analysis ramp rate (0.1°C/s) enabled the production of sharp, high-resolution melt curve peaks that were easily distinguishable from each other. The detection limit in food (milk, rice, and lettuce) was 3.7 × 10(3) CFU/g without an enrichment step and 3.7 × 10(1) CFU/g following the 10-h enrichment. Hence, the assay developed here is specific and sensitive, providing an efficient tool for implementation in food for the simultaneous detection of B. cereus, L. monocytogenes, and S. aureus .

  10. A real-time PCR approach to identify anthelmintic-resistant nematodes in sheep farms.

    Science.gov (United States)

    Milhes, M; Guillerm, M; Robin, M; Eichstadt, M; Roy, C; Grisez, C; Prévot, F; Liénard, E; Bouhsira, E; Franc, M; Jacquiet, P

    2017-03-01

    Resistance to fenbendazole, ivermectin, and moxidectin was explored by a fecal egg count reduction test in four meat sheep flocks in southwestern France where anthelmintic resistance was suspected. The FECR test results of the present study confirmed the presence of benzimidazole resistance in three out of the four farms and the presence of ivermectin resistance in one flock. In addition, a suspicion of moxidectin resistance was shown in this latter farm. Both conventional morphological and molecular identifications were performed on larval cultures before and after the treatment in the studied farms. A high positive correlation was found between the number of larvae counted under binocular microscope and the number of larvae estimated by the qPCR analysis (R 2 = 0.88) and a high Cohen's Kappa value (0.91) in the detection of strongylid larvae in larval cultures. According to qPCR results, Trichostrongylus species demonstrated high levels of BZ resistance and Teladorsagia circumcincta was involved in the IVM resistance in one farm. The molecular procedures used in this study have the potential to be beneficial for anthelmintic resistance surveillance in sheep industry.

  11. Performance of the Cobas® Influenza A/B Assay for Rapid Pcr-Based Detection of Influenza Compared to Prodesse ProFlu+ and Viral Culture

    Science.gov (United States)

    Chen, L.; Tian, Y.; Chen, S.; Liesenfeld, O.

    2015-01-01

    Rapid and accurate diagnosis of influenza is important for patient management and infection control. We determined the performance of the cobas® Influenza A/B assay, a rapid automated nucleic acid assay performed on the cobas® Liat System for qualitative detection of influenza A and influenza B from nasopharyngeal (NP) swab specimens. Retrospective frozen and prospectively collected NP swabs from patients with signs and symptoms of influenza collected in universal transport medium (UTM) were tested at multiple sites including CLIA-waived sites using the cobas® Influenza A/B assay. Results were compared to the Prodesse Pro-Flu+ assay and to viral culture. Compared to the Prodesse ProFlu+ Assay, sensitivities of the cobas® Influenza A/B assay for influenza A and B were 97.7 and 98.6%, respectively; specificity was 99.2 and 99.4%. Compared to viral culture, the cobas® Influenza A/B assay showed sensitivities of 97.5 and 96.9% for influenza virus A and B, respectively; specificities were 97.9% for both viruses. Polymerase chain reaction (PCR)/sequencing showed that the majority of viral culture negative but cobas® Influenza A/B positive results were true positive results, indicating that the cobas® Influenza A/B assay has higher sensitivity compared to viral culture. In conclusion, the excellent accuracy, rapid time to result, and remarkable ease of use make the cobas® Influenza A/B nucleic acid assay for use on the cobas® Liat System a highly suitable point-of-care solution for the management of patients with suspected influenza A and B infection. PMID:26716012

  12. Real-time immuno-PCR: an approach for detection of trace amounts of transgenic proteins.

    Science.gov (United States)

    Kumar, Rajesh; Sinha, Rajeshwar P

    2014-01-01

    The research on manipulation of crop genomes for transgenic development is continuously increasing due to several benefits. The major concerns linked to the effect of transgenic crops are human health and environment sustainability. To monitor transgenic samples in the food chain, several highly sensitive and specific DNA-based and protein-based detection methods are being used. However, real- time immunio-PCR (RT-IPCR) assay would be able to provide a sensitive detection of trace amounts of transgenic proteins or allergens in the samples and help in monitoring these materials. In the present study, we developed a novel RT-IPCR method to monitor CrylAc transgenic protein in samples with an LOD of 100 pg/mL. The assay may also be useful in the evaluation of functional stability of transgenes inserted in the plant genome.

  13. Development of a rapid method for identifying carryover contamination of positive control DNA, using a chimeric positive control and restriction enzyme for the diagnosis of white spot syndrome virus by nested PCR.

    Science.gov (United States)

    Kim, Hyoung Jun; Kwon, Se Ryun

    2014-12-01

    Chimeric positive plasmids have been developed to minimize false-positive reactions caused by polymerase chain reaction (PCR) contamination. Here, we developed a rapid method for identifying false-positive results while detecting white spot syndrome virus (WSSV) by nested PCR, using chimeric positive plasmids. The results of PCRs using WSSV diagnostic primer sets showed PCR products of a similar size (WSSV 1st PCR product, 1,447 bp; WSSV 2nd PCR product, 941 bp) using WSSV chimeric plasmids or DNA from shrimp infected with WSSV. The PCR products were digested with DraI for 1 h at 37 °C. The digested chimeric DNA separated into two DNA bands; however, the WSSV-infected shrimp DNA did not separate. Thus, chimeric plasmid DNA may be used as positive control DNA instead of DNA from WSSV-infected shrimp, in order to prevent PCR contamination. Thus, the use of restriction enzyme digestion allowed us to rapidly distinguish between WSSV DNA and WSSV chimeric plasmid DNA.

  14. Ultrasensitive quantification of hepatitis B virus A1762T/G1764A mutant by a SimpleProbe PCR using a wild-type-selective PCR blocker and a primer-blocker-probe partial-overlap approach.

    Science.gov (United States)

    Nie, Hui; Evans, Alison A; London, W Thomas; Block, Timothy M; Ren, Xiangdong David

    2011-07-01

    Hepatitis B virus (HBV) carrying the A1762T/G1764A double mutation in the basal core promoter (BCP) region is associated with HBe antigen seroconversion and increased risk of liver cirrhosis and hepatocellular carcinoma (HCC). Quantification of the mutant viruses may help in predicting the risk of HCC. However, the viral genome tends to have nucleotide polymorphism, which makes it difficult to design hybridization-based assays including real-time PCR. Ultrasensitive quantification of the mutant viruses at the early developmental stage is even more challenging, as the mutant is masked by excessive amounts of the wild-type (WT) viruses. In this study, we developed a selective inhibitory PCR (siPCR) using a locked nucleic acid-based PCR blocker to selectively inhibit the amplification of the WT viral DNA but not the mutant DNA. At the end of siPCR, the proportion of the mutant could be increased by about 10,000-fold, making the mutant more readily detectable by downstream applications such as real-time PCR and DNA sequencing. We also describe a primer-probe partial overlap approach which significantly simplified the melting curve patterns and minimized the influence of viral genome polymorphism on assay accuracy. Analysis of 62 patient samples showed a complete match of the melting curve patterns with the sequencing results. More than 97% of HBV BCP sequences in the GenBank database can be correctly identified by the melting curve analysis. The combination of siPCR and the SimpleProbe real-time PCR enabled mutant quantification in the presence of a 100,000-fold excess of the WT DNA.

  15. Comparison of four rapid diagnostic tests, ELISA, microscopy and PCR for the detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in feces.

    Science.gov (United States)

    Van den Bossche, Dorien; Cnops, Lieselotte; Verschueren, Jacob; Van Esbroeck, Marjan

    2015-03-01

    Microscopy is the diagnostic reference standard for the detection of parasites, but it is labor-intensive and requires experience. Rapid diagnostic tests (RDTs) can provide an alternative to microscopy. RDTs from four different manufacturers were compared to enzyme-linked immunosorbent assay (ELISA), microscopy and/or parasite-specific real-time PCR: ImmunoCardSTAT!®CGE (Meridian Bioscience Inc., Cincinnati, Ohio, USA) (A), Crypto/Giardia Duo-Strip (Coris Bioconcepts, Gembloux, Belgium) (B), RIDA®QUICK Cryptosporidium/Giardia/Entamoeba Combi (R-BioPharm, Darmstadt, Germany) (C) and Giardia/Cryptosporidium Quik Chek (Techlab Inc., Blacksburg, Virginia, USA) (D). Thirty frozen samples were analyzed retrospectively. For Giardia lamblia (n=12) and Cryptosporidium (n=12) sensitivities ranged from 58% (B), over 83% (A, C) to 100% (D) and from 92% (B) to 100% (A, C, D), respectively. Specificity for both G. lamblia and Cryptosporidium was 100% for all RDT brands. Sensitivity for Entamoeba histolytica (n=5) was 100%, while specificity reached 80% (A) to 88% (C). In a prospective study, fresh samples were tested. For G. lamblia (n=30), sensitivity ranged from 66% (B), over 79% (A) and 83% (C) to 100% (D) and specificity varied between 94% (D) and 100% (A, B, C). For Cryptosporidium (n=3), sensitivity was 100% for all brands except (B) (67%) and specificities were 95% (A, B), 98% (C) and 100% (D). E. histolytica (n=1) was detected by both (A) and (C), while specificity was 81% and 87% respectively. RDTs can be a valuable tool when microscopic expertise is poor and in remote and outbreak settings where other techniques are often not available and rapid diagnosis is required. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Self-collected buccal swabs and rapid, real-time PCR during a large measles outbreak in Wales: Evidence for the protective effect of prior MMR immunisation.

    Science.gov (United States)

    Moore, Catherine; Cottrell, Simon; Hoffmann, Jörg; Carr, Michael; Evans, Hannah; Dunford, Linda; Lawson, Heather; Brown, Kevin E; Jones, Rachel

    2015-06-01

    We describe the laboratory response to a large measles outbreak that occurred during 2012-2013 centred in mid and west Wales, UK. To demonstrate the impact of rapid measles testing on the management of a large outbreak, to show the complex molecular epidemiology and determine the role of previous MMR immunisation on a large cohort of exposed people. Results from oral fluid antibody testing and self-collected buccal swabs tested by real-time PCR were reconciled and analysed to determine level of agreement and to calculate MMR vaccine efficacy during the outbreak. During the outbreak 1435 notifications of measles were received from across Wales. Samples were received from 70% of notified cases with a positivity rate of 56% within the outbreak compared to 15% for the rest of Wales. Measles RNA was detected in 53 cases with previous history of MMR immunisation, but viral loads were lower than those detected in unimmunised cases. The molecular epidemiology showed at least two distinct D8 strains of measles virus were introduced into Wales along with a separate introduction of a B3 strain outside the outbreak area. Molecular testing of all notified measles cases offers the most rapid way of confirming the introduction of measles into a population potentially before secondary transmission has already occurred. The outbreak data confirms the protective effect of the MMR vaccine with vaccine efficacy calculated at 96% for one dose and 99% for two doses supporting the WHO recommendations for a two dose MMR immunisation schedule. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

    Science.gov (United States)

    Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

    2017-01-01

    Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

  19. Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

    Directory of Open Access Journals (Sweden)

    Yajuan Sun

    Full Text Available Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM, but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST, was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

  20. A new PCR approach for the identification of Fusarium graminearum Um novo protocolo de PCR para a identificação de Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Gleison Ricardo de Biazio

    2008-09-01

    Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as

  1. TeloPCR-seq: a high-throughput sequencing approach for telomeres

    Science.gov (United States)

    Bennett, Henrietta W.; Liu, Na; Hu, Yan; King, Megan C.

    2017-01-01

    We have developed a high-throughput sequencing approach that enables us to determine terminal telomere sequences from tens of thousands of individual Schizosaccharomyces pombe telomeres. This method provides unprecedented coverage of telomeric sequence complexity in fission yeast. S. pombe telomeres are composed of modular degenerate repeats that can be explained by variation in usage of the TER1 RNA template during reverse transcription. Taking advantage of this deep sequencing approach, we find that “like” repeat modules are highly correlated within individual telomeres. Moreover, repeat module preference varies with telomere length, suggesting that existing repeats promote the incorporation of like repeats and/or that specific conformations of the telomerase holoenzyme efficiently and/or processively add repeats of like nature. After the loss of telomerase activity, this sequencing and analysis pipeline defines a population of telomeres with altered sequence content. This approach will be adaptable to study telomeric repeats in other organisms and also to interrogate repetitive sequences throughout the genome that are inaccessible to other sequencing methods. PMID:27714790

  2. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples......Identification of sources Campylobacter infection in the poultry houses is in general problematic due to the lack of reliable methods to detect campylobacteria in environmental samples. Detection of campylobacteria in environmental samples by conventional culture methods is difficult and of limited...... sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...

