WorldWideScience

Sample records for rapid pcr approach

  1. A rapid PCR-based approach for molecular identification of filamentous fungi.

    Science.gov (United States)

    Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-08-01

    In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

  2. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  3. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  4. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  5. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  6. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    International Nuclear Information System (INIS)

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  7. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  8. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

    Science.gov (United States)

    Smith, Cindy J; Osborn, A Mark

    2009-01-01

    Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

  9. A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

    Directory of Open Access Journals (Sweden)

    Grace Wong

    Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

  10. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  11. Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.

    Science.gov (United States)

    Weßling, Ralf; Panstruga, Ralph

    2012-08-31

    The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.

  12. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  13. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

  14. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  15. Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Kang Feng-feng

    2012-03-01

    Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

  16. Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

    Directory of Open Access Journals (Sweden)

    Touseef Hussain

    2018-05-01

    Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

  17. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  18. Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

    Science.gov (United States)

    Wan, Weijie; Yeow, John T W

    2012-04-01

    This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

  19. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  20. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  1. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  2. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  3. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  4. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  5. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  6. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  8. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  9. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    OpenAIRE

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

  10. A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

    Science.gov (United States)

    Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

    2011-02-01

    In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  12. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  13. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  14. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  15. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  16. Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

    Directory of Open Access Journals (Sweden)

    Ramadass P

    2002-01-01

    Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

  17. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  18. Rapid PCR amplification using a microfluidic device with integrated microwave heating and air impingement cooling.

    Science.gov (United States)

    Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2010-07-07

    A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.

  19. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  20. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  1. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  2. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    Science.gov (United States)

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  3. Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2009-01-01

    Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

  4. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  5. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

    Science.gov (United States)

    Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

    2011-09-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

  6. Evaluation of PCR electrospray-ionization mass spectrometry for rapid molecular diagnosis of bovine mastitis.

    Science.gov (United States)

    Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely

    2013-06-01

    Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

    Science.gov (United States)

    Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

    2017-05-01

    Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

  8. A rapid cycleave PCR method for distinguishing the vaccine strain Brucella abortus A19 in China.

    Science.gov (United States)

    Nan, Wenlong; Zhang, Yueyong; Tan, Pengfei; Xu, Zouliang; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2016-05-01

    Brucellosis is a widespread zoonotic disease caused by Brucella spp. Immunization with attenuated vaccines has proved to be an effective method of prevention; however, it may also interfere with diagnosis. Brucella abortus strain A19, which is homologous to B. abortus strain S19, is widely used for the prevention of bovine brucellosis in China. For effective monitoring of the control of brucellosis, it is essential to distinguish A19 from field strains. Single-nucleotide polymorphism-based assays offer a new approach to such discrimination studies. In the current study, we developed a cycleave PCR assay that successfully distinguished attenuated vaccine strains A19 and S19 from 22 strains of B. abortus and 57 strains of 5 other Brucella species. The assay gave a negative reaction with 4 non-Brucella species. The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 7.6 fg for the A19 strain and 220 fg for the single non-A19/non-S19 Brucella strain tested (B. abortus 104M). The assay was also reproducible (intra- and interassay coefficients of variation: 0.003-0.01 and 0.004-0.025, respectively). The cycleave assay gave an A19/S19-specific reaction in 3 out of 125 field serum samples, with the same 3 samples being positive in an alternative A19/S19-specific molecular assay. The cycleave assay gave a total of 102 Brucella-specific reactions (3 being the A19/S19-specific reactions), whereas an alternative Brucella-specific assay gave 92 positive reactions (all also positive in the cycleave assay). Therefore, this assay represents a simple, rapid, sensitive, and specific tool for use in brucellosis control. © 2016 The Author(s).

  9. A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

    Science.gov (United States)

    Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

    2000-01-01

    Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

  10. [Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].

    Science.gov (United States)

    Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi

    2009-11-01

    We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.

  11. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  12. Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases.

    Science.gov (United States)

    Rossetti, Lia; Giraffa, Giorgio

    2005-11-01

    About a thousand lactic acid bacteria (LAB) isolated from dairy products, especially cheeses, were identified and typed by species-specific PCR and RAPD-PCR, respectively. RAPD-PCR profiles, which were obtained by using the M13 sequence as a primer, allowed us to implement a large database of different fingerprints, which were analysed by BioNumerics software. Cluster analysis of the combined RAPD-PCR fingerprinting profiles enabled us to implement a library, which is a collection of library units, which in turn is a selection of representative database entries. A library unit, in this case, can be considered to be a definable taxon. The strains belonged to 11 main RAPD-PCR fingerprinting library units identified as Lactobacillus casei/paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus brevis, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus and Lactococcus lactis. The possibility to routinely identify newly typed, bacterial isolates by consulting the library of the software was valued. The proposed method could be suggested to refine previous strain identifications, eliminate redundancy and dispose of a technologically useful LAB strain collection. The same approach could also be applied to identify LAB strains isolated from other food ecosystems.

  13. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    Science.gov (United States)

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  14. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  15. Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

    Science.gov (United States)

    Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

    2010-04-01

    Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

  16. Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR

    Science.gov (United States)

    Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich

    2012-06-01

    To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.

  17. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  18. The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

    Science.gov (United States)

    Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

    2015-01-01

    Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

  19. The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

    Directory of Open Access Journals (Sweden)

    Michael S Bartsch

    Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

  20. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    Science.gov (United States)

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  1. Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

    Science.gov (United States)

    Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2015-07-01

    Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

  2. Development of a qPCR method to rapidly assess the function of NKT cells.

    Science.gov (United States)

    Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J

    2014-05-01

    NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  4. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  5. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  6. A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

    Science.gov (United States)

    Gallaher, Sean D.; Berk, Arnold J.

    2013-01-01

    Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

  7. Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

    Directory of Open Access Journals (Sweden)

    Hyoung Rai Ko

    2017-09-01

    Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

  8. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  9. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  10. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  11. [Development and evaluation of a rapid PCR detection kit for Ophiocordyceps sinensis].

    Science.gov (United States)

    Hou, Fei-Xia; Cao, Jing; Wang, Sha-Sha; Wang, Xi; Yuan, Yuan; Peng, Cheng; Wan, De-Guang; Guo, Jin-Lin

    2017-03-01

    Ophiocordyceps sinensis is a valuable traditional Chinese medicine. Due to resource shortage, expensive price and huge market demand, there are many adulterants of O. sinensis in markets. Therefore, it is necessary to establish a rapid and effective method for distinguishing O. sinensis. Based on the species-specific PCR of O. sinensis, this study developed a detection kit by optimizing the components and evaluated the specificity, detection limit, repeatability and shelf life of the kit. The results showed that when the quality of O. sinensis accounted for more than 1/200 of that mixture, it could be detected successfully. Moreover, only O. sinensis could be amplified and glowed bright green fluorescence under ultraviolet light. The kit was still in effect when it was placed at 37 ℃ for three days, which indicated that it was stable and effective for one year stored in 4 ℃. The kit in the same batch under different operation conditions, and in different batch under the same operation conditions gave the same result and accuracy, which showed good repeatability of the kit. It is simple, rapid and accurate to distinguish O. sinensis from its adulterants using the kit, and lays the foundation for commercialization of traditional Chinese medicine fast detection kit. Copyright© by the Chinese Pharmaceutical Association.

  12. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2013-01-01

    Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

  13. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Science.gov (United States)

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  14. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  15. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    African Journals Online (AJOL)

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  16. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  17. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  18. Rapid detection and strain typing of Chlamydia trachomatis using a highly multiplexed microfluidic PCR assay.

    Directory of Open Access Journals (Sweden)

    Rosemary S Turingan

    Full Text Available Nucleic acid amplification tests (NAATs are recommended by the CDC for detection of Chlamydia trachomatis (Ct urogenital infections. Current commercial NAATs require technical expertise and sophisticated laboratory infrastructure, are time-consuming and expensive, and do not differentiate the lymphogranuloma venereum (LGV strains that require a longer duration of treatment than non-LGV strains. The multiplexed microfluidic PCR-based assay presented in this work simultaneously interrogates 13 loci to detect Ct and identify LGV and non-LGV strain-types. Based on amplified fragment length polymorphisms, the assay differentiates LGV, ocular, urogenital, and proctocolitis clades, and also serovars L1, L2, and L3 within the LGV group. The assay was evaluated in a blinded fashion using 95 clinical swabs, with 76 previously reported as urogenital Ct-positive samples and typed by ompA genotyping and/or Multi-Locus Sequence Typing. Results of the 13-plex assay showed that 51 samples fell within urogenital clade 2 or 4, 24 samples showed both clade 2 and 4 signatures, indicating possible mixed infection, gene rearrangement, or inter-clade recombination, and one sample was a noninvasive trachoma biovar (either a clade 3 or 4. The remaining 19 blinded samples were correctly identified as LGV clade 1 (3, ocular clade 3 (4, or as negatives (12. To date, no NAAT assay can provide a point-of-care applicable turnaround time for Ct detection while identifying clinically significant Ct strain types to inform appropriate treatment. Coupled with rapid DNA processing of clinical swabs (approximately 60 minutes from swab-in to result-out, the assay has significant potential as a rapid POC diagnostic for Ct infections.

  19. Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests

    Science.gov (United States)

    Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.

    1999-01-01

    Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815

  20. PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

    Science.gov (United States)

    Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

    2007-01-01

    PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

  1. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  2. Quantitative PCR high-resolution melting (qPCR-HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: application to MLH1 germline mutations in Lynch syndrome.

    Science.gov (United States)

    Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette

    2009-06-01

    Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.

  3. A one-step, real-time PCR assay for rapid detection of rhinovirus.

    Science.gov (United States)

    Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

  4. Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

    Science.gov (United States)

    Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

    2006-01-01

    Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

  5. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...

  6. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  7. A Systems Approach to Rapid School Improvement

    Science.gov (United States)

    McCauley, Carlas

    2018-01-01

    To support systemic thinking about school improvement, the Center on School Turnaround at WestEd developed a framework to assist states, districts, and schools in leading and managing rapid improvement efforts. The framework, which is presented in this article, has four domains that have proved central to rapid, significant improvement: (1)…

  8. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  9. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  10. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  11. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  12. Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

    Science.gov (United States)

    Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

    2015-07-07

    Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

  13. PCR-based Approaches for the Detection of Clinical Methicillin-resistant Staphylococcus aureus

    Science.gov (United States)

    Liu, Ying; Zhang, Jiang; Ji, Yinduo

    2016-01-01

    Staphylococcus aureus is an important pathogen that can cause a variety of infections, including superficial and systematic infections, in humans and animals. The persistent emergence of multidrug resistant S. aureus, particularly methicillin-resistant S. aureus, has caused dramatically economic burden and concerns in the public health due to limited options of treatment of MRSA infections. In order to make a correct choice of treatment for physicians and understand the prevalence of MRSA, it is extremely critical to precisely and timely diagnose the pathogen that induces a specific infection of patients and to reveal the antibiotic resistant profile of the pathogen. In this review, we outlined different PCR-based approaches that have been successfully utilized for the rapid detection of S. aureus, including MRSA and MSSA, directly from various clinical specimens. The sensitivity and specificity of detections were pointed out. Both advantages and disadvantages of listed approaches were discussed. Importantly, an alternative approach is necessary to further confirm the detection results from the molecular diagnostic assays. PMID:27335617

  14. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  15. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    OpenAIRE

    Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

    2014-01-01

    Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...

  16. The use of newly developed real-time PCR for the rapid identification of bacteria in culture-negative osteomyelitis.

    Science.gov (United States)

    Kobayashi, Naomi; Bauer, Thomas W; Sakai, Hiroshige; Togawa, Daisuke; Lieberman, Isador H; Fujishiro, Takaaki; Procop, Gary W

    2006-12-01

    We report a case of a culture-negative osteomyelitis in which our newly developed real-time polymerase chain reaction (PCR) could differentiate Staphylococcus aureus from Staphylococcus epidermidis. This is the first report that described the application of this novel assay to an orthopedics clinical sample. This assay may be useful for other clinical culture-negative cases in a combination with a broad-spectrum assay as a rapid microorganism identification method.

  17. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  18. Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

    Science.gov (United States)

    Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

    2018-03-16

    Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

  19. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  20. A dual PCR-based sequencing approach for the identification and discrimination of Echinococcus and Taenia taxa.

    Science.gov (United States)

    Boubaker, Ghalia; Marinova, Irina; Gori, Francesca; Hizem, Amani; Müller, Norbert; Casulli, Adriano; Jerez Puebla, Luis Enrique; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2016-08-01

    Reliable and rapid molecular tools for the genetic identification and differentiation of Echinococcus species and/or genotypes are crucial for studying spatial and temporal transmission dynamics. Here, we describe a novel dual PCR targeting regions in the small (rrnS) and large (rrnL) subunits of mitochondrial ribosomal RNA (rRNA) genes, which enables (i) the specific identification of species and genotypes of Echinococcus (rrnS + L-PCR) and/or (ii) the identification of a range of taeniid cestodes, including different species of Echinococcus, Taenia and some others (17 species of diphyllidean helminths). This dual PCR approach was highly sensitive, with an analytical detection limit of 1 pg for genomic DNA of Echinococcus. Using concatenated sequence data derived from the two gene markers (1225 bp), we identified five unique and geographically informative single nucleotide polymorphisms (SNPs) that allowed genotypes (G1 and G3) of Echinococcus granulosus sensu stricto to be distinguished, and 25 SNPs that allowed differentiation within Echinococcus canadensis (G6/7/8/10). In conclusion, we propose that this dual PCR-based sequencing approach can be used for molecular epidemiological studies of Echinococcus and other taeniid cestodes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  2. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  3. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  4. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Science.gov (United States)

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  6. PCR-RFLP on β-tubulin gene for rapid identification of the most clinically important species of Aspergillus.

    Science.gov (United States)

    Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba

    2015-10-01

    Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

    Science.gov (United States)

    von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

    2018-05-01

    Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

    Science.gov (United States)

    Hanabara, Yutaro; Ueda, Yutaka

    2016-11-22

    A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

  9. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

    Directory of Open Access Journals (Sweden)

    Ma Mingxiao

    Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

  10. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  11. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  13. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

    OpenAIRE

    Luo, Guizhen; Mitchell, Thomas G.

    2002-01-01

    A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

  14. Rapid PCR Detection of Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum

    OpenAIRE

    Scott A. Cunningham; Jayawant N. Mandrekar; Jon E. Rosenblatt; Robin Patel

    2013-01-01

    Objective. We compared laboratory developed real-time PCR assays for detection of Mycoplasma hominis and for detection and differentiation of Ureaplasma urealyticum and parvum to culture using genitourinary specimens submitted for M. hominis and Ureaplasma culture. Methods. 283 genitourinary specimens received in the clinical bacteriology laboratory for M. hominis and Ureaplasma species culture were evaluated. Nucleic acids were extracted using the Total Nucleic Acid Kit on the MagNA Pure 2.0...

  15. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    ) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

  16. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Directory of Open Access Journals (Sweden)

    Henrich Birgit

    2008-04-01

    Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

  17. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Science.gov (United States)

    Schaeffer, Anke; Henrich, Birgit

    2008-01-01

    Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

  18. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  19. Comparison of Enzymatic Method Rapid Yeast Plus System with RFLP-PCR for Identification of Isolated Yeast from Vulvovaginal Candidiasis.

    Science.gov (United States)

    Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura

    2011-09-01

    To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.

  20. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....

  1. Rapid detection of Lactobacillus kefiranofaciens in kefir grain and kefir milk using newly developed real-time PCR.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kim, Hong-Seok; Yim, Jin-Hyeok; Kim, Hyunsook; Seo, Kun-Ho

    2015-04-01

    Lactobacillus kefiranofaciens is an indicator microorganism for kefir and a key factor in kefir grain formation and kefiran production. We designed a novel real-time PCR primer and probe set, LKF_KU504, for the rapid detection of L. kefiranofaciens. In inclusivity and exclusivity tests, only 14 L. kefiranofaciens strains were positive among 61 microorganisms, indicating 100 % sensitivity and specificity. The LKF_KU504 set also differentiated kefir milk from 30 commercial nonkefir yogurts. The levels of L. kefiranofaciens in kefir grain and kefir milk were significantly different, indicating L. kefiranofaciens was more concentrated in kefir grain than in kefir milk.

  2. A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

    Science.gov (United States)

    Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

    2003-01-01

    Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

  3. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  4. Rapid and Accurate Identification by Real-Time PCR of Biotoxin-Producing Dinoflagellates from the Family Gymnodiniaceae

    Directory of Open Access Journals (Sweden)

    Kirsty F. Smith

    2014-03-01

    Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  5. Rapid and accurate identification by real-time PCR of biotoxin-producing dinoflagellates from the family gymnodiniaceae.

    Science.gov (United States)

    Smith, Kirsty F; de Salas, Miguel; Adamson, Janet; Rhodes, Lesley L

    2014-03-07

    The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR) assays targeting the large subunit ribosomal RNA (LSU rRNA) gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  6. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  7. Rapid detection of human parechoviruses in clinical samples by real-time PCR

    NARCIS (Netherlands)

    Benschop, Kimberley; Molenkamp, Richard; van der Ham, Alwin; Wolthers, Katja; Beld, Marcel

    2008-01-01

    BACKGROUND: Human parechoviruses (HPeVs) have been associated with severe conditions such as neonatal sepsis and meningitis in young children. Rapid identification of an infectious agent in such serious conditions in these patients is essential for adequate decision making regarding treatment and

  8. Development and validation of real-time PCR for rapid detection of Mecistocirrus digitatus.

    Directory of Open Access Journals (Sweden)

    Subhra Subhadra

    Full Text Available Hematophagous activity of Mecistocirrus digitatus, which causes substantial blood and weight loss in large ruminants, is an emerging challenge due to the economic loss it brings to the livestock industry. Infected animals are treated with anthelmintic drugs, based on the identification of helminth species and the severity of infection; however, traditional methods such as microscopic identification and the counting of eggs for diagnosis and determination of level of infection are laborious, cumbersome and unreliable. To facilitate the detection of this parasite, a SYBR green-based real-time PCR was standardized and validated for the detection of M. digitatus infection in cattle and buffaloes. Oligonucleotides were designed to amplify partial Internal Transcribed Spacer (ITS-1 sequence of M. digitatus. The specificity of the primers was confirmed by non-amplification of DNA extracted from other commonly occurring gastrointestinal nematodes in ruminants. Plasmids were ligated with partial ITS-1 sequence of M. digitatus, serially diluted (hundred fold and used as standards in the real-time PCR assay. The quantification cycle (Cq values were plotted against the standard DNA concentration to produce a standard curve. The assay was sensitive enough to detect one plasmid containing the M. digitatus DNA. Clinical application of this assay was validated by testing the DNA extracted from the faeces of naturally infected cattle (n = 40 and buffaloes (n = 25. The results were compared with our standard curve to calculate the quantity of M. digitatus in each faecal sample. The Cq value of the assay depicted a strong linear relationship with faecal DNA content, with a regression coefficient of 0.984 and efficiency of 99%. This assay has noteworthy advantages over the conventional methods of diagnosis because it is more specific, sensitive and reliable.

  9. Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.

    Directory of Open Access Journals (Sweden)

    Lutz E Lehmann

    2011-02-01

    Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.

  10. PCR-based verification of positive rapid diagnostic tests for intestinal protozoa infections with variable test band intensity.

    Science.gov (United States)

    Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg

    2017-10-01

    Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

    OpenAIRE

    Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

    2011-01-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real...

  12. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  14. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

    Science.gov (United States)

    Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

    2017-01-01

    In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

  16. Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

    Directory of Open Access Journals (Sweden)

    Jiashun Wang

    Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

  17. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    Science.gov (United States)

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  18. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  19. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD......) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...

  20. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer......A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD...

  1. Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

    Science.gov (United States)

    Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

    2017-10-27

    Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  3. Rapid and sensitive detection of Pseudomonas aeruginosa in chlorinated water and aerosols targeting gyrB gene using real-time PCR.

    Science.gov (United States)

    Lee, C S; Wetzel, K; Buckley, T; Wozniak, D; Lee, J

    2011-10-01

    For the rapid detection of Pseudomonas aeruginosa from chlorinated water and aerosols, gyrB gene-based real-time PCR assay was developed and investigated. Two novel primer sets (pa722F/746MGB/899R and pa722F/746MGB/788R) were designed using the most updated 611 Pseudomonas and 748 other bacterial gyrB genes for achieving high specificity. Their specificity showed 100% accuracy when tested with various strains including clinical isolates from cystic fibrosis patients. The assay was tested with Ps. aeruginosa-containing chlorinated water and aerosols to simulate the waterborne and airborne transmission routes (detection limit 3·3 × 10² CFU per PCR-2·3 × 10³ CFU per PCR). No chlorine interference in real-time PCR was observed at drinking water level (c. 1 mg l⁻¹), but high level of chorine (12 mg l⁻¹) interfered the assay, and thus neutralization was needed. Pseudomonas aeruginosa in aerosol was successfully detected after capturing with gelatin filters with minimum 2 min of sampling time when the initial concentration of 10⁴ CFU ml⁻¹ bacteria existed in the nebulizer. A highly specific and rapid assay (2-3 h) was developed by targeting gyrB gene for the detection of Ps. aeruginosa in chlorinated water and aerosols, combined with optimized sample collection methods and sample processing, so the direct DNA extraction from either water or aerosol was possible while achieving the desired sensitivity of the method.   The new assay can provide timely and accurate risk assessment to prevent Ps. aeruginosa exposure from water and aerosol, resulting in reduced disease burden, especially among immune-compromised and susceptible individuals. This approach can be easily utilized as a platform technology for the detection of other types of micro-organisms, especially for those that are transmitted via water and aerosol routes, such as Legionella pneumophila. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  4. Rapid detection and differentiation of Clonorchis sinensis and Opisthorchis viverrini using real-time PCR and high resolution melting analysis.

    Science.gov (United States)

    Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

    2014-01-01

    Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  5. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    Directory of Open Access Journals (Sweden)

    Xian-Quan Cai

    2014-01-01

    Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  6. Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit

    Science.gov (United States)

    Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu

    2017-01-01

    Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107

  7. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  8. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  9. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  10. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  11. Rapid detox: understanding new treatment approaches for the addicted patient.

    Science.gov (United States)

    McCabe, S

    2000-01-01

    Despite substantive advances in understanding of genetic and biochemical basis of substance abuse and addiction in the last decade, little information has been translated into alternative treatment models for the addicted patient. Rapid detox, an alternative form of detox treatment, is gaining in both acceptance and popularity. To increase readers' understanding of the neurobiology of addiction and the mode of action of new detox approaches for patients addicted to opiate drugs. A review of the current literature pertaining to rapid detox. Rapid detox is a viable alternative for selected patients attempting to detox from opiate agents of abuse. Increasing knowledge of new treatment approaches allows nurses working to assist addicted patients in planning and receiving treatment based on new awareness of the neurobiology of addiction.

  12. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  13. A novel approach for rapid micropropagation of maspine pineapple ...

    African Journals Online (AJOL)

    A novel approach for rapid micropropagation of maspine pineapple ( Ananas comosus L.) shoots using liquid shake culture system. ... Maspine (Ananas comosus L.) is currently the most preferred pineapple variety in Malaysia due to its pleasant aroma and applicability in caning. Large quantities of plant materials are ...

  14. Rapid and Specific Detection of Acidovorax avenae subsp. citrulli Using SYBR Green-Based Real-Time PCR Amplification of the YD-Repeat Protein Gene.

    Science.gov (United States)

    Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk

    2015-09-01

    The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.

  15. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Science.gov (United States)

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Rapid and sensitive detection of cytokines using functionalized gold nanoparticle-based immuno-PCR, comparison with immuno-PCR and ELISA

    Czech Academy of Sciences Publication Activity Database

    Potůčková, Lucie; Franko, Filip; Bambousková, Monika; Dráber, Petr

    2011-01-01

    Roč. 371, 1-2 (2011), s. 38-47 ISSN 0022-1759 R&D Projects: GA AV ČR KAN200520701; GA MŠk 1M0506; GA MŠk LC545; GA ČR GA301/09/1826; GA ČR GAP302/10/1759; GA ČR(CZ) GD204/05/H023 Grant - others:AV ČR(CZ) M200520901 Institutional research plan: CEZ:AV0Z50520514 Keywords : immuno-PCR * nano-iPCR * nanogold particles Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.203, year: 2011

  17. Rapid real-time PCR assay for culture and tissue identification of Geomyces destructans: the etiologic agent of bat geomycosis (white nose syndrome).

    Science.gov (United States)

    Chaturvedi, Sudha; Rudd, Robert J; Davis, April; Victor, Tanya R; Li, Xiaojiang; Appler, Kim A; Rajkumar, Sunanda S; Chaturvedi, Vishnu

    2011-10-01

    Geomyces destructans is the etiologic agent of bat geomycosis, commonly referred to as white nose syndrome (WNS). This infection has caused severe morbidity and mortality in little brown bats (Myotis lucifugus) and has also spread to other bat species with significant decline in the populations. Currently, G. destructans infection is identified by culture, ITS-PCR, and histopathology. We hypothesized that a real-time PCR assay would considerably improve detection of G. destructans in bats. The 100 bp sequence of the Alpha-L-Rhamnosidase gene was validated as a target for real-time PCR. The assay sensitivity was determined from serial dilution of DNA extracted from G. destructans conidia (5 × 10(-1)-5 × 10(7)), and the specificity was tested using DNA from 30 closely and distantly related fungi and 5 common bacterial pathogens. The real-time PCR assay was highly sensitive with detection limit of two G. destructans conidia per reaction at 40 PCR cycles. The assay was also highly specific as none of the other fungal or bacterial DNA cross-reacted in the real-time PCR assay. One hundred and forty-seven bat tissue samples, suspected of infection with G. destructans, were used to compare the real-time PCR assay to other methods employed for the detection of G. destructans. Real-time PCR was highly sensitive with 80 of 147 (55%) samples testing positive for G. destructans DNA. In comparison, histopathology examination revealed 64/147 (44%) positive samples. The internal transcribed spacer (ITS)-PCR yielded positive amplicon for G. destructans from 37 tissue samples (25%). The least sensitive assay was the fungal culture with only 17 tissue samples (12%) yielding G. destructans in culture. The data suggested that the real-time PCR assay is highly promising for rapid, sensitive, and specific identification of G. destructans. Further trials and inter-laboratory comparisons of this novel assay are recommended to improve the diagnosis of bat geomycosis.

  18. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  19. New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

    Science.gov (United States)

    Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

    2001-01-01

    Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

  20. A Practical Approach to Rapid Prototyping of SCA Waveforms

    OpenAIRE

    DePriest, Jacob Andrew

    2006-01-01

    With the growing interest in software defined radios (SDRs), cognitive radios, the Joint Tactical Radio System (JTRS), and the Software Communication Architecture (SCA) comes the need for a rapid prototyping approach to radio design. In the past, radios have traditionally been designed to have a static implementation with the express goal of implementing a specific type of communication, such as 802.11b, CDMA voice communication, or just a simple FM tuner. However, when designing an ...

  1. Comparison of false-negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture.

    Science.gov (United States)

    Hutchison, J R; Piepel, G F; Amidan, B G; Hess, B M; Sydor, M A; Deatherage Kaiser, B L

    2018-05-01

    We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials and assay methods on false-negative rate (FNR) and limit of detection (LOD 95 ) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2-500 per coupon) onto glass, stainless steel, vinyl tile and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD 95 results. Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD 95 was lowest for glass and highest for vinyl tile. LOD 95 values overall were lower for mRV-PCR than for the culture method. This study adds to the limited data on FNR and LOD 95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis. © 2018 The Society for Applied Microbiology.

  2. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  3. Exploring viral reservoir: The combining approach of cell sorting and droplet digital PCR.

    Science.gov (United States)

    Gibellini, Lara; Pecorini, Simone; De Biasi, Sara; Pinti, Marcello; Bianchini, Elena; De Gaetano, Anna; Digaetano, Margherita; Pullano, Rosalberta; Lo Tartaro, Domenico; Iannone, Anna; Mussini, Cristina; Cossarizza, Andrea; Nasi, Milena

    2018-02-01

    Combined antiretroviral therapy (cART) blocks different steps of HIV replication and maintains plasma viral RNA at undetectable levels. The virus can remain in long-living cells and create a reservoir where HIV can restart replicating after cART discontinuation. A persistent viral production triggers and maintains a persistent immune activation, which is a well-known feature of chronic HIV infection, and contributes either to precocious aging, or to the increased incidence of morbidity and mortality of HIV positive patients. The new frontier of the treatment of HIV infection is nowadays eradication of the virus from all host cells and tissues. For this reason, it is crucial to have a clear and precise idea of where the virus hides, and which are the cells that keep it silent. Important efforts have been made to improve the detection of viral reservoirs, and new techniques are now giving the opportunity to characterize viral reservoirs. Among these techniques, a strategic approach based upon cell sorting and droplet digital PCR (ddPCR) is opening new horizons and opportunities of research. This review provides an overview of the methods that combine cell sorting and ddPCR for the quantification of HIV DNA in different cell types, and for the detection of its maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  5. Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

    OpenAIRE

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DN...

  6. Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

    Science.gov (United States)

    Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

    2010-07-01

    To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  7. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    Science.gov (United States)

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  9. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  10. Reduction of the use of antimicrobial drugs following the rapid detection of Streptococcus agalactiae in the vagina at delivery by real-time PCR assay.

    Science.gov (United States)

    Poncelet-Jasserand, E; Forges, F; Varlet, M-N; Chauleur, C; Seffert, P; Siani, C; Pozzetto, B; Ros, A

    2013-08-01

    To assess whether the determination of the presence of group B streptococci (GBS) in the vagina using a rapid polymerase chain reaction (PCR) assay at delivery was able to spare useless antimicrobial treatments, as compared with conventional culture at 34-38 weeks of gestation. Practical evaluation and prospective cost-effectiveness analysis. A university hospital in France. A cohort of 225 women in labour at the University-Hospital of Saint-Etienne. Each woman had a conventional culture performed at 34-38 weeks of gestation. At the beginning of labour, two vaginal swabs were sampled for rapid PCR testing and culture. The decision to prescribe a prophylactic antimicrobial treatment or not was taken according to the result of the PCR test. A comparative cost-effectiveness analysis of the two diagnostic strategies was carried out. Number of women receiving inadequate prophylactic antimicrobial drugs following each testing strategy, costs of PCR testing and culture, frequency of vaginal GBS, and diagnostic performance of the PCR test at delivery. The percentage of unnecessarily treated women was significantly reduced using the rapid test versus conventional culture (4.5 and 13.6%, respectively; P < 0.001). The rate of vaginal GBS at delivery was 12.5%. The incremental cost-effectiveness ratio (ICER) for each inadequate management avoided was €36 and €173 from the point of view of the healthcare system and hospital, respectively. The PCR assay reduced the number of inadequate antimicrobial treatments aimed to prevent the early onset of GBS disease. However, this strategy generates extra costs that must be put into balance with its clinical benefits. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.

  11. A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    Directory of Open Access Journals (Sweden)

    Lingxiang Zhu

    Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  12. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

    Science.gov (United States)

    Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

    2018-03-01

    Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  14. Rapid Discrimination between Candida glabrata, Candida nivariensis, and Candida bracarensis by Use of a Singleplex PCR

    OpenAIRE

    Enache-Angoulvant, A.; Guitard, J.; Grenouillet, F.; Martin, T.; Durrens, P.; Fairhead, C.; Hennequin, C.

    2011-01-01

    We report here a PCR-based assay using a single primer pair targeting the RPL31 gene that allows discrimination between Candida glabrata, Candida bracarensis, and Candida nivariensis according to the size of the generated amplicon.

  15. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Science.gov (United States)

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. PCR-based approach to SINE isolation: simple and complex SINEs.

    Science.gov (United States)

    Borodulina, Olga R; Kramerov, Dmitri A

    2005-04-11

    Highly repeated copies of short interspersed elements (SINEs) occur in eukaryotic genomes. The distribution of each SINE family is usually restricted to some genera, families, or orders. SINEs have an RNA polymerase III internal promoter, which is composed of boxes A and B. Here we propose a method for isolation of novel SINE families based on genomic DNA PCR with oligonucleotide identical to box A as a primer. Cloning of the size-heterogeneous PCR-products and sequencing of their terminal regions allow determination of SINE structure. Using this approach, two novel SINE families, Rhin-1 and Das-1, from the genomes of great horseshoe bat (Rhinolophus ferrumequinum) and nine-banded armadillo (Dasypus novemcinctus), respectively, were isolated and studied. The distribution of Rhin-1 is restricted to two of six bat families tested. Copies of this SINE are characterized by frequent internal insertions and significant length (200-270 bp). Das-1 being only 90 bp in length is one of the shortest SINEs known. Most of Das-1 nucleotide sequences demonstrate significant similarity to alanine tRNA which appears to be an evolutionary progenitor of this SINE. Together with three other known SINEs (ID, Vic-1, and CYN), Das-1 constitutes a group of simple SINEs. Interestingly, three SINE families of this group are alanine tRNA-derived. Most probably, this tRNA gave rise to short and simple but successful SINEs several times during mammalian evolution.

  17. Rapid detection of enterovirus in cerebrospinal fluid by a fully-automated PCR assay is associated with improved management of aseptic meningitis in adult patients.

    Science.gov (United States)

    Giulieri, Stefano G; Chapuis-Taillard, Caroline; Manuel, Oriol; Hugli, Olivier; Pinget, Christophe; Wasserfallen, Jean-Blaise; Sahli, Roland; Jaton, Katia; Marchetti, Oscar; Meylan, Pascal

    2015-01-01

    Enterovirus (EV) is the most frequent cause of aseptic meningitis (AM). Lack of microbiological documentation results in unnecessary antimicrobial therapy and hospitalization. To assess the impact of rapid EV detection in cerebrospinal fluid (CSF) by a fully-automated PCR (GeneXpert EV assay, GXEA) on the management of AM. Observational study in adult patients with AM. Three groups were analyzed according to EV documentation in CSF: group A = no PCR or negative PCR (n=17), group B = positive real-time PCR (n = 20), and group C = positive GXEA (n = 22). Clinical, laboratory and health-care costs data were compared. Clinical characteristics were similar in the 3 groups. Median turn-around time of EV PCR decreased from 60 h (IQR (interquartile range) 44-87) in group B to 5h (IQR 4-11) in group C (p<0.0001). Median duration of antibiotics was 1 (IQR 0-6), 1 (0-1.9), and 0.5 days (single dose) in groups A, B, and C, respectively (p < 0.001). Median length of hospitalization was 4 days (2.5-7.5), 2 (1-3.7), and 0.5 (0.3-0.7), respectively (p < 0.001). Median hospitalization costs were $5458 (2676-6274) in group A, $2796 (2062-5726) in group B, and $921 (765-1230) in group C (p < 0.0001). Rapid EV detection in CSF by a fully-automated PCR improves management of AM by significantly reducing antibiotic use, hospitalization length and costs. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  19. PCR amplification of repetitive sequences as a possible approach in relative species quantification

    DEFF Research Database (Denmark)

    Ballin, Nicolai Zederkopff; Vogensen, Finn Kvist; Karlsson, Anders H

    2012-01-01

    Abstract Both relative and absolute quantifications are possible in species quantification when single copy genomic DNA is used. However, amplification of single copy genomic DNA does not allow a limit of detection as low as one obtained from amplification of repetitive sequences. Amplification...... of repetitive sequences is therefore frequently used in absolute quantification but problems occur in relative quantification as the number of repetitive sequences is unknown. A promising approach was developed where data from amplification of repetitive sequences were used in relative quantification of species...... to relatively quantify the amount of chicken DNA in a binary mixture of chicken DNA and pig DNA. However, the designed PCR primers lack the specificity required for regulatory species control....

  20. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

    OpenAIRE

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-01-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  1. Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

    Directory of Open Access Journals (Sweden)

    Da-Sheng Lee

    2010-01-01

    Full Text Available Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

  2. Stochastic Approaches Within a High Resolution Rapid Refresh Ensemble

    Science.gov (United States)

    Jankov, I.

    2017-12-01

    It is well known that global and regional numerical weather prediction (NWP) ensemble systems are under-dispersive, producing unreliable and overconfident ensemble forecasts. Typical approaches to alleviate this problem include the use of multiple dynamic cores, multiple physics suite configurations, or a combination of the two. While these approaches may produce desirable results, they have practical and theoretical deficiencies and are more difficult and costly to maintain. An active area of research that promotes a more unified and sustainable system is the use of stochastic physics. Stochastic approaches include Stochastic Parameter Perturbations (SPP), Stochastic Kinetic Energy Backscatter (SKEB), and Stochastic Perturbation of Physics Tendencies (SPPT). The focus of this study is to assess model performance within a convection-permitting ensemble at 3-km grid spacing across the Contiguous United States (CONUS) using a variety of stochastic approaches. A single physics suite configuration based on the operational High-Resolution Rapid Refresh (HRRR) model was utilized and ensemble members produced by employing stochastic methods. Parameter perturbations (using SPP) for select fields were employed in the Rapid Update Cycle (RUC) land surface model (LSM) and Mellor-Yamada-Nakanishi-Niino (MYNN) Planetary Boundary Layer (PBL) schemes. Within MYNN, SPP was applied to sub-grid cloud fraction, mixing length, roughness length, mass fluxes and Prandtl number. In the RUC LSM, SPP was applied to hydraulic conductivity and tested perturbing soil moisture at initial time. First iterative testing was conducted to assess the initial performance of several configuration settings (e.g. variety of spatial and temporal de-correlation lengths). Upon selection of the most promising candidate configurations using SPP, a 10-day time period was run and more robust statistics were gathered. SKEB and SPPT were included in additional retrospective tests to assess the impact of using

  3. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  4. Phenylketonuria mutation analysis in Northern Ireland: A rapid stepwise approach

    Energy Technology Data Exchange (ETDEWEB)

    Zschocke, J.; Graham, C.A.; Nevin, N.C. [Queen`s Univ., Belfast (Australia)] [and others

    1995-12-01

    We present a multistep approach for the rapid analysis of phenylketonuria (PKU) mutations. In the first step, three common mutations and a polymorphic short tandem repeat (STR) system are rapidly analyzed with a fluorescent multiplex assay. In the second step, minihaplotypes combining STR and VNTR data are used to determine rare mutations likely to be present in an investigated patient, which are then confirmed by restriction enzyme analysis. The remaining mutations are analyzed with denaturant gradient-gel electrophoresis and sequencing. The first two steps together identify both mutations in 90%-95% of PKU patients, and results can be obtained within 2 d. We have investigated 121 Northern Irish families with hyperphenylalaninemia, including virtually all patients born since 1972, and have found 34 different mutations on 241 of the 242 mutant alleles. Three mutations (R408W, 165T, and F39L) account for 57.5% of mutations, while 14 mutations occur with a frequency of 1%-6%. The present analysis system is efficient and inexpensive and is particularly well suited to routine mutation analysis in a diagnostic setting. 19 refs., 5 tabs.

  5. Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

    Science.gov (United States)

    Schoener, E R; Hunter, S; Howe, L

    2017-07-01

    Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

  6. Quantitative real-time PCR approaches for microbial community studies in wastewater treatment systems: applications and considerations.

    Science.gov (United States)

    Kim, Jaai; Lim, Juntaek; Lee, Changsoo

    2013-12-01

    Quantitative real-time PCR (qPCR) has been widely used in recent environmental microbial ecology studies as a tool for detecting and quantifying microorganisms of interest, which aids in better understandings of the complexity of wastewater microbial communities. Although qPCR can be used to provide more specific and accurate quantification than other molecular techniques, it does have limitations that must be considered when applying it in practice. This article reviews the principle of qPCR quantification and its applications to microbial ecology studies in various wastewater treatment environments. Here we also address several limitations of qPCR-based approaches that can affect the validity of quantification data: template nucleic acid quality, nucleic acid extraction efficiency, specificity of group-specific primers and probes, amplification of nonviable DNA, gene copy number variation, and limited number of sequences in the database. Even with such limitations, qPCR is reportedly among the best methods for quantitatively investigating environmental microbial communities. The application of qPCR is and will continue to be increasingly common in studies of wastewater treatment systems. To obtain reliable analyses, however, the limitations that have often been overlooked must be carefully considered when interpreting the results. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Science.gov (United States)

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  8. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  9. Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

    International Nuclear Information System (INIS)

    Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

    2005-01-01

    The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

  10. A rapid real-time PCR method to differentiate between mottled skate (Beringraja pulchra) and other skate and ray species.

    Science.gov (United States)

    Kim, Mi-Ra; Kwon, Kisung; Jung, Yoo-Kyung; Kang, Tae Sun

    2018-07-30

    Skates and rays are commercially important fish in South Korea, and among them, Beringraja pulchra has the highest economic value. However, the similar morphological traits among skates and rays are often exploited for seafood fraud. Here, we designed both Beringraja pulchra-specific and skate-universal primer sets, capable of detecting short sequences in the cytochrome oxidase subunit I gene, and developed highly sensitive and reliable quantitative real-time PCR (qPCR) assays to differentiate between Beringraja pulchra and other skate and ray species. AΔCq method based on differences in the amplification efficiency was developed, validated, and then used to confirm the presence of Beringraja pulchra in twenty-six commercial skate products. The averageΔCq value obtained for other skate species (18.94 ± 3.46) was significantly higher than that of Beringraja pulchra (1.18 ± 0.15). For on-site applications, we developed an ultra-fast qPCR assay, allowing for completion of the entire analytical procedure within 30 min. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Development of a quantitative PCR assay for rapid detection of Lactobacillus plantarum and Lactobacillus fermentum in cocoa bean fermentation.

    Science.gov (United States)

    Schwendimann, Livia; Kauf, Peter; Fieseler, Lars; Gantenbein-Demarchi, Corinne; Miescher Schwenninger, Susanne

    2015-08-01

    To monitor dominant species of lactic acid bacteria during cocoa bean fermentation, i.e. Lactobacillus plantarum and Lactobacillus fermentum, a fast and reliable culture-independent qPCR assay was developed. A modified DNA isolation procedure using a commercial kit followed by two species-specific qPCR assays resulted in 100% sensitivity for L. plantarum and L. fermentum. Kruskal-Wallis and post-hoc analyses of data obtained from experiments with cocoa beans that were artificially spiked with decimal concentrations of L. plantarum and L. fermentum strains allowed the calculation of a regression line suitable for the estimation of both species with a detection limit of 3 to 4 Log cells/g cocoa beans. This process was successfully tested for efficacy through the analyses of samples from laboratory-scale cocoa bean fermentations with both the qPCR assay and a culture-dependent method which resulted in comparable results. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

    DEFF Research Database (Denmark)

    Mahende, Coline; Ngasala, Billy; Lusingu, John

    2016-01-01

    with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. Results: A total of 867 febrile patients......Background: Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity...... of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. Methods: The study enrolled children aged 2-59 months...

  13. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  14. Rapid Molecular Identification of Human Taeniid Cestodes by Pyrosequencing Approach

    Science.gov (United States)

    Thanchomnang, Tongjit; Tantrawatpan, Chairat; Intapan, Pewpan M.; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Tourtip, Somjintana; Yamasaki, Hiroshi; Maleewong, Wanchai

    2014-01-01

    Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse. PMID:24945530

  15. Rapid molecular identification of human taeniid cestodes by pyrosequencing approach.

    Directory of Open Access Journals (Sweden)

    Tongjit Thanchomnang

    Full Text Available Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1 gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse.

  16. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Directory of Open Access Journals (Sweden)

    Irina N Riediger

    2017-09-01

    Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  17. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Science.gov (United States)

    Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A

    2017-09-01

    With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  18. Rapid differentiation of Staphylococcus aureus isolates harbouring egc loci with pseudogenes psient1 and psient2 and the selu or seluv gene using PCR-RFLP.

    Science.gov (United States)

    Collery, Mark M; Smyth, Cyril J

    2007-02-01

    The egc locus of Staphylococus aureus harbours two enterotoxin genes (seg and sei) and three enterotoxin-like genes (selm, seln and selo). Between the sei and seln genes are located two pseudogenes, psient1 and psient2, or the selu or seluv gene. While these two alternative sei-seln intergenic regions can be distinguished by PCR, to date, DNA sequencing has been the only confirmatory option because of the very high degree of sequence similarity between egc loci bearing the pseudogenes and the selu or seluv gene. In silico restriction enzyme digestion of genomic regions encompassing the egc locus from the 3' end of the sei gene through the 5' first quarter of the seln gene allowed pseudogene- and selu- or seluv-bearing egc loci to be distinguished by PCR-RFLP. Experimental application of these findings demonstrated that endonuclease HindIII cleaved PCR amplimers bearing pseudogenes but not those with a selu or seluv gene, while selu- or seluv-bearing amplimers were susceptible to cleavage by endonuclease HphI, but not by endonuclease HindIII. The restriction enzyme BccI cleaved selu- or seluv-harbouring amplimers at a unique restriction site created by their signature 15 bp insertion compared with pseudogene-bearing amplimers, thereby allowing distinction of these egc loci. PCR-RFLP analysis using these restriction enzymes provides a rapid, easy to interpret alternative to DNA sequencing for verification of PCR findings on the nature of an egc locus type, and can also be used for the primary identification of the intergenic sei-seln egc locus type.

  19. Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

    Directory of Open Access Journals (Sweden)

    Serrano Oscar K

    2008-10-01

    Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

  20. DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract

    NARCIS (Netherlands)

    Zoetendal, E.G.; Ben-Amor, K.; Akkermans, A.D.L.; Abee, T.; Vos, de W.M.

    2001-01-01

    A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven

  1. Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

    Directory of Open Access Journals (Sweden)

    Adeline Bidault

    2015-12-01

    Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

  2. Rapid BRAF mutation tests in patients with advanced melanoma : Comparison of immunohistochemistry, Droplet Digital PCR, and the Idylla Mutation Platform

    NARCIS (Netherlands)

    Bisschop, Cornelis; Ter Elst, Arja; Bosman, Lisette J; Platteel, Inge; Jalving, Mathilde; van den Berg, Anke; Diepstra, Arjan; van Hemel, Bettien; Diercks, Gilles F H; Hospers, Geke A P; Schuuring, Ed

    BRAF mutational testing has become a common practice in the diagnostic process of patients with advanced melanoma. Although time-consuming, DNA sequencing techniques are the current gold standard for mutational testing. However, in certain clinical situations, a rapid test result is required. In

  3. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  4. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  5. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  6. Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

    Science.gov (United States)

    Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

    2014-09-01

    The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

  7. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Science.gov (United States)

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  8. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  9. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Directory of Open Access Journals (Sweden)

    Denis Martine

    2011-05-01

    Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

  10. Rapid Quantification of Viable Campylobacter Bacteria on Chicken Carcasses, Using Real-Time PCR and Propidium Monoazide Treatment, as a Tool for Quantitative Risk Assessment

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

    2010-01-01

    A number of intervention strategies against Campylobacter contaminated poultry focus on post-slaughter reduction of the number of cells, emphasizing the need for rapid and reliable quantitative detection of only viable Campylobacter. We present a new and rapid quantitative approach for enumeration...... method does not detect DNA from dead Campylobacter, but recognises the infectious potential of the VBNC state, and is thereby able to assess the effect of control strategies, and provide trustworthy data for risk assessment....

  11. Performance of Droplet Digital PCR in Non-Invasive Fetal RHD Genotyping - Comparison with a Routine Real-Time PCR Based Approach.

    Directory of Open Access Journals (Sweden)

    Iveta Svobodová

    Full Text Available Detection and characterization of circulating cell-free fetal DNA (cffDNA from maternal circulation requires an extremely sensitive and precise method due to very low cffDNA concentration. In our study, droplet digital PCR (ddPCR was implemented for fetal RHD genotyping from maternal plasma to compare this new quantification alternative with real-time PCR (qPCR as a golden standard for quantitative analysis of cffDNA. In the first stage of study, a DNA quantification standard was used. Clinical samples, including 10 non-pregnant and 35 pregnant women, were analyzed as a next step. Both methods' performance parameters-standard curve linearity, detection limit and measurement precision-were evaluated. ddPCR in comparison with qPCR has demonstrated sufficient sensitivity for analysing of cffDNA and determination of fetal RhD status from maternal circulation, results of both methods strongly correlated. Despite the more demanding workflow, ddPCR was found to be slightly more precise technology, as evaluated using quantitative standard. Regarding the clinical samples, the precision of both methods equalized with decreasing concentrations of tested DNA samples. In case of cffDNA with very low concentrations, variance parameters of both techniques were comparable. Detected levels of fetal cfDNA in maternal plasma were slightly higher than expected and correlated significantly with gestational age as measured by both methods (ddPCR r = 0.459; qPCR r = 0.438.

  12. Novel approach for assessing performance of PCR cyclers used for diagnostic testing

    DEFF Research Database (Denmark)

    Schoder, D.; Schmalwieser, A.; Schauberger, G.

    2005-01-01

    of thermal homogeneities became most evident at the denaturation level during the first 15 s. At the time point zero, the accurate cyclers showed temperature deviations of 0.5 to 1.5 degrees C, whereas less-accurate cyclers failed to reach the set temperature by 13 to 20 degrees C. Consequently, the two less......As part of a large international project for validation and standardization of PCR, the influence of thermocyclers on PCR was tested. Six brand-new, Peltier technology-driven 96-well thermocyclers were subjected to a novel and stringent in-tube (not block) physical testing. The temperature...

  13. Powerful qPCR assays for the early detection of latent invaders: interdisciplinary approaches in clinical cancer research and plant pathology.

    Science.gov (United States)

    Luchi, Nicola; Capretti, Paolo; Pazzagli, Mario; Pinzani, Pamela

    2016-06-01

    Latent invaders represent the first step of disease before symptoms occur in the host. Based on recent findings, tumors are considered to be ecosystems in which cancer cells act as invasive species that interact with the native host cell species. Analogously, in plants latent fungal pathogens coevolve within symptomless host tissues. For these reasons, similar detection approaches can be used for an early diagnosis of the invasion process in both plants and humans to prevent or reduce the spread of the disease. Molecular tools based on the evaluation of nucleic acids have been developed for the specific, rapid, and early detection of human diseases. During the last decades, these techniques to assess and quantify the proliferation of latent invaders in host cells have been transferred from the medical field to different areas of scientific research, such as plant pathology. An improvement in molecular biology protocols (especially referring to qPCR assays) specifically designed and optimized for detection in host plants is therefore advisable. This work is a cross-disciplinary review discussing the use of a methodological approach that is employed within both medical and plant sciences. It provides an overview of the principal qPCR tools for the detection of latent invaders, focusing on comparisons between clinical cancer research and plant pathology, and recent advances in the early detection of latent invaders to improve prevention and control strategies.

  14. Tuber aestivum Vittad. mycelium quantified: advantages and limitations of a qPCR approach

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Trilčová, Jana; Hršelová, Hana; Streiblová, Eva; Gryndlerová, Hana; Jansa, Jan

    2013-01-01

    Roč. 23, č. 5 (2013), s. 341-348 ISSN 0940-6360 R&D Projects: GA ČR GAP504/10/0382 Institutional support: RVO:61388971 Keywords : Summer truffle * Quantitative real-time PCR * Carpinus Subject RIV: EE - Microbiology, Virology Impact factor: 2.985, year: 2013

  15. Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis.

    Science.gov (United States)

    Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

    2011-12-01

    Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.

  16. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

    Science.gov (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-06-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Rapid detection of most frequent Slovenian germ-line mutations in BRCA1 gene using real-time PCR and melting curve analysis

    International Nuclear Information System (INIS)

    Novakovic, S.; Stegel, V.

    2005-01-01

    Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)

  19. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  20. An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

  1. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  2. A nested PCR approach for unambiguous typing of pestiviruses infecting cattle.

    Science.gov (United States)

    Decaro, Nicola; Sciarretta, Rossana; Lucente, Maria Stella; Mari, Viviana; Amorisco, Francesca; Colaianni, Maria Loredana; Cordioli, Paolo; Parisi, Antonio; Lelli, Rossella; Buonavoglia, Canio

    2012-02-01

    An atypical pestivirus ('Hobi'-like pestivirus, putative bovine viral diarrhoea 3, BVDV-3) was identified firstly in contaminated foetal calf serum batches and isolated subsequently from an outbreak of respiratory disease in a cattle herd in Italy. The isolation of the novel pestivirus from animals affected clinically posed concerns about the validity of BVDV eradication programs, considering that 'Hobi'-like pestivirus (BVDV-3) is undetected or mistyped by the molecular diagnostic tools currently employed. In this paper, the development of a nested PCR (nPCR) assay for unambiguous typing of all bovine pestiviruses is reported. The assay consisted of a first-round amplification using an oligonucleotide pair which binds to conserved sequences located in the 5' untranslated region and capsid gene, followed by a heminested PCR using virus-specific forward primers. The assay performances were evaluated analytically, showing good sensitivity and specificity. By analysis of 100 BVDV-positive samples typed using a nPCR assay discriminating ruminant pestiviruses, five samples recognised previously as BVDV-2 were not typed when submitted to the new assay (n=2) or reacted as 'Hobi'-like pestivirus BVDV-3 (n=3). Sequence analysis of the first-round amplification products showed that the untyped strains were border disease viruses, whereas the other three strains were true 'Hobi'-like viruses. The development of a molecular assay able to identify simultaneously all bovine pestiviruses known currently will help warrant biosafety of live vaccines and other biological products and assess the molecular epidemiology of 'Hobi'-like pestivirus, thus leading to the improvement of the eradication programs through unambiguous typing of pestiviruses infecting cattle. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. A Bac Library and Paired-PCR Approach to Mapping and Completing the Genome Sequence of Sulfolobus Solfataricus P2

    DEFF Research Database (Denmark)

    She, Qunxin; Confalonieri, F.; Zivanovic, Y.

    2000-01-01

    The original strategy used in the Sulfolobus solfatnricus genome project was to sequence non overlapping, or minimally overlapping, cosmid or lambda inserts without constructing a physical map. However, after only about two thirds of the genome sequence was completed, this approach became counter......-productive because there was a high sequence bias in the cosmid and lambda libraries. Therefore, a new approach was devised for linking the sequenced regions which may be generally applicable. BAC libraries were constructed and terminal sequences of the clones were determined and used for both end mapping and PCR...

  4. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  5. Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach

    DEFF Research Database (Denmark)

    Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere

    2013-01-01

    was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...

  6. Ebola Preparedness: Diagnosis Improvement Using Rapid Approaches for Proficiency Testing.

    Science.gov (United States)

    Lau, Katherine A; Theis, Torsten; Gray, Joanna; Rawlinson, William D

    2017-03-01

    The unprecedented 2015 Ebolavirus (EBOV) outbreak in West Africa was declared a public health emergency, making diagnosis and quality of testing a global issue. The accuracy of laboratory diagnostic capacity for EBOV was assessed in 2014 to 2016 using a proficiency testing (PT) strategy developed by the Royal College of Pathologists of Australasia Quality Assurance Programs (RCPAQAP) in Biosecurity. Following a literature search, EBOV-specific gene targets were ranked according to the frequency of their use in published methods. The most commonly used gene regions (nucleoprotein [NP], glycoprotein [GP], and RNA-dependent RNA polymerase [L]) were selected for the design of in vitro RNA transcripts to be included in the simulated EBOV specimens used for EBOV detection with PCR-based assays. Specimens were tested for stability and found to be stable on long-term storage (1 year) at -80°C and on shorter-term storage in lyophilized form (1 week at ambient temperature and a subsequent week at -80°C). These specimens were used in three EBOV PTs offered from April 2014 to March 2016. In the first and third PTs, all laboratories (3/3 and 9/9, respectively) correctly identified specimens containing EBOV RNA transcripts, while in the second PT, all but one laboratory (5/6) correctly confirmed the presence of EBOV. The EBOV PT panel was useful for ensuring the competency of laboratories in detecting EBOV in the absence of readily available clinical samples. The simulated EBOV specimen was safe, stable, and reliable and can be used in lyophilized form for future EBOV PT programs, allowing simplicity of transport. Copyright © 2017 American Society for Microbiology.

  7. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

  8. A real-time PCR approach to identify anthelmintic-resistant nematodes in sheep farms.

    Science.gov (United States)

    Milhes, M; Guillerm, M; Robin, M; Eichstadt, M; Roy, C; Grisez, C; Prévot, F; Liénard, E; Bouhsira, E; Franc, M; Jacquiet, P

    2017-03-01

    Resistance to fenbendazole, ivermectin, and moxidectin was explored by a fecal egg count reduction test in four meat sheep flocks in southwestern France where anthelmintic resistance was suspected. The FECR test results of the present study confirmed the presence of benzimidazole resistance in three out of the four farms and the presence of ivermectin resistance in one flock. In addition, a suspicion of moxidectin resistance was shown in this latter farm. Both conventional morphological and molecular identifications were performed on larval cultures before and after the treatment in the studied farms. A high positive correlation was found between the number of larvae counted under binocular microscope and the number of larvae estimated by the qPCR analysis (R 2  = 0.88) and a high Cohen's Kappa value (0.91) in the detection of strongylid larvae in larval cultures. According to qPCR results, Trichostrongylus species demonstrated high levels of BZ resistance and Teladorsagia circumcincta was involved in the IVM resistance in one farm. The molecular procedures used in this study have the potential to be beneficial for anthelmintic resistance surveillance in sheep industry.

  9. Pediatric Dispersible Tablets: a Modular Approach for Rapid Prototyping.

    Science.gov (United States)

    Buck, Jonas; Huwyler, Jörg; Kühl, Peter; Dischinger, Angela

    2016-08-01

    The design of pediatric formulations is challenging. Solid dosage forms for children have to meet the needs of different ages, e.g. high number of dosing increments and strengths. A modular formulation strategy offering the possibility of rapid prototyping was applied. Different tablet compositions and the resulting tablet characteristics were investigated for dispersible tablets using customized analytical methods. Fluid bed granules were blended with extragranular components, and compressed to tablets. Disintegration behavior was studied with a Texture Analyzer and a Tensiometer. Methods for determination of disintegration time and water uptake of tablets were developed with a Texture Analyzer, and a Tensiometer, respectively. Twenty-two different tablet formulations were prepared and analyzed with respect to disintegration time, hardness, friability, and viscosity. Multivariate data analysis revealed a high impact of type and amount of viscosity enhancer on the disintegration behavior of tablets. An optimized formulation was selected with a disintegration time of 24 s. Methods providing additional information on the disintegration behavior of dispersible tablets compared to standard pharmacopoeia methods were established. Selecting the right type and level of viscosity enhancer and superdisintegrant was critical for developing pediatric tablets with a disintegration time of less than 30 s but still pleasant mouth feel.

  10. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. A novel approach for rapid screening of mitochondrial D310 polymorphism

    International Nuclear Information System (INIS)

    Aral, Cenk; Kaya, Handan; Ataizi-Çelikel, Çiğdem; Akkiprik, Mustafa; Sönmez, Özgür; Güllüoğlu, Bahadır M; Özer, Ayşe

    2006-01-01

    Mutations in the mitochondrial DNA (mtDNA) have been reported in a wide variety of human neoplasms. A polynucleotide tract extending from 303 to 315 nucleotide positions (D310) within the non-coding region of mtDNA has been identified as a mutational hotspot of primary tumors. This region consists of two polycytosine stretches interrupted by a thymidine nucleotide. The number of cytosines at the first and second stretches are 7 and 5 respectively, according to the GeneBank sequence. The first stretch exhibits a polymorphic length variation (6-C to 9-C) among individuals and has been investigated in many cancer types. Large-scale studies are needed to clarify the relationship between cytosine number and cancer development/progression. However, time and money consuming methods such as radioactivity-based gel electrophoresis and sequencing, are not appropriate for the determination of this polymorphism for large case-control studies. In this study, we conducted a rapid RFLP analysis using a restriction enzyme, BsaXI, for the single step simple determination of 7-C carriers at the first stretch in D310 region. 25 colorectal cancer patients, 25 breast cancer patients and 41 healthy individuals were enrolled into the study. PCR amplification followed by restriction enzyme digestion of D310 region was performed for RFLP analysis. Digestion products were analysed by agarose gel electrophoresis. Sequencing was also applied to samples in order to confirm the RFLP data. Samples containing 7-C at first stretch of D310 region were successfully determined by the BsaXI RFLP method. Heteroplasmy and homoplasmy for 7-C content was also determined as evidenced by direct sequencing. Forty-one percent of the studied samples were found to be BsaXI positive. Furthermore, BsaXI status of colorectal cancer samples were significantly different from that of healthy individuals. In conclusion, BsaXI RFLP analysis is a simple and rapid approach for the single step determination of D310

  12. Heterologous reconstitution of the intact geodin gene cluster in Aspergillus nidulans through a simple and versatile PCR based approach.

    Directory of Open Access Journals (Sweden)

    Morten Thrane Nielsen

    Full Text Available Fungal natural products are a rich resource for bioactive molecules. To fully exploit this potential it is necessary to link genes to metabolites. Genetic information for numerous putative biosynthetic pathways has become available in recent years through genome sequencing. However, the lack of solid methodology for genetic manipulation of most species severely hampers pathway characterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to transformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC encodes a polyketide synthase, ATEG_08453 (gedR encodes a transcription factor responsible for activation of the geodin gene cluster and ATEG_08460 (gedL encodes a halogenase that catalyzes conversion of sulochrin to dihydrogeodin. We expect that our approach for transferring intact biosynthetic pathways to a fungus with a well developed genetic toolbox will be instrumental in characterizing the many exciting pathways for secondary metabolite production that are currently being uncovered by the fungal genome sequencing projects.

  13. A real-time PCR approach to detect predation on anchovy and sardine early life stages

    Science.gov (United States)

    Cuende, Elsa; Mendibil, Iñaki; Bachiller, Eneko; Álvarez, Paula; Cotano, Unai; Rodriguez-Ezpeleta, Naiara

    2017-12-01

    Recruitment of sardine (Sardina pilchardus Walbaum, 1792) and anchovy (Engraulis encrasicolus Linnaeus, 1758) is thought to be regulated by predation of their eggs and larvae. Predators of sardine and anchovy can be identified by visual taxonomic identification of stomach contents, but this method is time consuming, tedious and may underestimate predation, especially in small predators such as fish larvae. Alternatively, genetic tools may offer a more cost-effective and accurate alternative. Here, we have developed a multiplex real-time polymerase chain reaction (RT-PCR) assay based on TaqMan probes to simultaneously detect sardine and anchovy remains in gut contents of potential predators. The assay combines previously described and newly generated species-specific primers and probes for anchovy and sardine detection respectively, and allows the detection of 0,001 ng of target DNA (which corresponds to about one hundredth of the total DNA present in a single egg). We applied the method to candidate anchovy and sardine egg predators in the Bay of Biscay, Atlantic Mackerel (Scomber scombrus) larvae. Egg predation observed was limited primarily to those stations where sardine and/or anchovy eggs were present. Our developed assay offers a suitable tool to understand the effects of predation on the survival of anchovy and sardine early life stages.

  14. Comparison of the novel Partec rapid malaria test to the conventional Giemsa stain and the gold standard real-time PCR.

    Science.gov (United States)

    Nkrumah, Bernard; Agyekum, Alex; Acquah, Samuel E K; May, Jürgen; Tannich, Egbert; Brattig, Norbert; Nguah, Samuel Blay; von Thien, Heidrun; Adu-Sarkodie, Yaw; Huenger, Frank

    2010-08-01

    Malaria remains the single most frequent cause of death in Africa, killing one child every 30 s, but treatment decisions are often made only on clinical diagnosis, as laboratory techniques to confirm the clinical suspicion are labor intensive and costly. In this study, we evaluated the recently developed Partec rapid malaria test (PM) for the detection of Plasmodium spp. in human blood from patients in an area where malaria is endemic and compared the results with those of thick blood film Giemsa stain (GS) in terms of its performance and operational characteristics, using real-time (RT) PCR as the gold standard. The sensitivities of the PM and the GS were 62.2% (95% CI, 56.3 to 67.8) and 61.8% (95% CI, 55.9 to 67.4), respectively, while the specificities were 96.0% (95% CI, 92.3 to 98.3) and 98% (95% CI, 95.0 to 99.5), respectively. There was an excellent agreement between the results for the PM and those of the GS (k [level of agreement] = 0.96; P < 0.001). The results for the PM were obtained more quickly and at less cost than those for the GS. The performance characteristics of the PM were almost equal to those of the GS, but the operational characteristics were better, and the PM can therefore be considered as an alternative method for GS.

  15. Comparison of the Novel Partec Rapid Malaria Test to the Conventional Giemsa Stain and the Gold Standard Real-Time PCR

    Science.gov (United States)

    Nkrumah, Bernard; Agyekum, Alex; Acquah, Samuel E. K.; May, Jürgen; Tannich, Egbert; Brattig, Norbert; Nguah, Samuel Blay; von Thien, Heidrun; Adu-Sarkodie, Yaw; Huenger, Frank

    2010-01-01

    Malaria remains the single most frequent cause of death in Africa, killing one child every 30 s, but treatment decisions are often made only on clinical diagnosis, as laboratory techniques to confirm the clinical suspicion are labor intensive and costly. In this study, we evaluated the recently developed Partec rapid malaria test (PM) for the detection of Plasmodium spp. in human blood from patients in an area where malaria is endemic and compared the results with those of thick blood film Giemsa stain (GS) in terms of its performance and operational characteristics, using real-time (RT) PCR as the gold standard. The sensitivities of the PM and the GS were 62.2% (95% CI, 56.3 to 67.8) and 61.8% (95% CI, 55.9 to 67.4), respectively, while the specificities were 96.0% (95% CI, 92.3 to 98.3) and 98% (95% CI, 95.0 to 99.5), respectively. There was an excellent agreement between the results for the PM and those of the GS (k [level of agreement] = 0.96; P < 0.001). The results for the PM were obtained more quickly and at less cost than those for the GS. The performance characteristics of the PM were almost equal to those of the GS, but the operational characteristics were better, and the PM can therefore be considered as an alternative method for GS. PMID:20554822

  16. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  17. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Science.gov (United States)

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  18. Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

    Science.gov (United States)

    Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

    2017-01-01

    Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

  19. A new PCR approach for the identification of Fusarium graminearum Um novo protocolo de PCR para a identificação de Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Gleison Ricardo de Biazio

    2008-09-01

    Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as

  20. High-resolution melting-curve analysis of ligation-mediated real-time PCR for rapid evaluation of an epidemiological outbreak of extended-spectrum-beta-lactamase-producing Escherichia coli.

    Science.gov (United States)

    Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E; Schön, Thomas

    2011-12-01

    Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE.

  1. High-Resolution Melting-Curve Analysis of Ligation-Mediated Real-Time PCR for Rapid Evaluation of an Epidemiological Outbreak of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli ▿

    Science.gov (United States)

    Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E.; Schön, Thomas

    2011-01-01

    Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE. PMID:21956981

  2. Comparison of false-negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture

    Energy Technology Data Exchange (ETDEWEB)

    Hutchison, J. R. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Piepel, G. F. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Amidan, B. G. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Hess, B. M. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Sydor, M. A. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Deatherage Kaiser, B. L. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA

    2018-03-13

    Aims: We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials, and assay methods on false-negative rate (FNR) and limit of detection (LOD95) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Methods and Results: Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2 – 500 coupon-1) onto glass, stainless steel, vinyl tile, and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD95 results. Conclusions: Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD95 was lowest for glass and highest for vinyl tile. LOD95 values overall were lower for mRV-PCR than for the culture method. Significance and Impact of Study: This study adds to the limited data on FNR and LOD95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis.

  3. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  4. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

    Science.gov (United States)

    van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

    2018-04-26

    Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

  5. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51

    OpenAIRE

    Ewalt, Darla R.; Bricker, Betsy J.

    2000-01-01

    The Brucella AMOS PCR assay was previously developed to identify and differentiate specific Brucella species. In this study, an abbreviated Brucella AMOS PCR test was evaluated to determine its accuracy in differentiating Brucella abortus into three categories: field strains, vaccine strain 19 (S19), and vaccine strain RB51/parent strain 2308 (S2308). Two hundred thirty-one isolates were identified and tested by the conventional biochemical tests and Brucella AMOS PCR. This included 120 isola...

  6. Validation of the Pockit Dengue Virus Reagent Set for Rapid Detection of Dengue Virus in Human Serum on a Field-Deployable PCR System.