  3. Development and validation of a multiplex reverse transcription quantitative PCR (RT-qPCR) assay for the rapid detection of Citrus tristeza virus, Citrus psorosis virus, and Citrus leaf blotch virus.

    Science.gov (United States)

    Osman, Fatima; Hodzic, Emir; Kwon, Sun-Jung; Wang, Jinbo; Vidalakis, Georgios

    2015-08-01

    A single real-time multiplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay for the simultaneous detection of Citrus tristeza virus (CTV), Citrus psorosis virus (CPsV), and Citrus leaf blotch virus (CLBV) was developed and validated using three different fluorescently labeled minor groove binding qPCR probes. To increase the detection reliability, coat protein (CP) genes from large number of different isolates of CTV, CPsV and CLBV were sequenced and a multiple sequence alignment was generated with corresponding CP sequences from the GenBank and a robust multiplex RT-qPCR assay was designed. The capacity of the multiplex RT-qPCR assay in detecting the viruses was compared to singleplex RT-qPCR designed specifically for each virus and was assessed using multiple virus isolates from diverse geographical regions and citrus species as well as graft-inoculated citrus plants infected with various combination of the three viruses. No significant difference in detection limits was found and specificity was not affected by the inclusion of the three assays in a multiplex RT-qPCR reaction. Comparison of the viral load for each virus using singleplex and multiplex RT-qPCR assays, revealed no significant differences between the two assays in virus detection. No significant difference in Cq values was detected when using one-step and two-step multiplex RT-qPCR detection formats. Optimizing the RNA extraction technique for citrus tissues and testing the quality of the extracted RNA using RT-qPCR targeting the cytochrome oxidase citrus gene as an RNA specific internal control proved to generate better diagnostic assays. Results showed that the developed multiplex RT-qPCR can streamline viruses testing of citrus nursery stock by replacing three separate singleplex assays, thus reducing time and labor while retaining the same sensitivity and specificity. The three targeted RNA viruses are regulated pathogens for California's mandatory "Section 3701

  4. Enrichment followed by quantitative PCR both for rapid detection and as a tool for quantitative risk assessment of food-borne thermotolerant campylobacters

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Jacobsen, N. R.; Hoorfar, Jeffrey

    2004-01-01

    As part of a large international project for standardization of PCR (Food-PCR; www.pcr.dk), a multiplex, multiplatform, ready-to-go enrichment followed by a real-time PCR method, including an internal amplification control, was developed for detection of food-borne thermotolerant campylobacters...... Organization (ISO)-based culture method by testing low, medium, and high levels of 12 spiked and 66 unspiked, presumably naturally contaminated, chicken rinse samples. In the RotorGene, a positive PCR response was detected in 40 samples of the 66. This was in complete agreement with the enriched ISO culture...... naturally contaminated chicken samples, which indicates PCR's additional potential as a tool for quantitative risk assessment. Signal from the internal amplification control was detected in all culture-negative samples (VIC Ct: 23.1 to 28.1). The method will be taken further and validated...

  5. Differential conductance as a promising approach for rapid DNA sequencing with nanopore-embedded electrodes

    Science.gov (United States)

    He, Yuhui; Shao, Lubing; Scheicher, Ralph H.; Grigoriev, Anton; Ahuja, Rajeev; Long, Shibing; Ji, Zhuoyu; Yu, Zhaoan; Liu, Ming

    2010-07-01

    We propose an approach for nanopore-based DNA sequencing using characteristic transverse differential conductance. Molecular dynamics and electron transport simulations show that the transverse differential conductance during the translocation of DNA through the nanopore is distinguishable enough for the detection of the base sequence and can withstand electrical noise caused by DNA structure fluctuation. Our findings demonstrate several advantages of the transverse conductance approach, which may lead to important applications in rapid genome sequencing.

  6. An immunomagnetic separation-reverse transcription polymerase chain reaction (IMS-RT-PCR) test for sensitive and rapid detection of viable waterborne Cryptosporidium parvum.

    Science.gov (United States)

    Hallier-Soulier, Sylvie; Guillot, Emmanuelle

    2003-07-01

    The public health problem posed by the waterborne parasite Cryptosporidium parvum incited the water supply industry to develop very accurate analytical tools able to assess the presence of viable oocysts in drinking water. In this study, we report the development of a viability assay for C. parvum oocysts based on immunomagnetic separation and reverse transcription polymerase chain reaction (IMS-RT-PCR). The detection limit of the IMS-RT-PCR assay, which targets the hsp70 heat shock-induced mRNA, was in the range of ten viable oocysts per 100-l tap water samples. Purified Cryptosporidium parvum oocysts were exposed to heating, freezing and three chemical disinfection treatments namely, chlorination, chlorine dioxide treatment and ozonation under conventional doses used in water treatment plants, then detected by IMS-PCR and IMS-RT-PCR. The results obtained by IMS-PCR showed that none of the treatments had an effect on oocyst detection. The inactivation of oocysts by boiling resulted in no RT-PCR signal. Chlorine as well as chlorine dioxide did not influence oocyst viability as determined by IMS-RT-PCR. Ozone more effectively inactivated oocysts. The IMS-RT-PCR assay in conjunction with IMS-PCR marks the development of a combined detection and viability test which can be used for drinking water quality control as well as for reliable evaluation of treatment efficiency.

  7. Polymeric LabChip Real-Time PCR as a Point-of-Care-Potential Diagnostic Tool for Rapid Detection of Influenza A/H1N1 Virus in Human Clinical Specimens

    Science.gov (United States)

    Song, Hyun-Ok; Kim, Je-Hyoung; Ryu, Ho-Sun; Lee, Dong-Hoon; Kim, Sun-Jin; Kim, Deog-Joong; Suh, In Bum; Choi, Du Young; In, Kwang-Ho; Kim, Sung-Woo; Park, Hyun

    2012-01-01

    It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR) system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1) It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2) It is portable, with a weight of only 5.5 kg. (3) The reaction cost is low, since it uses disposable plastic chips. (4) Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA) gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and specificity

  8. Polymeric LabChip real-time PCR as a point-of-care-potential diagnostic tool for rapid detection of influenza A/H1N1 virus in human clinical specimens.

    Directory of Open Access Journals (Sweden)

    Hyun-Ok Song

    Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and

  9. CONCEPTUAL APPROACHES TO THE RAPID DETECTION OF CAMPYLOBACTER SPP. IN MEAT OF SLAUGHTER ANIMALS

    Directory of Open Access Journals (Sweden)

    D. S. Bataeva

    2017-01-01

    Full Text Available The modern approach to quality assurance of food products based on the ISO 9000 standards indicates the need for the implementation of quality management systems in processing plants. According to the analysis of scientific publication databases (Science Direct and Web of Science, it is established that only 0.5–1.7% of publications are related to studying meat of slaughter animals (except for birds concerning the presence of Campylobacter. The priority method of investigation is PCR. Ready-to-use PCR test system was developed for the detection of Campylobacter spp. on the basis of selected gene-specific primers to bacteria of Campylobacter genus. Specificity of the test system is established for Gram-negative bacteria of Salmonella, Escherichia, and Proteus genera, and for oxidase-positive Aeromonas. Gene-specific primers for Campylobacter were selected and ready-to-use PCR test system was developed on their basis. It was found that the selected primers have 100% convergence to the genome of Campylobacter genus bacteria, the PCR efficiency is not less than 95%, and the detection limit is not more than 1× 104 CFU/g. When estimating the specificity of the primers, it was taken into account that the bacteria of Campylobacter genus may be incorporated in a consortium with intestine microbiome, mainly with Enterobacteriaceae and lactic acid bacteria. However, Bolton’s enrichment medium is selective and, during the cultivation process, suppresses the growth of Gram-positive lactic acid bacteria. It was found that the selected primers were 100% specific and did not give false positive reactions with this group of microorganisms. The developed test system was successfully validated in a cycle of qualitative tests in the FEPAS system and implemented into laboratory practice. It was proved that the developed test system may be used both in screening at the stages of Campylobacter enrichment and in identification of pure culture of the

  10. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid strain typing of Bacillus coagulans.

    Science.gov (United States)

    Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa

    2017-01-01

    In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  11. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS for rapid strain typing of Bacillus coagulans.

    Directory of Open Access Journals (Sweden)

    Jun Sato

    Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  12. Evaluation of pre-PCR processing approaches for enumeration of Salmonella enterica in naturally contaminated animal feed.

    Science.gov (United States)

    Schelin, J; Andersson, G; Vigre, H; Norling, B; Häggblom, P; Hoorfar, J; Rådström, P; Löfström, C

    2014-01-01

    Three pre-PCR processing strategies for the detection and/or quantification of Salmonella in naturally contaminated soya bean meal were evaluated. Methods included: (i) flotation-qPCR [enumeration of intact Salmonella cells prior to quantitative PCR (qPCR)], (ii) MPN-PCR (modified most probable number method combined with qPCR) and (iii) qualitative culture enrichment PCR. The limit of quantification was 1·8 × 10(2) CFU g(-1) (flotation-qPCR) and 0·02 MPN g(-1) (MPN-PCR). Fifteen naturally contaminated Salmonella positive soya bean meal samples from one lot were analysed in parallel with the three methods, using 2·5, 50 and 25 g of feed, respectively, resulting in detection of Salmonella in 6, 15 and 9 bags. Enumeration resulted in 1·8 × 10(2) -7·8 × 10(3) CFU g(-1) (flotation-qPCR) and 0·024 to >5·2 MPN g(-1) (MPN-PCR). Except for differences in methodology, results obtained with the three techniques could be due to the presence of nonculturable Salmonella and/or a heterogeneous distribution of Salmonella in the material. The evaluated methods provide different possibilities to assess the prevalence of Salmonella in feed, together with the numbers of culturable, as well as nonculturable cells, and can be applied to generate data to allow more accurate quantitative microbial risk assessment for Salmonella in the feed chain. © 2013 The Society for Applied Microbiology.

  13. Nested quantitative PCR approach for urinary cell-free EZH2 mRNA and its potential clinical application in bladder cancer.

    Science.gov (United States)

    Zhang, Xin; Zhang, Yanli; Liu, Xinfeng; Liu, Tong; Li, Peilong; Du, Lutao; Yang, Yongmei; Wang, Lili; Wang, Chuanxin

    2016-10-15

    EZH2 is overexpressed in bladder cancer (BC) and plays important roles in tumor development and progression. Recent studies show cell free (cf) RNAs released from cancer cells can reflect tissues changes and are stable and detectable in urine. Although conventional quantitative real-time PCR (qPCR) is highly sensitive, low abundances of urinary cf-RNAs usually result in false-negatives. Thus, this study develops a nested qPCR (nqPCR) approach to quantify cf-EZH2 mRNA in urine and further assess its clinical significance for BC. Forty urine samples were first selected to evaluate feasibility of nqPCR. Then, levels of urinary cf-EZH2 mRNA were detected using developed method in an independent cohort of subjects with 91 healthy, 81 cystitis, 169 nonmuscle invasive BC (NMIBC) and 103 muscle-invasive BC (MIBC). In cf-EZH2 mRNA detection, nqPCR method was significantly associated with qPCR, but it could detect more urine samples and increase detection limit three orders of magnitude. Based on nqPCR method, cf-EZH2 mRNA levels have been found to be increased in urine of NMIBC and MIBC patients (p EZH2 mRNA showed higher diagnostic ability for MIBC (p  0.05). Moreover, it also could distinguish MIBC from NMIBC, with AUC of 0.787. For MIBC patients, high expression of cf-EZH2 mRNA associated with advanced stage and was an independent predictor of reduced disease free survival or overall survival. In conclusion, detection of cf-EZH2 mRNA in urine by nqPCR is a sensitive and noninvasive approach and may be used for diagnosis and prognosis prediction of MIBC. © 2016 UICC.

  14. A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2009-01-01

    In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

  15. Exploring MALDI-TOF MS approach for a rapid identification of Mycobacterium avium ssp. paratuberculosis field isolates.

    Science.gov (United States)

    Ricchi, M; Mazzarelli, A; Piscini, A; Di Caro, A; Cannas, A; Leo, S; Russo, S; Arrigoni, N

    2017-03-01

    The aim of the study was to explore the suitability of matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) for a rapid and correct identification of Mycobacterium avium ssp. paratuberculosis (MAP) field isolates. MALDI-TOF MS approach is becoming one of the most popular tests for the identification of intact bacterial cells which has been shown to be fast and reliable. For this purpose, 36 MAP field isolates were analysed through MALDI-TOF MS and the spectra compared with two different databases: one provided by the vendor of the system employed (Biotyper ver. 3·0; Bruker Daltonics) and a homemade database containing spectra from both tuberculous and nontuberculous Mycobacteria. Moreover, principal component analysis procedure was employed to confirm the ability of MALDI-TOF MS to discriminate between very closely related subspecies. Our results suggest MAP can be differentiated from other Mycobacterium species, both when the species are very close (M. intracellulare) and when belonging to different subspecies (M. avium ssp. avium and M. avium ssp. silvaticum). The procedure applied is fast, easy to perform, and achieves an earlier accurate species identification of MAP and nontuberculous Mycobacteria in comparison to other procedures. The gold standard test for the diagnosis of paratuberculosis is still isolation of MAP by cultural methods, but additional assays, such as qPCR and subculturing for determination of mycobactin dependency are required to confirm its identification. We have provided here evidence pertaining to the usefulness of MALDI-TOF MS approach for a rapid identification of this mycobacterium among other members of M. avium complex. © 2016 The Society for Applied Microbiology.

  16. Development of a multiplexed microsphere PCR for rapid, culture-free detection and Gram-typing of bacteria in human blood samples.

    Science.gov (United States)

    Liang, Fang; Browne, Daniel J; Gray, Megan J; Gartlan, Kate H; Smith, David D; Barnard, Ross; Hill, Geoff R; Corrie, Simon Robert; Markey, Kate

    2018-01-19

    Blood stream infection is a significant clinical problem, particularly in vulnerable patient groups such as those undergoing chemotherapy and bone marrow transplantation. Clinical diagnostics for suspected blood stream infection remain centered around blood culture (highly variable timing, hours to days), and empiric use of broad-spectrum antibiotics is often employed for patients presenting with febrile neutropenia. Gram-typing provides the first opportunity to target therapy (e.g. combinations containing vancomycin or teicoplanin for Gram-positives; piperacillin-tazobactam or a carbapenem for Gram-negatives), however current approaches require blood culture. In this study, we describe a multiplexed microsphere-PCR assay with flow cytometry readout, which can distinguish Gram-positive from Gram-negative bacterial DNA in a 3.5-hour time period. The combination of a simple assay design (amplicon-dependent release of Gram-type specific Cy3-labelled oligonucleotides) and the Luminex-based readout (for quantifying each specific Cy3-labelled sequence) opens opportunities for further multiplexing. We demonstrate the feasibility of detecting common Gram-positive and Gram-negative organisms after spiking whole bacteria into healthy human blood prior to DNA extraction. Further development of DNA extraction methods is required to reach detection limits comparable to blood culture.

  17. Combining COLD-PCR and high-resolution melt analysis for rapid detection of low-level, rifampin-resistant mutations in Mycobacterium tuberculosis.

    Science.gov (United States)

    Pang, Yu; Liu, Guan; Wang, Yufeng; Zheng, Suhua; Zhao, Yan-Lin

    2013-04-01

    Multidrug-resistant Mycobacterium tuberculosis (M. tuberculosis) remains a serious threat to public health. Mutational analysis of the gene encoding the beta subunit of RNA polymerase (rpoB) is an established and widely used surrogate marker for multidrug-resistant tuberculosis (MDR-TB). The rpoB-based drug-resistant assay requires relatively less time to detect drug resistance in M. tuberculosis, yet it fails to detect low-level mutations in wild-type DNA. Here, we describe a low-level mutation detection method that combines co-amplification at lower denaturation temperature polymerase chain reaction (COLD-PCR) with high-resolution melting (HRM) analysis, aimed at detecting low-level, rifampin-resistant mutations in M. tuberculosis. Compared to conventional polymerase chain reaction (PCR), dilution experiments demonstrated a four- to eightfold improvement in selectivity using COLD-PCR/HRM to detect low-level, rifampin-resistant mutations. The mutation detection limit of conventional PCR/HRM was approximately 20%, whereas COLD-PCR/HRM had a mutation detection limit of 2.5%. Using traditional PCR/HRM and DNA sequencing, we found rpoB mutation in 110 rifampin-resistant isolates. The use of COLD-PCR/HRM allowed us to detect 10 low-level, rifampin-resistant mutations in 16 additional drug-resistant isolates. The sensitivity of COLD-PCR/HRM (95.2%) is significantly higher than that of PCR/HRM (87.3%). Our findings demonstrate that combined use of COLD-PCR with HRM can provide a sensitivity of at least 5% in detecting rpoB-mutated populations in a wild-type background, decreasing the delay in drug-resistant TB diagnosis and leading to faster, cheaper, more efficient, and more personalized antibiotic treatment, especially for low-level drug resistance mutations among the excess wild-type DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) for large genomic rearrangements (LGRs) detection: A new approach to assess quantitative status of BRCA1 gene in a reference laboratory.

    Science.gov (United States)

    Minucci, Angelo; De Paolis, Elisa; Concolino, Paola; De Bonis, Maria; Rizza, Roberta; Canu, Giulia; Scaglione, Giovanni Luca; Mignone, Flavio; Scambia, Giovanni; Zuppi, Cecilia; Capoluongo, Ettore

    2017-07-01

    Evaluation of copy number variation (CNV) in BRCA1/2 genes, due to large genomic rearrangements (LGRs), is a mandatory analysis in hereditary breast and ovarian cancers families, if no pathogenic variants are found by sequencing. LGRs cannot be detected by conventional methods and several alternative methods have been developed. Since these approaches are expensive and time consuming, identification of alternative screening methods for LGRs detection is needed in order to reduce and optimize the diagnostic procedure. The aim of this study was to investigate a Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) as molecular tool to detect recurrent BRCA1 LGRs. C-PCR-HRMA was performed on exons 3, 14, 18, 19, 20 and 21 of the BRCA1 gene; exons 4, 6 and 7 of the ALB gene were used as reference fragments. This study showed that it is possible to identify recurrent BRCA1 LGRs, by melting peak height ratio between target (BRCA1) and reference (ALB) fragments. Furthermore, we underline that a peculiar amplicon-melting profile is associated to a specific BRCA1 LGR. All C-PCR-HRMA results were confirmed by Multiplex ligation-dependent probe amplification. C-PCR-HRMA has proved to be an innovative, efficient and fast method for BRCA1 LGRs detection. Given the sensitivity, specificity and ease of use, c-PCR-HRMA can be considered an attractive and powerful alternative to other methods for BRCA1 CNVs screening, improving molecular strategies for BRCA testing in the context of Massive Parallel Sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. First exploration of Nitrobacter diversity in soils by a PCR cloning-sequencing approach targeting functional gene nxrA.

    Science.gov (United States)

    Poly, Franck; Wertz, Sophie; Brothier, Elisabeth; Degrange, Valérie

    2008-01-01

    Nitrite oxidoreductase (NXR) is the key enzyme responsible for the oxidation of NO(2)(-) to NO(3)(-) in nitrite-oxidizing bacteria. For the first time a molecular approach for targeting the nxrA gene was developed, encoding the catalytic subunit of the NXR, to study diversity of Nitrobacter-like organisms based on the phylogeny of nxrA gene sequences in soils. NxrA sequences of the Nitrobacter strains analysed (Nitrobacter hamburgensis, Nitrobacter vulgaris, Nitrobacter winogradskyi, Nitrobacter alkalicus) by PCR, cloning and sequencing revealed the occurrence of multiple copies of nxrA genes in these strains. The copy number and similarity varied among strains. The diversity of Nitrobacter-like nxrA sequences was explored in three soils (a French permanent pasture soil, a French fallow soil, and an African savannah soil) using a cloning and sequencing approach. Most nxrA sequences found in these soils (84%) differed from nxrA sequences obtained from Nitrobacter strains. Moreover, the phylogenetic distribution and richness of nxrA-like sequences was extremely variable depending on soil type. This nxrA tool extends the panel of functional genes available for studying bacteria involved in the nitrogen cycle.

  20. Rapid and Quantitative Detection of Leifsonia xyli subsp. xyli in Sugarcane Stalk Juice Using a Real-Time Fluorescent (TaqMan PCR Assay

    Directory of Open Access Journals (Sweden)

    Hua-Ying Fu

    2016-01-01

    Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.

  1. Sensitivity of rapid influenza antigen tests in the diagnosis of pandemic (H1N1)2009 compared with the standard rRT-PCR technique during the 2009 pandemic in Turkey.

    Science.gov (United States)

    Ciblak, Meral Akcay; Kanturvardar, Melis; Asar, Serkan; Bozkaya, Emel; Yenen, O Sadi; Badur, Selim

    2010-12-01

    The real-time reverse transcription polymerase chain reaction (rRT-PCR) technique has been used as the reference technique for the diagnosis of pandemic (H1N1)2009 virus infections. However, rapid influenza diagnostics tests (RIDTs) have been considered in the diagnosis of pandemic (H1N1)2009 by some healthcare institutions in Turkey due to their ease of use and generation of fast results. Nevertheless, their low sensitivity has caused concern during the control of the pandemic. This study aimed to determine the sensitivity of 4 different rapid tests available on the market in Turkey in the diagnosis of pandemic (H1N1)2009 infections compared to the reference rRT-PCR technique. One hundred and four patient samples that tested positive and 88 samples that tested negative for pandemic (H1N1)2009 by rRT-PCR were tested with RIDTs available on the market. The sensitivity of the rapid tests ranged from 31.7% to 50% depending on the brand of RIDT. Specificity ranged from 97.7% to 100%. Currently available RIDTs are not sensitive enough and could lead physicians to delay the treatment of patients, adversely affecting control efforts to mitigate the pandemic. Therefore, these tests should only be used for screening, and negative results should not rule out influenza. More sensitive and rapid point-of-care techniques are needed to meet the demands of point-of-care testing.

  2. Comparison of bacterial culture and qPCR testing of rectal and pen floor samples as diagnostic approaches to detect enterotoxic Escherichia coli in nursery pigs

    DEFF Research Database (Denmark)

    Weber, N. R.; Nielsen, J. P.; Hjulsager, Charlotte Kristiane

    2017-01-01

    : bacterial culturing of faecal samples from three pigs (per pen) with clinical diarrhoea and subsequent testing for virulence genes in E. coli isolates; bacterial culturing of pen floor samples and subsequent testing for virulence genes in E. coli isolates; qPCR testing of pen floor samples in order....... The only adhesin factor detected in this study was F18. When comparing bacterial culture or qPCR testing of pen floor samples with detection of ETEC-positive diarrhoeic pigs by culture, agreement was found in 26 (83.9%, Kappa = 0.665) and 23 (74.2%, Kappa = 0.488) of the pens, respectively. Agreement...... and qPCR. This study showed that both bacterial culture and qPCR testing of pen floor samples can be used as a diagnostic approach for detecting groups of ETEC-positive diarrhoeic nursery pigs....

  3. Multiplex PCR provides a low-cost alternative to DNA probe methods for rapid identification of Mycobacterium avium and Mycobacterium intracellulare.

    OpenAIRE

    Cousins, D; Francis, B; Dawson, D

    1996-01-01

    A multiplex PCR designed to differentiate Mycobacterium tuberculosis complex organisms from M. avium and M. intracellulare was used to test 105 isolates identified by DNA probe methods as M. avium, M. intracellulare, or M. avium complex type X. The multiple PCR correctly identified 33 of 34 isolates identified by commercial probe methods as M. avium and all 51 isolates identified as M. intracellulare. The 20 isolates identified as M. avium complex type X by probe were identified as Mycobacter...

  4. Green, Rapid, and Universal Preparation Approach of Graphene Quantum Dots under Ultraviolet Irradiation.

    Science.gov (United States)

    Zhu, Jinli; Tang, Yanfeng; Wang, Gang; Mao, Jiarong; Liu, Zhiduo; Sun, Tongming; Wang, Miao; Chen, Da; Yang, Yucheng; Li, Jipeng; Deng, Yuan; Yang, Siwei

    2017-04-26

    It is of great significance and importance to explore a mild, clean, and highly efficient universal approach for the synthesis of graphene quantum dots. Herein, we introduced a new green, rapid, and universal preparation approach for graphene quantum dots via the free-radical polymerization of oxygen-containing aromatic compounds under ultraviolet irradiation. This approach had a high yield (86%), and the byproducts are only H2O and CO2. The obtained graphene quantum dots were well-crystallized and showed remarkable optical and biological properties. The colorful, different-sized graphene quantum dots can be used in fluorescent bioimaging in vitro and in vivo. This approach is suitable not only for the preparation of graphene quantum dots but also for heteroatom-doped graphene quantum dots.