    Science.gov (United States)

    Tsai, Jih-Jin; Liu, Li-Teh; Lin, Ping-Chang; Tsai, Ching-Yi; Chou, Pin-Hsing; Tsai, Yun-Long; Chang, Hsiao-Fen Grace; Lee, Pei-Yu Alison

    2018-05-01

    Dengue virus (DENV) infection, a mosquito-borne disease, is a major public health problem in tropical countries. Point-of-care DENV detection with good sensitivity and specificity enables timely early diagnosis of DENV infection, facilitating effective disease management and control, particularly in regions of low resources. The Pockit dengue virus reagent set (GeneReach Biotech), a reverse transcription insulated isothermal PCR (RT-iiPCR), is available to detect all four serotypes of DENV on the field-deployable Pockit system, which is ready for on-site applications. In this study, analytical and clinical performances of the assay were evaluated. The index assay did not react with 14 non-DENV human viruses, indicating good specificity. Compared to the U.S. CDC DENV-1-4 real-time quantitative RT-PCR (qRT-PCR) assay, testing with serial dilutions of virus-spiked human sera demonstrated that the index assay had detection endpoints that were separately comparable with the 4 serotypes. Excellent reproducibility was observed among repeat tests done by six operators at three sites. In clinical performance, 195 clinical sera collected around Kaohsiung city in 2012 and 21 DENV-4-spiked sera were tested with the RT-iiPCR and qRT-PCR assays in parallel. The 121 (11 DENV-1, 78 DENV-2, 11 DENV-3, and 21 DENV-4) qRT-PCR-positive and 95 qRT-PCR-negative samples were all positive and negative by the RT-iiPCR reagent results, respectively, demonstrating high (100%) interrater agreement (95% confidence interval [CI 95% ], ∼98.81% to 100%; κ = 1). With analytical and clinical performance equivalent to those of the reference qRT-PCR assay, the index PCR assay on the field-deployable system can serve as a highly sensitive and specific on-site tool for DENV detection. Copyright © 2018 American Society for Microbiology.

  7. Polymeric LabChip real-time PCR as a point-of-care-potential diagnostic tool for rapid detection of influenza A/H1N1 virus in human clinical specimens.

    Directory of Open Access Journals (Sweden)

    Hyun-Ok Song

    Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and

  8. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS for rapid strain typing of Bacillus coagulans.

    Directory of Open Access Journals (Sweden)

    Jun Sato

    Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  9. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid strain typing of Bacillus coagulans.

    Science.gov (United States)

    Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa

    2017-01-01

    In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  10. Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children

    NARCIS (Netherlands)

    Bruijnesteijn van Coppenraet, E. S.; Lindeboom, J. A.; Prins, J. M.; Peeters, M. F.; Claas, E. C. J.; Kuijper, E. J.

    2004-01-01

    A real-time PCR assay was developed to diagnose and identify the causative agents of suspected mycobacterial lymphadenitis. Primers and probes for the real-time PCR were designed on the basis of the internal transcribed spacer sequence, enabling the recognition of the genus Mycobacterium and the

  11. A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2009-01-01

    In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

  12. Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) for large genomic rearrangements (LGRs) detection: A new approach to assess quantitative status of BRCA1 gene in a reference laboratory.

    Science.gov (United States)

    Minucci, Angelo; De Paolis, Elisa; Concolino, Paola; De Bonis, Maria; Rizza, Roberta; Canu, Giulia; Scaglione, Giovanni Luca; Mignone, Flavio; Scambia, Giovanni; Zuppi, Cecilia; Capoluongo, Ettore

    2017-07-01

    Evaluation of copy number variation (CNV) in BRCA1/2 genes, due to large genomic rearrangements (LGRs), is a mandatory analysis in hereditary breast and ovarian cancers families, if no pathogenic variants are found by sequencing. LGRs cannot be detected by conventional methods and several alternative methods have been developed. Since these approaches are expensive and time consuming, identification of alternative screening methods for LGRs detection is needed in order to reduce and optimize the diagnostic procedure. The aim of this study was to investigate a Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) as molecular tool to detect recurrent BRCA1 LGRs. C-PCR-HRMA was performed on exons 3, 14, 18, 19, 20 and 21 of the BRCA1 gene; exons 4, 6 and 7 of the ALB gene were used as reference fragments. This study showed that it is possible to identify recurrent BRCA1 LGRs, by melting peak height ratio between target (BRCA1) and reference (ALB) fragments. Furthermore, we underline that a peculiar amplicon-melting profile is associated to a specific BRCA1 LGR. All C-PCR-HRMA results were confirmed by Multiplex ligation-dependent probe amplification. C-PCR-HRMA has proved to be an innovative, efficient and fast method for BRCA1 LGRs detection. Given the sensitivity, specificity and ease of use, c-PCR-HRMA can be considered an attractive and powerful alternative to other methods for BRCA1 CNVs screening, improving molecular strategies for BRCA testing in the context of Massive Parallel Sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

    Science.gov (United States)

    Vela, J; Vitorica, J; Ruano, D

    2001-12-01

    We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

  14. Rapid and Quantitative Detection of Leifsonia xyli subsp. xyli in Sugarcane Stalk Juice Using a Real-Time Fluorescent (TaqMan PCR Assay

    Directory of Open Access Journals (Sweden)

    Hua-Ying Fu

    2016-01-01

    Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.

  15. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  16. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  17. CONCEPTUAL APPROACHES TO THE RAPID DETECTION OF CAMPYLOBACTER SPP. IN MEAT OF SLAUGHTER ANIMALS

    Directory of Open Access Journals (Sweden)

    D. S. Bataeva

    2017-01-01

    Full Text Available The modern approach to quality assurance of food products based on the ISO 9000 standards indicates the need for the implementation of quality management systems in processing plants. According to the analysis of scientific publication databases (Science Direct and Web of Science, it is established that only 0.5–1.7% of publications are related to studying meat of slaughter animals (except for birds concerning the presence of Campylobacter. The priority method of investigation is PCR. Ready-to-use PCR test system was developed for the detection of Campylobacter spp. on the basis of selected gene-specific primers to bacteria of Campylobacter genus. Specificity of the test system is established for Gram-negative bacteria of Salmonella, Escherichia, and Proteus genera, and for oxidase-positive Aeromonas. Gene-specific primers for Campylobacter were selected and ready-to-use PCR test system was developed on their basis. It was found that the selected primers have 100% convergence to the genome of Campylobacter genus bacteria, the PCR efficiency is not less than 95%, and the detection limit is not more than 1× 104 CFU/g. When estimating the specificity of the primers, it was taken into account that the bacteria of Campylobacter genus may be incorporated in a consortium with intestine microbiome, mainly with Enterobacteriaceae and lactic acid bacteria. However, Bolton’s enrichment medium is selective and, during the cultivation process, suppresses the growth of Gram-positive lactic acid bacteria. It was found that the selected primers were 100% specific and did not give false positive reactions with this group of microorganisms. The developed test system was successfully validated in a cycle of qualitative tests in the FEPAS system and implemented into laboratory practice. It was proved that the developed test system may be used both in screening at the stages of Campylobacter enrichment and in identification of pure culture of the

  18. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Utilizing a Rapid Prototyping Approach in the Building of a Hypermedia-Based Reference Station.

    Science.gov (United States)

    Sell, Dan

    This paper discusses the building of a hypermedia-based reference station at the Wright Laboratory Technical Library, Wright-Patterson Air Force Base, Ohio. Following this, the paper focuses on an electronic user survey from which data is collected and analysis is made. The survey data is used in a rapid prototyping approach, which is defined as…

  20. Exploring MALDI-TOF MS approach for a rapid identification of Mycobacterium avium ssp. paratuberculosis field isolates.

    Science.gov (United States)

    Ricchi, M; Mazzarelli, A; Piscini, A; Di Caro, A; Cannas, A; Leo, S; Russo, S; Arrigoni, N

    2017-03-01

    The aim of the study was to explore the suitability of matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) for a rapid and correct identification of Mycobacterium avium ssp. paratuberculosis (MAP) field isolates. MALDI-TOF MS approach is becoming one of the most popular tests for the identification of intact bacterial cells which has been shown to be fast and reliable. For this purpose, 36 MAP field isolates were analysed through MALDI-TOF MS and the spectra compared with two different databases: one provided by the vendor of the system employed (Biotyper ver. 3·0; Bruker Daltonics) and a homemade database containing spectra from both tuberculous and nontuberculous Mycobacteria. Moreover, principal component analysis procedure was employed to confirm the ability of MALDI-TOF MS to discriminate between very closely related subspecies. Our results suggest MAP can be differentiated from other Mycobacterium species, both when the species are very close (M. intracellulare) and when belonging to different subspecies (M. avium ssp. avium and M. avium ssp. silvaticum). The procedure applied is fast, easy to perform, and achieves an earlier accurate species identification of MAP and nontuberculous Mycobacteria in comparison to other procedures. The gold standard test for the diagnosis of paratuberculosis is still isolation of MAP by cultural methods, but additional assays, such as qPCR and subculturing for determination of mycobactin dependency are required to confirm its identification. We have provided here evidence pertaining to the usefulness of MALDI-TOF MS approach for a rapid identification of this mycobacterium among other members of M. avium complex. © 2016 The Society for Applied Microbiology.

  1. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    Science.gov (United States)

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  2. A nested PCR approach for improved recovery of archaeal 16S rRNA gene fragments from freshwater samples

    NARCIS (Netherlands)

    Vissers, E.W.; Bodelier, P.L.E.; Muyzer, G.; Laanbroek, R.

    2009-01-01

    In a survey on the presence of archaea in a number of European lakes, it was found that known archaeal primer sets for PCR were not suited for use in freshwater environment, as some lack selectivity, while others were too selective. A nested PCR was developed for denaturing gradient gel

  3. Evaluation of pre-PCR processing approaches for enumeration of Salmonella enterica in naturally contaminated animal feed

    DEFF Research Database (Denmark)

    Schelin, Jenny; Andersson, Gunnar; Vigre, Håkan

    2014-01-01

    Three pre‐PCR processing strategies for the detection and/or quantification of Salmonella in naturally contaminated soya bean meal were evaluated. Methods included: (i) flotation‐qPCR [enumeration of intact Salmonella cells prior to quantitative PCR (qPCR)], (ii) MPN‐PCR (modified most probable...... be due to the presence of nonculturable Salmonella and/or a heterogeneous distribution of Salmonella in the material. The evaluated methods provide different possibilities to assess the prevalence of Salmonella in feed, together with the numbers of culturable, as well as nonculturable cells, and can...... be applied to generate data to allow more accurate quantitative microbial risk assessment for Salmonella in the feed chain....

  4. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    DEFF Research Database (Denmark)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350......-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained...... between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU...

  5. Rapid and Accurate Detection of Bacteriophage Activity against Escherichia coli O157:H7 by Propidium Monoazide Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Hui Liu

    2014-01-01

    Full Text Available Conventional methods to determine the efficacy of bacteriophage (phage for biocontrol of E. coli require several days, due to the need to culture bacteria. Furthermore, cell surface-attached phage particles may lyse bacterial cells during experiments, leading to an overestimation of phage activity. DNA-based real-time quantitative polymerase chain reaction (qPCR is a fast, sensitive, and highly specific means of enumerating pathogens. However, qPCR may underestimate phage activity due to its inability to distinguish viable from nonviable cells. In this study, we evaluated the suitability of propidium monoazide (PMA, a microbial membrane-impermeable dye that inhibits amplification of extracellular DNA and DNA within dead or membrane-compromised cells as a means of using qPCR to identify only intact E. coli cells that survive phage exposure. Escherichia coli O157:H7 strain R508N and 4 phages (T5-like, T1-like, T4-like, and O1-like were studied. Results compared PMA-qPCR and direct plating and confirmed that PMA could successfully inhibit amplification of DNA from compromised/damaged cells E. coli O157:H7. Compared to PMA-qPCR, direct plating overestimated (P < 0.01 phage efficacy as cell surface-attached phage particles lysed E. coli O157:H7 during the plating process. Treatment of samples with PMA in combination with qPCR can therefore be considered beneficial when assessing the efficacy of bacteriophage for biocontrol of E. coli O157:H7.

  6. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Stephen Jacques

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18 is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer. Tissue blocks from 35 cases of in situ or invasive cervical squamouscell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 and for the housekeeping gene beta-actin by conventional PCR using type...

  7. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Steven

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18, is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer.Tissue blocks from 35 cases of in situ or invasive cervical squamous cell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 by conventional PCR using type specific primers, and for the housekeeping gene...

  8. Rapid detection of Salmonella in meat: Comparative and collaborative validation of a non-complex and cost effective pre-PCR protocol

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, F.; Mansdal, S.

    2011-01-01

    samples using a real-time PCR method. The protocol included incubation in buffered peptone water, centrifugation of an aliquot and a boiling procedure. The validation study included comparative and collaborative trials recommended by the Nordic Organization for Validation of Alternative Methods (NordVal......). The comparative trial was performed against a culture based reference method (NMKL187, 2007) and a previously NordVal approved PCR method with a semi-automated magnetic bead-based DNA extraction step using 122 artificially contaminated samples. The limit of detection (LOD50) was found to be 3.0, 3.2 and 3.4 CFU...

  9. The potential of three different PCR-related approaches for the authentication of mixtures of herbal substances and finished herbal medicinal products.

    Science.gov (United States)

    Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner

    2018-04-01

    Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined

  10. Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

    DEFF Research Database (Denmark)

    Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

    2004-01-01

    As part of a multi-centre European project, FOOD-PCR, the feasibility of a novel approach for production of dried bacterial DNA that could be used as certified reference materials (CRM) was assessed. Selected strains of Salmonella typhimurium, Listeria monocytogenes, Escherichia coli O157...

  11. 'Distorted structure modelling' - a more physical approach to Rapid Distortion Theory

    International Nuclear Information System (INIS)

    Savill, A.M.

    1979-11-01

    Rapid Distortion Theory is reviewed in the light of the modern mechanistic approach to turbulent motion. The apparent failure of current models, based on this theory, to predict stress intensity ratios accurately in distorted shear flows is attributed to their oversimplistic assumptions concerning the inherent turbulence structure of such flows. A more realistic picture of this structure and the manner in which it responds to distortion is presented in terms of interactions between the mean flow and three principal types of eddies. If Rapid Distortion Theory is modified to account for this it is shown that the stress intensity ratios can be accurately predicted in three test flows. It is concluded that a computational scheme based on Rapid Distortion Theory might ultimately be capable of predicting turbulence parameters in the highly complex geometries of reactor cooling systems. (author)

  12. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Science.gov (United States)

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  13. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  14. Development of a taqman-based real-time PCR assay for the rapid and specific detection of novel duck- origin goose parvovirus.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Cui, Yuan; Nan, Huizhu; Yuan, Wanzhe

    2017-08-01

    A real-time PCR assay was developed for specific detection of novel duck-origin goose parvovirus (N-GPV), the etiological agent of duck beak atrophy and dwarfism syndrome (BADS). The detection limit of the assay was 10 2 copies. The assay was useful in the prevention and control of BADS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  16. A highly sensitive, multiplex broad-spectrum PCR-DNA-enzyme immunoassay and reverse hybridization assay for rapid detection and identification of Chlamydia trachomatis serovars.

    NARCIS (Netherlands)

    Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.

    2007-01-01

    Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT

  17. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...

  18. Pharmacological modulations of cardiac ultra-rapid and slowly activating delayed rectifier currents: potential antiarrhythmic approaches.

    Science.gov (United States)

    Islam, Mohammed A

    2010-01-01

    Despite the emerging new insights into our understandings of the cellular mechanisms underlying cardiac arrhythmia, medical therapy for this disease remains unsatisfactory. Atrial fibrillation (AF), the most prevalent arrhythmia, is responsible for significant morbidity and mortality. On the other hand, ventricular fibrillation results in sudden cardiac deaths in many instances. Prolongation of cardiac action potential (AP) is a proven principle of antiarrhythmic therapy. Class III antiarrhythmic agents prolong AP and QT interval by blocking rapidly activating delayed rectifier current (I(Kr)). However, I(Kr) blocking drugs carry the risk of life-threatening proarrhythmia. Recently, modulation of atrial-selective ultra-rapid delayed rectifier current (I(Kur)), has emerged as a novel therapeutic approach to treat AF. A number of I(Kur) blockers are being evaluated for the treatment of AF. The inhibition of slowly activating delayed rectifier current (I(Ks)) has also been proposed as an effective and safer antiarrhythmic approach because of its distinguishing characteristics that differ in remarkable ways from other selective class III agents. Selective I(Ks) block may prolong AP duration (APD) at rapid rates without leading to proarrhythmia. This article reviews the pathophysiological roles of I(Kur) and I(Ks) in cardiac repolarization and the implications of newly developed I(Kur) and I(Ks) blocking agents as promising antiarrhythmic approaches. Several recent patents pertinent to antiarrhythmic drug development have been discussed. Further research will be required to evaluate the efficacy and safety of these agents in the clinical setting.

  19. High-resolution melt PCR analysis for rapid identification of Chlamydia abortus live vaccine strain 1B among C. abortus strains and field isolates.

    Science.gov (United States)

    Vorimore, Fabien; Cavanna, Noémie; Vicari, Nadia; Magnino, Simone; Willems, Hermann; Rodolakis, Annie; Siarkou, Victoria I; Laroucau, Karine

    2012-09-01

    We describe a novel high-resolution melt assay that clearly differentiates Chlamydia abortus live vaccine strain 1B from field C. abortus strains and field wild-type isolates based on previously described single nucleotide polymorphisms. This modern genotyping technique is inexpensive, easy to use, and less time-consuming than PCR-RFLP. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Comparison of a rational vs. high throughput approach for rapid salt screening and selection.

    Science.gov (United States)

    Collman, Benjamin M; Miller, Jonathan M; Seadeek, Christopher; Stambek, Julie A; Blackburn, Anthony C

    2013-01-01

    In recent years, high throughput (HT) screening has become the most widely used approach for early phase salt screening and selection in a drug discovery/development setting. The purpose of this study was to compare a rational approach for salt screening and selection to those results previously generated using a HT approach. The rational approach involved a much smaller number of initial trials (one salt synthesis attempt per counterion) that were selected based on a few strategic solubility determinations of the free form combined with a theoretical analysis of the ideal solvent solubility conditions for salt formation. Salt screening results for sertraline, tamoxifen, and trazodone using the rational approach were compared to those previously generated by HT screening. The rational approach produced similar results to HT screening, including identification of the commercially chosen salt forms, but with a fraction of the crystallization attempts. Moreover, the rational approach provided enough solid from the very initial crystallization of a salt for more thorough and reliable solid-state characterization and thus rapid decision-making. The crystallization techniques used in the rational approach mimic larger-scale process crystallization, allowing smoother technical transfer of the selected salt to the process chemist.

  2. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  3. Sixty-five radiation hybrids for the short arm of human chromosome 6: their value as a mapping panel and as a source for rapid isolation of new probes using repeat element-mediated PCR

    International Nuclear Information System (INIS)

    Zoghbi, H.Y.; McCall, A.E.; LeBorgne-Demarquoy, F.

    1991-01-01

    We have used an irradiation and fusion procedure to generate somatic cell hybrids that retain fragments of the short arm of human chromosome 6 (6p). To identify hybrids retaining human material, we performed repeat element-mediated PCR on crude lysates of cells from individual clones. Sixty-five hybrids were shown to contain human material and fifty of those contained one or more 6p-specific probes. Detailed characterization of these hybrids identified a subset that divides 6p into ten mapping intervals. Using repeat element-mediated PCR, we were able to isolate and map 61 new DNA fragments from specific regions of 6p. Fifteen of these fragments were used to screen for restriction fragment length polymorphisms (RFLPs), and nine identified RFLPs with one or more enzymes. The radiation hybrids described in this study provide a valuable resource for high-resolution mapping of 6p and for the rapid isolation of region-specific markers

  4. Implementation of the rapid cross section adjustment approach at General Electric

    International Nuclear Information System (INIS)

    Cowan, C.L.; Kujawski, E.; Protsik, R.

    1978-01-01

    The General Electric rapid cross section adjustment approach was developed to use the shielding factor method for formulating multigroup cross sections. In this approach, space- and composition-dependent cross sections for a particular reactor or shield design are prepared from a generalized cross section library by the use of resonance self-shielding factors, and by the adjustment of elastic scattering cross sections for the local neutron flux spectra. The principal tool in the cross section adjustment package is the data processing code TDOWN. This code was specified to give the user a high degree of flexibility in the analysis of advanced reactor designs. Of particular interest in the analysis of critical experiments is the ability to carry out cell heterogeneity self-shielding calculations using a multiregion equivalence relationship, and the homogenization of the cross sections over the specified cell with the flux weighting obtained from transport theory calculations. Extensive testing of the rapid cross section adjustment approach, including comparisons with Monte Carlo methods, indicated that this approach can be utilized with a high degree of confidence in the design analysis of complex fast reactor systems. 2 figures, 1 table

  5. App Factory: A flexible approach to rehabilitation engineering in an era of rapid technology advancement.

    Science.gov (United States)

    Jones, Michael; Mueller, James; Morris, John

    2017-01-01

    This article describes a flexible and effective approach to research and development in an era of rapid technological advancement. The approach relies on secondary dispersal of grant funds to commercial developers through a competitive selection process. This "App Factory" model balances the practical reliance on multi-year funding needed to sustain a rehabilitation engineering research center (RERC), with the need for agility and adaptability of development efforts undertaken in a rapidly changing technology environment. This approach also allows us to take advantage of technical expertise needed to accomplish a particular development task, and provides incentives to deliver successful products in a cost-effective manner. In this article, we describe the App Factory structure, process, and results achieved to date; and we discuss the lessons learned and the potential relevance of this approach for other grant-funded research and development efforts. Data presented on the direct costs and number of downloads of the 16 app development projects funded in the App Factory's first 3 years show that it can be an effective means for supporting focused, short-term assistive technology development projects.

  6. 'Rapid Learning health care in oncology' - an approach towards decision support systems enabling customised radiotherapy'.

    Science.gov (United States)

    Lambin, Philippe; Roelofs, Erik; Reymen, Bart; Velazquez, Emmanuel Rios; Buijsen, Jeroen; Zegers, Catharina M L; Carvalho, Sara; Leijenaar, Ralph T H; Nalbantov, Georgi; Oberije, Cary; Scott Marshall, M; Hoebers, Frank; Troost, Esther G C; van Stiphout, Ruud G P M; van Elmpt, Wouter; van der Weijden, Trudy; Boersma, Liesbeth; Valentini, Vincenzo; Dekker, Andre

    2013-10-01

    An overview of the Rapid Learning methodology, its results, and the potential impact on radiotherapy. Rapid Learning methodology is divided into four phases. In the data phase, diverse data are collected about past patients, treatments used, and outcomes. Innovative information technologies that support semantic interoperability enable distributed learning and data sharing without additional burden on health care professionals and without the need for data to leave the hospital. In the knowledge phase, prediction models are developed for new data and treatment outcomes by applying machine learning methods to data. In the application phase, this knowledge is applied in clinical practice via novel decision support systems or via extensions of existing models such as Tumour Control Probability models. In the evaluation phase, the predictability of treatment outcomes allows the new knowledge to be evaluated by comparing predicted and actual outcomes. Personalised or tailored cancer therapy ensures not only that patients receive an optimal treatment, but also that the right resources are being used for the right patients. Rapid Learning approaches combined with evidence based medicine are expected to improve the predictability of outcome and radiotherapy is the ideal field to study the value of Rapid Learning. The next step will be to include patient preferences in the decision making. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  7. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  8. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same...

  9. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  10. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  11. Comparison of bacterial culture and qPCR testing of rectal and pen floor samples as diagnostic approaches to detect enterotoxic Escherichia coli in nursery pigs

    DEFF Research Database (Denmark)

    Weber, N. R.; Nielsen, J. P.; Hjulsager, Charlotte Kristiane

    2017-01-01

    Enterotoxigenic E. coli (ETEC) are a major cause of diarrhoea in weaned pigs. The objective of this study was to evaluate the agreement at pen level among three different diagnostic approaches for the detection of ETEC in groups of nursery pigs with diarrhoea. The diagnostic approaches used were......: bacterial culturing of faecal samples from three pigs (per pen) with clinical diarrhoea and subsequent testing for virulence genes in E. coli isolates; bacterial culturing of pen floor samples and subsequent testing for virulence genes in E. coli isolates; qPCR testing of pen floor samples in order...... to determine the quantity of F18 and F4 genes. The study was carried out in three Danish pig herds and included 31 pens with a pen-level diarrhoea prevalence of > 25%, as well as samples from 93 diarrhoeic nursery pigs from these pens. All E. coli isolates were analysed by PCR and classified as ETEC when genes...

  12. A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

    Science.gov (United States)

    Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

    2015-01-01

    Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

  13. Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

    Science.gov (United States)

    Gell, I; Cubero, J; Melgarejo, P

    2007-12-01

    To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

  14. An SSP-PCR method for the rapid detection of disease-associated alleles HLA-A*29 and HLA-B*51.

    Science.gov (United States)

    Amstutz, U; Schaerer, D; Andrey, G; Wirthmueller, U; Largiadèr, C R

    2018-05-15

    HLA-A*29 and HLA-B*51 are associated with birdshot uveitis and Behçet's disease, respectively, and are used as a diagnostic criterion in patients with suspected disease, requiring their detection in diagnostic laboratories. While commercial tests for individual HLA alleles are available for other disease-associated HLA variants, no similar allele-specific assays are available for HLA-A*29 and -B*51. Here, we report SSP-PCR methods for the detection of HLA-A*29 and -B*51 using a single PCR reaction per allele. The assays were tested in 30 and 32 previously HLA-typed samples, respectively, representing >97% of HLA-A alleles and >93% of HLA-B alleles in a European population. A concordance of 100% was observed with previous typing results, validating these methods for use in a diagnostic or research context. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. A new PCR-based approach indicates the range of Clonorchis sinensis now extends to Central Thailand.

    Directory of Open Access Journals (Sweden)

    Rebecca J Traub

    Full Text Available Differentiation of the fish-borne trematodes belonging to the Opisthorchiidae, Heterophyidae and Lecithodendriidae is important from a clinical and epidemiological perspective, yet it is impossible to do using conventional coprological techniques, as the eggs are morphologically similar. Epidemiological investigation therefore currently relies on morphological examination of adult worms following expulsion chemotherapy. A PCR test capable of amplifying a segment of the internal transcribed spacer region of ribosomal DNA for the opisthorchiid and heterophyid flukes eggs taken directly from faeces was developed and evaluated in a rural community in central Thailand. The lowest quantity of DNA that could be amplified from individual adults of Opisthorchis viverrini, Clonorchis sinensis and Haplorchis taichui was estimated at 0.6 pg, 0.8 pg and 3 pg, respectively. The PCR was capable of detecting mixed infection with the aforementioned species of flukes under experimental conditions. A total of 11.6% of individuals in rural communities in Sanamchaikaet district, central Thailand, were positive for 'Opisthorchis-like' eggs in their faeces using conventional parasitological detection techniques. In comparison to microscopy, the PCR yielded a sensitivity and specificity of 71.0% and 76.7%, respectively. Analysis of the microscopy-positive PCR products revealed 64% and 23% of individuals to be infected with O. viverrini and C. sinensis, respectively. The remaining 13% (three individuals were identified as eggs of Didymozoidae, presumably being passed mechanically in the faeces following the ingestion of infected fishes. An immediate finding of this study is the identification and first report of a C. sinensis-endemic community in central Thailand. This extends the known range of this liver fluke in Southeast Asia. The PCR developed herein provides an important tool for the specific identification of liver and intestinal fluke species for future

  16. CGC/saturation approach for soft interactions at high energy: long range rapidity correlations

    International Nuclear Information System (INIS)

    Gotsman, E.; Maor, U.; Levin, E.

    2015-01-01

    In this paper we continue our program to construct a model for high energy soft interactions that is based on the CGC/saturation approach. The main result of this paper is that we have discovered a mechanism that leads to large long range rapidity correlations and results in large values of the correlation function R(y 1 , y 2 ) ≥ 1, which is independent of y 1 and y 2 . Such a behavior of the correlation function provides strong support for the idea that at high energies the system of partons that is produced is not only dense but also has strong attractive forces acting between the partons. (orig.)

  17. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  18. Use of a Real-Time PCR TaqMan Assay for Rapid Identification and Differentiation of Burkholderia pseudomallei and Burkholderia mallei

    OpenAIRE

    U'Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W. Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul

    2005-01-01

    A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.

  19. Validation of a commercial insulated isothermal PCR-based POCKIT test for rapid and easy detection of white spot syndrome virus infection in Litopenaeus vannamei.

    Directory of Open Access Journals (Sweden)

    Yun-Long Tsai

    Full Text Available Timely pond-side detection of white spot syndrome virus (WSSV plays a critical role in the implementation of bio-security measures to help minimize economic losses caused by white spot syndrome disease, an important threat to shrimp aquaculture industry worldwide. A portable device, namely POCKIT™, became available recently to complete fluorescent probe-based insulated isothermal PCR (iiPCR, and automatic data detection and interpretation within one hour. Taking advantage of this platform, the IQ Plus™ WSSV Kit with POCKIT system was established to allow simple and easy WSSV detection for on-site users. The assay was first evaluated for its analytical sensitivity and specificity performance. The 95% limit of detection (LOD of the assay was 17 copies of WSSV genomic DNA per reaction (95% confidence interval [CI], 13 to 24 copies per reaction. The established assay has detection sensitivity similar to that of OIE-registered IQ2000™ WSSV Detection and Protection System with serial dilutions of WSSV-positive Litopenaeus vannamei DNA. No cross-reaction signals were generated from infectious hypodermal and haematopoietic necrosis virus (IHHNV, monodon baculovirus (MBV, and hepatopancreatic parvovirus (HPV positive samples. Accuracy analysis using 700 L. vannamei of known WSSV infection status shows that the established assayhassensitivity93.5% (95% CI: 90.61-95.56% and specificity 97% (95% CI: 94.31-98.50%. Furthermore, no discrepancy was found between the two assays when 100 random L. vannamei samples were tested in parallel. Finally, excellent correlation was observed among test results of three batches of reagents with 64 samples analyzed in three different laboratories. Working in a portable device, IQ Plus™ WSSV Kit with POCKIT system allows reliable, sensitive and specific on-site detection of WSSV in L. vannamei.

  20. An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

  1. The Use of Infrared Thermography as a Novel Approach for Real-Time Validation of PCR Thermocyclers

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Löfström, Charlotta; Helleskov, Jens Bue

    2010-01-01

    Validation of PCR thermocycler performance is crucial to obtain reliable results. In this study, infrared (IR) thermography was evaluated as a novel validation tool. After stabilisation, no significant difference in the temperatures recorded using thermography and a reference blockbased system wa...... was found. By employing IR thermography, information about the length of the time until temperature stabilisation in the sample could be obtained. This study shows the potential of using IR thermography for validation of thermocyclers.......Validation of PCR thermocycler performance is crucial to obtain reliable results. In this study, infrared (IR) thermography was evaluated as a novel validation tool. After stabilisation, no significant difference in the temperatures recorded using thermography and a reference blockbased system...

  2. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  3. Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR.

    Science.gov (United States)

    Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich

    2010-12-01

    This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.

  4. A Method to Represent Heterogeneous Materials for Rapid Prototyping: The Matryoshka Approach.

    Science.gov (United States)

    Lei, Shuangyan; Frank, Matthew C; Anderson, Donald D; Brown, Thomas D

    The purpose of this paper is to present a new method for representing heterogeneous materials using nested STL shells, based, in particular, on the density distributions of human bones. Nested STL shells, called Matryoshka models, are described, based on their namesake Russian nesting dolls. In this approach, polygonal models, such as STL shells, are "stacked" inside one another to represent different material regions. The Matryoshka model addresses the challenge of representing different densities and different types of bone when reverse engineering from medical images. The Matryoshka model is generated via an iterative process of thresholding the Hounsfield Unit (HU) data using computed tomography (CT), thereby delineating regions of progressively increasing bone density. These nested shells can represent regions starting with the medullary (bone marrow) canal, up through and including the outer surface of the bone. The Matryoshka approach introduced can be used to generate accurate models of heterogeneous materials in an automated fashion, avoiding the challenge of hand-creating an assembly model for input to multi-material additive or subtractive manufacturing. This paper presents a new method for describing heterogeneous materials: in this case, the density distribution in a human bone. The authors show how the Matryoshka model can be used to plan harvesting locations for creating custom rapid allograft bone implants from donor bone. An implementation of a proposed harvesting method is demonstrated, followed by a case study using subtractive rapid prototyping to harvest a bone implant from a human tibia surrogate.

  5. Development and systematic validation of qPCR assays for rapid and reliable differentiation of Xylella fastidiosa strains causing citrus variegated chlorosis.

    Science.gov (United States)

    Li, Wenbin; Teixeira, Diva C; Hartung, John S; Huang, Qi; Duan, Yongping; Zhou, Lijuan; Chen, Jianchi; Lin, Hong; Lopes, Silvio; Ayres, A Juliano; Levy, Laurene

    2013-01-01

    The xylem-limited, Gram-negative, fastidious plant bacterium Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease affecting approximately half of the citrus plantations in the State of São Paulo, Brazil. The disease was recently found in Central America and is threatening the multi-billion U.S. citrus industry. Many strains of X. fastidiosa are pathogens or endophytes in various plants growing in the U.S., and some strains cross infect several host plants. In this study, a TaqMan-based assay targeting the 16S rDNA signature region was developed for the identification of X. fastidiosa at the species level. Another TaqMan-based assay was developed for the specific identification of the CVC strains. Both new assays have been systematically validated in comparison with the primer/probe sets from four previously published assays on one platform and under similar PCR conditions, and shown to be superior. The species specific assay detected all X. fastidiosa strains and did not amplify any other citrus pathogen or endophyte tested. The CVC-specific assay detected all CVC strains but did not amplify any non-CVC X. fastidiosa nor any other citrus pathogen or endophyte evaluated. Both sets were multiplexed with a reliable internal control assay targeting host plant DNA, and their diagnostic specificity and sensitivity remained unchanged. This internal control provides quality assurance for DNA extraction, performance of PCR reagents, platforms and operators. The limit of detection for both assays was equivalent to 2 to 10 cells of X. fastidiosa per reaction for field citrus samples. Petioles and midribs of symptomatic leaves of sweet orange harbored the highest populations of X. fastidiosa, providing the best materials for detection of the pathogen. These new species specific assay will be invaluable for molecular identification of X. fastidiosa at the species level, and the CVC specific assay will be very powerful for the

  6. A Method to Represent Heterogeneous Materials for Rapid Prototyping: The Matryoshka Approach

    Science.gov (United States)

    Lei, Shuangyan; Frank, Matthew C.; Anderson, Donald D.; Brown, Thomas D.