  5. Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene

    Directory of Open Access Journals (Sweden)

    Mehran Khan

    2017-10-01

    Full Text Available Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP assay, conventional polymerase chain reaction (PCR, nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1, being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1, 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1 and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1. In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem, and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

  6. Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene.

    Science.gov (United States)

    Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

    2017-01-01

    Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1), being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1), 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1) and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

  7. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    Science.gov (United States)

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  8. Development of SCAR markers for rapid and specific detection of Pseudomonas syringae pv. morsprunorum races 1 and 2, using conventional and real-time PCR.

    Science.gov (United States)

    Kałużna, Monika; Albuquerque, Pedro; Tavares, Fernando; Sobiczewski, Piotr; Puławska, Joanna

    2016-04-01

    Specific primers were developed to detect the causal agent of stone fruit bacterial canker using conventional and real-time polymerase chain reaction (PCR) methods. PCR melting profile (PCR MP) used for analysis of diversity of Pseudomonas syringae strains, allowed to pinpoint the amplified fragments specific for P. syringae pv. morsprunorum race 1 (Psm1) and race 2 (Psm2), which were sequenced. Using obtained data, specific sequence characterised amplified region (SCAR) primers were designed. Conventional and real-time PCRs, using genomic DNA isolated from different bacterial strains belonging to the Pseudomonas genus, confirmed the specificity of selected primers. Additionally, the specificity of the selected DNA regions for Psm1 and Psm2 was confirmed by dot blot hybridisation. Conventional and real-time PCR assays enabled accurate detection of Psm1 and Psm2 in pure cultures and in plant material. For conventional PCR, the detection limits were the order of magnitude ~10(0) cfu/reaction for Psm1 and 10(1) cfu/reaction for Psm2 in pure cultures, while in plant material were 10(0)-10(1) cfu/reaction using primers for Psm1 and 3 × 10(2) cfu/reaction using primers for Psm2. Real-time PCR assays with SYBR Green I showed a higher limit of detection (LOD) - 10(0) cfu/reaction in both pure culture and in plant material for each primer pairs designed, which corresponds to 30-100 and 10-50 fg of DNA of Psm1 and Psm2, respectively. To our knowledge, this is the first PCR-based method for detection of the causal agents of bacterial canker of stone fruit trees.

  9. Development of a rapid multiplex PCR assay to genotype Pasteurella multocida strains by use of the lipopolysaccharide outer core biosynthesis locus.

    Science.gov (United States)

    Harper, Marina; John, Marietta; Turni, Conny; Edmunds, Mark; St Michael, Frank; Adler, Ben; Blackall, P J; Cox, Andrew D; Boyce, John D

    2015-02-01

    Pasteurella multocida is a Gram-negative bacterial pathogen that is the causative agent of a wide range of diseases in many animal species, including humans. A widely used method for differentiation of P. multocida strains involves the Heddleston serotyping scheme. This scheme was developed in the early 1970s and classifies P. multocida strains into 16 somatic or lipopolysaccharide (LPS) serovars using an agar gel diffusion precipitin test. However, this gel diffusion assay is problematic, with difficulties reported in accuracy, reproducibility, and the sourcing of quality serovar-specific antisera. Using our knowledge of the genetics of LPS biosynthesis in P. multocida, we have developed a multiplex PCR (mPCR) that is able to differentiate strains based on the genetic organization of the LPS outer core biosynthesis loci. The accuracy of the LPS-mPCR was compared with classical Heddleston serotyping using LPS compositional data as the "gold standard." The LPS-mPCR correctly typed 57 of 58 isolates; Heddleston serotyping was able to correctly and unambiguously type only 20 of the 58 isolates. We conclude that our LPS-mPCR is a highly accurate LPS genotyping method that should replace the Heddleston serotyping scheme for the classification of P. multocida strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. App Factory: A flexible approach to rehabilitation engineering in an era of rapid technology advancement.

    Science.gov (United States)

    Jones, Michael; Mueller, James; Morris, John

    2017-01-01

    This article describes a flexible and effective approach to research and development in an era of rapid technological advancement. The approach relies on secondary dispersal of grant funds to commercial developers through a competitive selection process. This "App Factory" model balances the practical reliance on multi-year funding needed to sustain a rehabilitation engineering research center (RERC), with the need for agility and adaptability of development efforts undertaken in a rapidly changing technology environment. This approach also allows us to take advantage of technical expertise needed to accomplish a particular development task, and provides incentives to deliver successful products in a cost-effective manner. In this article, we describe the App Factory structure, process, and results achieved to date; and we discuss the lessons learned and the potential relevance of this approach for other grant-funded research and development efforts. Data presented on the direct costs and number of downloads of the 16 app development projects funded in the App Factory's first 3 years show that it can be an effective means for supporting focused, short-term assistive technology development projects.

  11. 'Rapid Learning health care in oncology' - an approach towards decision support systems enabling customised radiotherapy'.

    Science.gov (United States)

    Lambin, Philippe; Roelofs, Erik; Reymen, Bart; Velazquez, Emmanuel Rios; Buijsen, Jeroen; Zegers, Catharina M L; Carvalho, Sara; Leijenaar, Ralph T H; Nalbantov, Georgi; Oberije, Cary; Scott Marshall, M; Hoebers, Frank; Troost, Esther G C; van Stiphout, Ruud G P M; van Elmpt, Wouter; van der Weijden, Trudy; Boersma, Liesbeth; Valentini, Vincenzo; Dekker, Andre

    2013-10-01

    An overview of the Rapid Learning methodology, its results, and the potential impact on radiotherapy. Rapid Learning methodology is divided into four phases. In the data phase, diverse data are collected about past patients, treatments used, and outcomes. Innovative information technologies that support semantic interoperability enable distributed learning and data sharing without additional burden on health care professionals and without the need for data to leave the hospital. In the knowledge phase, prediction models are developed for new data and treatment outcomes by applying machine learning methods to data. In the application phase, this knowledge is applied in clinical practice via novel decision support systems or via extensions of existing models such as Tumour Control Probability models. In the evaluation phase, the predictability of treatment outcomes allows the new knowledge to be evaluated by comparing predicted and actual outcomes. Personalised or tailored cancer therapy ensures not only that patients receive an optimal treatment, but also that the right resources are being used for the right patients. Rapid Learning approaches combined with evidence based medicine are expected to improve the predictability of outcome and radiotherapy is the ideal field to study the value of Rapid Learning. The next step will be to include patient preferences in the decision making. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  12. Rapid and Accurate Detection of Bacteriophage Activity against Escherichia coli O157:H7 by Propidium Monoazide Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Hui Liu

    2014-01-01

    Full Text Available Conventional methods to determine the efficacy of bacteriophage (phage for biocontrol of E. coli require several days, due to the need to culture bacteria. Furthermore, cell surface-attached phage particles may lyse bacterial cells during experiments, leading to an overestimation of phage activity. DNA-based real-time quantitative polymerase chain reaction (qPCR is a fast, sensitive, and highly specific means of enumerating pathogens. However, qPCR may underestimate phage activity due to its inability to distinguish viable from nonviable cells. In this study, we evaluated the suitability of propidium monoazide (PMA, a microbial membrane-impermeable dye that inhibits amplification of extracellular DNA and DNA within dead or membrane-compromised cells as a means of using qPCR to identify only intact E. coli cells that survive phage exposure. Escherichia coli O157:H7 strain R508N and 4 phages (T5-like, T1-like, T4-like, and O1-like were studied. Results compared PMA-qPCR and direct plating and confirmed that PMA could successfully inhibit amplification of DNA from compromised/damaged cells E. coli O157:H7. Compared to PMA-qPCR, direct plating overestimated (P < 0.01 phage efficacy as cell surface-attached phage particles lysed E. coli O157:H7 during the plating process. Treatment of samples with PMA in combination with qPCR can therefore be considered beneficial when assessing the efficacy of bacteriophage for biocontrol of E. coli O157:H7.

  13. Development of a TaqMan-based real-time PCR assay for rapid and specific detection of fowl aviadenovirus serotype 4.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Chen, Ping; Liu, Libing; Yuan, Wanzhe

    2017-06-01

    Twelve serotypes of fowl aviadenovirus, namely, FAdV-(1-8a and 8b-11), have been identified, among which FAdV-4 is the aetiologic agent of hepatitis hydropericardium syndrome (HHS) in chickens. Outbreaks of HHS have been documented in many countries, causing significant economic losses. Real-time PCR methods described so far in the literature cross-detect different serotypes of FAdVs. In this study, we aimed to develop a TaqMan-based real-time PCR assay for the specific detection of FAdV-4. A pair of primers targeting the hexon gene and a TaqMan probe were designed. Using different copy numbers of plasmid DNA carrying the hexon gene as template, we showed the detection limit of this assay was 101 copies/reaction, which was 10 times higher than conventional PCR. The assay was highly specific for FAdV-4 and did not cross-detect 11 other serotypes of FAdVs, avian influenza virus, Newcastle disease virus, infectious bronchitis virus or subgroup J of the avian leukosis virus. The reproducibility of the assay was assessed by five independent reactions using different copy numbers of plasmid DNA (103 and 105) as template, and the results showed 0.56-1.15% coefficient of variation for inter-assay variability. Furthermore, the assay was validated with 80 clinical samples. Real-time PCR showed that 76 out of 80 samples were positive for FAdV-4 (95.0% positivity) while 68 out of 80 were tested positive by conventional PCR (85.0% positivity). Our data suggest this real-time PCR assay could be an attractive tool for screening, confirmatory diagnosis and specific differentiation of FAdV-4 infection.

  14. A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR

    Directory of Open Access Journals (Sweden)

    Israelsson Stina

    2009-12-01

    Full Text Available Abstract Background Measuring virus attachment to host cells is of great importance when trying to identify novel receptors. The presence of a usable receptor is a major determinant of viral host range and cell tropism. Furthermore, identification of appropriate receptors is central for the understanding of viral pathogenesis and gives possibilities to develop antiviral drugs. Attachment is presently measured using radiolabeled and subsequently gradient purified viruses. Traditional methods are expensive and time-consuming and not all viruses are stable during a purification procedure; hence there is room for improvement. Real-time PCR (RT-PCR has become the standard method to detect and quantify virus infections, including enteroviruses, in clinical samples. For instance, primers directed to the highly conserved 5' untranslated region (5'UTR of the enterovirus genome enable detection of a wide spectrum of enteroviruses. Here, we evaluate the capacity of the RT-PCR technology to study enterovirus host cell interactions at the cell surface and compare this novel implementation with an established assay using radiolabeled viruses. Results Both purified and crude viral extracts of CVB5 generated comparable results in attachment studies when analyzed with RT-PCR. In addition, receptor binding studies regarding viruses with coxsackie- and adenovirus receptor (CAR and/or decay accelerating factor (DAF affinity, further demonstrated the possibility to use RT-PCR to measure virus attachment to host cells. Furthermore, the RT-PCR technology and crude viral extracts was used to study attachment with low multiplicity of infection (0.05 × 10-4TCID50/cell and low cell numbers (250, which implies the range of potential implementations of the presented technique. Conclusion We have implemented the well-established RT-PCR technique to measure viral attachment to host cells with high accuracy and reproducibility, at low cost and with less effort than

  15. A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR.

    Science.gov (United States)

    Jonsson, Nina; Gullberg, Maria; Israelsson, Stina; Lindberg, A Michael

    2009-12-07

    Measuring virus attachment to host cells is of great importance when trying to identify novel receptors. The presence of a usable receptor is a major determinant of viral host range and cell tropism. Furthermore, identification of appropriate receptors is central for the understanding of viral pathogenesis and gives possibilities to develop antiviral drugs. Attachment is presently measured using radiolabeled and subsequently gradient purified viruses. Traditional methods are expensive and time-consuming and not all viruses are stable during a purification procedure; hence there is room for improvement. Real-time PCR (RT-PCR) has become the standard method to detect and quantify virus infections, including enteroviruses, in clinical samples. For instance, primers directed to the highly conserved 5' untranslated region (5'UTR) of the enterovirus genome enable detection of a wide spectrum of enteroviruses. Here, we evaluate the capacity of the RT-PCR technology to study enterovirus host cell interactions at the cell surface and compare this novel implementation with an established assay using radiolabeled viruses. Both purified and crude viral extracts of CVB5 generated comparable results in attachment studies when analyzed with RT-PCR. In addition, receptor binding studies regarding viruses with coxsackie- and adenovirus receptor (CAR) and/or decay accelerating factor (DAF) affinity, further demonstrated the possibility to use RT-PCR to measure virus attachment to host cells. Furthermore, the RT-PCR technology and crude viral extracts was used to study attachment with low multiplicity of infection (0.05 x 10(-4)TCID50/cell) and low cell numbers (250), which implies the range of potential implementations of the presented technique. We have implemented the well-established RT-PCR technique to measure viral attachment to host cells with high accuracy and reproducibility, at low cost and with less effort than traditional methods. Furthermore, replacing traditional

  16. Rapid DNA haplotyping using a multiplex heteroduplex approach: application to Duchenne muscular dystrophy carrier testing.