    2015-01-01

    Purpose The purpose of this paper is to present a new method for representing heterogeneous materials using nested STL shells, based, in particular, on the density distributions of human bones. Design/methodology/approach Nested STL shells, called Matryoshka models, are described, based on their namesake Russian nesting dolls. In this approach, polygonal models, such as STL shells, are “stacked” inside one another to represent different material regions. The Matryoshka model addresses the challenge of representing different densities and different types of bone when reverse engineering from medical images. The Matryoshka model is generated via an iterative process of thresholding the Hounsfield Unit (HU) data using computed tomography (CT), thereby delineating regions of progressively increasing bone density. These nested shells can represent regions starting with the medullary (bone marrow) canal, up through and including the outer surface of the bone. Findings The Matryoshka approach introduced can be used to generate accurate models of heterogeneous materials in an automated fashion, avoiding the challenge of hand-creating an assembly model for input to multi-material additive or subtractive manufacturing. Originality/Value This paper presents a new method for describing heterogeneous materials: in this case, the density distribution in a human bone. The authors show how the Matryoshka model can be used to plan harvesting locations for creating custom rapid allograft bone implants from donor bone. An implementation of a proposed harvesting method is demonstrated, followed by a case study using subtractive rapid prototyping to harvest a bone implant from a human tibia surrogate. PMID:26120277

  7. Rapid diagnosis and identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima, Peru Diagnóstico e identificación rápidos por PCR de Yersinia ruckeri aislada de Oncorhynchus mykiss procedentes de Canta, Lima, Perú

    Directory of Open Access Journals (Sweden)

    Susana Sirvas-Cornejo

    2012-02-01

    Full Text Available Twenty individuals of rainbow trout were sampled (fry and juveniles from Acochinchan Fishfarm (Canta, Lima - Peru, and analyzed with the Polimerase Chain Reaction test (PCR in order to achieve a rapid identification of Yersinia ruckeri, which is the pathogen agent that causes the enteric red mouth disease (ERM and produces high rates of mortality. Nine fish samples were asymptomatic, while 11 of them showed signs of ERM. In addition, 22 bacterial strains were isolated from the liver, spleen and kidney. PCR and specific primers (16S rRNA, were used to amplified a specific 575 bp DNA fragment of Yersinia ruckeri. Nineteen strains were identified as Yersinia ruckeri by PCR in symptomatic and asymptomatic fishes. It was established a diagnosis time of 26 hours, compared with the 2 or 3 days that would take the diagnosis using biochemical tests.Se muestrearon 20 ejemplares (alevines y juveniles de trucha arco iris cultivados en la piscifactoría Acochinchán (Canta, Lima, Perú, y se les aplico la técnica de la Reacción en Cadena de la Polimerasa (PCR con la finalidad de obtener una identificación rápida del agente patógeno Yersinia ruckeri que produce la enfermedad entérica de la boca roja (ERM y genera elevadas tasas de mortalidad. Nueve ejemplares fueron asintomáticos mientras que 11 presentaron signos de ERM. Se aislaron 22 cepas bacterianas del hígado, bazo y riñón. Se empleó la técnica de la PCR para la amplificación y cebadores específicos (ARNr 16S, que permitieron amplificar un fragmento de ADN de 575 pb de Yersinia ruckeri. Diecinueve cepas fueron identificadas como Yersinia ruckeri mediante la PCR, tanto en peces sintomáticos como asintomáticos. Se estableció un tiempo de diagnóstico de 26 horas, en comparación con los 2 ó 3 días que duraría el diagnóstico empleando las pruebas bioquímicas.

  8. Four-channel asymmetric Real-Time PCR hybridization probe assay: a rapid pre-screening method for critical BCR-ABL kinase domain mutations.

    Science.gov (United States)

    Martinez-Serra, Jordi; Gutiérrez, Antonio; Marcús, Toni F; Soverini, Simona; Amat, Juan Carlos; Navarro-Palou, María; Ros, Teresa; Bex, Teresa; Ballester, Carmen; Bauça, Josep Miquel; SanFelix, Sara; Novo, Andrés; Vidal, Carmen; Santos, Carmen; Besalduch, Joan

    2012-03-01

    Within the laboratory protocols, used for the study of BCR-ABL resistance mutations in chronic myeloid leukemia patients treated with Imatinib, direct sequencing remains the reference method. Since the incidence of patients with a mutation-related loss of response is not very high, it is very useful in the routine laboratory to perform a fast pre-screening method. With this in mind, we have designed a new technique, based on a single Real-Time FRET-based PCR, followed by a study of melting peaks. This new tool, developed in a LightCycler 2.0, combines four different fluorescence channels for the simultaneous detection, in a single close tube, of critical mutations within the ABL kinase domain. Assay evaluation performed on 33 samples, previously genotyped by sequentiation, resulted in full concordance of results. This new methodology detects in a few steps the presence of critical mutations associated to Imatinib resistance. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  10. Rapid detection and identification of Stachybotrys and Chaetomium species using tissue PCR analysis

    DEFF Research Database (Denmark)

    Lewinska, Anna Malgorzata; Peuhkuri, Ruut Hannele; Rode, Carsten

    2016-01-01

    level is essential for health risk assessment and building remediation. This study focuses on molecular identification of two common indoor fungal genera: Stachybotrys and Chaetomium. This study proposes two new DNA barcode candidates for Stachybotrys and Chaetomium: the gene encoding mitogen activated...... protein kinase (hogA) and the intergenic region between histone 3 and histone 4 (h3-h4) as well as it introduces a rapid - 3.5 h - protocol for direct Stachybotrys and Chaetomium species identification, which bypasses culture cultivation, DNA extraction and DNA sequencing....

  11. Comprehensive and Methodical: Diagnostic and Management Approaches to Rapidly Progressive Dementia.

    Science.gov (United States)

    Mahajan, Supriya; Appleby, Brian S

    2017-09-30

    Purpose of review The sudden emergence of a change in cognitive abilities or behavior is an important symptom that warrants medical evaluation and may represent the early stages of a rapidly progressive dementia (RPD). To correctly ascertain the cause of RPD in a given patient, the clinician must be methodical and knowledgeable about the range of potential causes and must move forward with supportive treatment, and in some cases empiric treatment, based on clinical features alone. Recent findings Significant advances in prion disease biomarkers, the molecular features of rapidly progressive Alzheimer's disease, and new detection of autoimmune limbic encephalitis disease entities have caused a shift in the diagnostic and treatment framework of RPD. Additionally, in the past decade, emerging retrospective data have led to suggested treatments in autoimmune encephalitis that, if instituted early, can protect patients against residual deficits and disease relapse. Summary Here, we provide an integrative clinical and diagnostic treatment approach that is applicable to the various forms of RPD. We have highlighted the clinical features of selected types of RPD that have experienced advances in the last 10-15 years.

  12. A rapid assessment and response approach for socially marketed nutrition commodities in Viet Nam.

    Science.gov (United States)

    Turk, Tahir; Quang, Nguyen Dinh; Nga, Tran Thuy; Phuong, Huynh; Tung, Le Van Anh; Trang, Vu Hoang

    2017-01-01

    The leading cause of death in children in developing countries is protein-energy malnutrition. In Viet Nam, 25.9% of children under 5 experience stunted growth and 6.6% are moderately wasted. Iron deficiency anaemia and vitamin A deficiency contribute to these and other malnutrition conditions. Given these factors, more evidence based approaches are required to improve understanding of current attitudes, opinions and behaviours of mothers with young children, in order to operationalise social marketing of nutrition commodities in Viet Nam. A literature review supported a rapid assessment and response method involving semi-structured interviews with 77 stakeholders and focus group discussions with 80 program beneficiaries from four geographic locations in the north and south of Viet Nam. Discussion agendas were developed to address key program issues with grounded theory utilized for data analysis. Data analysis highlighted challenges and opportunities within the six Ps of social marketing: Supply and demand side issues included: cost and the quality of products, the limited scale of interventions and promotional activities. Policy issues identified related to current policies that inhibited the broader promotion and distribution of micronutrient products, and opportunities for improved dialogue with policy partners. Partnerships further emphasized the need for public private partnerships to support the social change process. Implications for theory, policy, and practice indicates that rapid assessment and response is a cost-effective, pragmatic method of public health research, in resource constrained settings, to explore policies and behaviours amenable to change and build stakeholder engagement in the program.

  13. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  14. Assessment of variable fluorescence fluorometry as an approach for rapidly detecting living photoautotrophs in ballast water

    Science.gov (United States)

    First, Matthew R.; Robbins-Wamsley, Stephanie H.; Riley, Scott C.; Drake, Lisa A.

    2018-03-01

    Variable fluorescence fluorometry, an analytical approach that estimates the fluorescence yield of chlorophyll a (F0, a proximal measure of algal concentration) and photochemical yield (FV/FM, an indicator of the physiological status of algae) was evaluated as a means to rapidly assess photoautotrophs. Specifically, it was used to gauge the efficacy of ballast water treatment designed to reduce the transport and delivery of potentially invasive organisms. A phytoflagellate, Tetraselmis spp. (10-12 μm) and mixed communities of ambient protists were examined in both laboratory experiments and large-scale field trials simulating 5-d hold times in mock ballast tanks. In laboratory incubations, ambient organisms held in the dark exhibited declining F0 and FV/FM measurements relative to organisms held under lighted conditions. In field experiments, increases and decreases in F0 and FV/FM over the tank hold time corresponded to those of microscope counts of organisms in two of three trials. In the third trial, concentrations of organisms ≥ 10 and protists) increased while F0 and FV/FM decreased. Rapid and sensitive, variable fluorescence fluorometry is appropriate for detecting changes in organism concentrations and physiological status in samples dominated by microalgae. Changes in the heterotrophic community, which may become more prevalent in light-limited ballast tanks, would not be detected via variable fluorescence fluorometry, however.

  15. CGC/saturation approach for soft interactions at high energy: long range rapidity correlations

    Energy Technology Data Exchange (ETDEWEB)

    Gotsman, E.; Maor, U. [Tel Aviv University, Department of Particle Physics, School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Science, Tel Aviv (Israel); Levin, E. [Tel Aviv University, Department of Particle Physics, School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Science, Tel Aviv (Israel); Universidad Tecnica Federico Santa Maria and Centro Cientifico- Tecnologico de Valparaiso, Departemento de Fisica, Valparaiso (Chile)

    2015-11-15

    In this paper we continue our program to construct a model for high energy soft interactions that is based on the CGC/saturation approach. The main result of this paper is that we have discovered a mechanism that leads to large long range rapidity correlations and results in large values of the correlation function R(y{sub 1}, y{sub 2}) ≥ 1, which is independent of y{sub 1} and y{sub 2}. Such a behavior of the correlation function provides strong support for the idea that at high energies the system of partons that is produced is not only dense but also has strong attractive forces acting between the partons. (orig.)

  16. Rapid assessment of antimicrobial resistance prevalence using a Lot Quality Assurance sampling approach.

    Science.gov (United States)

    van Leth, Frank; den Heijer, Casper; Beerepoot, Mariëlle; Stobberingh, Ellen; Geerlings, Suzanne; Schultsz, Constance

    2017-04-01

    Increasing antimicrobial resistance (AMR) requires rapid surveillance tools, such as Lot Quality Assurance Sampling (LQAS). LQAS classifies AMR as high or low based on set parameters. We compared classifications with the underlying true AMR prevalence using data on 1335 Escherichia coli isolates from surveys of community-acquired urinary tract infection in women, by assessing operating curves, sensitivity and specificity. Sensitivity and specificity of any set of LQAS parameters was above 99% and between 79 and 90%, respectively. Operating curves showed high concordance of the LQAS classification with true AMR prevalence estimates. LQAS-based AMR surveillance is a feasible approach that provides timely and locally relevant estimates, and the necessary information to formulate and evaluate guidelines for empirical treatment.

  17. A novel genotoxin-specific qPCR array based on the metabolically competent human HepaRG™ cell line as a rapid and reliable tool for improved in vitro hazard assessment.

    Science.gov (United States)

    Ates, Gamze; Mertens, Birgit; Heymans, Anja; Verschaeve, Luc; Milushev, Dimiter; Vanparys, Philippe; Roosens, Nancy H C; De Keersmaecker, Sigrid C J; Rogiers, Vera; Doktorova, Tatyana Y

    2018-04-01

    Although the value of the regulatory accepted batteries for in vitro genotoxicity testing is recognized, they result in a high number of false positives. This has a major impact on society and industries developing novel compounds for pharmaceutical, chemical, and consumer products, as afflicted compounds have to be (prematurely) abandoned or further tested on animals. Using the metabolically competent human HepaRG ™ cell line and toxicogenomics approaches, we have developed an upgraded, innovative, and proprietary gene classifier. This gene classifier is based on transcriptomic changes induced by 12 genotoxic and 12 non-genotoxic reference compounds tested at sub-cytotoxic concentrations, i.e., IC10 concentrations as determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The resulting gene classifier was translated into an easy-to-handle qPCR array that, as shown by pathway analysis, covers several different cellular processes related to genotoxicity. To further assess the predictivity of the tool, a set of 5 known positive and 5 known negative test compounds for genotoxicity was evaluated. In addition, 2 compounds with debatable genotoxicity data were tested to explore how the qPCR array would classify these. With an accuracy of 100%, when equivocal results were considered positive, the results showed that combining HepaRG ™ cells with a genotoxin-specific qPCR array can improve (geno)toxicological hazard assessment. In addition, the developed qPCR array was able to provide additional information on compounds for which so far debatable genotoxicity data are available. The results indicate that the new in vitro tool can improve human safety assessment of chemicals in general by basing predictions on mechanistic toxicogenomics information.

  18. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  19. Rapid detection of Echinococcus species by a high-resolution melting (HRM) approach.

    Science.gov (United States)

    Santos, Guilherme Brzoskowski; Espínola, Sergio Martín; Ferreira, Henrique Bunselmeyer; Margis, Rogerio; Zaha, Arnaldo

    2013-11-14

    High-resolution melting (HRM) provides a low-cost, fast and sensitive scanning method that allows the detection of DNA sequence variations in a single step, which makes it appropriate for application in parasite identification and genotyping. The aim of this work was to implement an HRM-PCR assay targeting part of the mitochondrial cox1 gene to achieve an accurate and fast method for Echinococcus spp. differentiation. For melting analysis, a total of 107 samples from seven species were used in this study. The species analyzed included Echinococcus granulosus (n = 41) and Echinococcus ortleppi (n = 50) from bovine, Echinococcus vogeli (n = 2) from paca, Echinococcus oligarthra (n = 3) from agouti, Echinococcus multilocularis (n = 6) from monkey and Echinococcus canadensis (n = 2) and Taenia hydatigena (n = 3) from pig. DNA extraction was performed, and a 444-bp fragment of the cox1 gene was amplified. Two approaches were used, one based on HRM analysis, and a second using SYBR Green Tm-based. In the HRM analysis, a specific profile for each species was observed. Although some species exhibited almost the same melting temperature (Tm) value, the HRM profiles could be clearly discriminated. The SYBR Green Tm-based analysis showed differences between E. granulosus and E. ortleppi and between E. vogeli and E. oligarthra. In this work, we report the implementation of HRM analysis to differentiate species of the genus Echinococcus using part of the mitochondrial gene cox1. This method may be also potentially applied to identify other species belonging to the Taeniidae family.

  20. Force scanning: a rapid, high-resolution approach for spatial mechanical property mapping

    International Nuclear Information System (INIS)

    Darling, E M

    2011-01-01

    Atomic force microscopy (AFM) can be used to co-localize mechanical properties and topographical features through property mapping techniques. The most common approach for testing biological materials at the microscale and nanoscale is force mapping, which involves taking individual force curves at discrete sites across a region of interest. The limitations of force mapping include long testing times and low resolution. While newer AFM methodologies, like modulated scanning and torsional oscillation, circumvent this problem, their adoption for biological materials has been limited. This could be due to their need for specialized software algorithms and/or hardware. The objective of this study is to develop a novel force scanning technique using AFM to rapidly capture high-resolution topographical images of soft biological materials while simultaneously quantifying their mechanical properties. Force scanning is a straightforward methodology applicable to a wide range of materials and testing environments, requiring no special modification to standard AFMs. Essentially, if a contact-mode image can be acquired, then force scanning can be used to produce a spatial modulus map. The current study first validates this technique using agarose gels, comparing results to ones achieved by the standard force mapping approach. Biologically relevant demonstrations are then presented for high-resolution modulus mapping of individual cells, cell-cell interfaces, and articular cartilage tissue.

  1. Neurohormones, Brain, and Behavior: A Comparative Approach to Understanding Rapid Neuroendocrine Action.

    Science.gov (United States)

    Calisi, Rebecca M; Saldanha, Colin J

    2015-08-01

    The definition of a hormone has been in part delineated by its journey to distant receptor targets. Following activation of a receptor, a subsequent reaction facilitates the regulation of physiology and, ultimately, behavior. However, a growing number of studies report that hormones can influence these events at a previously underappreciated high speed. With the potential to act as neurotransmitters, the definition of a hormone and its mechanisms of action are evolving. In this symposium, we united scientists who use contemporary molecular, electrophysiological, and biochemical approaches to study aspects of rapid hormone action in a broad array of systems across different levels of biological organization. What emerged was an overwhelming consensus that the use of integrative and comparative approaches fuels discovery and increases our understanding of de novo hormone synthesis, local actions of neurohormones, and subsequent effects on neuroplasticity and behavior. © The Author 2015. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  2. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  3. A novel approach for high precision rapid potentiometric titrations: application to hydrazine assay.

    Science.gov (United States)

    Sahoo, P; Malathi, N; Ananthanarayanan, R; Praveen, K; Murali, N

    2011-11-01

    We propose a high precision rapid personal computer (PC) based potentiometric titration technique using a specially designed mini-cell to carry out redox titrations for assay of chemicals in quality control laboratories attached to industrial, R&D, and nuclear establishments. Using this technique a few microlitre of sample (50-100 μl) in a total volume of ~2 ml solution can be titrated and the waste generated after titration is extremely low comparing to that obtained from the conventional titration technique. The entire titration including online data acquisition followed by immediate offline analysis of data to get information about concentration of unknown sample is completed within a couple of minutes (about 2 min). This facility has been created using a new class of sensors, viz., pulsating sensors developed in-house. The basic concept in designing such instrument and the salient features of the titration device are presented in this paper. The performance of the titration facility was examined by conducting some of the high resolution redox titrations using dilute solutions--hydrazine against KIO(3) in HCl medium, Fe(II) against Ce(IV) and uranium using Davies-Gray method. The precision of titrations using this innovative approach lies between 0.048% and 1.0% relative standard deviation in different redox titrations. With the evolution of this rapid PC based titrator it was possible to develop a simple but high precision potentiometric titration technique for quick determination of hydrazine in nuclear fuel dissolver solution in the context of reprocessing of spent nuclear fuel in fast breeder reactors. © 2011 American Institute of Physics

  4. HRP2 and pLDH-Based Rapid Diagnostic Tests, Expert Microscopy, and PCR for Detection of Malaria Infection during Pregnancy and at Delivery in Areas of Varied Transmission: A Prospective Cohort Study in Burkina Faso and Uganda.

    Directory of Open Access Journals (Sweden)

    Daniel J Kyabayinze

    Full Text Available Intermittent screening and treatment (IST of malaria during pregnancy has been proposed as an alternative to intermittent preventive treatment in pregnancy (IPTp, where IPTp is failing due to drug resistance. However, the antenatal parasitaemias are frequently very low, and the most appropriate screening test for IST has not been defined.We conducted a multi-center prospective study of 990 HIV-uninfected women attending ANC in two different malaria transmission settings at Tororo District Hospital, eastern Uganda and Colsama Health Center in western Burkina Faso. Women were enrolled in the study in the second or third trimester of pregnancy and followed to delivery, generating 2,597 blood samples for analysis. Screening tests included rapid diagnostic tests (RDTs targeting histidine-rich protein 2 (HRP2 and parasite lactate dehydrogenase (pLDH and microscopy, compared to nPCR as a reference standard. At enrolment, the proportion of pregnant women who were positive for P. falciparum by HRP2/pan pLDH RDT, Pf pLDH/pan pLDH RDT, microscopy and PCR was 38%, 29%, 36% and 44% in Uganda and 21%, 16%, 15% and 35% in Burkina Faso, respectively. All test positivity rates declined during follow-up. In comparison to PCR, the sensitivity of the HRP2/pan pLDH RDT, Pf pLDH/pan pLDH RDT and microscopy was 75.7%, 60.1% and 69.7% in Uganda, 55.8%, 42.6% and 55.8% in Burkina Faso respectively for all antenatal visits. Specificity was greater than 96% for all three tests. Comparison of accuracy using generalized estimating equation revealed that the HRP2- detecting RDT was the most accurate test in both settings.The study suggests that HRP2-based RDTs are the most appropriate point-of-care test currently available for use during pregnancy especially for symptomatic women, but will still miss some PCR-positive women. The clinical significance of these very low density infections needs to be better defined.

  5. Multiplex real-time quantitative PCR, microscopy and rapid diagnostic immuno-chromatographic tests for the detection of Plasmodium spp: performance, limit of detection analysis and quality assurance

    Directory of Open Access Journals (Sweden)

    Ralevski Filip

    2009-12-01

    Full Text Available Abstract Background Accurate laboratory diagnosis of malaria species in returning travelers is paramount in the treatment of this potentially fatal infectious disease. Materials and methods A total of 466 blood specimens from returning travelers to Africa, Asia, and South/Central America with suspected malaria infection were collected between 2007 and 2009 at the reference public health laboratory. These specimens were assessed by reference microscopy, multipex real-time quantitative polymerase chain reaction (QPCR, and two rapid diagnostic immuno-chromatographic tests (ICT in a blinded manner. Key clinical laboratory parameters such as limit of detection (LOD analysis on clinical specimens by parasite stage, inter-reader variability of ICTs, staffing implications, quality assurance and cost analysis were evaluated. Results QPCR is the most analytically sensitive method (sensitivity 99.41%, followed by CARESTART (sensitivity 88.24%, and BINAXNOW (sensitivity 86.47% for the diagnosis of malaria in returning travelers when compared to reference microscopy. However, microscopy was unable to specifically identify Plasmodia spp. in 18 out of 170 positive samples by QPCR. Moreover, the 17 samples that were negative by microscopy and positive by QPCR were also positive by ICTs. Quality assurance was achieved for QPCR by exchanging a blinded proficiency panel with another reference laboratory. The Kappa value of inter-reader variability among three readers for BINAXNOW and CARESTART was calculated to be 0.872 and 0.898 respectively. Serial dilution studies demonstrated that the QPCR cycle threshold correlates linearly with parasitemia (R2 = 0.9746 in a clinically relevant dynamic range and retains a LOD of 11 rDNA copies/μl for P. falciparum, which was several log lower than reference microscopy and ICTs. LOD for QPCR is affected not only by parasitemia but the parasite stage distribution of each clinical specimen. QPCR was approximately 6-fold more

  6. Comparison of bacterial culture and qPCR testing of rectal and pen floor samples as diagnostic approaches to detect enterotoxic Escherichia coli in nursery pigs

    DEFF Research Database (Denmark)

    Weber, N. R.; Nielsen, J. P.; Hjulsager, Charlotte Kristiane

    2017-01-01

    Enterotoxigenic E. coli (ETEC) are a major cause of diarrhoea in weaned pigs. The objective of this study was to evaluate the agreement at pen level among three different diagnostic approaches for the detection of ETEC in groups of nursery pigs with diarrhoea. The diagnostic approaches used were...... to determine the quantity of F18 and F4 genes. The study was carried out in three Danish pig herds and included 31 pens with a pen-level diarrhoea prevalence of > 25%, as well as samples from 93 diarrhoeic nursery pigs from these pens. All E. coli isolates were analysed by PCR and classified as ETEC when genes...... was observed between the detection of ETEC by bacterial culture and qPCR in the same pen floor sample in 26 (83.9%, Kappa = 0.679) pens. Conclusion: We observed an acceptable agreement for the detection of ETEC-positive diarrhoeic nursery pigs in pen samples for both bacterial culture of pen floor samples...

  7. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  8. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae.

    Directory of Open Access Journals (Sweden)

    Nicole Roschanski

    Full Text Available Beta-lactamase resistant bacteria and especially ESBL producing Enterobacteriaceae are an increasing problem worldwide. For this reason a major interest in efficient and reliable methods for rapid screening of high sample numbers is recognizable. Therefore, a multiplex real-time PCR was developed to detect the predominant class A beta-lactamase genes blaCTX-M, blaSHV, blaTEM and CIT-type AmpCs in a one-step reaction. A set of 114 Enterobacteriaceae containing previously identified resistance gene subtypes and in addition 20 undefined animal and environmental isolates were used for the validation of this assay. To confirm the accessibility in variable settings, the real-time runs were performed analogous in two different laboratories using different real-time cyclers. The obtained results showed complete accordance between the real-time data and the predetermined genotypes. Even if sequence analyses are further necessary for a comprehensive characterization, this method was proofed to be reliable for rapid screening of high sample numbers and therefore could be an important tool for e. g. epidemiological purposes or support infection control measures.

  9. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  10. Rapid Fishery Assessment by Market Survey (RFAMS--an improved rapid-assessment approach to characterising fish landings in developing countries.

    Directory of Open Access Journals (Sweden)

    William T White

    Full Text Available The complex multi-gear, multi-species tropical fisheries in developing countries are poorly understood and characterising the landings from these fisheries is often impossible using conventional approaches. A rapid assessment method for characterising landings at fish markets, using an index of abundance and estimated weight within taxonomic groups, is described. This approach was developed for contexts where there are no detailed data collection protocols, and where consistent data collection across a wide range of fisheries types and geographic areas is required, regardless of the size of the site and scale of the landings. This methodology, which was demonstrated at seven fish landing sites/fish markets in southern Indonesia between July 2008 and January 2011, provides a rapid assessment of the abundance and diversity in the wild catch over a wide variety of taxonomic groups. The approach has wider application for species-rich fisheries in developing countries where there is an urgent need for better data collection protocols, monitoring future changes in market demographics, and evaluating health of fisheries.

  11. VA announces aggressive new approach to produce rapid improvements in VA medical centers

    Directory of Open Access Journals (Sweden)

    Robbins RA

    2018-02-01

    Full Text Available No abstract available. Article truncated at 150 words. The U.S. Department of Veterans Affairs (VA announced steps that it is taking as part of an aggressive new approach to produce rapid improvements at VA’s low-performing medical facilities nationwide (1. VA defines its low-performing facilities as those medical centers that receive the lowest score in its Strategic Analytics for Improvement and Learning (SAIL star rating system, or a one-star rating out of five. The SAIL star rating was initiated in 2016 and uses a variety of measures including mortality, length of hospital stay, readmission rates, hospital complications, physician productivity and efficiency. A complete listing of the VA facilities, their star ratings and the metrics used to determine the ratings is available through the end of fiscal year 2017 (2. Based on the latest ratings, the VA currently has 15 one-star facilities including Denver, Loma Linda, and Phoenix in the Southwest (Table 1. Table 1. VA facilities with one-star ratings …

  12. Non-equiatomic high entropy alloys: Approach towards rapid alloy screening and property-oriented design

    Energy Technology Data Exchange (ETDEWEB)

    Pradeep, K.G. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Materials Chemistry, RWTH Aachen University, Kopernikusstr.10, 52074 Aachen (Germany); Tasan, C.C., E-mail: c.tasan@mpie.de [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Yao, M.J. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Deng, Y. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Department of Engineering Design and Materials, Norwegian University of Science and Technology, No-7491 Trondheim (Norway); Springer, H. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Raabe, D., E-mail: d.raabe@mpie.de [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany)

    2015-11-11

    The high entropy alloy (HEA) concept has triggered a renewed interest in alloy design, even though some aspects of the underlying thermodynamic concepts are still under debate. This study addresses the short-comings of this alloy design strategy with the aim to open up new directions of HEA research targeting specifically non-equiatomic yet massively alloyed compositions. We propose that a wide range of massive single phase solid solutions could be designed by including non-equiatomic variants. It is demonstrated by introducing a set of novel non-equiatomic multi-component CoCrFeMnNi alloys produced by metallurgical rapid alloy prototyping. Despite the reduced configurational entropy, detailed characterization of these materials reveals a strong resemblance to the well-studied equiatomic single phase HEA: The microstructure of these novel alloys exhibits a random distribution of alloying elements (confirmed by Energy-Dispersive Spectroscopy and Atom Probe Tomography) in a single face-centered-cubic phase (confirmed by X-ray Diffraction and Electron Backscatter Diffraction), which deforms through planar slip (confirmed by Electron-Channeling Contrast Imaging) and leads to excellent ductility (confirmed by uniaxial tensile tests). This approach widens the field of HEAs to non-equiatomic multi-component alloys since the concept enables to tailor the stacking fault energy and associated transformation phenomena which act as main mechanisms to design useful strain hardening behavior.

  13. Non-equiatomic high entropy alloys: Approach towards rapid alloy screening and property-oriented design

    International Nuclear Information System (INIS)

    Pradeep, K.G.; Tasan, C.C.; Yao, M.J.; Deng, Y.; Springer, H.; Raabe, D.

    2015-01-01

    The high entropy alloy (HEA) concept has triggered a renewed interest in alloy design, even though some aspects of the underlying thermodynamic concepts are still under debate. This study addresses the short-comings of this alloy design strategy with the aim to open up new directions of HEA research targeting specifically non-equiatomic yet massively alloyed compositions. We propose that a wide range of massive single phase solid solutions could be designed by including non-equiatomic variants. It is demonstrated by introducing a set of novel non-equiatomic multi-component CoCrFeMnNi alloys produced by metallurgical rapid alloy prototyping. Despite the reduced configurational entropy, detailed characterization of these materials reveals a strong resemblance to the well-studied equiatomic single phase HEA: The microstructure of these novel alloys exhibits a random distribution of alloying elements (confirmed by Energy-Dispersive Spectroscopy and Atom Probe Tomography) in a single face-centered-cubic phase (confirmed by X-ray Diffraction and Electron Backscatter Diffraction), which deforms through planar slip (confirmed by Electron-Channeling Contrast Imaging) and leads to excellent ductility (confirmed by uniaxial tensile tests). This approach widens the field of HEAs to non-equiatomic multi-component alloys since the concept enables to tailor the stacking fault energy and associated transformation phenomena which act as main mechanisms to design useful strain hardening behavior.

  14. Rapid wasted-free microfluidic fabrication based on ink-jet approach for microfluidic sensing applications

    Science.gov (United States)

    Jarujareet, Ungkarn; Amarit, Rattasart; Sumriddetchkajorn, Sarun

    2016-11-01

    Realizing that current microfluidic chip fabrication techniques are time consuming and labor intensive as well as always have material leftover after chip fabrication, this research work proposes an innovative approach for rapid microfluidic chip production. The key idea relies on a combination of a widely-used inkjet printing method and a heat-based polymer curing technique with an electronic-mechanical control, thus eliminating the need of masking and molds compared to typical microfluidic fabrication processes. In addition, as the appropriate amount of polymer is utilized during printing, there is much less amount of material wasted. Our inkjet-based microfluidic printer can print out the desired microfluidic chip pattern directly onto a heated glass surface, where the printed polymer is suddenly cured. Our proof-of-concept demonstration for widely-used single-flow channel, Y-junction, and T-junction microfluidic chips shows that the whole microfluidic chip fabrication process requires only 3 steps with a fabrication time of 6 minutes.

  15. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  16. Insights Into the Bifunctional Aphidicolan-16-ß-ol Synthase Through Rapid Biomolecular Modeling Approaches.

    Science.gov (United States)

    Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B

    2018-01-01

    the enzyme's active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modeling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.

  17. Insights Into the Bifunctional Aphidicolan-16-ß-ol Synthase Through Rapid Biomolecular Modeling Approaches

    Directory of Open Access Journals (Sweden)

    Max Hirte

    2018-04-01

    restricted location of the enzyme's active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modeling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.

  18. Insights into the bifunctional Aphidicolan-16-ß-ol synthase through rapid biomolecular modelling approaches

    Science.gov (United States)

    Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.

    2018-04-01

    of the enzyme’s active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modelling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.

  19. IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

    Directory of Open Access Journals (Sweden)

    Ervi Salwati

    2012-09-01

    Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

  20. Prospective evaluation of commercial antibody-based rapid tests in combination with a loop-mediated isothermal amplification PCR assay for detection of Orientia tsutsugamushi during the acute phase of scrub typhus infection.

    Science.gov (United States)

    Blacksell, Stuart D; Paris, Daniel H; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Teeratakul, Achara; Kantipong, Pacharee; Day, Nicholas P J

    2012-03-01

    Samples from 160 prospectively recruited febrile patients with typhus-like illness in an area of Thailand (Chiang Rai, northern Thailand) where scrub typhus is endemic were used to evaluate the diagnostic capabilities of four rapid immunochromatographic tests (ICTs) for the detection of Orientia tsutsugamushi IgM and total antibodies during acute scrub typhus infection. Of the 160 cases, 54 (34%) had been confirmed to have scrub typhus using the reference scrub typhus infection criteria (STIC), i.e., positive cell culture isolation, an admission IgM antibody titer of ≥1:12,800, a 4-fold rising IgM antibody titer, and/or positivity for ≥2 out of 3 PCR gene targets). The ICTs gave the following sensitivities and specificities: the Panbio IgM ICT, 46% (95% confidence interval [CI], 33 to 60) and 95% (95% CI, 89 to 98), respectively; the Standard Diagnostics IgM ICT, 68% (95% CI, 60 to 75) and 73% (95% CI, 68 to 78), respectively; the AccessBio IgM ICT, 56% (95% CI, 48 to 63) and 90% (95% CI, 87 to 94), respectively; and the AccessBio total antibody ABt ICT, 61% (95% CI, 53 to 68) and 68% (95% CI, 63 to 73), respectively. An isothermal loop amplification (LAMP) PCR assay for scrub typhus demonstrated a sensitivity of 52% (95% CI, 38 to 66) and a specificity of 94% (95% CI, 88 to 98). This study has revealed the diagnostic limitations of antibody-based assays in an acute care setting. However, the combination of ICTs with LAMP usually increased sensitivity with a minimal reduction in specificity. The best combination, the Panbio IgM ICT and LAMP, resulted in a sensitivity of 67% (95% CI, 53 to 79) and a specificity of 91% (95% CI, 83 to 95). The combination of antibody-based assays with DNA- or antigen-based tests shows promise for improved diagnostic sensitivity.

  1. The diagnostic sensitivity of dengue rapid test assays is significantly enhanced by using a combined antigen and antibody testing approach.

    Directory of Open Access Journals (Sweden)

    Scott R Fry

    2011-06-01

    Full Text Available BACKGROUND: Serological tests for IgM and IgG are routinely used in clinical laboratories for the rapid diagnosis of dengue and can differentiate between primary and secondary infections. Dengue virus non-structural protein 1 (NS1 has been identified as an early marker for acute dengue, and is typically present between days 1-9 post-onset of illness but following seroconversion it can be difficult to detect in serum. AIMS: To evaluate the performance of a newly developed Panbio® Dengue Early Rapid test for NS1 and determine if it can improve diagnostic sensitivity when used in combination with a commercial IgM/IgG rapid test. METHODOLOGY: The clinical performance of the Dengue Early Rapid was evaluated in a retrospective study in Vietnam with 198 acute laboratory-confirmed positive and 100 negative samples. The performance of the Dengue Early Rapid in combination with the IgM/IgG Rapid test was also evaluated in Malaysia with 263 laboratory-confirmed positive and 30 negative samples. KEY RESULTS: In Vietnam the sensitivity and specificity of the test was 69.2% (95% CI: 62.8% to 75.6% and 96% (95% CI: 92.2% to 99.8 respectively. In Malaysia the performance was similar with 68.9% sensitivity (95% CI: 61.8% to 76.1% and 96.7% specificity (95% CI: 82.8% to 99.9% compared to RT-PCR. Importantly, when the Dengue Early Rapid test was used in combination with the IgM/IgG test the sensitivity increased to 93.0%. When the two tests were compared at each day post-onset of illness there was clear differentiation between the antigen and antibody markers. CONCLUSIONS: This study highlights that using dengue NS1 antigen detection in combination with anti-glycoprotein E IgM and IgG serology can significantly increase the sensitivity of acute dengue diagnosis and extends the possible window of detection to include very early acute samples and enhances the clinical utility of rapid immunochromatographic testing for dengue.

  2. 'Rapid Learning health care in oncology' - An approach towards decision support systems enabling customised radiotherapy'

    NARCIS (Netherlands)

    Lambin, P.; Roelofs, E.; Reymen, B.; Velazquez, E.R.; Buijsen, J.; Zegers, C.M.; Carvalho, S.; Leijenaar, R.T.; Nalbantov, G.; Oberije, C.; Marshall, M.; Hoebers, F.; Troost, E.G.C.; Stiphout, R.G.; Elmpt, W. van; Weijden, T.T. van der; Boersma, L.; Valentini, V.; Dekker, A.

    2013-01-01

    PURPOSE: An overview of the Rapid Learning methodology, its results, and the potential impact on radiotherapy. MATERIAL AND RESULTS: Rapid Learning methodology is divided into four phases. In the data phase, diverse data are collected about past patients, treatments used, and outcomes. Innovative

  3. Complementing approaches to demonstrate chlorinated solvent biodegradation in a complex pollution plume: Mass balance, PCR and compound-specific stable isotope analysis

    Science.gov (United States)

    Courbet, Christelle; Rivière, Agnès; Jeannottat, Simon; Rinaldi, Sandro; Hunkeler, Daniel; Bendjoudi, Hocine; de Marsily, Ghislain

    2011-11-01

    , although TCE biodegradation seems to occur only in the upgradient part of the studied zone, DCE and VC dechlorination (originating from the initial TCE dechlorination) occurs along the entire flowpath. TCE reductase was not detected among the Dehalococcoides bacteria identified by quantitative PCR (qPCR), while DCE and VC reductases were present in the majority of the population. Reverse transcriptase PCR assays (rt-PCR) also indicated that bacteria and their DCE and VC reductases were active. Mass balance calculations showed moreover that 1,1-DCE was the predominant DCE isomer produced by TCE dechlorination in the upgradient part of the site. Consequently, coupling rt-PCR assays with isotope measurements removes the uncertainties inherent in a simple mass balance approach, so that when the three methods are used jointly, they allow the identification and quantification of natural biodegradation, even under apparently complex geochemical and hydraulic conditions.

  4. Status and future transition of rapid urbanizing landscape in central Western Ghats - CA based approach

    Science.gov (United States)

    Bharath, S..; Rajan, K. S.; Ramachandra, T. V.

    2014-11-01

    The land use changes in forested landscape are highly complex and dynamic, affected by the natural, socio-economic, cultural, political and other factors. The remote sensing (RS) and geographical information system (GIS) techniques coupled with multi-criteria evaluation functions such as Markov-cellular automata (CA-Markov) model helps in analysing intensity, extent and future forecasting of human activities affecting the terrestrial biosphere. Karwar taluk of Central Western Ghats in Karnataka state, India has seen rapid transitions in its forest cover due to various anthropogenic activities, primarily driven by major industrial activities. A study based on Landsat and IRS derived data along with CA-Markov method has helped in characterizing the patterns and trends of land use changes over a period of 2004-2013, expected transitions was predicted for a set of scenarios through 2013-2022. The analysis reveals the loss of pristine forest cover from 75.51% to 67.36% (1973 to 2013) and increase in agriculture land as well as built-up area of 8.65% (2013), causing impact on local flora and fauna. The other factors driving these changes are the aggregated level of demand for land, local and regional effects of land use activities such as deforestation, improper practices in expansion of agriculture and infrastructure development, deteriorating natural resources availability. The spatio temporal models helped in visualizing on-going changes apart from prediction of likely changes. The CA-Markov based analysis provides us insights into the localized changes impacting these regions and can be useful in developing appropriate mitigation management approaches based on the modelled future impacts. This necessitates immediate measures for minimizing the future impacts.

  5. A meta-model based approach for rapid formability estimation of continuous fibre reinforced components

    Science.gov (United States)

    Zimmerling, Clemens; Dörr, Dominik; Henning, Frank; Kärger, Luise

    2018-05-01

    Due to their high mechanical performance, continuous fibre reinforced plastics (CoFRP) become increasingly important for load bearing structures. In many cases, manufacturing CoFRPs comprises a forming process of textiles. To predict and optimise the forming behaviour of a component, numerical simulations are applied. However, for maximum part quality, both the geometry and the process parameters must match in mutual regard, which in turn requires numerous numerically expensive optimisation iterations. In both textile and metal forming, a lot of research has focused on determining optimum process parameters, whilst regarding the geometry as invariable. In this work, a meta-model based approach on component level is proposed, that provides a rapid estimation of the formability for variable geometries based on pre-sampled, physics-based draping data. Initially, a geometry recognition algorithm scans the geometry and extracts a set of doubly-curved regions with relevant geometry parameters. If the relevant parameter space is not part of an underlying data base, additional samples via Finite-Element draping simulations are drawn according to a suitable design-table for computer experiments. Time saving parallel runs of the physical simulations accelerate the data acquisition. Ultimately, a Gaussian Regression meta-model is built from the data base. The method is demonstrated on a box-shaped generic structure. The predicted results are in good agreement with physics-based draping simulations. Since evaluations of the established meta-model are numerically inexpensive, any further design exploration (e.g. robustness analysis or design optimisation) can be performed in short time. It is expected that the proposed method also offers great potential for future applications along virtual process chains: For each process step along the chain, a meta-model can be set-up to predict the impact of design variations on manufacturability and part performance. Thus, the method is

  6. A multiple-proxy approach to understanding rapid Holocene climate change in Southeast Greenland

    Science.gov (United States)

    Davin, S. H.; Bradley, R. S.; Balascio, N. L.; de Wet, G.

    2012-12-01

    The susceptibility of the Arctic to climate change has made it an excellent workshop for paleoclimatological research. Although there have been previous studies concerning climate variability carried out in the Arctic, there remains a critical dearth of knowledge due the limited number of high-resolution Holocene climate-proxy records available from this region. This gap skews our understanding of observed and predicted climate change, and fuels uncertainty both in the realms of science and policy. This study takes a comprehensive approach to tracking Holocene climate variability in the vicinity of Tasiilaq, Southeast Greenland using a ~5.6 m sediment core from Lower Sermilik Lake. An age-depth model for the core has been established using 8 radiocarbon dates, the oldest of which was taken at 4 m down core and has been been dated to approximately 6.2 kyr BP. The bottom meter of the core below the final radiocarbon date contains a transition from cobbles and coarse sand to organic-rich laminations, indicating the termination of direct glacial influence and therefore likely marking the end of the last glacial period in this region. The remainder of the core is similarly organic-rich, with light-to-dark brown laminations ranging from 0.5 -1 cm in thickness and riddled with turbidites. Using this core in tandem with findings from an on-site assessment of the geomorphic history of the locale we attempt to assess and infer the rapid climatic shifts associated with the Holocene on a sub-centennial scale. Such changes include the termination of the last glacial period, the Mid-Holocene Climatic Optimum, the Neoglacial Period, the Medieval Climatic Optimum, and the Little Ice Age. A multiple proxy approach including magnetic susceptibility, bulk organic geochemistry, elemental profiles acquired by XRF scanning, grain-size, and spectral data will be used to characterize the sediment and infer paleoclimate conditions. Additionally, percent biogenic silica by weight has been

  7. Evaluation of a rapid LMP-based approach for calculating marginal unit emissions

    International Nuclear Information System (INIS)

    Rogers, Michelle M.; Wang, Yang; Wang, Caisheng; McElmurry, Shawn P.; Miller, Carol J.

    2013-01-01

    Graphical abstract: Display Omitted - Highlights: • Pollutant emissions estimated based on locational marginal price and eGRID data. • Stochastic model using IEEE RTS-96 system used to evaluate LMP approach. • Incorporating membership function enhanced reliability of pollutant estimate. • Error in pollutant estimate typically 2 and X and SO 2 . - Abstract: To evaluate the sustainability of systems that draw power from electrical grids there is a need to rapidly and accurately quantify pollutant emissions associated with power generation. Air emissions resulting from electricity generation vary widely among power plants based on the types of fuel consumed, the efficiency of the plant, and the type of pollution control systems in service. To address this need, methods for estimating real-time air emissions from power generation based on locational marginal prices (LMPs) have been developed. Based on LMPs the type of the marginal generating unit can be identified and pollutant emissions are estimated. While conceptually demonstrated, this LMP approach has not been rigorously tested. The purpose of this paper is to (1) improve the LMP method for predicting pollutant emissions and (2) evaluate the reliability of this technique through power system simulations. Previous LMP methods were expanded to include marginal emissions estimates using an LMP Emissions Estimation Method (LEEM). The accuracy of emission estimates was further improved by incorporating a probability distribution function that characterize generator fuel costs and a membership function (MF) capable of accounting for multiple marginal generation units. Emission estimates were compared to those predicted from power flow simulations. The improved LEEM was found to predict the marginal generation type approximately 70% of the time based on typical system conditions (e.g. loads and fuel costs) without the use of a MF. With the addition of a MF, the LEEM was found to provide emission estimates with

  8. Quantitative Real Time PCR approach to study gene expression profile during prenatal growth of skeletal muscle in pig of Duroc and Pietrain breeds

    Directory of Open Access Journals (Sweden)

    M. Cagnazzo

    2010-01-01

    Full Text Available The quantitative real time-PCR (QRT-PCR is a very sensitive method used to quantify mRNA level in gene expression analysis. Combining amplification, detection and quantification in a single step, allows a more accurate measurement compared to the traditional PCR end point analysis (Pfaffl, 2001; Bustin, 2002.

  9. Using a Microscale Approach to Rapidly Separate and Characterize Three Photosynthetic Pigment Species from Fern

    Science.gov (United States)

    Ayudhya, Theppawut Israsena Na; Posey, Frederick T.; Tyus, Jessica C.; Dingra, Nin N.

    2015-01-01

    A rapid separation of three photosynthetic pigments (chlorophyll "a" and "b" and xanthophyll) from fern ("Polystichum acrostichoides") is described using microscale solvent extraction and traditional thin layer chromatography that minimizes use of harmful chemicals and lengthy procedures. The experiment introduces…

  10. A Comprehensive Quality Evaluation System for Complex Herbal Medicine Using PacBio Sequencing, PCR-Denaturing Gradient Gel Electrophoresis, and Several Chemical Approaches

    Science.gov (United States)

    Zheng, Xiasheng; Zhang, Peng; Liao, Baosheng; Li, Jing; Liu, Xingyun; Shi, Yuhua; Cheng, Jinle; Lai, Zhitian; Xu, Jiang; Chen, Shilin

    2017-01-01

    Herbal medicine is a major component of complementary and alternative medicine, contributing significantly to the health of many people and communities. Quality control of herbal medicine is crucial to ensure that it is safe and sound for use. Here, we investigated a comprehensive quality evaluation system for a classic herbal medicine, Danggui Buxue Formula, by applying genetic-based and analytical chemistry approaches to authenticate and evaluate the quality of its samples. For authenticity, we successfully applied two novel technologies, third-generation sequencing and PCR-DGGE (denaturing gradient gel electrophoresis), to analyze the ingredient composition of the tested samples. For quality evaluation, we used high performance liquid chromatography assays to determine the content of chemical markers to help estimate the dosage relationship between its two raw materials, plant roots of Huangqi and Danggui. A series of surveys were then conducted against several exogenous contaminations, aiming to further access the efficacy and safety of the samples. In conclusion, the quality evaluation system demonstrated here can potentially address the authenticity, quality, and safety of herbal medicines, thus providing novel insight for enhancing their overall quality control. Highlight: We established a comprehensive quality evaluation system for herbal medicine, by combining two genetic-based approaches third-generation sequencing and DGGE (denaturing gradient gel electrophoresis) with analytical chemistry approaches to achieve the authentication and quality connotation of the samples. PMID:28955365

  11. A Comprehensive Quality Evaluation System for Complex Herbal Medicine Using PacBio Sequencing, PCR-Denaturing Gradient Gel Electrophoresis, and Several Chemical Approaches

    Directory of Open Access Journals (Sweden)

    Xiasheng Zheng

    2017-09-01

    Full Text Available Herbal medicine is a major component of complementary and alternative medicine, contributing significantly to the health of many people and communities. Quality control of herbal medicine is crucial to ensure that it is safe and sound for use. Here, we investigated a comprehensive quality evaluation system for a classic herbal medicine, Danggui Buxue Formula, by applying genetic-based and analytical chemistry approaches to authenticate and evaluate the quality of its samples. For authenticity, we successfully applied two novel technologies, third-generation sequencing and PCR-DGGE (denaturing gradient gel electrophoresis, to analyze the ingredient composition of the tested samples. For quality evaluation, we used high performance liquid chromatography assays to determine the content of chemical markers to help estimate the dosage relationship between its two raw materials, plant roots of Huangqi and Danggui. A series of surveys were then conducted against several exogenous contaminations, aiming to further access the efficacy and safety of the samples. In conclusion, the quality evaluation system demonstrated here can potentially address the authenticity, quality, and safety of herbal medicines, thus providing novel insight for enhancing their overall quality control.Highlight: We established a comprehensive quality evaluation system for herbal medicine, by combining two genetic-based approaches third-generation sequencing and DGGE (denaturing gradient gel electrophoresis with analytical chemistry approaches to achieve the authentication and quality connotation of the samples.

  12. A Comprehensive Quality Evaluation System for Complex Herbal Medicine Using PacBio Sequencing, PCR-Denaturing Gradient Gel Electrophoresis, and Several Chemical Approaches.

    Science.gov (United States)

    Zheng, Xiasheng; Zhang, Peng; Liao, Baosheng; Li, Jing; Liu, Xingyun; Shi, Yuhua; Cheng, Jinle; Lai, Zhitian; Xu, Jiang; Chen, Shilin

    2017-01-01

    Herbal medicine is a major component of complementary and alternative medicine, contributing significantly to the health of many people and communities. Quality control of herbal medicine is crucial to ensure that it is safe and sound for use. Here, we investigated a comprehensive quality evaluation system for a classic herbal medicine, Danggui Buxue Formula, by applying genetic-based and analytical chemistry approaches to authenticate and evaluate the quality of its samples. For authenticity, we successfully applied two novel technologies, third-generation sequencing and PCR-DGGE (denaturing gradient gel electrophoresis), to analyze the ingredient composition of the tested samples. For quality evaluation, we used high performance liquid chromatography assays to determine the content of chemical markers to help estimate the dosage relationship between its two raw materials, plant roots of Huangqi and Danggui. A series of surveys were then conducted against several exogenous contaminations, aiming to further access the efficacy and safety of the samples. In conclusion, the quality evaluation system demonstrated here can potentially address the authenticity, quality, and safety of herbal medicines, thus providing novel insight for enhancing their overall quality control. Highlight : We established a comprehensive quality evaluation system for herbal medicine, by combining two genetic-based approaches third-generation sequencing and DGGE (denaturing gradient gel electrophoresis) with analytical chemistry approaches to achieve the authentication and quality connotation of the samples.

  13. An evidence-based approach for investment in rapid-charging infrastructure

    International Nuclear Information System (INIS)

    Serradilla, Javier; Wardle, Josey; Blythe, Phil; Gibbon, Jane

    2017-01-01

    To date, real cost data for Electric Vehicle (EV) rapid charging infrastructure is largely missing in the literature, preventing development of economic models to encourage private investment and limiting policy decisions. A business model has been constructed using actual capital expenditure, operating costs and usage data from the Rapid Charge Network project (RCN) which can be used to assist future investment and policy decisions. The model is run under a wide spectrum of EV uptake scenarios to provide plausible answers to a variety of research, policy and investment questions, including minimum growth rates to break even under current policy. Using real-world data we have confirmed that a financial business opportunity does exist for investment in rapid chargers on main highways and have identified the operating area in which a profit can be made. However, since UK EV adoption is still at the Innovators stage in a niche market where innovations in technology, user practices, supporting infrastructure and functionality are still required to achieve wide user acceptance, the case is also made for continued fiscal incentives to encourage investment in rapid-charging infrastructure. - Highlights: • Uses actual cost and use data to propose credible business model for EV rapid charging. • Identifies a profit area for successful operation. • Applying 3.3 electricity mark-up over 10 year investment period gives financial return. • EV uptake and Drivers’ willingness to pay remain key constraints. • Fiscal incentives would encourage private investment where demand is uncertain.

  14. Rapid assessment of antimicrobial resistance prevalence using a Lot Quality Assurance sampling approach

    NARCIS (Netherlands)

    van Leth, Frank; den Heijer, Casper; Beerepoot, Marielle; Stobberingh, Ellen; Geerlings, Suzanne; Schultsz, Constance

    2017-01-01

    Increasing antimicrobial resistance (AMR) requires rapid surveillance tools, such as Lot Quality Assurance Sampling (LQAS). LQAS classifies AMR as high or low based on set parameters. We compared classifications with the underlying true AMR prevalence using data on 1335 Escherichia coli isolates

  15. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2018-05-01

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  16. Evaluating different approaches to non-destructive nitrogen status diagnosis of rice using portable RapidSCAN active canopy sensor.

    Science.gov (United States)

    Lu, Junjun; Miao, Yuxin; Shi, Wei; Li, Jingxin; Yuan, Fei

    2017-10-26

    RapidSCAN is a new portable active crop canopy sensor with three wavebands in red, red-edge, and near infrared spectral regions. The objective of this study was to determine the potential and practical approaches of using this sensor for non-destructive diagnosis of rice nitrogen (N) status. Sixteen plot experiments and ten on-farm experiments were conducted from 2014 to 2016 in Jiansanjiang Experiment Station of the China Agricultural University and Qixing Farm in Northeast China. Two mechanistic and three semi-empirical approaches using the sensor's default vegetation indices, normalized difference vegetation index and normalized difference red edge, were evaluated in comparison with the top performing vegetation indices selected from 51 tested indices. The results indicated that the most practical and stable method of using the RapidSCAN sensor for rice N status diagnosis is to calculate N sufficiency index with the default vegetation indices and then to estimate N nutrition index non-destructively (R 2  = 0.50-0.59). This semi-empirical approach achieved a diagnosis accuracy rate of 59-76%. The findings of this study will facilitate the application of the RapidSCAN active sensor for rice N status diagnosis across growth stages, cultivars and site-years, and thus contributing to precision N management for sustainable intensification of agriculture.

  17. A comparative expression analysis of gene transcripts in brain tissue of non-transgenic and GH-transgenic zebrafish (Danio rerio using a DDRT-PCR approach

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2012-06-01

    Full Text Available The presence of higher level of exogenous growth hormone (GH in transgenic animals could lead to several physiological alterations. A GH transgenic zebrafish (Danio rerio line was compared to nontransgenic (NT samples of the species through a DDRT-PCR approach, with the goal of identifying candidate differentially expressed transcripts in brain tissues that could be involved in GH overexpression. Densitometric analyses of two selected amplification products, p300 and ADCY2, pointed to a significant lower gene expression in the transgenic zebrafish (104.02 ± 57.71; 224.10 ± 91.73 when compared to NT samples (249.75 ± 30.08; 342.95 ± 65.19. The present data indicate that p300 and ADCY2 are involved in a regulation system for GH when high circulating levels of this hormone are found in zebrafishes.A presença de níveis mais elevados do hormônio de crescimento (GH em animais transgênicos poderia levar a várias alterações fisiológicas. Uma linhagem transgênica de paulistinha (Danio rerio para o GH foi comparada com amostras não transgênicas (NT desta espécie, através de uma abordagem de DDRT-PCR, com o objetivo de identificar transcritos candidatos diferencialmente expressos em tecido cerebral que poderiam estar envolvidos na superexpressão de GH. Análises densitométricas de dois produtos de amplificação selecionados, p300 e ADCY2, apontaram uma expressão gênica significativamente menor nas amostras transgênicas de paulistinha (104.02 ± 57.71; 224.10 ± 91.73, quando comparadas com as amostras NT (249.75 ± 30.08; 342.95±65.19. Os presentes dados indicam que p300 e ADCY2 estão envolvidos em um sistema de regulação do GH, quando altos níveis circulantes desse hormônio são encontrados em paulistinha.

  18. SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

    Science.gov (United States)

    Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

    2015-06-26

    There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein

  19. Rapid Learning health care in oncology’ – An approach towards decision support systems enabling customised radiotherapy’

    International Nuclear Information System (INIS)

    Lambin, Philippe; Roelofs, Erik; Reymen, Bart; Velazquez, Emmanuel Rios; Buijsen, Jeroen; Zegers, Catharina M.L.; Carvalho, Sara; Leijenaar, Ralph T.H.; Nalbantov, Georgi; Oberije, Cary; Scott Marshall, M.; Hoebers, Frank; Troost, Esther G.C.; Stiphout, Ruud G.P.M. van; Elmpt, Wouter van; Weijden, Trudy van der; Boersma, Liesbeth; Valentini, Vincenzo; Dekker, Andre

    2013-01-01

    Purpose: An overview of the Rapid Learning methodology, its results, and the potential impact on radiotherapy. Material and results: Rapid Learning methodology is divided into four phases. In the data phase, diverse data are collected about past patients, treatments used, and outcomes. Innovative information technologies that support semantic interoperability enable distributed learning and data sharing without additional burden on health care professionals and without the need for data to leave the hospital. In the knowledge phase, prediction models are developed for new data and treatment outcomes by applying machine learning methods to data. In the application phase, this knowledge is applied in clinical practice via novel decision support systems or via extensions of existing models such as Tumour Control Probability models. In the evaluation phase, the predictability of treatment outcomes allows the new knowledge to be evaluated by comparing predicted and actual outcomes. Conclusion: Personalised or tailored cancer therapy ensures not only that patients receive an optimal treatment, but also that the right resources are being used for the right patients. Rapid Learning approaches combined with evidence based medicine are expected to improve the predictability of outcome and radiotherapy is the ideal field to study the value of Rapid Learning. The next step will be to include patient preferences in the decision making

  20. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2013-06-01

    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  1. A simple and rapid approach to develop recombinant avian herpesvirus vectored vaccines using CRISPR/Cas9 system.

    Science.gov (United States)

    Tang, Na; Zhang, Yaoyao; Pedrera, Miriam; Chang, Pengxiang; Baigent, Susan; Moffat, Katy; Shen, Zhiqiang; Nair, Venugopal; Yao, Yongxiu

    2018-01-29

    Herpesvirus of turkeys (HVT) has been successfully used as live vaccine against Marek's disease (MD) worldwide for more than 40 years either alone or in combination with other serotypes. HVT is also widely used as a vector platform for generation of recombinant vaccines against a number of avian diseases such as infectious bursal disease (IBD), Newcastle disease (ND) and avian influenza (AI) using conventional recombination methods or recombineering tools on cloned viral genomes. In the present study, we describe the application of CRISPR/Cas9-based genome editing as a rapid and efficient method of generating HVT recombinants expressing VP2 protein of IBDV. This approach offers an efficient method to introduce other viral antigens into the HVT genome for rapid development of recombinant vaccines. Copyright © 2018 The Pirbright Institute. Published by Elsevier Ltd.. All rights reserved.

  2. Gardening in the desert: a spatial optimization approach to locating gardens in rapidly expanding urban environments.

    Science.gov (United States)

    Mack, Elizabeth A; Tong, Daoqin; Credit, Kevin

    2017-10-16

    Food access is a global issue, and for this reason, a wealth of studies are dedicated to understanding the location of food deserts and the benefits of urban gardens. However, few studies have linked these two strands of research together to analyze whether urban gardening activity may be a step forward in addressing issues of access for food desert residents. The Phoenix, Arizona metropolitan area is used as a case to demonstrate the utility of spatial optimization models for siting urban gardens near food deserts and on vacant land. The locations of urban gardens are derived from a list obtained from the Maricopa County Cooperative Extension office at the University of Arizona which were geo located and aggregated to Census tracts. Census tracts were then assigned to one of three categories: tracts that contain a garden, tracts that are immediately adjacent to a tract with a garden, and all other non-garden/non-adjacent census tracts. Analysis of variance is first used to ascertain whether there are statistical differences in the demographic, socio-economic, and land use profiles of these three categories of tracts. A maximal covering spatial optimization model is then used to identify potential locations for future gardening activities. A constraint of these models is that gardens be located on vacant land, which is a growing problem in rapidly urbanizing environments worldwide. The spatial analysis of garden locations reveals that they are centrally located in tracts with good food access. Thus, the current distribution of gardens does not provide an alternative food source to occupants of food deserts. The maximal covering spatial optimization model reveals that gardens could be sited in alternative locations to better serve food desert residents. In fact, 53 gardens may be located to cover 96.4% of all food deserts. This is an improvement over the current distribution of gardens where 68 active garden sites provide coverage to a scant 8.4% of food desert

  3. Rapid capillary electrophoresis approach for the quantification of ewe milk adulteration with cow milk.

    Science.gov (United States)

    Trimboli, Francesca; Morittu, Valeria Maria; Cicino, Caterina; Palmieri, Camillo; Britti, Domenico

    2017-10-13

    The substitution of ewe milk with more economic cow milk is a common fraud. Here we present a capillary electrophoresis method for the quantification of ewe milk in ovine/bovine milk mixtures, which allows for the rapid and inexpensive recognition of ewe milk adulteration with cow milk. We utilized a routine CE method for human blood and urine proteins analysis, which fulfilled the separation of skimmed milk proteins in alkaline buffer. Under this condition, ovine and bovine milk exhibited a recognizable and distinct CE protein profiles, with a specific ewe peak showing a reproducible migration zone in ovine/bovine mixtures. Based on ewe specific CE peak, we developed a method for ewe milk quantification in ovine/bovine skimmed milk mixtures, which showed good linearity, precision and accuracy, and a minimum amount of detectable fraudulent cow milk equal to 5%. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Implementation of Bus Rapid Transit in Copenhagen: A Mesoscopic Model Approach

    DEFF Research Database (Denmark)

    Ingvardson, Jesper Bláfoss; Kornerup Jensen, Jonas

    2012-01-01

    Bus Rapid Transit(BRT) has shown to be an efficient and cost-effective mode of public transport, and has gained popularity in many cities around the world.To optimise the operations and infrastructure it is advantageous to deploy transportmodels. However, microscopic models are very inefficient...... upgrades (busways and enhanced stations) ensure a reduction to traveltime whereas no improvements to reliability occur. Upgrades to technology and serviceplanning (pre-paid fare collection, boarding and alighting from all doors, special BRT vehicles, ITS, and active bus control) ensure an increase...... in service reliability whereas only small reductions to travel time are observed. By combining all BRT elements it is possible to obtain synergies where the improved reliability due to planning and technology elements makes it possible to utilise the infrastructure optimally. Hence, it is possible...

  5. Scalable Approach to Highly Efficient and Rapid Capacitive Deionization with CNT-Thread As Electrodes.

    Science.gov (United States)

    Moronshing, Maku; Subramaniam, Chandramouli

    2017-11-22

    A scalable route to highly efficient purification of water through capacitive deionization (CDI) is reported using CNT-thread as electrodes. Electro-sorption capacity (q e ) of 139 mg g -1 and average salt-adsorption rate (ASAR) of 2.78 mg g -1 min -1 achieved here is the highest among all known electrode materials and nonmembrane techniques, indicating efficient and rapid deionization. Such exceptional performance is achieved with feedstock concentrations (≤1000 ppm) where conventional techniques such as reverse osmosis and electrodialysis prove ineffective. Further, both cations (Na + , K + , Mg 2+ , and Ca 2+ ) and anions (Cl - , SO 4 2- and NO 3 - ) are removed with equally high efficiency (∼80%). Synergism between electrical conductivity (∼25 S cm -1 ), high specific surface area (∼900 m 2 g -1 ), porosity (0.7 nm, 3 nm) and hydrophilicity (contact angle ∼25°) in CNT-thread electrode enable superior contact with water, rapid formation of extensive electrical double layer and consequently efficient deionization. The tunable capacitance of the device (0.4-120 mF) and its high specific capacitance (∼27.2 F g -1 ) enable exceptional performance across a wide range of saline concentrations (50-1000 ppm). Facile regeneration of the electrode and reusability of the device is achieved for several cycles. The device demonstrated can desalinate water as it trickles down its surface because of gravity, thereby eliminating the requirement of any water pumping system. Finally, its portable adaptability is demonstrated by operating the device with an AA battery.

  6. Rapid approach for cloning bacterial single-genes directly from soils ...

    African Journals Online (AJOL)

    Obtaining functional genes of bacteria from environmental samples usually depends on library-based approach which is not favored as its large amount of work with small possibility of positive clones. A kind of bacterial single-gene encoding glutamine synthetase (GS) was selected as example to detect the efficiency of ...

  7. "Ultra-rapid" sequential treatment in cholecystocholedocholithiasis: alternative same-day approach to laparoendoscopic rendezvous.

    Science.gov (United States)

    Borreca, Dario; Bona, Alberto; Bellomo, Maria Paola; Borasi, Andrea; De Paolis, Paolo

    2015-12-01

    There is still no consensus about timing of laparoscopic cholecystectomy after endoscopic retrograde cholangiopancreatography in the treatment of cholecystocholedocholithiasis. The aim of our retrospective study is to analyze the optimal timing of surgical treatment in patients presenting concurrent choledocholithiasis, choosing to perform a sequential endoscopic plus surgical approach, introducing a same-day two-stage alternative. All cases of cholecystocholedocholithiasis occurred between January 2007 and December 2014 in "Gradenigo" Hospital (Turin-Italy) were reviewed. Patients were divided into three groups, based on the timing of cholecystectomy after endoscopic retrograde cholangiopancreatography, and compared. Out of 2233 cholecystectomies performed in the mentioned time interval, have been identified 93 patients that fulfill the selection criteria. 36 patients were treated with a same-day approach, while 29 within first 72 h and 28 with delayed surgery. The overall length of stay was significantly lower in patients that were treated with a same-day approach (4.7 days), compared with other groups (p = 0.001), while no significant differences were found in terms of length of surgical intervention, intraoperative complications and conversions to open procedure, postoperative stay, morbidity and mortality. Patients treated with delayed surgery had a 18 % recurrency rate of biliary events, with an odds ratio of 14.13 (p = 0.018). Same-day two-stage approach should be performed in suitable patients at the index admission, reducing overall risks, improving the patients' quality-of-life, preventing recurrency, leading to a significant cost abatement; furthermore, this approach allows same outcomes of laparoendoscopic rendezvous, avoiding technical and organizational troubles.

  8. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  9. NEBNext Direct: A Novel, Rapid, Hybridization-Based Approach for the Capture and Library Conversion of Genomic Regions of Interest.

    Science.gov (United States)

    Emerman, Amy B; Bowman, Sarah K; Barry, Andrew; Henig, Noa; Patel, Kruti M; Gardner, Andrew F; Hendrickson, Cynthia L

    2017-07-05

    Next-generation sequencing (NGS) is a powerful tool for genomic studies, translational research, and clinical diagnostics that enables the detection of single nucleotide polymorphisms, insertions and deletions, copy number variations, and other genetic variations. Target enrichment technologies improve the efficiency of NGS by only sequencing regions of interest, which reduces sequencing costs while increasing coverage of the selected targets. Here we present NEBNext Direct ® , a hybridization-based, target-enrichment approach that addresses many of the shortcomings of traditional target-enrichment methods. This approach features a simple, 7-hr workflow that uses enzymatic removal of off-target sequences to achieve a high specificity for regions of interest. Additionally, unique molecular identifiers are incorporated for the identification and filtering of PCR duplicates. The same protocol can be used across a wide range of input amounts, input types, and panel sizes, enabling NEBNext Direct to be broadly applicable across a wide variety of research and diagnostic needs. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  10. A rapid and rational approach to generating isomorphous heavy-atom phasing derivatives.