    Science.gov (United States)

    Prior, T W; Wenger, G D; Papp, A C; Snyder, P J; Sedra, M S; Bartolo, C; Moore, J W; Highsmith, W E

    1995-01-01

    A new strategy has been developed for rapid haplotype analysis based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. This simple, rapid method does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. The method may be used for other genetic diseases when mutations are unknown or there are few dinucleotide markers in the gene proximity, and for the identification of haplotype backgrounds of mutant alleles.

  17. Multidisciplinary synthetic approach for rapid combinatorial library synthesis of triaza-fluorenes.

    Science.gov (United States)

    Hsiao, Ya-Shan; Yellol, Gorakh S; Chen, Li-Hsun; Sun, Chung-Ming

    2010-09-13

    A new multidisciplinary synthetic approach comprising polymer-support synthesis, microwave-assisted synthesis, and multicomponent condensation facilitates synthesis of triaza-fluorenes library with a set of advantages such as rapid process, simple purification, and structural diversity in one shot. Microwave-assisted multistep synthetic protocol was used to construct the benzimidazole ring on soluble polymer support using activated aryl-fluorides. The PEG anchored aryl fluoride was condensed with selective primary amines via an ipso-fluoro displacement reaction followed by reduction of nitro group. The subsequent cyclization with cyanogen bromide is used as a key step to furnish immobilized benzimidazoles. Finally multicomponent condensation of resulted polymer bound benzimidazoles with various aldehydes and 1,3-diones under microwave irradiations provides rapid access for triaza-fluorenes with high purity and excellent yields. Microwave irradiation greatly accelerates the rate of all reactions while polymer support facilitates purifications by simple precipitation technique. This strategy dramatically increases efficiency of overall multistep synthesis.

  18. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...

  19. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    DEFF Research Database (Denmark)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka

    2013-01-01

    -bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained...

  20. Evaluation of a PCR-Based Universal Heteroduplex Generator Assay as a Tool for Rapid Detection of Multidrug-Resistant Mycobacterium tuberculosis in Peru

    Science.gov (United States)

    Mayta, Holger; Gilman, Robert H.; Arenas, Fanny; Valencia, Teresa; Caviedes, Luz; Montenegro, Sonia H.; Ticona, Eduardo; Ortiz, Jaime; Chumpitaz, Rosa; Evans, Carlton A.; Williams, Diana L.

    2003-01-01

    Multidrug-resistant tuberculosis is an increasing health problem worldwide, especially in developing countries. The PCR-UHG-Rif assay, which detects mutations within the rpoB gene associated with rifampin resistance, was evaluated for its ability and reliability to detect and identify drug-resistant Mycobacterium tuberculosis in a developing country where tuberculosis is highly endemic. PMID:14662980

  1. Rapid Screening Method for Compounds That Affect the Growth and Germination of Candida albicans, Using a Real-Time PCR Thermocycler

    NARCIS (Netherlands)

    Jarosz, Lucja M.; Krom, Bastiaan P.

    2011-01-01

    We propose a screening method for compounds affecting growth and germination in Candida albicans using a real-time PCR thermocycler to quantify green fluorescent protein (GFP) fluorescence. Using P(ACT1)-GFP and P(HWP1)-GFP reporter strains, the effects of a wide range of compounds on growth and

  2. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  3. Evaluation of a PCR-based universal heteroduplex generator assay as a tool for rapid detection of multidrug-resistant Mycobacterium tuberculosis in Peru.

    Science.gov (United States)

    Mayta, Holger; Gilman, Robert H; Arenas, Fanny; Valencia, Teresa; Caviedes, Luz; Montenegro, Sonia H; Ticona, Eduardo; Ortiz, Jaime; Chumpitaz, Rosa; Evans, Carlton A; Williams, Diana L

    2003-12-01

    Multidrug-resistant tuberculosis is an increasing health problem worldwide, especially in developing countries. The PCR-UHG-Rif assay, which detects mutations within the rpoB gene associated with rifampin resistance, was evaluated for its ability and reliability to detect and identify drug-resistant Mycobacterium tuberculosis in a developing country where tuberculosis is highly endemic.

  4. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Steven

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18, is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...

  5. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Stephen Jacques

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18 is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...

  6. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Science.gov (United States)

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  7. Interlaboratory comparison of quantitative RT-PCR based detection for minimal residual disease in leukemias: a standardization approach in Japan.

    Science.gov (United States)

    Yamada, Minami F; Fujiwara, Tohru; Ishikawa, Izumi; Kohata, Katsura; Katoh, Chiaki; Miyamura, Koichi; Harigae, Hideo

    2008-02-01

    Real-time quantitative polymerase chain reaction (RQ-PCR) has been accepted as integral part of the management of patients with hematologic malignancies. Whereas standardization efforts of RQ-PCR, initiated by Europe Against Cancer (EAC) group, have been gradually widespread in the world, Japanese laboratories use their individual protocol for RQ-PCR analysis. Therefore, we assessed the variability of quantitative results obtained from 4 different laboratories in Japan, including 3 companies and Tohoku University Hospital, using identical peripheral blood or bone marrow samples of patients in chronic myeloid leukemia (CML; n = 11) and acute myeloid leukemia (AML; n = 2). RQ-PCR was designed to quantify the copy numbers of disease-specific fusion chimeras; BCR-ABL (CML) and AML1-ETO (AML). In 5 out of 13 samples, the quantitative results from 4 laboratories varied more than 10 times (up to 712 times). Thus, we next sought to determine factors affecting the variability of RQ-PCR results across laboratories, by sending back RNA and cDNA samples from each company to Tohoku University, and they were further proceed to yield quantitative data. The main difference between companies and Tohoku University was probably due to the difference of blood separation method (Blood lysis or Ficoll-Hypaque). On the other hand, the variability among 4 laboratories was the most noticeable in the PCR step, mainly attributable to the difference of primer/probe sequence among laboratories. In conclusion, our analyses indicate the importance to limit both preanalytical (sample processing) and analytical (RQ-PCR) interlaboratory variability for RQ-PCR protocol, and the need of further efforts on standardization program in Japan.

  8. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    Science.gov (United States)

    Mellerup, Anders; Ståhl, Marie

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same samples, and therefore differences in antibiotic resistance levels between samples were more readily detected. To our knowledge, this is the first study to describe sampling and pooling methods for qPCR quantification of antibiotic resistance genes in total DNA extracted from swine feces. PMID:26114765

  9. Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

    DEFF Research Database (Denmark)

    Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

    2004-01-01

    , Campylobacter jejuni and Yersinia enterocolitica were used to produce genomic DNA (gDNA). These preparations gave support to method development for qualitative polymerase chain reaction (PCR) detection methods for food-borne pathogens. Purified gDNA was transformed into stable and dry gDNA by using......As part of a multi-centre European project, FOOD-PCR, the feasibility of a novel approach for production of dried bacterial DNA that could be used as certified reference materials (CRM) was assessed. Selected strains of Salmonella typhimurium, Listeria monocytogenes, Escherichia coli O157...... of distilled water then gentle shaking. These studies have shown that production of stable and dry bacterial gDNA material is feasible and could help satisfy the increasing need for certified reference DNA positive control samples in the field of PCR testing for detection and verification of food...

  10. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

    DEFF Research Database (Denmark)

    Mahende, Coline; Ngasala, Billy; Lusingu, John

    2016-01-01

    predictive value (PPV) of 88.9 % (95 % CI, 79.3-95.1 %) and 75.3 % (95 % CI, 64.8-84.0 %), respectively. Confirmation of P. falciparum infection with PCR analysis provided lower sensitivity and PPV of 88.6 % (95 % CI, 79.5-94.7 %) and 84.3 % (95 % CI, 74.7-91.4 %) for RDT compared to microscopy. Conclusion...

  11. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    OpenAIRE

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-jacques; Dalgaard, Paw,; Pilet, Marie-France; Dousset, Xavier

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When th...

  12. Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates.

    Science.gov (United States)

    Kumar, Parveen; Benny, Prit; Jain, Manisha; Singh, Sarman

    2014-03-01

    Species specific diagnosis of mycobacterial infection is crucial because treatment of infections caused by Mycobacterium tuberculosis (MTB) differs from that of non-tuberculous mycobacterial (NTM) species. The species identification used to be cumbersome and non-reproducible a decade ago. Recently, some commercial tests have been made available to differentiate the MTB and NTM growths in culture media. Sensitivity and specificity of these tests was evaluated. In this double blind study 572 clinical samples were cultured in an automated BACTEC-MGIT-960 system. A total of 147 (25.7%) samples were MGIT culture positive. These cultures were subjected to an in-house m-PCR (which amplifies hsp-65, esat-6 and ITS region for MAC), two commercial immune-chromatographic tests (ICTs) and phenotypic tests. Of the 147 MGIT positive cultures, m-PCR was able to correctly identify MTB in 123 cultures and NTM in 24 which included 3 MAC isolates. m-PCR showed 100% agreement with two gold standard methods-the nitrate reductase assay and PNB tests-in correctly identifying MTB. Commercial strips were able to correctly identify MTB in 120 (97.5%) of 123 cultures, while 3 (2.5%) isolates were falsely identified as NTM. However, none of the growth negative spent medium gave false positive results in any of the tests. None of the commercial strips misidentified any of the 24 NTM as MTB; hence, specificity of these strips was 100%. Of the 2 IC test systems, both SD Bioline and BD TBc strip tests missed 2.5% of MTB isolates and misidentified these as NTM. The in-house m-PCR was found to be the most accurate and efficient tool for identifying the MTB, MAC and other NTMs. Copyright © 2014 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  13. PCR-Based Rapid Identification System Using Bridged Nucleic Acids for Detection of Clarithromycin-Resistant Mycobacterium avium-M. intracellulare Complex Isolates

    Science.gov (United States)

    Shiono, Ayako; Egashira, Hiroshi; Kishi, Etsuko; Hagiwara, Koichi; Nakamura, Hidetoshi; Kanazawa, Minoru; Nagata, Makoto

    2016-01-01

    The nontuberculous mycobacteria (NTM) cause miscellaneous disorders in humans, especially in the lungs, which present with a variety of radiological features. To date, knowledge of the pathogenic role of the Mycobacterium avium-intracellulare complex (MAC) in the human lung and the definitive criteria for initiating multidrug therapy are still lacking. However, there is little doubt that clarithromycin is the most efficacious drug among the various treatment regimens for lung NTM. In this study, with the use of a bridged nucleic acid (BNA) probe a detection system based on a real-time PCR (BNA-PCR) for the identification of the point mutations at position 2058 or 2059 in domain V of the 23S rRNA gene responsible for clarithromycin resistance was developed and has been assessed using MAC isolates from clinical samples. Out of 199 respiratory specimens, the drug susceptibility test demonstrated 12 strains resistant to clarithromycin, while the BNA-PCR showed 8 strains carrying the point mutation at position 2058 or 2059 of the 23S rRNA gene. This system revealed that there were mycobacterial strains resistant to clarithromycin which do not carry previously identified resistance genes. This paper documents a novel system for detecting clarithromycin-resistant strains and demonstrates that although these mutations are tacitly assumed to account for >90% of the reported resistant mutants, there is a significant fraction of resistant mutants that do not harbor these mutations. Therefore, unknown mechanisms affecting clarithromycin resistance remain to be elucidated. PMID:26739154

  14. A simple and rapid PCR-based method to isolate complete small macronuclear minichromosomes from hypotrich ciliates: 5S rDNA and S26 ribosomal protein gene of Oxytricha (Sterkiella) nova.

    Science.gov (United States)

    Callejas, Sergio; Gutiérrez, Juan Carlos

    2002-06-01

    Hypotrich ciliates present a macronuclear genome consisting of gene-sized instead of chromosome-sized DNA molecules. Exploiting this unique eukaryotic genome feature, we introduce, for the first time in ciliates, a rapid and easy PCR method using telomeric primers to isolate small complete macronuclear DNA molecules or minichromosomes. Two presumably abundant macronuclear DNA molecules, containing ribosomal genes, were amplified from the Oxytricha (Sterkiella) nova complete genome after using this method, and then were cloned and sequenced. The 5S rDNA sequence of O. (S.) nova is the third one reported among hypotrich ciliates; its primary and secondary structure is compared with other eukaryotic 5S rRNAs. The ribosomal protein S26 gene is the first one reported among ciliates. This "End-End-PCR" method might be useful to obtain similar gene-sized macronuclear molecules from other hypotrich ciliates, and, therefore, to increase our knowledge on ribosomal genes in these eukaryotic microorganisms.