    Science.gov (United States)

    Lu, Jinghua; Sun, Peter D

    2014-09-01

    In attempts to replace the conventional trial-and-error heavy-atom derivative search method with a rational approach, we previously defined heavy metal compound reactivity against peptide ligands. Here, we assembled a composite pH- and buffer-dependent peptide reactivity profile for each heavy metal compound to guide rational heavy-atom derivative search. When knowledge of the best-reacting heavy-atom compound is combined with mass spectrometry assisted derivatization, and with a quick-soak method to optimize phasing, it is likely that the traditional heavy-atom compounds could meet the demand of modern high-throughput X-ray crystallography. As an example, we applied this rational heavy-atom phasing approach to determine a previously unknown mouse serum amyloid A2 crystal structure. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  11. Whole cell based electrical impedance sensing approach for a rapid nanotoxicity assay

    Energy Technology Data Exchange (ETDEWEB)

    Hondroulis, Evangelia; Liu Chang; Li Chenzhong, E-mail: licz@fiu.edu [Nanobioengineering/Bioelectronics Laboratory, Department of Biomedical Engineering, Florida International University, 10555 West Flagler Street, Miami, FL 33174 (United States)

    2010-08-06

    A whole cell based biosensor for rapid real-time testing of human and environmental toxicity of nanoscale materials is reported. Recent studies measuring nanoparticle cytotoxicity in vitro provide a final measurement of toxicity to a cell culture overlooking the ongoing cytotoxic effects of the nanoparticles over the desired timeframe. An array biosensor capable of performing multiple cytotoxicity assays simultaneously was designed to address the need for a consistent method to measure real-time assessments of toxicity. The impedimetric response of human lung fibroblasts (CCL-153) and rainbow trout gill epithelial cells (RTgill-W1) when exposed to gold and silver nanoparticles (AuNPs, AgNPs), single walled carbon nanotubes (SWCNTs) and cadmium oxide (CdO) was tested. Exposure to CdO particles exhibited the fastest rate of cytotoxicity and demonstrated the biosensor's ability to monitor toxicity instantaneously in real time. Advantages of the present method include shorter run times, easier usage, and multi-sample analysis leading to a method that can monitor the kinetic effects of nanoparticle toxicity continuously over a desired timeframe.

  12. Whole cell based electrical impedance sensing approach for a rapid nanotoxicity assay

    Science.gov (United States)

    Hondroulis, Evangelia; Liu, Chang; Li, Chen-Zhong

    2010-08-01

    A whole cell based biosensor for rapid real-time testing of human and environmental toxicity of nanoscale materials is reported. Recent studies measuring nanoparticle cytotoxicity in vitro provide a final measurement of toxicity to a cell culture overlooking the ongoing cytotoxic effects of the nanoparticles over the desired timeframe. An array biosensor capable of performing multiple cytotoxicity assays simultaneously was designed to address the need for a consistent method to measure real-time assessments of toxicity. The impedimetric response of human lung fibroblasts (CCL-153) and rainbow trout gill epithelial cells (RTgill-W1) when exposed to gold and silver nanoparticles (AuNPs, AgNPs), single walled carbon nanotubes (SWCNTs) and cadmium oxide (CdO) was tested. Exposure to CdO particles exhibited the fastest rate of cytotoxicity and demonstrated the biosensor's ability to monitor toxicity instantaneously in real time. Advantages of the present method include shorter run times, easier usage, and multi-sample analysis leading to a method that can monitor the kinetic effects of nanoparticle toxicity continuously over a desired timeframe.

  13. Whole cell based electrical impedance sensing approach for a rapid nanotoxicity assay

    International Nuclear Information System (INIS)

    Hondroulis, Evangelia; Liu Chang; Li Chenzhong

    2010-01-01

    A whole cell based biosensor for rapid real-time testing of human and environmental toxicity of nanoscale materials is reported. Recent studies measuring nanoparticle cytotoxicity in vitro provide a final measurement of toxicity to a cell culture overlooking the ongoing cytotoxic effects of the nanoparticles over the desired timeframe. An array biosensor capable of performing multiple cytotoxicity assays simultaneously was designed to address the need for a consistent method to measure real-time assessments of toxicity. The impedimetric response of human lung fibroblasts (CCL-153) and rainbow trout gill epithelial cells (RTgill-W1) when exposed to gold and silver nanoparticles (AuNPs, AgNPs), single walled carbon nanotubes (SWCNTs) and cadmium oxide (CdO) was tested. Exposure to CdO particles exhibited the fastest rate of cytotoxicity and demonstrated the biosensor's ability to monitor toxicity instantaneously in real time. Advantages of the present method include shorter run times, easier usage, and multi-sample analysis leading to a method that can monitor the kinetic effects of nanoparticle toxicity continuously over a desired timeframe.

  14. Training of Tonal Similarity Ratings in Non-Musicians: A “Rapid Learning” Approach

    Science.gov (United States)

    Oechslin, Mathias S.; Läge, Damian; Vitouch, Oliver

    2012-01-01

    Although cognitive music psychology has a long tradition of expert–novice comparisons, experimental training studies are rare. Studies on the learning progress of trained novices in hearing harmonic relationships are still largely lacking. This paper presents a simple training concept using the example of tone/triad similarity ratings, demonstrating the gradual progress of non-musicians compared to musical experts: In a feedback-based “rapid learning” paradigm, participants had to decide for single tones and chords whether paired sounds matched each other well. Before and after the training sessions, they provided similarity judgments for a complete set of sound pairs. From these similarity matrices, individual relational sound maps, intended to display mental representations, were calculated by means of non-metric multidimensional scaling (NMDS), and were compared to an expert model through procrustean transformation. Approximately half of the novices showed substantial learning success, with some participants even reaching the level of professional musicians. Results speak for a fundamental ability to quickly train an understanding of harmony, show inter-individual differences in learning success, and demonstrate the suitability of the scaling method used for learning research in music and other domains. Results are discussed in the context of the “giftedness” debate. PMID:22629252

  15. Training of tonal similarity ratings in non-musicians: a "rapid learning" approach.

    Science.gov (United States)

    Oechslin, Mathias S; Läge, Damian; Vitouch, Oliver

    2012-01-01

    Although cognitive music psychology has a long tradition of expert-novice comparisons, experimental training studies are rare. Studies on the learning progress of trained novices in hearing harmonic relationships are still largely lacking. This paper presents a simple training concept using the example of tone/triad similarity ratings, demonstrating the gradual progress of non-musicians compared to musical experts: In a feedback-based "rapid learning" paradigm, participants had to decide for single tones and chords whether paired sounds matched each other well. Before and after the training sessions, they provided similarity judgments for a complete set of sound pairs. From these similarity matrices, individual relational sound maps, intended to display mental representations, were calculated by means of non-metric multidimensional scaling (NMDS), and were compared to an expert model through procrustean transformation. Approximately half of the novices showed substantial learning success, with some participants even reaching the level of professional musicians. Results speak for a fundamental ability to quickly train an understanding of harmony, show inter-individual differences in learning success, and demonstrate the suitability of the scaling method used for learning research in music and other domains. Results are discussed in the context of the "giftedness" debate.

  16. Training of tonal similarity ratings in non-musicians: a rapid learning approach

    Directory of Open Access Journals (Sweden)

    Mathias S Oechslin

    2012-05-01

    Full Text Available Although music psychology has a long tradition of expert-novice comparisons, experimental training studies are rare. Studies on the learning progress of trained novices in hearing harmonic relationships are still largely lacking. This paper presents a simple training concept using the example of tone/triad similarity ratings, demonstrating the gradual progress of non-musicians compared to musical experts: In a feedback-based rapid learning paradigm, participants had to decide for single tones and chords whether paired sounds matched each other well. Before and after the training sessions, they provided similarity judgments for a complete set of sound pairs. From these similarity matrices, individual relational sound maps, aiming to map the mental representations, were calculated by means of non-metric multidimensional scaling (NMDS, which were compared to an expert model through procrustean transformation. Approximately half of the novices showed substantial learning success, with some participants even reaching the level of professional musicians. Results speak for a fundamental ability to quickly train an understanding of harmony, show inter-individual differences in learning success, and demonstrate the suitability of the scaling method used for music psychological research. Results are discussed in the context of the giftedness debate.

  17. Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks

    DEFF Research Database (Denmark)

    Blixenkrone-Møller, Merete; Martella, Vito

    2007-01-01

    CDV is a highly contagious viral pathogen causing a lethal systemic disease in dogs and other carnivores. Several lineages or genotypes of CDV exist that are variously distributed throughout several continents. Legal or uncontrolled trading of animals may modify the epidemiology of CDV, introduci...

  18. Innovative Approaches to Space-Based Manufacturing and Rapid Prototyping of Composite Materials

    Science.gov (United States)

    Hill, Charles S.

    2012-01-01

    The ability to deploy large habitable structures, construct, and service exploration vehicles in low earth orbit will be an enabling capability for continued human exploration of the solar system. It is evident that advanced manufacturing methods to fabricate replacement parts and re-utilize launch vehicle structural mass by converting it to different uses will be necessary to minimize costs and allow flexibility to remote crews engaged in space travel. Recent conceptual developments and the combination of inter-related approaches to low-cost manufacturing of composite materials and structures are described in context leading to the possibility of on-orbit and space-based manufacturing.

  19. Rapid Construction of Fe-Co-Ni Composition-Phase Map by Combinatorial Materials Chip Approach.

    Science.gov (United States)

    Xing, Hui; Zhao, Bingbing; Wang, Yujie; Zhang, Xiaoyi; Ren, Yang; Yan, Ningning; Gao, Tieren; Li, Jindong; Zhang, Lanting; Wang, Hong

    2018-03-12

    One hundred nanometer thick Fe-Co-Ni material chips were prepared and isothermally annealed at 500, 600, and 700 °C, respectively. Pixel-by-pixel composition and structural mapping was performed by microbeam X-ray at synchrotron light source. Diffraction images were recorded at a rate of 1 pattern/s. The XRD patterns were automatically processed, phase-identified, and categorized by hierarchical clustering algorithm to construct the composition-phase map. The resulting maps are consistent with corresponding isothermal sections reported in the ASM Alloy Phase Diagram Database, verifying the effectiveness of the present approach in phase diagram construction.

  20. Rapid differential diagnosis of diabetes insipidus in a 7-month-old infant: The copeptin approach.

    Science.gov (United States)

    Vergier, J; Fromonot, J; Alvares De Azevedo Macedo, A; Godefroy, A; Marquant, E; Guieu, R; Tsimaratos, M; Reynaud, R

    2018-01-01

    Diabetes insipidus is characterized by hypoosmotic polyuria related to deficiency of arginine-vasopressin (AVP) secretion (central diabetes insipidus, CDI) or renal insensitivity to AVP (nephrogenic diabetes insipidus, NDI). The water deprivation test with assessment of AVP activity is currently the gold standard for differential diagnosis in patients presenting polyuria-polydipsia syndrome. Nevertheless, it can be dangerous without proper surveillance and its interpretation may be challenging. Other markers have been suggested. Direct quantification of circulating AVP is not sufficient for diagnosis: vasopressin is unstable, analysis is complex. AVP comes from prohormone preprovasopressin with concomitant release of copeptin (C-terminal moiety) in the equimolar ratio. Copeptin is stable in vitro, with easy and rapid measurement (polyuria in adults, but its value has not been demonstrated in infants yet. A 7-month-old infant presented polyuria-polydipsia syndrome with poor weight gain. Laboratory tests pointed out hypernatremia (170mmol/L) and blood hyperosmolarity (330mOsm/L) with inappropriate urinary hypoosmolarity (168mOsm/L). Plasmatic copeptin measurement was found at a very high level, 303pmol/L (1-14pmol/L). DdAVP administration did not improve the polyuria, confirming the final diagnosis of NDI. Hyperhydration with a hypoosmolar diet normalized the hydration status and circulating levels of copeptin within 1 week. Copeptin, a stable peptide reflecting AVP secretion, could be a safer and faster biomarker for etiological diagnosis of polyuria-polydipsia syndrome in children. Before regularization of hydration status, a single baseline measurement may be enough to discriminate NDI from other etiologies without the water deprivation test. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. A new approach to measure the temperature in rapid thermal processing

    Science.gov (United States)

    Yan, Jiang

    This dissertation has presented the research work about a new method to measure the temperatures for the silicon wafer. The new technology is mainly for the rapid thermal processing (RTP) system. RTP is a promising technology in semiconductor manufacturing especially for the devices with minimum feature size less than 0.5 μm. The technique to measure the temperatures of the silicon wafer accurately is the key factor to apply the RTP technology to more critical processes in the manufacturing. Two methods which are mostly used nowadays, thermocouples and pyrometer, all have the limitation to be applied in the RTP. This is the motivation to study the new method using acoustic waves for the temperature measurement. The test system was designed and built up for the study of the acoustic method. The whole system mainly includes the transducer unit, circuit hardware, control software, the computer, and the chamber. The acoustic wave was generated by the PZT-5H transducer. The wave travels through the quartz rod into the silicon wafer. After traveling a certain distances in the wafer, the acoustic waves could be received by other transducers. By measuring the travel time and with the travel distance, the velocity of the acoustic wave traveling in the silicon wafer can be calculated. Because there is a relationship between the velocity and the temperature: the velocities of the acoustic waves traveling in the silicon wafer decrease as the temperatures of the wafer increase, the temperature of the wafer can be finally obtained. The thermocouples were used to check the measurement accuracy of the acoustic method. The temperature mapping across the 8″ silicon wafer was obtained with four transducer sensor unit. The temperatures of the wafer were measured using acoustic method at both static and dynamic status. The main purpose of the tests is to know the measurement accuracy for the new method. The goal of the research work regarding to the accuracy is acoustic method is

  2. Polypyrrole solid phase microextraction: A new approach to rapid sample preparation for the monitoring of antibiotic drugs

    International Nuclear Information System (INIS)

    Szultka, Malgorzata; Kegler, Ricarda; Fuchs, Patricia; Olszowy, Pawel; Miekisch, Wolfram; Schubert, Jochen K.; Buszewski, Boguslaw; Mundkowski, Ralf G.

    2010-01-01

    Simple or even rapid bioanalytical methods are rare, since they generally involve complicated, time-consuming sample preparation from the biological matrices like LLE or SPE. SPME provides a promising approach to overcome these limitations. The full potential of this innovative technique for medical diagnostics, pharmacotherapy or biochemistry has not been tapped yet. In-house manufactured SPME probes with polypyrrole (PPy) coating were evaluated using three antibiotics of high clinical relevance - linezolid, daptomycin, and moxifloxacin - from PBS, plasma, and whole blood. The PPy coating was characterised by scanning electron microscopy. Influences of pH, inorganic salt, and blood anticoagulants were studied for optimum performance. Extraction yields were determined from stagnant media as well as re-circulating human blood using the heart-and-lung machine model system. The PPy-SPME fibres showed high extraction yields, particularly regarding linezolid. The reproducibility of the method was optimised to achieve RSDs of 9% or 17% and 7% for SPME from stagnant or re-circulating blood using fresh and re-used fibres, respectively. The PPy-SPME approach was demonstrated to meet the requirements of therapeutic monitoring of the drugs tested, even from re-circulating blood at physiological flow rates. SPME represents a rapid and simple dual-step procedure with potency to significantly reduce the effort and expenditure of complicated sample preparations in biomedical analysis.

  3. Polypyrrole solid phase microextraction: A new approach to rapid sample preparation for the monitoring of antibiotic drugs

    Energy Technology Data Exchange (ETDEWEB)

    Szultka, Malgorzata [Department of Environmental Chemistry and Bioanalytics, Faculty of Chemistry, Nicolaus, Copernicus University, Gagarin 7, 87-100 Torun (Poland); Kegler, Ricarda [Institute of Clinical Pharmacology, University of Rostock, Schillingallee 70, D-18057 Rostock (Germany); Fuchs, Patricia [Department of Anaesthesia and Intensive Care, University of Rostock, Schillingallee 35, D-18057 Rostock (Germany); Olszowy, Pawel [Department of Environmental Chemistry and Bioanalytics, Faculty of Chemistry, Nicolaus, Copernicus University, Gagarin 7, 87-100 Torun (Poland); Miekisch, Wolfram; Schubert, Jochen K. [Department of Anaesthesia and Intensive Care, University of Rostock, Schillingallee 35, D-18057 Rostock (Germany); Buszewski, Boguslaw [Department of Environmental Chemistry and Bioanalytics, Faculty of Chemistry, Nicolaus, Copernicus University, Gagarin 7, 87-100 Torun (Poland); Mundkowski, Ralf G., E-mail: ralf.mundkowski@med.uni-rostock.de [Institute of Clinical Pharmacology, University of Rostock, Schillingallee 70, D-18057 Rostock (Germany)

    2010-05-14

    Simple or even rapid bioanalytical methods are rare, since they generally involve complicated, time-consuming sample preparation from the biological matrices like LLE or SPE. SPME provides a promising approach to overcome these limitations. The full potential of this innovative technique for medical diagnostics, pharmacotherapy or biochemistry has not been tapped yet. In-house manufactured SPME probes with polypyrrole (PPy) coating were evaluated using three antibiotics of high clinical relevance - linezolid, daptomycin, and moxifloxacin - from PBS, plasma, and whole blood. The PPy coating was characterised by scanning electron microscopy. Influences of pH, inorganic salt, and blood anticoagulants were studied for optimum performance. Extraction yields were determined from stagnant media as well as re-circulating human blood using the heart-and-lung machine model system. The PPy-SPME fibres showed high extraction yields, particularly regarding linezolid. The reproducibility of the method was optimised to achieve RSDs of 9% or 17% and 7% for SPME from stagnant or re-circulating blood using fresh and re-used fibres, respectively. The PPy-SPME approach was demonstrated to meet the requirements of therapeutic monitoring of the drugs tested, even from re-circulating blood at physiological flow rates. SPME represents a rapid and simple dual-step procedure with potency to significantly reduce the effort and expenditure of complicated sample preparations in biomedical analysis.

  4. A rapid approach for measuring silver nanoparticle concentration and dissolution in seawater by UV-Vis.

    Science.gov (United States)

    Sikder, Mithun; Lead, Jamie R; Chandler, G Thomas; Baalousha, Mohammed

    2018-03-15

    Detection and quantification of engineered nanoparticles (NPs) in environmental systems is challenging and requires sophisticated analytical equipment. Furthermore, dissolution is an important environmental transformation process for silver nanoparticles (AgNPs) which affects the size, speciation and concentration of AgNPs in natural water systems. Herein, we present a simple approach for the detection, quantification and measurement of dissolution of PVP-coated AgNPs (PVP-AgNPs) based on monitoring their optical properties (extinction spectra) using UV-vis spectroscopy. The dependence of PVP-AgNPs extinction coefficient (ɛ) and maximum absorbance wavelength (λ max ) on NP size was experimentally determined. The concentration, size, and extinction spectra of PVP-AgNPs were characterized during dissolution in 30ppt synthetic seawater. AgNPs concentration was determined as the difference between the total and dissolved Ag concentrations measured by inductively coupled plasma-mass spectroscopy (ICP-MS); extinction spectra of PVP-AgNPs were monitored by UV-vis; and size evolution was monitored by atomic force microscopy (AFM) over a period of 96h. Empirical equations for the dependence of maximum absorbance wavelength (λ max ) and extinction coefficient (ɛ) on NP size were derived. These empirical formulas were then used to calculate the size and concentration of PVP-AgNPs, and dissolved Ag concentration released from PVP-AgNPs in synthetic seawater at variable particle concentrations (i.e. 25-1500μgL -1 ) and in natural seawater at particle concentration of 100μgL -1 . These results suggest that UV-vis can be used as an easy and quick approach for detection and quantification (size and concentration) of sterically stabilized PVP-AgNPs from their extinction spectra. This approach can also be used to monitor the release of Ag from PVP-AgNPs and the concurrent NP size change. Finally, in seawater, AgNPs dissolve faster and to a higher extent with the decrease in NP

  5. RFMix: A Discriminative Modeling Approach for Rapid and Robust Local-Ancestry Inference

    Science.gov (United States)

    Maples, Brian K.; Gravel, Simon; Kenny, Eimear E.; Bustamante, Carlos D.

    2013-01-01

    Local-ancestry inference is an important step in the genetic analysis of fully sequenced human genomes. Current methods can only detect continental-level ancestry (i.e., European versus African versus Asian) accurately even when using millions of markers. Here, we present RFMix, a powerful discriminative modeling approach that is faster (∼30×) and more accurate than existing methods. We accomplish this by using a conditional random field parameterized by random forests trained on reference panels. RFMix is capable of learning from the admixed samples themselves to boost performance and autocorrect phasing errors. RFMix shows high sensitivity and specificity in simulated Hispanics/Latinos and African Americans and admixed Europeans, Africans, and Asians. Finally, we demonstrate that African Americans in HapMap contain modest (but nonzero) levels of Native American ancestry (∼0.4%). PMID:23910464

  6. Rapid prototyping of an automated video surveillance system: a hardware-software co-design approach

    Science.gov (United States)

    Ngo, Hau T.; Rakvic, Ryan N.; Broussard, Randy P.; Ives, Robert W.

    2011-06-01

    FPGA devices with embedded DSP and memory blocks, and high-speed interfaces are ideal for real-time video processing applications. In this work, a hardware-software co-design approach is proposed to effectively utilize FPGA features for a prototype of an automated video surveillance system. Time-critical steps of the video surveillance algorithm are designed and implemented in the FPGAs logic elements to maximize parallel processing. Other non timecritical tasks are achieved by executing a high level language program on an embedded Nios-II processor. Pre-tested and verified video and interface functions from a standard video framework are utilized to significantly reduce development and verification time. Custom and parallel processing modules are integrated into the video processing chain by Altera's Avalon Streaming video protocol. Other data control interfaces are achieved by connecting hardware controllers to a Nios-II processor using Altera's Avalon Memory Mapped protocol.

  7. Development of a quantitative PCR for rapid and sensitive diagnosis of an intranuclear coccidian parasite in Testudines (TINC), and detection in the critically endangered Arakan forest turtle (Heosemys depressa).

    Science.gov (United States)

    Alvarez, W Alexander; Gibbons, Paul M; Rivera, Sam; Archer, Linda L; Childress, April L; Wellehan, James F X

    2013-03-31

    The intranuclear coccidian parasite of Testudines (TINC) is responsible for significant disease in turtles and tortoises causing high mortality and affecting several threatened species. Diagnostic testing has been limited to relatively labor intensive and expensive pan-coccidial PCR and sequencing techniques. A qPCR assay targeting a specific and conserved region of TINC 18S rRNA was designed. The qPCR reaction was run on samples known to be TINC positive and the results were consistent and analytically specific. The assay was able to detect as little as 10 copies of target DNA in a sample. Testing of soil and invertebrates was negative and did not provide any further insights into life cycles. This assay was used to identify TINC in a novel host species, the critically endangered Arakan forest turtle (Heosemys depressa). Copyright © 2012 Elsevier B.V. All rights reserved.

  8. A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Namouchi, Amine; Mardassi, Helmi

    2006-11-01

    Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.

  9. CFD modeling of two-stage ignition in a rapid compression machine: Assessment of zero-dimensional approach

    Energy Technology Data Exchange (ETDEWEB)

    Mittal, Gaurav [Department of Mechanical Engineering, The University of Akron, Akron, OH 44325 (United States); Raju, Mandhapati P. [General Motor R and D Tech Center, Warren, MI 48090 (United States); Sung, Chih-Jen [Department of Mechanical Engineering, University of Connecticut, Storrs, CT 06269 (United States)

    2010-07-15

    In modeling rapid compression machine (RCM) experiments, zero-dimensional approach is commonly used along with an associated heat loss model. The adequacy of such approach has not been validated for hydrocarbon fuels. The existence of multi-dimensional effects inside an RCM due to the boundary layer, roll-up vortex, non-uniform heat release, and piston crevice could result in deviation from the zero-dimensional assumption, particularly for hydrocarbons exhibiting two-stage ignition and strong thermokinetic interactions. The objective of this investigation is to assess the adequacy of zero-dimensional approach in modeling RCM experiments under conditions of two-stage ignition and negative temperature coefficient (NTC) response. Computational fluid dynamics simulations are conducted for n-heptane ignition in an RCM and the validity of zero-dimensional approach is assessed through comparisons over the entire NTC region. Results show that the zero-dimensional model based on the approach of 'adiabatic volume expansion' performs very well in adequately predicting the first-stage ignition delays, although quantitative discrepancy for the prediction of the total ignition delays and pressure rise in the first-stage ignition is noted even when the roll-up vortex is suppressed and a well-defined homogeneous core is retained within an RCM. Furthermore, the discrepancy is pressure dependent and decreases as compressed pressure is increased. Also, as ignition response becomes single-stage at higher compressed temperatures, discrepancy from the zero-dimensional simulations reduces. Despite of some quantitative discrepancy, the zero-dimensional modeling approach is deemed satisfactory from the viewpoint of the ignition delay simulation. (author)

  10. A rapid approach for automated comparison of independently derived stream networks

    Science.gov (United States)

    Stanislawski, Larry V.; Buttenfield, Barbara P.; Doumbouya, Ariel T.

    2015-01-01

    This paper presents an improved coefficient of line correspondence (CLC) metric for automatically assessing the similarity of two different sets of linear features. Elevation-derived channels at 1:24,000 scale (24K) are generated from a weighted flow-accumulation model and compared to 24K National Hydrography Dataset (NHD) flowlines. The CLC process conflates two vector datasets through a raster line-density differencing approach that is faster and more reliable than earlier methods. Methods are tested on 30 subbasins distributed across different terrain and climate conditions of the conterminous United States. CLC values for the 30 subbasins indicate 44–83% of the features match between the two datasets, with the majority of the mismatching features comprised of first-order features. Relatively lower CLC values result from subbasins with less than about 1.5 degrees of slope. The primary difference between the two datasets may be explained by different data capture criteria. First-order, headwater tributaries derived from the flow-accumulation model are captured more comprehensively through drainage area and terrain conditions, whereas capture of headwater features in the NHD is cartographically constrained by tributary length. The addition of missing headwaters to the NHD, as guided by the elevation-derived channels, can substantially improve the scientific value of the NHD.

  11. Rapid customization system for 3D-printed splint using programmable modeling technique - a practical approach.

    Science.gov (United States)

    Li, Jianyou; Tanaka, Hiroya

    2018-01-01

    Traditional splinting processes are skill dependent and irreversible, and patient satisfaction levels during rehabilitation are invariably lowered by the heavy structure and poor ventilation of splints. To overcome this drawback, use of the 3D-printing technology has been proposed in recent years, and there has been an increase in public awareness. However, application of 3D-printing technologies is limited by the low CAD proficiency of clinicians as well as unforeseen scan flaws within anatomic models.A programmable modeling tool has been employed to develop a semi-automatic design system for generating a printable splint model. The modeling process was divided into five stages, and detailed steps involved in construction of the proposed system as well as automatic thickness calculation, the lattice structure, and assembly method have been thoroughly described. The proposed approach allows clinicians to verify the state of the splint model at every stage, thereby facilitating adjustment of input content and/or other parameters to help solve possible modeling issues. A finite element analysis simulation was performed to evaluate the structural strength of generated models. A fit investigation was applied on fabricated splints and volunteers to assess the wearing experience. Manual modeling steps involved in complex splint designs have been programed into the proposed automatic system. Clinicians define the splinting region by drawing two curves, thereby obtaining the final model within minutes. The proposed system is capable of automatically patching up minor flaws within the limb model as well as calculating the thickness and lattice density of various splints. Large splints could be divided into three parts for simultaneous multiple printing. This study highlights the advantages, limitations, and possible strategies concerning application of programmable modeling tools in clinical processes, thereby aiding clinicians with lower CAD proficiencies to become adept

  12. A dried blood spot mass spectrometry metabolomic approach for rapid breast cancer detection

    Directory of Open Access Journals (Sweden)

    Wang Q

    2016-03-01

    of 84.4%. Compared to the routinely used protein markers, this model exhibited distinct advantage with its higher sensitivity.Conclusion: Blood metabolites screening is a more plausible approach for BC detection. Furthermore, this direct MS analysis could be finished within few minutes, which means that its throughput is higher than the currently used imaging techniques. Keywords: breast cancer, metabolomics, dried blood spot testing

  13. Evaluation of Rapid, Early Warning Approaches to Track Shellfish Toxins Associated with Dinophysis and Alexandrium Blooms

    Directory of Open Access Journals (Sweden)

    Theresa K. Hattenrath-Lehmann

    2018-01-01

    Full Text Available Marine biotoxin-contaminated seafood has caused thousands of poisonings worldwide this century. Given these threats, there is an increasing need for improved technologies that can be easily integrated into coastal monitoring programs. This study evaluates approaches for monitoring toxins associated with recurrent toxin-producing Alexandrium and Dinophysis blooms on Long Island, NY, USA, which cause paralytic and diarrhetic shellfish poisoning (PSP and DSP, respectively. Within contrasting locations, the dynamics of pelagic Alexandrium and Dinophysis cell densities, toxins in plankton, and toxins in deployed blue mussels (Mytilus edulis were compared with passive solid-phase adsorption toxin tracking (SPATT samplers filled with two types of resin, HP20 and XAD-2. Multiple species of wild shellfish were also collected during Dinophysis blooms and used to compare toxin content using two different extraction techniques (single dispersive and double exhaustive and two different toxin analysis assays (liquid chromatography/mass spectrometry and the protein phosphatase inhibition assay (PP2A for the measurement of DSP toxins. DSP toxins measured in the HP20 resin were significantly correlated (R2 = 0.7–0.9, p < 0.001 with total DSP toxins in shellfish, but were detected more than three weeks prior to detection in deployed mussels. Both resins adsorbed measurable levels of PSP toxins, but neither quantitatively tracked Alexandrium cell densities, toxicity in plankton or toxins in shellfish. DSP extraction and toxin analysis methods did not differ significantly (p > 0.05, were highly correlated (R2 = 0.98–0.99; p < 0.001 and provided complete recovery of DSP toxins from standard reference materials. Blue mussels (Mytilus edulis and ribbed mussels (Geukensia demissa were found to accumulate DSP toxins above federal and international standards (160 ng g−1 during Dinophysis blooms while Eastern oysters (Crassostrea virginica and soft shell clams (Mya

  14. Accurate quantification of microorganisms in PCR-inhibiting environmental DNA extracts by a novel Internal Amplification Control approach using Biotrove OpenArrays

    NARCIS (Netherlands)

    Van Doorn, R.; Klerks, M.; van Gent-Pelzer, M.; Speksnijder, A.G.C.L.; Kowalchuk, G.A.; Schoen, C.D.

    2009-01-01

    PCR-based detection assays are prone to inhibition by substances present in environmental samples, thereby potentially leading to inaccurate target quantification or false-negative results. Internal amplification controls (IACs) have been developed to help alleviate this problem but are generally

  15. Use of length heterogeneity polymerase chain reaction (LH-PCR as non-invasive approach for dietary analysis of Svalbard reindeer, Rangifer tarandus platyrhynchus.

    Directory of Open Access Journals (Sweden)

    Sungbae Joo

    Full Text Available To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus, we applied length-heterogeneity polymerase chain reaction (LH-PCR based on length differences of internal transcribed spacer (ITS regions of ribosomal RNA (rRNA to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp. and plant species (Salix polaris and Saxifraga oppositifolia were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.

  16. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  17. Improved approach for electric vehicle rapid charging station placement and sizing using Google maps and binary lightning search algorithm

    Science.gov (United States)

    Shareef, Hussain; Mohamed, Azah

    2017-01-01

    The electric vehicle (EV) is considered a premium solution to global warming and various types of pollution. Nonetheless, a key concern is the recharging of EV batteries. Therefore, this study proposes a novel approach that considers the costs of transportation loss, buildup, and substation energy loss and that incorporates harmonic power loss into optimal rapid charging station (RCS) planning. A novel optimization technique, called binary lightning search algorithm (BLSA), is proposed to solve the optimization problem. BLSA is also applied to a conventional RCS planning method. A comprehensive analysis is conducted to assess the performance of the two RCS planning methods by using the IEEE 34-bus test system as the power grid. The comparative studies show that the proposed BLSA is better than other optimization techniques. The daily total cost in RCS planning of the proposed method, including harmonic power loss, decreases by 10% compared with that of the conventional method. PMID:29220396

  18. Development of a Novel, Bicombinatorial Approach to Alloy Development, and Application to Rapid Screening of Creep Resistant Titanium Alloys

    Science.gov (United States)

    Martin, Brian

    Combinatorial approaches have proven useful for rapid alloy fabrication and optimization. A new method of producing controlled isothermal gradients using the Gleeble Thermomechanical simulator has been developed, and demonstrated on the metastable beta-Ti alloy beta-21S, achieving a thermal gradient of 525-700 °C. This thermal gradient method has subsequently been coupled with existing combinatorial methods of producing composition gradients using the LENS(TM) additive manufacturing system, through the use of elemental blended powders. This has been demonstrated with a binary Ti-(0-15) wt% Cr build, which has subsequently been characterized with optical and electron microscopy, with special attention to the precipitate of TiCr2 Laves phases. The TiCr2 phase has been explored for its high temperature mechanical properties in a new oxidation resistant beta-Ti alloy, which serves as a demonstration of the new bicombinatorial methods developed as applied to a multicomponent alloy system.

  19. Improved approach for electric vehicle rapid charging station placement and sizing using Google maps and binary lightning search algorithm.

    Directory of Open Access Journals (Sweden)

    Md Mainul Islam

    Full Text Available The electric vehicle (EV is considered a premium solution to global warming and various types of pollution. Nonetheless, a key concern is the recharging of EV batteries. Therefore, this study proposes a novel approach that considers the costs of transportation loss, buildup, and substation energy loss and that incorporates harmonic power loss into optimal rapid charging station (RCS planning. A novel optimization technique, called binary lightning search algorithm (BLSA, is proposed to solve the optimization problem. BLSA is also applied to a conventional RCS planning method. A comprehensive analysis is conducted to assess the performance of the two RCS planning methods by using the IEEE 34-bus test system as the power grid. The comparative studies show that the proposed BLSA is better than other optimization techniques. The daily total cost in RCS planning of the proposed method, including harmonic power loss, decreases by 10% compared with that of the conventional method.

  20. Rapid needle-out patient-rollover approach after cone beam CT-guided lung biopsy: effect on pneumothorax rate in 1,191 consecutive patients

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jung Im [Seoul National University College of Medicine, Department of Radiology, Jongno-gu, Seoul (Korea, Republic of); Seoul National University Medical Research Center, Institute of Radiation Medicine, Seoul (Korea, Republic of); Kyung Hee University Hospital at Gangdong, Kyung Hee University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Park, Chang Min; Goo, Jin Mo [Seoul National University College of Medicine, Department of Radiology, Jongno-gu, Seoul (Korea, Republic of); Seoul National University, Cancer Research Institute, Seoul (Korea, Republic of); Lee, Sang Min [Seoul National University College of Medicine, Department of Radiology, Jongno-gu, Seoul (Korea, Republic of)

    2015-07-15

    To investigate the effect of rapid needle-out patient-rollover approach on the incidence of pneumothorax and drainage catheter placement due to pneumothorax in C-arm Cone-beam CT (CBCT)-guided percutaneous transthoracic needle biopsy (PTNB) of lung lesions. From May 2011 to December 2012, 1227 PTNBs were performed in 1191 patients with a 17-gauge coaxial needle. 617 biopsies were performed without (conventional-group) and 610 with rapid-rollover approach (rapid-rollover-group). Overall pneumothorax rates and incidences of pneumothorax requiring drainage catheter placement were compared between two groups. There were no significant differences in overall pneumothorax rates between conventional and rapid-rollover groups (19.8 % vs. 23.1 %, p = 0.164). However, pneumothorax rate requiring drainage catheter placement was significantly lower in rapid-rollover-group (1.6 %) than conventional-group (4.2 %) (p = 0.010). Multivariate analysis revealed male, age > 60, bulla crossed, fissure crossed, pleura to target distance > 1.3 cm, emphysema along needle tract, and pleural punctures ≥ 2 were significant risk factors of pneumothorax (p < 0.05). Regarding pneumothorax requiring drainage catheter placement, fissure crossed, bulla crossed, and emphysema along needle tract were significant risk factors (p < 0.05), whereas rapid-rollover approach was an independent protective factor (p = 0.002). The rapid needle-out patient-rollover approach significantly reduced the rate of pneumothorax requiring drainage catheter placement after CBCT-guided PTNB. (orig.)

  1. Molecular typing for blood group antigens within 40 minutes by direct PCR from plasma or serum

    Science.gov (United States)

    Wagner, Franz Friedrich; Flegel, Willy Albert; Bittner, Rita; Döscher, Andrea

    2016-01-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fya, Fyb, Jka and Jkb antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. PMID:27991657

  2. Validation of RNAi by real time PCR

    DEFF Research Database (Denmark)

    Josefsen, Knud; Lee, Ying Chiu

    2011-01-01

    Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...

  3. Real-time PCR in virology

    OpenAIRE

    Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

    2002-01-01

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

  4. Real-time PCR in virology.

    Science.gov (United States)

    Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

    2002-03-15

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

  5. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  6. Application of laboratory and portable attenuated total reflectance infrared spectroscopic approaches for rapid quantification of alpaca serum immunoglobulin G

    Science.gov (United States)

    Burns, Jennifer B.; Riley, Christopher B.; Shaw, R. Anthony; McClure, J. Trenton

    2017-01-01

    The objective of this study was to develop and compare the performance of laboratory grade and portable attenuated total reflectance infrared (ATR-IR) spectroscopic approaches in combination with partial least squares regression (PLSR) for the rapid quantification of alpaca serum IgG concentration, and the identification of low IgG (portable ATR-IR spectrometers. Various pre-processing strategies were applied to the ATR-IR spectra that were linked to corresponding RID-IgG concentrations, and then randomly split into two sets: calibration (training) and test sets. PLSR was applied to the calibration set and calibration models were developed, and the test set was used to assess the accuracy of the analytical method. For the test set, the Pearson correlation coefficients between the IgG measured by RID and predicted by both laboratory grade and portable ATR-IR spectrometers was 0.91. The average differences between reference serum IgG concentrations and the two IR-based methods were 120.5 mg/dL and 71 mg/dL for the laboratory and portable ATR-IR-based assays, respectively. Adopting an IgG concentration portable ATR-IR assay were 95, 99 and 99%, respectively. These results suggest that the two different ATR-IR assays performed similarly for rapid qualitative evaluation of alpaca serum IgG and for diagnosis of IgG portable ATR-IR spectrometer performed slightly better, and provides more flexibility for potential application in the field. PMID:28651006

  7. External PCR, ASN's decision

    International Nuclear Information System (INIS)

    Anon.

    2012-01-01

    The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)

  8. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2012-02-20

    Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR

  9. Interlaboratory comparison of real-time pcr protocols for quantification of general fecal indicator bacteria

    Science.gov (United States)

    Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.

    2012-01-01

    The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.

  10. Rapid method for controlling the correct labeling of products containing common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas) by fast real-time PCR.

    Science.gov (United States)

    Espiñeira, Montserrat; Vieites, Juan M

    2012-12-15

    The TaqMan real-time PCR has the highest potential for automation, therefore representing the currently most suitable method for screening, allowing the detection of fraudulent or unintentional mislabeling of species. This work describes the development of a real-time polymerase chain reaction (RT-PCR) system for the detection and identification of common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas). This technique is notable for the combination of simplicity, speed, sensitivity and specificity in an homogeneous assay. The method can be applied to all kinds of products; fresh, frozen and processed, including those undergoing intensive processes of transformation. This methodology was validated to check how the degree of food processing affects the method and the detection of each species. Moreover, it was applied to 34 commercial samples to evaluate the labeling of products made from them. The methodology herein developed is useful to check the fulfillment of labeling regulations for seafood products and to verify traceability in commercial trade and for fisheries control. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Rapid Amplification of the 5'cDNA End of Reindeer Ghrelin by Inverse Nested PCR%反向嵌套PCR技术扩增驯鹿Ghrelin cDNA 5'末端序列

    Institute of Scientific and Technical Information of China (English)

    朱雪敏; 张义; 张剑平; 杨银凤

    2008-01-01

    为了研究Ghrelin在驯鹿生长发育过程中的作用和功能,以驯鹿为研究对象,采用反向嵌套PCR RACE技术原理,根据已知的序列设计1条5'末端磷酸化的特异性反转录引物和2对特异性反向嵌套PCR引物,首先进行反转录(RT),然后将反转录成的cDNA进行环化,最后进行反向嵌套巢式PCR,成功地扩增了驯鹿Ghrelin cDNA 5'末端序列.与锚定PCR相比,反向嵌套PCR法具有特异性强、扩增效率高等优点,是一种非常有效的扩增cDNA 5'末端序列的方法.

  12. Exploiting 16S rRNA gene for the detection and quantification of fish as a potential allergenic food: A comparison of two real-time PCR approaches.

    Science.gov (United States)

    Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel

    2018-04-15

    Fish is one of the most common allergenic foods that should be accurately labelled to protect the health of allergic consumers. In this work, two real-time PCR systems based on the EvaGreen dye and a TaqMan probe are proposed and compared. New primers were designed to target the 16S rRNA gene, as a universal maker for fish detection, with fully demonstrated specificity for a wide range of fish species. Both systems showed similar absolute sensitivities, down to 0.01 pg of fish DNA, and adequate real-time PCR performance parameters. The probe system showed higher relative sensitivity and dynamic range (0.0001-50%) than the EvaGreen (0.05-50%). They were both precise, but trueness was compromised at the highest tested level with the EvaGreen assay. Therefore, both systems were successful, although the probe one exhibited the best performance. Its application to verify labelling compliance of foodstuffs suggested a high level of mislabelling and/or fraudulent practices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Application of multiplex PCR approaches for shark molecular identification: feasibility and applications for fisheries management and conservation in the Eastern Tropical Pacific.

    Science.gov (United States)

    Caballero, S; Cardeñosa, D; Soler, G; Hyde, J

    2012-03-01

    Here we describe the application of new and existing multiplex PCR methodologies for shark species molecular identification. Four multiplex systems (group ID, thresher sharks, hammerhead sharks and miscellaneous shark) were employed with primers previously described and some designed in this study, which allow for species identification after running PCR products through an agarose gel. This system was implemented for samples (bodies and fins) collected from unidentified sharks landed in the port of Buenaventura and from confiscated tissues obtained from illegal fishing around the Malpelo Island Marine Protected Area, Pacific Coast of Colombia. This method has allowed reliable identification, to date, of 407 samples to the genus and/or species levels, most of them (380) identified as the pelagic thresher shark (Alopias pelagicus). Another seven samples were identified as scalloped hammerhead sharks (Sphyrna lewini). This is an easy-to-implement and reliable identification method that could even be used locally to monitor shark captures in the main fishing ports of developed and developing countries. © 2011 Blackwell Publishing Ltd.

  14. Quantification of B16 Melanoma Cells in Lungs Using Triplex Q-PCR - A New Approach to Evaluate Melanoma Cell Metastasis and Tumor Control

    DEFF Research Database (Denmark)

    Sorensen, Maria R; Pedersen, Sara R; Lindkvist, Annika

    2014-01-01

    of survival once the tumor has metastasized. In the present study, we have developed a new assay for quantitative analysis of B16 melanoma metastasis in the lungs. We have used a triplex Q-PCR to determine the expression of the melanoma genes GP100/Pmel and tyrosinase-related protein 2 (TRP-2), and found...... that B16.F10gp cells were detectable in the lungs as early as 2 hours after intravenous challenge with ≥10(4) tumor cells. When investigating the gene expression as a function of time, we observed a gradual decrease from 2-24 hours post tumor challenge followed by an increase of approximately 2 log10...... the outgrowth of subcutaneous melanomas. Results obtained using Q-PCR were compared to conventional counting of metastatic foci under a dissection microscope. A marked reduction in gene expression was observed in the lungs after vaccination with both vectors; however, Ad-Ii-GP showed the highest protection...

  15. Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.

  16. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  17. Application of laboratory and portable attenuated total reflectance infrared spectroscopic approaches for rapid quantification of alpaca serum immunoglobulin G.

    Directory of Open Access Journals (Sweden)

    Ibrahim Elsohaby

    Full Text Available The objective of this study was to develop and compare the performance of laboratory grade and portable attenuated total reflectance infrared (ATR-IR spectroscopic approaches in combination with partial least squares regression (PLSR for the rapid quantification of alpaca serum IgG concentration, and the identification of low IgG (<1000 mg/dL, which is consistent with the diagnosis of failure of transfer of passive immunity (FTPI in neonates. Serum samples (n = 175 collected from privately owned, healthy alpacas were tested by the reference method of radial immunodiffusion (RID assay, and laboratory grade and portable ATR-IR spectrometers. Various pre-processing strategies were applied to the ATR-IR spectra that were linked to corresponding RID-IgG concentrations, and then randomly split into two sets: calibration (training and test sets. PLSR was applied to the calibration set and calibration models were developed, and the test set was used to assess the accuracy of the analytical method. For the test set, the Pearson correlation coefficients between the IgG measured by RID and predicted by both laboratory grade and portable ATR-IR spectrometers was 0.91. The average differences between reference serum IgG concentrations and the two IR-based methods were 120.5 mg/dL and 71 mg/dL for the laboratory and portable ATR-IR-based assays, respectively. Adopting an IgG concentration <1000 mg/dL as the cut-point for FTPI cases, the sensitivity, specificity, and accuracy for identifying serum samples below this cut point by laboratory ATR-IR assay were 86, 100 and 98%, respectively (within the entire data set. Corresponding values for the portable ATR-IR assay were 95, 99 and 99%, respectively. These results suggest that the two different ATR-IR assays performed similarly for rapid qualitative evaluation of alpaca serum IgG and for diagnosis of IgG <1000 mg/dL, the portable ATR-IR spectrometer performed slightly better, and provides more flexibility for

  18. Rapid detection of bovine coronavirus by a semi-nested RT-PCR Detecção rápida do Coronavírus Bovino (BCoV por meio de uma semi-nested RT-PCR

    Directory of Open Access Journals (Sweden)

    Karen M. Asano

    2009-11-01

    Full Text Available Bovine coronavirus (BCoV is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256 in DEPC treated ultra-pure water, in fetal bovine serum (FBS and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694. The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.O Coronavírus bovino (BCoV pertence ao grupo 2 do gênero Coronavirus (Nidovirales: Coronaviridae e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doen

  19. An approach for evaluating the repeatability of rapid wetland assessment methods: The effects of training and experience

    Science.gov (United States)

    We sampled 92 wetlands from four different basins in the United States to quantify observer repeatability in rapid wetland condition assessment using the Delaware Rapid Assessment Protocol (DERAP). In the Inland Bays basin of Delaware, 58 wetland sites were sampled by multiple ob...

  20. Microbiological evaluation of a new growth-based approach for rapid detection of methicillin-resistant Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Maas, Dominik; Sander, Gunnar; Friedrich, Alexander W; Peters, Georg; Becker, Karsten

    OBJECTIVES: Recently, a rapid screening tool for methicillin-resistant Staphylococcus aureus (MRSA) has been introduced that applies a novel detection technology allowing the rapid presence or absence of MRSA to be determined from an enrichment broth after only a few hours of incubation. To evaluate

  1. Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

    Science.gov (United States)

    Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

    2017-02-08

    Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

  2. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  3. Droplet digital PCR combined with minisequencing, a new approach to analyze fetal DNA from maternal blood: application to the non-invasive prenatal diagnosis of achondroplasia.

    Science.gov (United States)

    Orhant, Lucie; Anselem, Olivia; Fradin, Mélanie; Becker, Pierre Hadrien; Beugnet, Caroline; Deburgrave, Nathalie; Tafuri, Gilles; Letourneur, Franck; Goffinet, François; Allach El Khattabi, Laïla; Leturcq, France; Bienvenu, Thierry; Tsatsaris, Vassilis; Nectoux, Juliette

    2016-05-01

    Achondroplasia is generally detected by abnormal prenatal ultrasound findings in the third trimester of pregnancy and then confirmed by molecular genetic testing of fetal genomic DNA obtained by aspiration of amniotic fluid. This invasive procedure presents a small but significant risk for both the fetus and mother. Therefore, non-invasive procedures using cell-free fetal DNA in maternal plasma have been developed for the detection of the fetal achondroplasia mutations. To determine whether the fetus carries the de novo mis-sense genetic mutation at nucleotide 1138 in FGFR3 gene involved in >99% of achondroplasia cases, we developed two independent methods: digital-droplet PCR combined with minisequencing, which are very sensitive methods allowing detection of rare alleles. We collected 26 plasmatic samples from women carrying fetus at risk of achondroplasia and diagnosed to date a total of five affected fetuses in maternal blood. The sensitivity and specificity of our test are respectively 100% [95% confidence interval, 56.6-100%] and 100% [95% confidence interval, 84.5-100%]. This novel, original strategy for non-invasive prenatal diagnosis of achondroplasia is suitable for implementation in routine clinical testing and allows considering extending the applications of these technologies in non-invasive prenatal diagnosis of many other monogenic diseases. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

  4. Role of PCR in Helicobacter pylori diagnostics and research – new approaches for study of coccoid and spiral forms of the bacteria

    Directory of Open Access Journals (Sweden)

    Irena Duś

    2013-04-01

    Full Text Available Helicobacter pylori since Marshall and Warren’s discovery has been an object of interest of gastroenterologistsand many researchers of other specialties. What needs to be highlighted is also the growing interest of dentists in the role of oral residue of H. pylori in oral pathologies such as burning mouth syndrome, periodontitis and gingivitis.With the development of medical techniques more studies using highly specific diagnostic methods are performed in order to determine the transmission pattern of bacterial infection. Suggested faecal-oral and oral-oral routes of bacterial transmission raised interest in molecular biology methods as tools for the study of these environments. Additionally, co-existence of helical and coccoidal forms of H. pylori in the mentioned niches raised the question whether the latter is potentially pathogenic. This is why molecular biology is now giving a great opportunityto explore parts of the human body that could not have been diagnosed before using only gold standard diagnostic methods. Molecular techniques have shown their usefulness in examining the potential virulence of coccoid forms of bacterium. This review was created also to summarize the knowledge about molecular methods, especially different PCR techniques, as diagnostic tools that can help medical teams during regular diagnosis of gastritis. 

  5. Characterization of mechanisms underlying degradation of sclerotia of Sclerotinia sclerotiorum by Aspergillus aculeatus Asp-4 using a combined qRT-PCR and proteomic approach.

    Science.gov (United States)

    Hu, Xiaojia; Qin, Lu; Roberts, Daniel P; Lakshman, Dilip K; Gong, Yangmin; Maul, Jude E; Xie, Lihua; Yu, Changbing; Li, Yinshui; Hu, Lei; Liao, Xiangsheng; Liao, Xing

    2017-08-31

    The biological control agent Aspergillus aculeatus Asp-4 colonizes and degrades sclerotia of Sclerotinia sclerotiorum resulting in reduced germination and disease caused by this important plant pathogen. Molecular mechanisms of mycoparasites underlying colonization, degradation, and reduction of germination of sclerotia of this and other important plant pathogens remain poorly understood. An RNA-Seq screen of Asp-4 growing on autoclaved, ground sclerotia of S. sclerotiorum for 48 h identified 997 up-regulated and 777 down-regulated genes relative to this mycoparasite growing on potato dextrose agar (PDA) for 48 h. qRT-PCR time course experiments characterized expression dynamics of select genes encoding enzymes functioning in degradation of sclerotial components and management of environmental conditions, including environmental stress. This analysis suggested co-temporal up-regulation of genes functioning in these two processes. Proteomic analysis of Asp-4 growing on this sclerotial material for 48 h identified 26 up-regulated and 6 down-regulated proteins relative to the PDA control. Certain proteins with increased abundance had putative functions in degradation of polymeric components of sclerotia and the mitigation of environmental stress. Our results suggest co-temporal up-regulation of genes involved in degradation of sclerotial compounds and mitigation of environmental stress. This study furthers the analysis of mycoparasitism of sclerotial pathogens by providing the basis for molecular characterization of a previously uncharacterized mycoparasite-sclerotial interaction.

  6. Development of a Rapid and Sensitive Method Combining a Cellulose Ester Microfilter and a Real-Time Quantitative PCR Assay To Detect Campylobacter jejuni and Campylobacter coli in 20 Liters of Drinking Water or Low-Turbidity Waters

    Science.gov (United States)

    Tissier, Adeline; Denis, Martine; Hartemann, Philippe

    2012-01-01

    Investigations of Campylobacter jejuni and Campylobacter coli in samples of drinking water suspected of being at the origin of an outbreak very often lead to negative results. One of the reasons for this failure is the small volume of water typically used for detecting these pathogens (10 to 1,000 ml). The efficiencies of three microfilters and different elution procedures were determined using real-time quantitative PCR to propose a procedure allowing detection of Campylobacter in 20 liters of drinking water or low-turbidity water samples. The results showed that more than 80% of the bacteria inoculated in 1 liter of drinking water were retained on each microfilter. An elution with a solution containing 3% beef extract, 0.05 M glycine at pH 9, combined with direct extraction of the bacterial genomes retained on the cellulose ester microfilter, allowed recovery of 87.3% (±22% [standard deviation]) of Campylobacter per 1 liter of tap water. Recoveries obtained from 20-liter volumes of tap water spiked with a C. coli strain were 69.5% (±10.3%) and 78.5% (±15.1%) for 91 CFU and 36 CFU, respectively. Finally, tests performed on eight samples of 20 liters of groundwater collected from an alluvial well used for the production of drinking water revealed the presence of C. jejuni and C. coli genomes, whereas no bacteria were detected with the normative culture method in volumes ranging from 10 to 1,000 ml. In the absence of available epidemiological data and information on bacterial viability, these last results indicate only that the water resource is not protected from contamination by Campylobacter. PMID:22138985

  7. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  8. Multi-Center Evaluation of the Fully Automated PCR-Based Idylla™ KRAS Mutation Assay for Rapid KRAS Mutation Status Determination on Formalin-Fixed Paraffin-Embedded Tissue of Human Colorectal Cancer

    DEFF Research Database (Denmark)

    Solassol, Jérôme; Vendrell, Julie; Märkl, Bruno

    2016-01-01

    , was assessed on archived formalin-fixed paraffin-embedded (FFPE) tissue sections by comparing its results with the results previously obtained by routine reference approaches for KRAS genotyping. In case of discordance, samples were assessed further by additional methods. Among the 374 colorectal cancer FFPE...

  9. Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.

    Science.gov (United States)

    Jahan, F; Shamsuzzaman, S M; Akter, S

    2014-12-01

    Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.

  10. Spatiotemporal Dynamics of Vibrio cholerae in Turbid Alkaline Lakes as Determined by Quantitative PCR.

    Science.gov (United States)

    Bliem, Rupert; Reischer, Georg; Linke, Rita; Farnleitner, Andreas; Kirschner, Alexander

    2018-06-01

    In recent years, global warming has led to a growing number of Vibrio cholerae infections in bathing water users in regions formerly unaffected by this pathogen. It is therefore of high importance to monitor V. cholerae in aquatic environments and to elucidate the main factors governing its prevalence and abundance. For this purpose, rapid and standardizable methods that can be performed by routine water laboratories are prerequisite. In this study, we applied a recently developed multiplex quantitative PCR (qPCR) strategy (i) to monitor the spatiotemporal variability of V. cholerae abundance in two small soda pools and a large lake that is intensively used for recreation and (ii) to elucidate the main factors driving V. cholerae dynamics in these environments. V. cholerae was detected with qPCR at high concentrations of up to 970,000 genomic units 100 ml -1 during the warm season, up to 2 orders of magnitude higher than values obtained by cultivation. An independent cytometric approach led to results comparable to qPCR data but with significantly more positive samples due to problems with DNA recovery for qPCR. Not a single sample was positive for toxigenic V. cholerae , indicating that only nontoxigenic V. cholerae (NTVC) was present. Temperature was the main predictor of NTVC abundance, but the quality and quantity of dissolved organic matter were also important environmental correlates. Based on this study, we recommend using the developed qPCR strategy for quantification of toxigenic and nontoxigenic V. cholerae in bathing waters with the need for improvements in DNA recovery. IMPORTANCE There is a definitive need for rapid and standardizable methods to quantify waterborne bacterial pathogens. Such methods have to be thoroughly tested for their applicability to environmental samples. In this study, we critically tested a recently developed multiplex qPCR strategy for its applicability to determine the spatiotemporal variability of V. cholerae abundance in

  11. Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

    Science.gov (United States)

    2013-01-01

    Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

  12. Comparison of viable plate count, turbidity measurement and real-time PCR for quantification of Porphyromonas gingivalis.

    Science.gov (United States)

    Clais, S; Boulet, G; Van Kerckhoven, M; Lanckacker, E; Delputte, P; Maes, L; Cos, P

    2015-01-01

    The viable plate count (VPC) is considered as the reference method for bacterial enumeration in periodontal microbiology but shows some important limitations for anaerobic bacteria. As anaerobes such as Porphyromonas gingivalis are difficult to culture, VPC becomes time-consuming and less sensitive. Hence, efficient normalization of experimental data to bacterial cell count requires alternative rapid and reliable quantification methods. This study compared the performance of VPC with that of turbidity measurement and real-time PCR (qPCR) in an experimental context using highly concentrated bacterial suspensions. Our TaqMan-based qPCR assay for P. gingivalis 16S rRNA proved to be sensitive and specific. Turbidity measurements offer a fast method to assess P. gingivalis growth, but suffer from high variability and a limited dynamic range. VPC was very time-consuming and less repeatable than qPCR. Our study concludes that qPCR provides the most rapid and precise approach for P. gingivalis quantification. Although our data were gathered in a specific research context, we believe that our conclusions on the inferior performance of VPC and turbidity measurements in comparison to qPCR can be extended to other research and clinical settings and even to other difficult-to-culture micro-organisms. Various clinical and research settings require fast and reliable quantification of bacterial suspensions. The viable plate count method (VPC) is generally seen as 'the gold standard' for bacterial enumeration. However, VPC-based quantification of anaerobes such as Porphyromonas gingivalis is time-consuming due to their stringent growth requirements and shows poor repeatability. Comparison of VPC, turbidity measurement and TaqMan-based qPCR demonstrated that qPCR possesses important advantages regarding speed, accuracy and repeatability. © 2014 The Society for Applied Microbiology.

  13. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  14. The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

    Science.gov (United States)

    Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

    2016-08-03

    Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification

  15. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  16. Germ cell transplantation using sexually competent fish: an approach for rapid propagation of endangered and valuable germlines.

    Directory of Open Access Journals (Sweden)

    Sullip K Majhi

    Full Text Available The transplantation of germ cells into adult recipient gonads is a tool with wide applications in animal breeding and conservation of valuable and/or endangered species; it also provides a means for basic studies involving germ cell (GC proliferation and differentiation. Here we describe the establishment of a working model for xenogeneic germ cell transplantation (GCT in sexually competent fish. Spermatogonial cells isolated from juveniles of one species, the pejerrey Odontesthes bonariensis (Atherinopsidae, were surgically transplanted into the gonads of sexually mature Patagonian pejerrey O. hatcheri, which have been partially depleted of endogenous GCs by a combination of Busulfan (40 mg/kg and high water temperature (25 degrees C treatments. The observation of the donor cells' behavior showed that transplanted spermatogonial cells were able to recolonize the recipients' gonads and resume spermatogenesis within 6 months from the GCT. The presence of donor-derived gametes was confirmed by PCR in 20% of the surrogate O. hatcheri fathers at 6 months and crosses with O. bonariensis mothers produced hybrids and pure O. bonariensis, with donor-derived germline transmission rates of 1.2-13.3%. These findings indicate that transplantation of spermatogonial cells into sexually competent fish can shorten considerably the production time of donor-derived gametes and offspring and could play a vital role in germline conservation and propagation of valued and/or endangered fish species.

  17. PCR in forensic genetics

    DEFF Research Database (Denmark)

    Morling, Niels

    2009-01-01

    Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...... and more advanced, special investigations in cases concerning crime, paternity, relationship, disaster victim identification etc. The present review gives an update on the use of DNA investigations in forensic genetics.......Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...

  18. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  19. New approach for rapid assessment of trophic status of Yellow Sea and East China Sea using easy-to-measure parameters

    Science.gov (United States)

    Kong, Xianyu; Liu, Yanfang; Jian, Huimin; Su, Rongguo; Yao, Qingzhen; Shi, Xiaoyong

    2017-10-01

    To realize potential cost savings in coastal monitoring programs and provide timely advice for marine management, there is an urgent need for efficient evaluation tools based on easily measured variables for the rapid and timely assessment of estuarine and offshore eutrophication. In this study, using parallel factor analysis (PARAFAC), principal component analysis (PCA), and discriminant function analysis (DFA) with the trophic index (TRIX) for reference, we developed an approach for rapidly assessing the eutrophication status of coastal waters using easy-to-measure parameters, including chromophoric dissolved organic matter (CDOM), fluorescence excitation-emission matrices, CDOM UV-Vis absorbance, and other water-quality parameters (turbidity, chlorophyll a, and dissolved oxygen). First, we decomposed CDOM excitation-emission matrices (EEMs) by PARAFAC to identify three components. Then, we applied PCA to simplify the complexity of the relationships between the water-quality parameters. Finally, we used the PCA score values as independent variables in DFA to develop a eutrophication assessment model. The developed model yielded classification accuracy rates of 97.1%, 80.5%, 90.3%, and 89.1% for good, moderate, and poor water qualities, and for the overall data sets, respectively. Our results suggest that these easy-to-measure parameters could be used to develop a simple approach for rapid in-situ assessment and monitoring of the eutrophication of estuarine and offshore areas.

  20. Rapid Chemometric X-Ray Fluorescence approaches for spectral Diagnostics of Cancer utilizing Tissue Trace Metals and Speciation profiles

    International Nuclear Information System (INIS)

    Okonda, J.J.

    2015-01-01

    Energy dispersive X-ray fluorescence (EDXRF) spectroscopy is an analytical method for identification and quantification of elements in materials by measurement of their spectral energy and intensity. EDXRFS spectroscopic technique involves simultaneous non-invasive acquisition of both fluorescence and scatter spectra from samples for quantitative determination of trace elemental content in complex matrix materials. The objective is develop a chemometric-aided EDXRFS method for rapid diagnosis of cancer and its severity (staging) based on analysis of trace elements (Cu, Zn, Fe, Se and Mn), their speciation and multivariate alterations of the elements in cancerous body tissue samples as cancer biomarkers. The quest for early diagnosis of cancer is based on the fact that early intervention translates to higher survival rate and better quality of life. Chemometric aided EDXRFS cancer diagnostic model has been evaluated as a direct and rapid superior alternative for the traditional quantitative methods used in XRF such as FP method. PCA results of cultured samples indicate that it is possible to characterize cancer at early and late stage of development based on trace elemental profiles

  1. Transgene detection by digital droplet PCR.

    Directory of Open Access Journals (Sweden)

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  2. Rapid thermal annealing of Ti-rich TiNi thin films: A new approach to fabricate patterned shape memory thin films

    International Nuclear Information System (INIS)

    Motemani, Y.; Tan, M.J.; White, T.J.; Huang, W.M.

    2011-01-01

    This paper reports the rapid thermal annealing (RTA) of Ti-rich TiNi thin films, synthesized by the co-sputtering of TiNi and Ti targets. Long-range order of aperiodic alloy could be achieved in a few seconds with the optimum temperature of 773 K. Longer annealing (773 K/240 s), transformed the film to a poorly ordered vitreous phase, suggesting a novel method for solid state amorphization. Reitveld refinement analyses showed significant differences in structural parameters of the films crystallized by rapid and conventional thermal annealing. Dependence of the elastic modulus on the valence electron density (VED) of the crystallized films was studied. It is suggested that RTA provides a new approach to fabricate patterned shape memory thin films.

  3. OFFGEL electrophoresis and tandem mass spectrometry approach compared with DNA-based PCR method for authentication of meat species from raw and cooked ground meat mixtures containing cattle meat, water buffalo meat and sheep meat.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth

    2017-10-15

    The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. PCR+ In Diesel Fuels and Emissions Research

    Energy Technology Data Exchange (ETDEWEB)

    McAdams, H.T.

    2002-04-15

    In past work for the U.S. Department of Energy (DOE) and Oak Ridge National Laboratory (ORNL), PCR+ was developed as an alternative methodology for building statistical models. PCR+ is an extension of Principal Components Regression (PCR), in which the eigenvectors resulting from Principal Components Analysis (PCA) are used as predictor variables in regression analysis. The work was motivated by the observation that most heavy-duty diesel (HDD) engine research was conducted with test fuels that had been ''concocted'' in the laboratory to vary selected fuel properties in isolation from each other. This approach departs markedly from the real world, where the reformulation of diesel fuels for almost any purpose leads to changes in a number of interrelated properties. In this work, we present new information regarding the problems encountered in the conventional approach to model-building and how the PCR+ method can be used to improve research on the relationship between fuel characteristics and engine emissions. We also discuss how PCR+ can be applied to a variety of other research problems related to diesel fuels.

  5. Rapid approach to identify the presence of Arabica and Robusta species in coffee using 1H NMR spectroscopy.

    Science.gov (United States)

    Monakhova, Yulia B; Ruge, Winfried; Kuballa, Thomas; Ilse, Maren; Winkelmann, Ole; Diehl, Bernd; Thomas, Freddy; Lachenmeier, Dirk W

    2015-09-01

    NMR spectroscopy was used to verify the presence of Arabica and Robusta species in coffee. Lipophilic extracts of authentic roasted and green coffees showed the presence of established markers for Robusta (16-O-methylcafestol (16-OMC)) and for Arabica (kahweol). The integration of the 16-OMC signal (δ 3.165 ppm) was used to estimate the amount of Robusta in coffee blends with an approximate limit of detection of 1-3%. The method was successfully applied for the analysis of 77 commercial coffee samples (coffee pods, coffee capsules, and coffee beans). Furthermore, principal component analysis (PCA) was applied to the spectra of lipophilic and aqueous extracts of 20 monovarietal authentic samples. Clusters of the two species were observed. NMR spectroscopy can be used as a rapid prescreening tool to discriminate Arabica and Robusta coffee species before the confirmation applying the official method. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Using the Consolidated Framework for Implementation Research (CFIR) to produce actionable findings: a rapid-cycle evaluation approach to improving implementation.

    Science.gov (United States)

    Keith, Rosalind E; Crosson, Jesse C; O'Malley, Ann S; Cromp, DeAnn; Taylor, Erin Fries

    2017-02-10

    Much research does not address the practical needs of stakeholders responsible for introducing health care delivery interventions into organizations working to achieve better outcomes. In this article, we present an approach to using the Consolidated Framework for Implementation Research (CFIR) to guide systematic research that supports rapid-cycle evaluation of the implementation of health care delivery interventions and produces actionable evaluation findings intended to improve implementation in a timely manner. To present our approach, we describe a formative cross-case qualitative investigation of 21 primary care practices participating in the Comprehensive Primary Care (CPC) initiative, a multi-payer supported primary care practice transformation intervention led by the Centers for Medicare and Medicaid Services. Qualitative data include observational field notes and semi-structured interviews with primary care practice leadership, clinicians, and administrative and medical support staff. We use intervention-specific codes, and CFIR constructs to reduce and organize the data to support cross-case analysis of patterns of barriers and facilitators relating to different CPC components. Using the CFIR to guide data collection, coding, analysis, and reporting of findings supported a systematic, comprehensive, and timely understanding of barriers and facilitators to practice transformation. Our approach to using the CFIR produced actionable findings for improving implementation effectiveness during this initiative and for identifying improvements to implementation strategies for future practice transformation efforts. The CFIR is a useful tool for guiding rapid-cycle evaluation of the implementation of practice transformation initiatives. Using the approach described here, we systematically identified where adjustments and refinements to the intervention could be made in the second year of the 4-year intervention. We think the approach we describe has broad

  7. Development of a rapid approach for the enumeration of Escherichia coli in riverbed sediment: case study, the Apies River, South Africa

    CSIR Research Space (South Africa)

    Abia

    2015-12-01

    Full Text Available stream_source_info Abia_2015_ABSTRACT.pdf.txt stream_content_type text/plain stream_size 3292 Content-Encoding UTF-8 stream_name Abia_2015_ABSTRACT.pdf.txt Content-Type text/plain; charset=UTF-8 Journal of Soils... and Sediments Development of a rapid approach for the enumeration of Escherichia coli in riverbed sediment: case study, the Apies River, South Africa L. K. A. Abia: M. N. B. Momba Department of Environmental, Water and Earth Science, Tshwane University...