  15. Rapid detection and identification of Stachybotrys and Chaetomium species using tissue PCR analysis

    DEFF Research Database (Denmark)

    Lewinska, Anna Malgorzata; Peuhkuri, Ruut Hannele; Rode, Carsten

    2016-01-01

    Indoor fungi are a worldwide problem causing negative health effects for infected building's occupants and even deterioration of building structures. Different fungal species affect buildings and their inhabitants differently. Therefore, rapid and accurate identification of fungi to the species l...

  16. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples.

    Science.gov (United States)

    Padhi, Bhaja K; Singh, Manjeet; Huang, Nicholas; Pelletier, Guillaume

    2016-02-01

    Genomic DNA (gDNA) contamination of RNA samples can lead to inaccurate measurement of gene expression by reverse transcription quantitative real-time PCR (RT-qPCR). We describe an easily adoptable PCR-based method where gDNA contamination in RNA samples is assessed by comparing the amplification of intronic and exonic sequences from a housekeeping gene. Although this alternative assay was developed for rat RNA samples, it could be easily adapted to other species. As a proof of concept, we assessed the effects of detectable gDNA contamination levels on the expression of a few genes that illustrate the importance of RNA quality in acquiring reliable data. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  17. Comparison of the Directigen flu A+B test, the QuickVue influenza test, and clinical case definition to viral culture and reverse transcription-PCR for rapid diagnosis of influenza virus infection.

    Science.gov (United States)

    Ruest, Annie; Michaud, Sophie; Deslandes, Sylvie; Frost, Eric H

    2003-08-01

    The diagnostic performances of the clinical case definition of influenza virus infection based on the combination of fever and cough and of two rapid influenza diagnostic tests, the Directigen Flu A+B test (Directigen; BD Diagnostic Systems, Sparks, Md.) and the QuickVue influenza test (QuickVue; Quidel, San Diego, Calif.), were compared to those of viral culture and an in-house reverse transcription (RT)-PCR during the 2000-2001 flu season. Two hundred consecutive nasopharyngeal aspirates were analyzed from 192 patients, including 122 adults and 70 children. Viral culture identified influenza virus A in 16 samples and influenza virus B in 55 samples, whereas RT-PCR identified influenza virus A in 21 samples and influenza virus B in 64 samples. When RT-PCR was used as the reference standard, the likelihood ratios for a positive test were 40.0 for Directigen, 8.6 for QuickVue, and 1.4 for the combination of fever and cough, whereas the likelihood ratios for a negative test were 0.22, 0.16, and 0.48, respectively. Our study suggests that (i). the poor specificity (35 to 58%) and the poor positive predictive value (41 to 60%) of the clinical case definition of influenza preclude its use for prediction of influenza virus infections during epidemics, especially when infection control decision making in the hospital setting is considered; (ii). Directigen has a higher diagnostic yield than QuickVue but is associated with a larger number of invalid results; (iii). the sensitivities of the rapid diagnostic tests are significantly lower with samples from adults than with samples from children, with the rates of false-negative results reaching up to 29%; and (iv). RT-PCR detects more cases of influenza than viral culture, and this greater accuracy makes it a more useful reference standard.

  18. Enhancement of PCR Detection Limit by Single-Tube Restriction Endonuclease-PCR (RE-PCR).

    Science.gov (United States)

    Datta, Sibnarayan; Budhauliya, Raghvendra; Chatterjee, Soumya; Vanlalhmuaka; Veer, Vijay; Chakravarty, Runu

    2016-06-01

    Polymerase chain reaction (PCR) is widely used in biological research and diagnostics because of its high sensitivity and specificity. However, the sensitivity of PCR is strongly influenced by topological characteristics of the template. Supercoiled templates are known to inhibit PCR, whereas linearized forms of the same supercoiled templates facilitate PCR. This study was conducted to compare the PCR efficiency of circular supercoiled DNA templates to their restriction endonuclease (RE)-mediated linearized forms. Additionally, we also evaluated the possibility of RE digestion of the circular supercoiled templates within the complete PCR buffer. Following a systematic approach, we demonstrated that circular supercoiled templates could be efficiently linearized by RE in the complete PCR buffer itself. This allowed linearization of circular supercoiled templates and their subsequent amplification in the PCR buffer in a single-tube format. Using this extremely simple RE-PCR approach, we documented up to tenfold increases in detection efficiency of PCR with two different circular supercoiled templates of clinical origin, including an international calibration standard. This inexpensive and easy approach to increasing PCR sensitivity can be easily adapted to any standard PCR protocol aimed at amplifying circular supercoiled genomes. Apart from its application in the development of sensitive clinical diagnostic PCR assays for a large number of organisms, this method could also prove to be very useful in simplifying the existing protocols for other applications where pre-PCR restriction digestion is required, such as mutation detection, genotyping, and selective template amplification.

  19. Development and evaluation of hexaplex PCR for rapid detection of methicillin, cadmium/zinc and antiseptic-resistant staphylococci, with simultaneous identification of PVL-positive and -negative Staphylococcus aureus and coagulase negative staphylococci.

    Science.gov (United States)

    Panda, Sasmita; Kar, Sarita; Choudhury, Ranginee; Sharma, Savitri; Singh, Durg V

    2014-03-01

    We developed a multiplex PCR to detect the presence of methicillin- (mecA), cadmium/zinc-(czrC) and antiseptic-resistant (qacA/B) staphylococci and to identify Panton-Valentine leukocidin (PVL)-positive and -negative Staphylococcus aureus and coagulase-negative staphylococci (CoNS) from infected and healthy eyes. The assay was validated on 177 staphylococci comprising of 55 each of S. aureus and CoNS isolated from infected eyes and five S. aureus and 62 CoNS isolated from healthy eyes and nine direct ocular samples. Nine direct ocular samples for in situ testing consisted of corneal scrapings (4), conjunctiva swabs (2) and others (3). Multiplex PCR result was correlated with genotype data obtained with single PCR and dot-blot assay. The control strains that were positive in multiplex PCR for 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes were also positive in the dot-blot assay. The specificity of amplified genes obtained with reference strains was further confirmed by DNA sequencing. The single step-hexaplex PCR method can be used for rapid detection of mecA, nuc, pvl, czrC and qacA/B genes in staphylococci with simultaneous identification of PVL-positive and -negative S. aureus and CoNS from a variety of ocular samples. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  20. The Use of Infrared Thermography as a Novel Approach for Real-Time Validation of PCR Thermocyclers

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Löfström, Charlotta; Helleskov, Jens Bue

    2010-01-01

    Validation of PCR thermocycler performance is crucial to obtain reliable results. In this study, infrared (IR) thermography was evaluated as a novel validation tool. After stabilisation, no significant difference in the temperatures recorded using thermography and a reference blockbased system wa...

  1. Occurrence of Listeria species in meat, chicken products and human stools in Assiut city, Egypt with PCR use for rapid identification of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashraf Mohamed Abd El-Malek

    Full Text Available The present research was conducted to check the presence of Listeria spp. in some meat and chicken products purchased from retail supermarkets in Assiut (Egypt. A total of 100 samples including 25 samples each of minced frozen beef, luncheon, frozen chicken legs and frozen chicken breast fillets were collected over a 7-month period between January and July 2009 and analyzed for the presence of Listeria spp. In addition, 28 stool cultures examined for Listeria spp. from hospitalized children resident in Assiut Pediatric University Hospital with diarrhea or fever. Out of the total 100 meat samples examined, Listeria spp. were detected in 8 (32% of minced frozen beef, 8 (32% of luncheon, 13 (52% of frozen chicken leg and 14 (56% of frozen chicken fillet samples analyzed, respectively. Regarding the examined 28 stool cultures from hospitalized children with underlying disease in Assiut Univ. hospital, 2 (7.14% were found positive for Listeria spp. For identification of L. monocytogenes using polymerase chain reaction (PCR, two primers were selected to detect 217-pb fragment ofthe prfA (transcriptional activator of the virulence factor gene for L. monocytogenes. 13 selected Listeria isolates displayed beta-haemolysis on sheep blood agar and positive CAMP test were further identified using PCR. PCR results showed that L. monocytogenes were confirmed in one of minced imported frozen meat examined, two of luncheon samples and two of frozen chicken legs with the total incidence of 5 isolates (5% from the total 100 examined food samples. This suggests the presence of a significant public health hazard linked to the consumption of these meat and chicken products sold in Assiut city contaminated with L. monocytogenes. The public health significance of these pathogens as well as recommended sanitary measures was discussed. [Veterinary World 2010; 3(8.000: 353-359

  2. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    -hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  3. Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design

    Science.gov (United States)

    Pilotte, Nils; Papaiakovou, Marina; Grant, Jessica R.; Bierwert, Lou Ann; Llewellyn, Stacey; McCarthy, James S.; Williams, Steven A.

    2016-01-01

    Background The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world’s most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays. Methodology/Principal Findings Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis). Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay. Conclusions/Significance The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other

  4. Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design.

    Science.gov (United States)

    Pilotte, Nils; Papaiakovou, Marina; Grant, Jessica R; Bierwert, Lou Ann; Llewellyn, Stacey; McCarthy, James S; Williams, Steven A

    2016-03-01

    The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world's most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays. Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis). Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay. The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other eukaryotic pathogens.

  5. A new PCR-based approach indicates the range of Clonorchis sinensis now extends to Central Thailand.

    Directory of Open Access Journals (Sweden)

    Rebecca J Traub

    Full Text Available Differentiation of the fish-borne trematodes belonging to the Opisthorchiidae, Heterophyidae and Lecithodendriidae is important from a clinical and epidemiological perspective, yet it is impossible to do using conventional coprological techniques, as the eggs are morphologically similar. Epidemiological investigation therefore currently relies on morphological examination of adult worms following expulsion chemotherapy. A PCR test capable of amplifying a segment of the internal transcribed spacer region of ribosomal DNA for the opisthorchiid and heterophyid flukes eggs taken directly from faeces was developed and evaluated in a rural community in central Thailand. The lowest quantity of DNA that could be amplified from individual adults of Opisthorchis viverrini, Clonorchis sinensis and Haplorchis taichui was estimated at 0.6 pg, 0.8 pg and 3 pg, respectively. The PCR was capable of detecting mixed infection with the aforementioned species of flukes under experimental conditions. A total of 11.6% of individuals in rural communities in Sanamchaikaet district, central Thailand, were positive for 'Opisthorchis-like' eggs in their faeces using conventional parasitological detection techniques. In comparison to microscopy, the PCR yielded a sensitivity and specificity of 71.0% and 76.7%, respectively. Analysis of the microscopy-positive PCR products revealed 64% and 23% of individuals to be infected with O. viverrini and C. sinensis, respectively. The remaining 13% (three individuals were identified as eggs of Didymozoidae, presumably being passed mechanically in the faeces following the ingestion of infected fishes. An immediate finding of this study is the identification and first report of a C. sinensis-endemic community in central Thailand. This extends the known range of this liver fluke in Southeast Asia. The PCR developed herein provides an important tool for the specific identification of liver and intestinal fluke species for future

  6. Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design.

    Directory of Open Access Journals (Sweden)

    Nils Pilotte

    2016-03-01

    Full Text Available The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world's most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays.Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis. Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay.The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other eukaryotic pathogens.

  7. Real-time PCR in Food Science: PCR Diagnostics.

    Science.gov (United States)

    Rodriguez-Lazaro, David; Cook, Nigel; Hernandez, Marta

    2013-01-01

    A principal consumer demand is a guarantee of the safety and quality of food. The presence of foodborne pathogens and their potential hazard, the use of genetically modified organisms (GMOs) in food production, and the correct labelling in foods suitable for vegetarians are among the subjects where society demands total transparency. The application of controls within the quality assessment programmes of the food industry is a way to satisfy these demands, and is necessary to ensure efficient analytical methodologies are possessed and correctly applied by the Food Sector. The use of real-time PCR has become a promising alternative approach in food diagnostics. It possesses a number of advantages over conventional culturing approaches, including rapidity, excellent analytical sensitivity and selectivity, and potential for quantification. However, the use of expensive equipment and reagents, the need for qualified personnel, and the lack of standardized protocols are impairing its practical implementation for food monitoring and control.