  8. Validating the Kinematic Wave Approach for Rapid Soil Erosion Assessment and Improved BMP Site Selection to Enhance Training Land Sustainability

    Science.gov (United States)

    2014-02-01

    installation based on a Euclidean distance allocation and assigned that installation’s threshold values. The second approach used a thin - plate spline ...installation critical nLS+ thresholds involved spatial interpolation. A thin - plate spline radial basis functions (RBF) was selected as the...the interpolation of installation results using a thin - plate spline radial basis function technique. 6.5 OBJECTIVE #5: DEVELOP AND

  9. Rapid ecological shift following piscivorous fish introduction to increasingly eutrophic and warmer Lake Furnas (Azores Archipelago, Portugal): A paleoecological approach

    DEFF Research Database (Denmark)

    Buchaca, Teresa; Skov, Tue; Amsinck, Susanne Lildal

    2011-01-01

    Lake ecosystems are nowadays often subjected to multi-stressors, such as eutrophication, climate change, and fish manipulations, the effects of which can be difficult to disentangle, not least from the usual short-term limnological time-series that are available. However, multi-proxy paleoecologi......Lake ecosystems are nowadays often subjected to multi-stressors, such as eutrophication, climate change, and fish manipulations, the effects of which can be difficult to disentangle, not least from the usual short-term limnological time-series that are available. However, multi......, meteorological forcing, and fish species introduction for recent lake ecosystem development in Lake Furnas on the island of Sa˜o Miguel, the Azores. The lake was stocked with cyprinids in the late nineteenth century and recently also with piscivorous fish, and has been affected by increasing agricultural......, and cryptophytes. The composition of microbial and algal assemblages changed rapidly after Daphnia appearance, and the covariance between fish stocking, nutrient loading, and enhanced temperatures captured most of the variability in algae accumulation, and thus likely in lake primary production as well. Thus, lake...

  10. PCR, exit stage left ...

    CERN Multimedia

    2004-01-01

    The Prevessin Control Room during LEP's start up in 1989. The Prévessin Control Room (PCR) was recently engulfed in a wave of nostalgia. The PCR, scene of some of the greatest moments in CERN's history, is being dismantled to prepare for a complete overhaul. In February 2006, a new combined control centre for all the accelerators will open its doors on the same site, together with a new building currently under construction (see Bulletin issue 27/2004 of 28 June 2004). This marks the end of an important chapter in CERN's history. The Prévessin Control Room saw its first momentous event 28 years ago when the 400 GeV beam for the SPS was commissioned in the presence of Project Leader John Adams. It was also here that the first proton-antiproton collisions were observed, in 1981. Eight years later, in 1989, operators and directors alike jumped for joy at the announcement of the first electron-positron collisions at the start up of LEP, the biggest accelerator in the world. Today the 80 terminals and PCs have b...

  11. Introducing a new and rapid microextraction approach based on magnetic ionic liquids: Stir bar dispersive liquid microextraction.

    Science.gov (United States)

    Chisvert, Alberto; Benedé, Juan L; Anderson, Jared L; Pierson, Stephen A; Salvador, Amparo

    2017-08-29

    With the aim of contributing to the development and improvement of microextraction techniques, a novel approach combining the principles and advantages of stir bar sorptive extraction (SBSE) and dispersive liquid-liquid microextraction (DLLME) is presented. This new approach, termed stir bar dispersive liquid microextraction (SBDLME), involves the addition of a magnetic ionic liquid (MIL) and a neodymium-core magnetic stir bar into the sample allowing the MIL coat the stir bar due to physical forces (i.e., magnetism). As long as the stirring rate is maintained at low speed, the MIL resists rotational (centrifugal) forces and remains on the stir bar surface in a manner closely resembling SBSE. By increasing the stirring rate, the rotational forces surpass the magnetic field and the MIL disperses into the sample solution in a similar manner to DLLME. After extraction, the stirring is stopped and the MIL returns to the stir bar without the requirement of an additional external magnetic field. The MIL-coated stir bar containing the preconcentrated analytes is thermally desorbed directly into a gas chromatographic system coupled to a mass spectrometric detector (TD-GC-MS). This novel approach opens new insights into the microextraction field, by using the benefits provided by SBSE and DLLME simultaneously, such as automated thermal desorption and high surface contact area, respectively, but most importantly, it enables the use of tailor-made solvents (i.e., MILs). To prove its utility, SBDLME has been used in the extraction of lipophilic organic UV filters from environmental water samples as model analytical application with excellent analytical features in terms of linearity, enrichment factors (67-791), limits of detection (low ng L -1 ), intra- and inter-day repeatability (RSD<15%) and relative recoveries (87-113%, 91-117% and 89-115% for river, sea and swimming pool water samples, respectively). Copyright © 2017 Elsevier B.V. All rights reserved.

  12. An extensive cocktail approach for rapid risk assessment of in vitro CYP450 direct reversible inhibition by xenobiotic exposure

    Energy Technology Data Exchange (ETDEWEB)

    Spaggiari, Dany, E-mail: dany.spaggiari@unige.ch [School of Pharmaceutical Sciences, University of Geneva, University of Lausanne, Boulevard d' Yvoy 20, 1211 Geneva 4 (Switzerland); Daali, Youssef, E-mail: youssef.daali@hcuge.ch [Clinical Pharmacology and Toxicology Service, Geneva University Hospitals, Rue Gabrielle Perret-Gentil, 1211 Genève 14 (Switzerland); Rudaz, Serge, E-mail: serge.rudaz@unige.ch [School of Pharmaceutical Sciences, University of Geneva, University of Lausanne, Boulevard d' Yvoy 20, 1211 Geneva 4 (Switzerland); Swiss Centre for Applied Human Toxicology, University of Geneva, Boulevard d' Yvoy 20, 1211 Geneva 4 (Switzerland)

    2016-07-01

    Acute exposure to environmental factors strongly affects the metabolic activity of cytochrome P450 (P450). As a consequence, the risk of interaction could be increased, modifying the clinical outcomes of a medication. Because toxic agents cannot be administered to humans for ethical reasons, in vitro approaches are therefore essential to evaluate their impact on P450 activities. In this work, an extensive cocktail mixture was developed and validated for in vitro P450 inhibition studies using human liver microsomes (HLM). The cocktail comprised eleven P450-specific probe substrates to simultaneously assess the activities of the following isoforms: 1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 2E1, 2J2 and subfamily 3A. The high selectivity and sensitivity of the developed UHPLC-MS/MS method were critical for the success of this methodology, whose main advantages are: (i) the use of eleven probe substrates with minimized interactions, (ii) a low HLM concentration, (iii) fast incubation (5 min) and (iv) the use of metabolic ratios as microsomal P450 activities markers. This cocktail approach was successfully validated by comparing the obtained IC{sub 50} values for model inhibitors with those generated with the conventional single probe methods. Accordingly, reliable inhibition values could be generated 10-fold faster using a 10-fold smaller amount of HLM compared to individual assays. This approach was applied to assess the P450 inhibition potential of widespread insecticides, namely, chlorpyrifos, fenitrothion, methylparathion and profenofos. In all cases, P450 2B6 was the most affected with IC{sub 50} values in the nanomolar range. For the first time, mixtures of these four insecticides incubated at low concentrations showed a cumulative inhibitory in vitro effect on P450 2B6. - Highlights: • Ten P450 isoforms activities assessed simultaneously with only one incubation. • P450 activity levels measured using the metabolic ratio approach. • IC{sub 50} values generated 10

  13. An extensive cocktail approach for rapid risk assessment of in vitro CYP450 direct reversible inhibition by xenobiotic exposure

    International Nuclear Information System (INIS)

    Spaggiari, Dany; Daali, Youssef; Rudaz, Serge

    2016-01-01

    Acute exposure to environmental factors strongly affects the metabolic activity of cytochrome P450 (P450). As a consequence, the risk of interaction could be increased, modifying the clinical outcomes of a medication. Because toxic agents cannot be administered to humans for ethical reasons, in vitro approaches are therefore essential to evaluate their impact on P450 activities. In this work, an extensive cocktail mixture was developed and validated for in vitro P450 inhibition studies using human liver microsomes (HLM). The cocktail comprised eleven P450-specific probe substrates to simultaneously assess the activities of the following isoforms: 1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 2E1, 2J2 and subfamily 3A. The high selectivity and sensitivity of the developed UHPLC-MS/MS method were critical for the success of this methodology, whose main advantages are: (i) the use of eleven probe substrates with minimized interactions, (ii) a low HLM concentration, (iii) fast incubation (5 min) and (iv) the use of metabolic ratios as microsomal P450 activities markers. This cocktail approach was successfully validated by comparing the obtained IC 50 values for model inhibitors with those generated with the conventional single probe methods. Accordingly, reliable inhibition values could be generated 10-fold faster using a 10-fold smaller amount of HLM compared to individual assays. This approach was applied to assess the P450 inhibition potential of widespread insecticides, namely, chlorpyrifos, fenitrothion, methylparathion and profenofos. In all cases, P450 2B6 was the most affected with IC 50 values in the nanomolar range. For the first time, mixtures of these four insecticides incubated at low concentrations showed a cumulative inhibitory in vitro effect on P450 2B6. - Highlights: • Ten P450 isoforms activities assessed simultaneously with only one incubation. • P450 activity levels measured using the metabolic ratio approach. • IC 50 values generated 10-fold faster

  14. On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System.

    Science.gov (United States)

    DeShields, Joseph B; Bomberger, Rachel A; Woodhall, James W; Wheeler, David L; Moroz, Natalia; Johnson, Dennis A; Tanaka, Kiwamu

    2018-02-23

    On-site diagnosis of plant diseases can be a useful tool for growers for timely decisions enabling the earlier implementation of disease management strategies that reduce the impact of the disease. Presently in many diagnostic laboratories, the polymerase chain reaction (PCR), particularly real-time PCR, is considered the most sensitive and accurate method for plant pathogen detection. However, laboratory-based PCRs typically require expensive laboratory equipment and skilled personnel. In this study, soil-borne pathogens of potato are used to demonstrate the potential for on-site molecular detection. This was achieved using a rapid and simple protocol comprising of magnetic bead-based nucleic acid extraction, portable real-time PCR (fluorogenic probe-based assay). The portable real-time PCR approach compared favorably with a laboratory-based system, detecting as few as 100 copies of DNA from Spongospora subterranea. The portable real-time PCR method developed here can serve as an alternative to laboratory-based approaches and a useful on-site tool for pathogen diagnosis.

  15. Failure of PCR to Detect Treponema pallidum ssp. pertenue DNA in Blood in Latent Yaws.

    Directory of Open Access Journals (Sweden)

    Michael Marks

    Full Text Available Yaws, caused by Treponema pallidum ssp. pertenue, is a neglected tropical disease closely related to venereal syphilis and is targeted for eradication by 2020. Latent yaws represents a diagnostic challenge, and current tools cannot adequately distinguish between individuals with true latent infection and individuals who are serofast following successful treatment. PCR on blood has previously been shown to detect T. pallidum DNA in patients with syphilis, suggesting that this approach may be of value in yaws. We performed real-time PCR for Treponema pallidum ssp. pertenue on blood samples from 140 children with positive T. pallidum Particle Agglutination (TPPA and Rapid Plasma Reagin (RPR tests and 7 controls (negative serology, all collected as part of a prospective study of yaws in the Solomon Islands. All samples were also tested by a nested PCR for T. pallidum. 12 patients had clinical evidence of active yaws whilst 128 were considered to have latent yaws. 43 children had high titre rapid plasma reagins (RPRs of ≥1:32. PCR testing with both assays gave negative results in all cases. It is possible that the failure to detect T. pallidum ssp. pertenue in blood reflects lower loads of organism in latent yaws compared to those in latent infection with T. pallidum ssp. pertenue, and/or a lower propensity for haematogenous dissemination in yaws than in syphilis. As the goal of the yaws control programme is eradication, a tool that can differentiate true latent infection from individuals who are serofast would be of value; however, PCR of blood is not that tool.

  16. Failure of PCR to Detect Treponema pallidum ssp. pertenue DNA in Blood in Latent Yaws.

    Science.gov (United States)

    Marks, Michael; Katz, Samantha; Chi, Kai-Hua; Vahi, Ventis; Sun, Yongcheng; Mabey, David C; Solomon, Anthony W; Chen, Cheng Y; Pillay, Allan

    2015-01-01

    Yaws, caused by Treponema pallidum ssp. pertenue, is a neglected tropical disease closely related to venereal syphilis and is targeted for eradication by 2020. Latent yaws represents a diagnostic challenge, and current tools cannot adequately distinguish between individuals with true latent infection and individuals who are serofast following successful treatment. PCR on blood has previously been shown to detect T. pallidum DNA in patients with syphilis, suggesting that this approach may be of value in yaws. We performed real-time PCR for Treponema pallidum ssp. pertenue on blood samples from 140 children with positive T. pallidum Particle Agglutination (TPPA) and Rapid Plasma Reagin (RPR) tests and 7 controls (negative serology), all collected as part of a prospective study of yaws in the Solomon Islands. All samples were also tested by a nested PCR for T. pallidum. 12 patients had clinical evidence of active yaws whilst 128 were considered to have latent yaws. 43 children had high titre rapid plasma reagins (RPRs) of ≥1:32. PCR testing with both assays gave negative results in all cases. It is possible that the failure to detect T. pallidum ssp. pertenue in blood reflects lower loads of organism in latent yaws compared to those in latent infection with T. pallidum ssp. pertenue, and/or a lower propensity for haematogenous dissemination in yaws than in syphilis. As the goal of the yaws control programme is eradication, a tool that can differentiate true latent infection from individuals who are serofast would be of value; however, PCR of blood is not that tool.

  17. Rational and evolutionary engineering approaches uncover a small set of genetic changes efficient for rapid xylose fermentation in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Soo Rin Kim

    Full Text Available Economic bioconversion of plant cell wall hydrolysates into fuels and chemicals has been hampered mainly due to the inability of microorganisms to efficiently co-ferment pentose and hexose sugars, especially glucose and xylose, which are the most abundant sugars in cellulosic hydrolysates. Saccharomyces cerevisiae cannot metabolize xylose due to a lack of xylose-metabolizing enzymes. We developed a rapid and efficient xylose-fermenting S. cerevisiae through rational and inverse metabolic engineering strategies, comprising the optimization of a heterologous xylose-assimilating pathway and evolutionary engineering. Strong and balanced expression levels of the XYL1, XYL2, and XYL3 genes constituting the xylose-assimilating pathway increased ethanol yields and the xylose consumption rates from a mixture of glucose and xylose with little xylitol accumulation. The engineered strain, however, still exhibited a long lag time when metabolizing xylose above 10 g/l as a sole carbon source, defined here as xylose toxicity. Through serial-subcultures on xylose, we isolated evolved strains which exhibited a shorter lag time and improved xylose-fermenting capabilities than the parental strain. Genome sequencing of the evolved strains revealed that mutations in PHO13 causing loss of the Pho13p function are associated with the improved phenotypes of the evolved strains. Crude extracts of a PHO13-overexpressing strain showed a higher phosphatase activity on xylulose-5-phosphate (X-5-P, suggesting that the dephosphorylation of X-5-P by Pho13p might generate a futile cycle with xylulokinase overexpression. While xylose consumption rates by the evolved strains improved substantially as compared to the parental strain, xylose metabolism was interrupted by accumulated acetate. Deletion of ALD6 coding for acetaldehyde dehydrogenase not only prevented acetate accumulation, but also enabled complete and efficient fermentation of xylose as well as a mixture of glucose and

  18. Rapid and sensitive approach to simultaneous detection of genomes of hepatitis A, B, C, D and E viruses.

    Science.gov (United States)

    Kodani, Maja; Mixson-Hayden, Tonya; Drobeniuc, Jan; Kamili, Saleem

    2014-10-01

    Five viruses have been etiologically associated with viral hepatitis. Nucleic acid testing (NAT) remains the gold standard for diagnosis of viremic stages of infection. NAT methodologies have been developed for all hepatitis viruses; however, a NAT-based assay that can simultaneously detect all five viruses is not available. We designed TaqMan card-based assays for detection of HAV RNA, HBV DNA, HCV RNA, HDV RNA and HEV RNA. The performances of individual assays were evaluated on TaqMan Array Cards (TAC) for detecting five viral genomes simultaneously. Sensitivity and specificity were determined by testing 329 NAT-tested clinical specimens. All NAT-positive samples for HCV (n = 32), HDV (n = 28) and HEV (n = 14) were also found positive in TAC (sensitivity, 100%). Forty-three of 46 HAV-NAT positive samples were also positive in TAC (sensitivity, 94%), while 36 of 39 HBV-NAT positive samples were positive (sensitivity, 92%). No false-positives were detected for HBV (n = 32), HCV (n = 36), HDV (n = 30), and HEV (n = 31) NAT-negative samples (specificity 100%), while 38 of 41 HAV-NAT negative samples were negative by TAC (specificity 93%). TAC assay was concordant with corresponding individual NATs for hepatitis A-E viral genomes and can be used for their detection simultaneously. The TAC assay has potential for use in hepatitis surveillance, for screening of donor specimens and in outbreak situations. Wider availability of TAC-ready assays may allow for customized assays, for improving acute jaundice surveillance and for other purposes for which there is need to identify multiple pathogens rapidly. Published by Elsevier B.V.

  19. Development of a surface plasmon resonance biosensing approach for the rapid detection of porcine circovirus type2 in sample solutions.

    Directory of Open Access Journals (Sweden)

    Jiandong Hu

    Full Text Available A sensitive and label-free analytical approach for the detection of porcine circovirus type 2 (PCV2 instead of PCV2 antibody in serum sample was systematically investigated in this research based on surface plasmon resonance (SPR with an establishment of special molecular identification membrane. The experimental device for constructing the biosensing analyzer is composed of an integrated biosensor, a home-made microfluidic module, and an electrical control circuit incorporated with a photoelectric converter. In order to detect the PCV2 using the surface plasmon resonance immunoassay, the mercaptopropionic acid has been used to bind the Au film in advance through the known form of the strong S-Au covalent bonds formed by the chemical radical of the mercaptopropionic acid and the Au film. PCV2 antibodies were bonded with the mercaptopropionic acid by covalent -CO-NH- amide bonding. For the purpose of evaluating the performance of this approach, the known concentrations of PCV2 Cap protein of 10 µg/mL, 7.5 µg/mL, 5 µg/mL, 2.5 µg/mL, 1 µg/mL, and 0.5 µg/mL were prepared by diluting with PBS successively and then the delta response units (ΔRUs were measured individually. Using the data collected from the linear CCD array, the ΔRUs gave a linear response over a wide concentration range of standard known concentrations of PCV2 Cap protein with the R-Squared value of 0.99625. The theoretical limit of detection was calculated to be 0.04 µg/mL for the surface plasmon resonance biosensing approach. Correspondingly, the recovery rate ranged from 81.0% to 89.3% was obtained. In contrast to the PCV2 detection kits, this surface plasmon resonance biosensing system was validated through linearity, precision and recovery, which demonstrated that the surface plasmon resonance immunoassay is reliable and robust. It was concluded that the detection method which is associated with biomembrane properties is expected to contribute much to determine the PCV2

  20. Introducing a new and rapid microextraction approach based on magnetic ionic liquids: Stir bar dispersive liquid microextraction

    International Nuclear Information System (INIS)

    Chisvert, Alberto; Benedé, Juan L.; Anderson, Jared L.; Pierson, Stephen A.; Salvador, Amparo

    2017-01-01

    With the aim of contributing to the development and improvement of microextraction techniques, a novel approach combining the principles and advantages of stir bar sorptive extraction (SBSE) and dispersive liquid-liquid microextraction (DLLME) is presented. This new approach, termed stir bar dispersive liquid microextraction (SBDLME), involves the addition of a magnetic ionic liquid (MIL) and a neodymium-core magnetic stir bar into the sample allowing the MIL coat the stir bar due to physical forces (i.e., magnetism). As long as the stirring rate is maintained at low speed, the MIL resists rotational (centrifugal) forces and remains on the stir bar surface in a manner closely resembling SBSE. By increasing the stirring rate, the rotational forces surpass the magnetic field and the MIL disperses into the sample solution in a similar manner to DLLME. After extraction, the stirring is stopped and the MIL returns to the stir bar without the requirement of an additional external magnetic field. The MIL-coated stir bar containing the preconcentrated analytes is thermally desorbed directly into a gas chromatographic system coupled to a mass spectrometric detector (TD-GC-MS). This novel approach opens new insights into the microextraction field, by using the benefits provided by SBSE and DLLME simultaneously, such as automated thermal desorption and high surface contact area, respectively, but most importantly, it enables the use of tailor-made solvents (i.e., MILs). To prove its utility, SBDLME has been used in the extraction of lipophilic organic UV filters from environmental water samples as model analytical application with excellent analytical features in terms of linearity, enrichment factors (67–791), limits of detection (low ng L −1 ), intra- and inter-day repeatability (RSD<15%) and relative recoveries (87–113%, 91–117% and 89–115% for river, sea and swimming pool water samples, respectively). - Highlights: • A new microextraction method combining the

  1. Molecular quantification of environmental DNA using microfluidics and digital PCR.

    Science.gov (United States)

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2012-09-01

    Real-time PCR has been widely used to evaluate gene abundance in natural microbial habitats. However, PCR-inhibitory substances often reduce the efficiency of PCR, leading to the underestimation of target gene copy numbers. Digital PCR using microfluidics is a new approach that allows absolute quantification of DNA molecules. In this study, digital PCR was applied to environmental samples, and the effect of PCR inhibitors on DNA quantification was tested. In the control experiment using λ DNA and humic acids, underestimation of λ DNA at 1/4400 of the theoretical value was observed with 6.58 ng μL(-1) humic acids. In contrast, digital PCR provided accurate quantification data with a concentration of humic acids up to 9.34 ng μL(-1). The inhibitory effect of paddy field soil extract on quantification of the archaeal 16S rRNA gene was also tested. By diluting the DNA extract, quantified copy numbers from real-time PCR and digital PCR became similar, indicating that dilution was a useful way to remedy PCR inhibition. The dilution strategy was, however, not applicable to all natural environmental samples. For example, when marine subsurface sediment samples were tested the copy number of archaeal 16S rRNA genes was 1.04×10(3) copies/g-sediment by digital PCR, whereas real-time PCR only resulted in 4.64×10(2) copies/g-sediment, which was most likely due to an inhibitory effect. The data from this study demonstrated that inhibitory substances had little effect on DNA quantification using microfluidics and digital PCR, and showed the great advantages of digital PCR in accurate quantifications of DNA extracted from various microbial habitats. Copyright © 2012 Elsevier GmbH. All rights reserved.

  2. A rapid, computational approach for assessing interfraction esophageal motion for use in stereotactic body radiation therapy planning

    Directory of Open Access Journals (Sweden)

    Michael L. Cardenas, MD

    2018-04-01

    Full Text Available Purpose: We present a rapid computational method for quantifying interfraction motion of the esophagus in patients undergoing stereotactic body radiation therapy on a magnetic resonance (MR guided radiation therapy system. Methods and materials: Patients who underwent stereotactic body radiation therapy had simulation computed tomography (CT and on-treatment MR scans performed. The esophagus was contoured on each scan. CT contours were transferred to MR volumes via rigid registration. Digital Imaging and Communications in Medicine files containing contour points were exported to MATLAB. In-plane CT and MR contour points were spline interpolated, yielding boundaries with centroid positions, CCT and CMR. MR contour points lying outside of the CT contour were extracted. For each such point, BMR(j, a segment from CCT intersecting BMR(j, was produced; its intersection with the CT contour, BCT(i, was calculated. The length of the segment Sij, between BCT(i and BMR(j, was found. The orientation θ was calculated from Sij vector components:θ = arctan[(Sijy / (Sijx]A set of segments {Sij} was produced for each slice and binned by quadrant with 0° < θ ≤ 90°, 90° < θ ≤ 180°, 180° < θ ≤ 270°, and 270° < θ ≤ 360° for the left anterior, right anterior, right posterior, and left posterior quadrants, respectively. Slices were binned into upper, middle, and lower esophageal (LE segments. Results: Seven patients, each having 3 MR scans, were evaluated, yielding 1629 axial slices and 84,716 measurements. The LE segment exhibited the greatest magnitude of motion. The mean LE measurements in the left anterior, left posterior, right anterior, and right posterior were 5.2 ± 0.07 mm, 6.0 ± 0.09 mm, 4.8 ± 0.08 mm, and 5.1 ± 0.08 mm, respectively. There was considerable interpatient variability. Conclusions: The LE segment exhibited the greatest magnitude of mobility compared with the

  3. A rapid-screening approach to detect and quantify microplastics based on fluorescent tagging with Nile Red

    Science.gov (United States)

    Maes, Thomas; Jessop, Rebecca; Wellner, Nikolaus; Haupt, Karsten; Mayes, Andrew G.

    2017-03-01

    A new approach is presented for analysis of microplastics in environmental samples, based on selective fluorescent staining using Nile Red (NR), followed by density-based extraction and filtration. The dye adsorbs onto plastic surfaces and renders them fluorescent when irradiated with blue light. Fluorescence emission is detected using simple photography through an orange filter. Image-analysis allows fluorescent particles to be identified and counted. Magnified images can be recorded and tiled to cover the whole filter area, allowing particles down to a few micrometres to be detected. The solvatochromic nature of Nile Red also offers the possibility of plastic categorisation based on surface polarity characteristics of identified particles. This article details the development of this staining method and its initial cross-validation by comparison with infrared (IR) microscopy. Microplastics of different sizes could be detected and counted in marine sediment samples. The fluorescence staining identified the same particles as those found by scanning a filter area with IR-microscopy.

  4. Rapid Synthesis of Highly Monodisperse Au x Ag 1− x Alloy Nanoparticles via a Half-Seeding Approach

    KAUST Repository

    Chng, Ting Ting

    2011-05-03

    Gold-silver alloy AuxAg1-x is an important class of functional materials promising new applications across a wide array of technological fields. In this paper, we report a fast and facile synthetic protocol for preparation of highly monodisperse AuxAg1-x alloy nanoparticles in the size range of 3-6 nm. The precursors employed in this work are M(I)-alkanethiolates (M = Au and Ag), which can be easily prepared by mixing common chemicals such as HAuCl4 or AgNO3 with alkanethiols at room temperature. In this half-seeding approach, one of the M(I)-alkanethiolates is first heated and reduced in oleylamine solvent, and freshly formed metal clusters will then act as premature seeds on which both the first and second metals (from M(I)-alkanethiolates, M = Au and Ag) can grow accordingly without additional nucleation and thus achieve high monodispersity for product alloy nanoparticles. Unlike in other prevailing methods, both Au and Ag elements present in these solid precursors are in the same monovalent state and have identical supramolecular structures, which may lead to a more homogeneous reduction and complete interdiffusion at elevated reaction temperatures. When the M(I)-alkanethiolates are reduced to metallic forms, the detached alkanethiolate ligands will serve as capping agent to control the growth. More importantly, composition, particle size, and optical properties of AuxAg1-x alloy nanoparticles can be conveniently tuned with this approach. The optical limiting properties of the prepared particles have also been investigated at 532 and 1064 nm using 7 ns laser pulses, which reveals that the as-prepared alloy nanoparticles exhibit outstanding broadband optical limiting properties with low thresholds. © 2011 American Chemical Society.

  5. A Multi-Level Approach to Modeling Rapidly Growing Mega-Regions as a Coupled Human-Natural System

    Science.gov (United States)

    Koch, J. A.; Tang, W.; Meentemeyer, R. K.

    2013-12-01

    The FUTure Urban-Regional Environment Simulation (FUTURES) integrates information on nonstationary drivers of land change (per capita land area demand, site suitability, and spatial structure of conversion events) into spatial-temporal projections of changes in landscape patterns (Meentemeyer et al., 2013). One striking feature of FUTURES is its patch-growth algorithm that includes feedback effects of former development events across several temporal and spatial scales: cell-level transition events are aggregated into patches of land change and their further growth is based on empirically derived parameters controlling its size, shape, and dispersion. Here, we augment the FUTURES modeling framework by expanding its multilevel structure and its representation of human decision making. The new modeling framework is hierarchically organized as nested subsystems including the latest theory on telecouplings in coupled human-natural systems (Liu et al., 2013). Each subsystem represents a specific level of spatial scale and embraces agents that have decision making authority at a particular level. The subsystems are characterized with regard to their spatial representation and are connected via flows of information (e.g. regulations and policies) or material (e.g. population migration). To provide a modeling framework that is applicable to a wide range of settings and geographical regions and to keep it computationally manageable, we implement a 'zooming factor' that allows to enable or disable subsystems (and hence the represented processes), based on the extent of the study region. The implementation of the FUTURES modeling framework for a specific case study follows the observational modeling approach described in Grimm et al. (2005), starting from the analysis of empirical data in order to capture the processes relevant for specific scales and to allow a rigorous calibration and validation of the model application. In this paper, we give an introduction to the basic

  6. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  7. Balancing practicality and hydrologic realism: a parsimonious approach for simulating rapid groundwater recharge via unsaturated-zone preferential flow

    Science.gov (United States)

    Mirus, Benjamin B.; Nimmo, J.R.

    2013-01-01

    The impact of preferential flow on recharge and contaminant transport poses a considerable challenge to water-resources management. Typical hydrologic models require extensive site characterization, but can underestimate fluxes when preferential flow is significant. A recently developed source-responsive model incorporates film-flow theory with conservation of mass to estimate unsaturated-zone preferential fluxes with readily available data. The term source-responsive describes the sensitivity of preferential flow in response to water availability at the source of input. We present the first rigorous tests of a parsimonious formulation for simulating water table fluctuations using two case studies, both in arid regions with thick unsaturated zones of fractured volcanic rock. Diffuse flow theory cannot adequately capture the observed water table responses at both sites; the source-responsive model is a viable alternative. We treat the active area fraction of preferential flow paths as a scaled function of water inputs at the land surface then calibrate the macropore density to fit observed water table rises. Unlike previous applications, we allow the characteristic film-flow velocity to vary, reflecting the lag time between source and deep water table responses. Analysis of model performance and parameter sensitivity for the two case studies underscores the importance of identifying thresholds for initiation of film flow in unsaturated rocks, and suggests that this parsimonious approach is potentially of great practical value.

  8. Digital PCR as a tool to measure HIV persistence.

    Science.gov (United States)

    Rutsaert, Sofie; Bosman, Kobus; Trypsteen, Wim; Nijhuis, Monique; Vandekerckhove, Linos

    2018-01-30

    Although antiretroviral therapy is able to suppress HIV replication in infected patients, the virus persists and rebounds when treatment is stopped. In order to find a cure that can eradicate the latent reservoir, one must be able to quantify the persisting virus. Traditionally, HIV persistence studies have used real-time PCR (qPCR) to measure the viral reservoir represented by HIV DNA and RNA. Most recently, digital PCR is gaining popularity as a novel approach to nucleic acid quantification as it allows for absolute target quantification. Various commercial digital PCR platforms are nowadays available that implement the principle of digital PCR, of which Bio-Rad's QX200 ddPCR is currently the most used platform in HIV research. Quantification of HIV by digital PCR is proving to be a valuable improvement over qPCR as it is argued to have a higher robustness to mismatches between the primers-probe set and heterogeneous HIV, and forfeits the need for a standard curve, both of which are known to complicate reliable quantification. However, currently available digital PCR platforms occasionally struggle with unexplained false-positive partitions, and reliable segregation between positive and negative droplets remains disputed. Future developments and advancements of the digital PCR technology are promising to aid in the accurate quantification and characterization of the persistent HIV reservoir.

  9. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  10. A rapid and accurate approach for prediction of interactomes from co-elution data (PrInCE).

    Science.gov (United States)

    Stacey, R Greg; Skinnider, Michael A; Scott, Nichollas E; Foster, Leonard J

    2017-10-23

    An organism's protein interactome, or complete network of protein-protein interactions, defines the protein complexes that drive cellular processes. Techniques for studying protein complexes have traditionally applied targeted strategies such as yeast two-hybrid or affinity purification-mass spectrometry to assess protein interactions. However, given the vast number of protein complexes, more scalable methods are necessary to accelerate interaction discovery and to construct whole interactomes. We recently developed a complementary technique based on the use of protein correlation profiling (PCP) and stable isotope labeling in amino acids in cell culture (SILAC) to assess chromatographic co-elution as evidence of interacting proteins. Importantly, PCP-SILAC is also capable of measuring protein interactions simultaneously under multiple biological conditions, allowing the detection of treatment-specific changes to an interactome. Given the uniqueness and high dimensionality of co-elution data, new tools are needed to compare protein elution profiles, control false discovery rates, and construct an accurate interactome. Here we describe a freely available bioinformatics pipeline, PrInCE, for the analysis of co-elution data. PrInCE is a modular, open-source library that is computationally inexpensive, able to use label and label-free data, and capable of detecting tens of thousands of protein-protein interactions. Using a machine learning approach, PrInCE offers greatly reduced run time, more predicted interactions at the same stringency, prediction of protein complexes, and greater ease of use over previous bioinformatics tools for co-elution data. PrInCE is implemented in Matlab (version R2017a). Source code and standalone executable programs for Windows and Mac OSX are available at https://github.com/fosterlab/PrInCE , where usage instructions can be found. An example dataset and output are also provided for testing purposes. PrInCE is the first fast and easy

  11. Stepped MS(All) Relied Transition (SMART): An approach to rapidly determine optimal multiple reaction monitoring mass spectrometry parameters for small molecules.

    Science.gov (United States)

    Ye, Hui; Zhu, Lin; Wang, Lin; Liu, Huiying; Zhang, Jun; Wu, Mengqiu; Wang, Guangji; Hao, Haiping

    2016-02-11

    Multiple reaction monitoring (MRM) is a universal approach for quantitative analysis because of its high specificity and sensitivity. Nevertheless, optimization of MRM parameters remains as a time and labor-intensive task particularly in multiplexed quantitative analysis of small molecules in complex mixtures. In this study, we have developed an approach named Stepped MS(All) Relied Transition (SMART) to predict the optimal MRM parameters of small molecules. SMART requires firstly a rapid and high-throughput analysis of samples usin