  8. Research on the rapid and accurate positioning and orientation approach for land missile-launching vehicle.

    Science.gov (United States)

    Li, Kui; Wang, Lei; Lv, Yanhong; Gao, Pengyu; Song, Tianxiao

    2015-10-20

    Getting a land vehicle's accurate position, azimuth and attitude rapidly is significant for vehicle based weapons' combat effectiveness. In this paper, a new approach to acquire vehicle's accurate position and orientation is proposed. It uses biaxial optical detection platform (BODP) to aim at and lock in no less than three pre-set cooperative targets, whose accurate positions are measured beforehand. Then, it calculates the vehicle's accurate position, azimuth and attitudes by the rough position and orientation provided by vehicle based navigation systems and no less than three couples of azimuth and pitch angles measured by BODP. The proposed approach does not depend on Global Navigation Satellite System (GNSS), thus it is autonomous and difficult to interfere. Meanwhile, it only needs a rough position and orientation as algorithm's iterative initial value, consequently, it does not have high performance requirement for Inertial Navigation System (INS), odometer and other vehicle based navigation systems, even in high precise applications. This paper described the system's working procedure, presented theoretical deviation of the algorithm, and then verified its effectiveness through simulation and vehicle experiments. The simulation and experimental results indicate that the proposed approach can achieve positioning and orientation accuracy of 0.2 m and 20″ respectively in less than 3 min.

  9. Research on the Rapid and Accurate Positioning and Orientation Approach for Land Missile-Launching Vehicle

    Directory of Open Access Journals (Sweden)

    Kui Li

    2015-10-01

    Full Text Available Getting a land vehicle’s accurate position, azimuth and attitude rapidly is significant for vehicle based weapons’ combat effectiveness. In this paper, a new approach to acquire vehicle’s accurate position and orientation is proposed. It uses biaxial optical detection platform (BODP to aim at and lock in no less than three pre-set cooperative targets, whose accurate positions are measured beforehand. Then, it calculates the vehicle’s accurate position, azimuth and attitudes by the rough position and orientation provided by vehicle based navigation systems and no less than three couples of azimuth and pitch angles measured by BODP. The proposed approach does not depend on Global Navigation Satellite System (GNSS, thus it is autonomous and difficult to interfere. Meanwhile, it only needs a rough position and orientation as algorithm’s iterative initial value, consequently, it does not have high performance requirement for Inertial Navigation System (INS, odometer and other vehicle based navigation systems, even in high precise applications. This paper described the system’s working procedure, presented theoretical deviation of the algorithm, and then verified its effectiveness through simulation and vehicle experiments. The simulation and experimental results indicate that the proposed approach can achieve positioning and orientation accuracy of 0.2 m and 20″ respectively in less than 3 min.

  10. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    Energy Technology Data Exchange (ETDEWEB)

    Huang, S-H; Tsai, M-H; Lin, C-W [Department of Biotechnology, College of Health Science, Asia University, Wufeng, Taichung, Taiwan (China); Yang, T-C; Chuang, P-H [Department of Medical Laboratory Science and Biotechnology, China Medical University, Taichung, Taiwan (China); Tsai, I-S; Lu, H-C [Nanotechnology Research Center, Feng Chia University, Taichung, Taiwan (China); Wan Lei; Lin, Y-J [Department of Medical Genetics and Medical Research, China Medical University Hospital, Taichung, Taiwan (China); Lai, C-H [Department of Microbiology and Immunology, China Medical University, Taichung, Taiwan (China)], E-mail: cwlin@mail.cmu.edu.tw

    2008-10-08

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples.

  11. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    Science.gov (United States)

    Huang, Su-Hua; Yang, Tsuey-Ching; Tsai, Ming-Hong; Tsai, I.-Shou; Lu, Huang-Chih; Chuang, Pei-Hsin; Wan, Lei; Lin, Ying-Ju; Lai, Chih-Ho; Lin, Cheng-Wen

    2008-10-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples.

  12. A PCR-mutagenesis strategy for rapid detection of mutations in codon 634 of the ret proto-oncogene related to MEN 2A.

    Directory of Open Access Journals (Sweden)

    Godoy Clara

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasias type 2A (MEN 2A is a dominantly inherited cancer syndrome. Missence mutations in the codon encoding cysteine 634 of the ret proto-oncogene have been found in 85% of the MEN 2A families. The main tumour type always present in MEN 2A is medullar thyroid carcinoma (MTC. Only 25% of all MTC are hereditary, and generally they are identified by a careful family history. However, some familial MTCs are not easily detected by this means and underdiagnosis of MEN 2A is suspected. Methods DNA samples from MEN 2A patients were amplified by PCR. The products were incubated with the restriction enzyme Bst ApI or Bgl I. The samples were loaded in non-denaturing 10% Polyacrilamyde Gel and run at 120 volts for 40 min. The gels were stained with 10 μg/ml ethidium bromide, and the bands were visualized under a UV lamp. Results We developed a PCR-mutagenic method to check the integrity of the three bases of the cysteine 634 codon. Conclusion The method can be used to detect inherited mutations in MTC patients without a clear family history. The method is relatively simple to use as a routine test in these patients to decrease the underdiagnosis of MEN 2A. In addition, the assay can be used to screen affected families with any mutation in cysteine 634.

  13. Charging YOYO-1 on capillary wall for online DNA intercalation and integrating this approach with multiplex PCR and bare narrow capillary-hydrodynamic chromatography for online DNA analysis.

    Science.gov (United States)

    Chen, Huang; Zhu, Zaifang; Lu, Joann Juan; Liu, Shaorong

    2015-02-03

    Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary-hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions.

  14. Charging YOYO-1 on Capillary Wall for Online DNA Intercalation and Integrating This Approach with Multiplex PCR and Bare Narrow Capillary–Hydrodynamic Chromatography for Online DNA Analysis

    Science.gov (United States)

    2016-01-01

    Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary–hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions. PMID:25555111

  15. A new PCR-based approach for the specific amplification of DNA from different Schistosoma species applicable to human urine samples.

    Science.gov (United States)

    Sandoval, N; Siles-Lucas, M; Pérez-Arellano, J L; Carranza, C; Puente, S; López-Abán, J; Muro, A

    2006-11-01

    Currently available methods for the diagnosis of human schistosomiasis often lack enough sensitivity and specificity. Recently, several authors have developed more specific and sensitive diagnostic methods, mainly based on the polymerase chain reaction (PCR) technique. Nevertheless, these have been only applied for the diagnosis of 1 out of 4 Schistosoma species affecting man (S. mansoni). Additionally, application of specific PCR has been exclusively used for blood or faecal patients' samples. Here, we develop a new, high sensitive PCR approach that allows the genus- and species-specific amplification of the main 4 Schistosoma species causing disease in man plus S. bovis. We further successfully apply this technique for the detection of parasite DNA in easy-to-handle urine samples from patients with schistosomiasis. With these samples, we have found 94.4% sensitivity and 99.9% specificity when applying a genus-specific (Schistosoma spp.) primer pair, and 100% sensitivity and 98.9% specificity in a species-specific (S. mansoni) PCR.

  16. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  17. CGC/saturation approach for soft interactions at high energy: long range rapidity correlations

    Energy Technology Data Exchange (ETDEWEB)

    Gotsman, E.; Maor, U. [Tel Aviv University, Department of Particle Physics, School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Science, Tel Aviv (Israel); Levin, E. [Tel Aviv University, Department of Particle Physics, School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Science, Tel Aviv (Israel); Universidad Tecnica Federico Santa Maria and Centro Cientifico- Tecnologico de Valparaiso, Departemento de Fisica, Valparaiso (Chile)

    2015-11-15

    In this paper we continue our program to construct a model for high energy soft interactions that is based on the CGC/saturation approach. The main result of this paper is that we have discovered a mechanism that leads to large long range rapidity correlations and results in large values of the correlation function R(y{sub 1}, y{sub 2}) ≥ 1, which is independent of y{sub 1} and y{sub 2}. Such a behavior of the correlation function provides strong support for the idea that at high energies the system of partons that is produced is not only dense but also has strong attractive forces acting between the partons. (orig.)

  18. Rapid assessment of antimicrobial resistance prevalence using a Lot Quality Assurance sampling approach.

    Science.gov (United States)

    van Leth, Frank; den Heijer, Casper; Beerepoot, Mariëlle; Stobberingh, Ellen; Geerlings, Suzanne; Schultsz, Constance

    2017-04-01

    Increasing antimicrobial resistance (AMR) requires rapid surveillance tools, such as Lot Quality Assurance Sampling (LQAS). LQAS classifies AMR as high or low based on set parameters. We compared classifications with the underlying true AMR prevalence using data on 1335 Escherichia coli isolates from surveys of community-acquired urinary tract infection in women, by assessing operating curves, sensitivity and specificity. Sensitivity and specificity of any set of LQAS parameters was above 99% and between 79 and 90%, respectively. Operating curves showed high concordance of the LQAS classification with true AMR prevalence estimates. LQAS-based AMR surveillance is a feasible approach that provides timely and locally relevant estimates, and the necessary information to formulate and evaluate guidelines for empirical treatment.

  19. A rapid and sensitive assay for detection of replication-competent adenoviruses by a combination of microcarrier cell culture and quantitative PCR

    NARCIS (Netherlands)

    Schalk, Johanna A. C.; de Vries, Claudette G. J. C. A.; Orzechowski, Tom J. H.; Rots, Marianne G.

    2007-01-01

    The development of a rapid and sensitive assay for detection of replication-competent adenoviruses (RCAs) is described. This RCA assay consists of an incubation step of 4 days of adenoviral vectors on A549 cells in a microcarrier cell culture system followed by detection of amplified RCAs by

  20. Rapid genotyping of the OATP1B1 polymorphisms A388G and T521C with real-time PCR FRET assays

    NARCIS (Netherlands)

    op den Buijsch, R.A.; Wijnen, P.A.H.M.; van Dieijen-Visser, M.P.; de Vries, J.E.; Bekers, O.

    2005-01-01

    The polymorphisms (OATP)1B1 A388G and T521C of the solute carrier organic anion-transporter family member 1B1 gene (SLCO1B1), previously known as OATP-C, have potential impacts on drug metabolism. In order to establish a fast and consistent assay for these polymorphisms, rapid speed polymerase chain

  1. Use of a Real-Time PCR TaqMan Assay for Rapid Identification and Differentiation of Burkholderia pseudomallei and Burkholderia mallei

    OpenAIRE

    U?Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul

    2005-01-01

    A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.

  2. Rapid Assessment of Health Services in Punjab using a Mixed Method Approach

    Directory of Open Access Journals (Sweden)

    Rajesh Kumar

    2015-06-01

    Full Text Available Introduction: The out-of-pocket expenditure is quite high in Punjab. Hence, a rapid review of health facilities was undertaken to suggest remedial measures. Methods: Mixed method research approach was used to identify strengths and weaknesses of the health services in Punjab. All health institutions were included in the assessment from the three purposively sampled districts – one from each of the three regions of Punjab. Tools were developed to collect data from record review, observations, and in-depth interviews. Six building blocks framework proposed by the World Health Organization was used for data collection and analyses. Results: In general physical infrastructure, especially the buildings were found to be reasonably constructed at most of the healthcare facilities. However, the maintenance was not regular. The vacancies for general doctors, specialist doctors, nurses, and paramedics were 26%, 38%, 31% and 12% respectively. Supply of drugs was irregular and inadequate. A large proportion (45% of ‘user charges’ were spent on purchase of drugs and other consumables. Most registers were found to be updated, and reports were transmitted to higher levels usually on time. However, institutionalized system of monitoring and supervision was lacking. Govt. hospitals were providing in-patient care to about 35.5% of those who were estimated to need hospitalization. State had allocated about Rs. 1200 crores to health (0.46% of GDP, thus, spending only Rs. 433 per capita per year. Conclusions: Despite constraints, the government health service is catering to the needs of a large section of the population. Rapid health system assessment at periodic intervals using a mixed method approach can supplement routine monitoring of the health system.

  3. An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

  4. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  5. Evaluation of pre-PCR processing approaches for enumeration of Salmonella enterica in naturally contaminated animal feed

    DEFF Research Database (Denmark)

    Schelin, Jenny; Andersson, Gunnar; Vigre, Håkan

    2014-01-01

    methods, using 2·5, 50 and 25 g of feed, respectively, resulting in detection of Salmonella in 6, 15 and 9 bags. Enumeration resulted in 1·8 × 102–7·8 × 103 CFU g−1 (flotation‐qPCR) and 0·024 to >5·2 MPN g−1 (MPN‐PCR). Except for differences in methodology, results obtained with the three techniques could...... be due to the presence of nonculturable Salmonella and/or a heterogeneous distribution of Salmonella in the material. The evaluated methods provide different possibilities to assess the prevalence of Salmonella in feed, together with the numbers of culturable, as well as nonculturable cells, and can...... be applied to generate data to allow more accurate quantitative microbial risk assessment for Salmonella in the feed chain....

  6. A new molecular approach based on qPCR for the quantification of fecal bacteria in contaminated marine sediments.

    Science.gov (United States)

    Luna, Gian Marco; Dell'Anno, Antonio; Pietrangeli, Biancamaria; Danovaro, Roberto

    2012-02-20

    Harbour sediments are periodically subjected to dredging operations and their management is mainly based on the assessment of the chemical contamination levels, but the potential risks posed by the presence of pathogenic microorganisms have been largely neglected. Here we first developed new molecular protocols based on the use of Real Time Quantitative PCR (qPCR), targeting both bacterial DNA and the transcription product (rRNA), for the identification and quantification of bacteria of fecal origin (Escherichia coli, Enterococcus spp. and Salmonella spp.) in contaminated harbour sediments. Then, we assessed the effects of bioremediation treatments, conventionally utilized for abating the hydrocarbon contamination in the sediment, on the abundance of fecal bacteria (FB). The qPCR technique was highly specific, sensitive and reproducible, and detected a number of fecal bacteria significantly higher than the classical cultivation techniques. Sediments subjected to bioremediation experiments by biostimulation with inorganic nutrients at different temperatures displayed a significant increase of the abundance of E. coli and Enterococcus spp. These findings suggest the risk of a potential increase of the contamination by pathogenic microorganisms of fecal origin during bioremediation and, as such, highlight the importance of careful monitoring this biological component in harbour sediments when subjected to bio-treatments. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Validation of a commercial insulated isothermal PCR-based POCKIT test for rapid and easy detection of white spot syndrome virus infection in Litopenaeus vannamei.

    Directory of Open Access Journals (Sweden)

    Yun-Long Tsai

    Full Text Available Timely pond-side detection of white spot syndrome virus (WSSV plays a critical role in the implementation of bio-security measures to help minimize economic losses caused by white spot syndrome disease, an important threat to shrimp aquaculture industry worldwide. A portable device, namely POCKIT™, became available recently to complete fluorescent probe-based insulated isothermal PCR (iiPCR, and automatic data detection and interpretation within one hour. Taking advantage of this platform, the IQ Plus™ WSSV Kit with POCKIT system was established to allow simple and easy WSSV detection for on-site users. The assay was first evaluated for its analytical sensitivity and specificity performance. The 95% limit of detection (LOD of the assay was 17 copies of WSSV genomic DNA per reaction (95% confidence interval [CI], 13 to 24 copies per reaction. The established assay has detection sensitivity similar to that of OIE-registered IQ2000™ WSSV Detection and Protection System with serial dilutions of WSSV-positive Litopenaeus vannamei DNA. No cross-reaction signals were generated from infectious hypodermal and haematopoietic necrosis virus (IHHNV, monodon baculovirus (MBV, and hepatopancreatic parvovirus (HPV positive samples. Accuracy analysis using 700 L. vannamei of known WSSV infection status shows that the established assayhassensitivity93.5% (95% CI: 90.61-95.56% and specificity 97% (95% CI: 94.31-98.50%. Furthermore, no discrepancy was found between the two assays when 100 random L. vannamei samples were tested in parallel. Finally, excellent correlation was observed among test results of three batches of reagents with 64 samples analyzed in three different laboratories. Working in a portable device, IQ Plus™ WSSV Kit with POCKIT system allows reliable, sensitive and specific on-site detection of WSSV in L. vannamei.

  8. Development of Dual TaqMan Based One-Step rRT-PCR Assay Panel for Rapid and Accurate Diagnostic Test of MERS-CoV: A Novel Human Coronavirus, Ahead of Hajj Pilgrimage.

    Science.gov (United States)

    Hashemzadeh, Mohammad Sadegh; Rasouli, Rahimeh; Zahraei, Bentolhoda; Izadi, Morteza; Tat, Mahdi; Saadat, Seyed Hassan; Najarasl, Mohammad; Khansari Nejad, Behzad; Dorostkar, Ruhollah

    2016-11-01

    Coronaviruses (CoVs) are large ribonucleic acid (RNA) viruses causing primarily respiratory disease in humans. A novel human coronavirus, subsequently named middle east respiratory syndrome coronavirus (MERS-CoV), was first reported in Saudi Arabia in September of 2012. With increasing numbers of infections and deaths from MERS-CoV, development of a rapid and reliable kit was crucial to prevent further spread of MERS-CoV. In this study, we present two real-time reverse-transcription polymerase chain reaction (rRT-PCR) assays for in-house rapid and sensitive diagnostic testing of MERS-CoV, detecting the regions upstream of the envelope gene (upE) and open reading frame (ORF) 1b, respectively, for initial screening and final confirmation of MERS-CoV infection, as recommended by the world health organization (WHO). In this experimental study, acquiring patient samples was difficult; thus, according to WHO recommendations and standard protocols, we synthesized RNA sequences of upE and ORF1b genes as the template signatures and TaqMan based-diagnostic rRT-PCR assays were carried out using these synthetic genes for detection of MERS-CoV. In this research, we also inaugurated a cell-free system to transcribe these RNA sequences using the DNA templates synthesized. The upE and ORF1b based one-step rRT-PCR assays were optimized by testing several times via different synthetic RNAs, and validation results were highly successful. The sensitivity obtained for upE was fewer than ten copies of RNA template per reaction and for ORF1b was 50 or fewer copies per reaction. This study showed that the developed rRT-PCR assays are rapid, reliable, reproducible, specific, sensitive, and simple tools for detection of MERS-CoV. Finally, a kit consisting of two assay signatures and controls was assembled, which can be distributed to public health laboratories in Iran to support international MERS-CoV surveillance and public health response.

  9. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    OpenAIRE

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction ...

  10. A proteomic approach for the rapid, multi-informative and reliable identification of blood.

    Science.gov (United States)

    Patel, E; Cicatiello, P; Deininger, L; Clench, M R; Marino, G; Giardina, P; Langenburg, G; West, A; Marshall, P; Sears, V; Francese, S

    2016-01-07

    Blood evidence is frequently encountered at the scene of violent crimes and can provide valuable intelligence in the forensic investigation of serious offences. Because many of the current enhancement methods used by crime scene investigators are presumptive, the visualisation of blood is not always reliable nor does it bear additional information. In the work presented here, two methods employing a shotgun bottom up proteomic approach for the detection of blood are reported; the developed protocols employ both an in solution digestion method and a recently proposed procedure involving immobilization of trypsin on hydrophobin Vmh2 coated MALDI sample plate. The methods are complementary as whilst one yields more identifiable proteins (as biomolecular signatures), the other is extremely rapid (5 minutes). Additionally, data demonstrate the opportunity to discriminate blood provenance even when two different blood sources are present in a mixture. This approach is also suitable for old bloodstains which had been previously chemically enhanced, as experiments conducted on a 9-year-old bloodstain deposited on a ceramic tile demonstrate.

  11. Validity of sound-proof approaches in rapidly-rotating compressible convection: marginal stability versus turbulence

    Science.gov (United States)

    Verhoeven, Jan; Glatzmaier, Gary A.

    2018-01-01

    The validity of the anelastic approximation has recently been questioned in the regime of rapidly-rotating compressible convection in low Prandtl number fluids (Calkins et al. 2015). Given the broad usage and the high computational efficiency of sound-proof approaches in this astrophysically relevant regime, this paper clarifies the conditions for a safe application. The potential of the alternative pseudo-incompressible approximation is investigated, which in contrast to the anelastic approximation is shown to never break down for predicting the point of marginal stability. Its accuracy, however, decreases close to the parameters corresponding to the failure of the anelastic approach, which is shown to occur when the sound-crossing time of the domain exceeds a rotation time scale, i.e. for rotational Mach numbers greater than one. Concerning the supercritical case, which is naturally characterised by smaller rotational Mach numbers, we find that the anelastic approximation does not show unphysical behaviour. Growth rates computed with the linearised anelastic equations converge toward the corresponding fully compressible values as the Rayleigh number increases. Likewise, our fully nonlinear turbulent simulations, produced with our fully compressible and anelastic models and carried out in a highly supercritical, rotating, compressible, low Prandtl number regime show good agreement. However, this nonlinear test example is for only a moderately low convective Rossby number of 0.14.

  12. Rapid and Simultaneous Detection of Mycobacterium tuberculosis Complex and Beijing/W Genotype in Sputum by an Optimized DNA Extraction Protocol and a Novel Multiplex Real-Time PCR

    Science.gov (United States)

    Leung, Eric T. Y.; Zheng, L.; Wong, Rity Y. K.; Chan, Edward W. C.; Au, T. K.; Chan, Raphael C. Y.; Lui, Grace; Lee, Nelson; Ip, Margaret

    2011-01-01

    Rapid diagnosis and genotyping of Mycobacterium tuberculosis by molecular methods are often limited by the amount and purity of DNA extracted from body fluids. In this study, we evaluated 12 DNA extraction methods and developed a highly sensitive protocol for mycobacterial DNA extraction directly from sputa using surface-coated magnetic particles. We have also developed a novel multiplex real-time PCR for simultaneous identification of M. tuberculosis complex and the Beijing/W genotype (a hypervirulent sublineage of M. tuberculosis) by using multiple fluorogenic probes targeting both the M. tuberculosis IS6110 and the Rv0927c-pstS3 intergenic region. With reference strains and clinical isolates, our real-time PCR accurately identified 20 non-Beijing/W and 20 Beijing/W M. tuberculosis strains from 17 different species of nontuberculosis Mycobacterium (NTM). Further assessment of our DNA extraction protocol and real-time PCR with 335 nonduplicate sputum specimens correctly identified all 74 M. tuberculosis culture-positive specimens. In addition, 15 culture-negative specimens from patients with confirmed tuberculosis were also identified. No cross-reactivity was detected with NTM specimens (n = 31). The detection limit of the assay is 10 M. tuberculosis bacilli, as determined by endpoint dilution analysis. In conclusion, an optimized DNA extraction protocol coupled with a novel multiprobe multiplex real-time PCR for the direct detection of M. tuberculosis, including Beijing/W M. tuberculosis, was found to confer high sensitivity and specificity. The combined procedure has the potential to compensate for the drawbacks of conventional mycobacterial culture in routine clinical laboratory setting, such as the lengthy incubation period and the limitation to viable organisms. PMID:21593264

  13. Rapid identification of methicillin-resistant Staphylococcus aureus transmission in hospitals by use of phage-derived open reading frame typing enhanced by multiplex PCR and reverse line blot assay.

    Science.gov (United States)

    O'Sullivan, Matthew V N; Kong, Fanrong; Sintchenko, Vitali; Gilbert, Gwendolyn L

    2010-08-01

    The relatively high-level clonality of methicillin-resistant Staphylococcus aureus (MRSA) and its frequent high-level endemicity in nosocomial settings complicate the development of methods for rapid subtyping of MRSA strains that are capable of identifying person-to-person transmission in hospitals. Phage-derived open reading frame (PDORF) typing is an MRSA typing method targeting mobile genetic elements that was recently described and evaluated using a geographically restricted set of isolates. The objective of this study was to develop a multiplex PCR-reverse line blot (mPCR/RLB) assay for PDORF typing and to test its applicability on a broad range of isolates and in an environment where MRSA is highly endemic. The 16 targets were identified using a 23-primer-pair mPCR/RLB assay with two probes for each target. The method was evaluated using 42 MRSA reference strains, including those representing major international clones, and 35 isolates from episodes of suspected nosocomial transmission. In vivo stability was explored using 81 isolate pairs. Pulsed-field gel electrophoresis (PFGE) and spa typing were performed for comparison. Among the 42 reference strains, there were 33 PFGE subtypes, 30 PDORF types, and 22 spa types. Simpson's index of diversity was 0.987, 0.971, and 0.926 for PFGE subtyping, PDORF typing, and spa typing, respectively. Typing of clinical isolates by PDORF typing and PFGE demonstrated concordant results. mPCR/RLB-based PDORF typing has similar discriminatory power to that of PFGE, can assist in tracking MRSA transmission events in a setting of high-level endemicity, and has the advantage of being a high-throughput technique.

  14. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida