Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.
Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng
2015-02-01
Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods.
Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris
2015-01-01
We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods
Directory of Open Access Journals (Sweden)
Nelly eDatukishvili
2015-07-01
Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo
2005-05-18
To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...
Zhang, D F; Zhang, Q Q; Li, A H
2014-11-01
Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR
Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex
2011-02-01
In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.
Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M
2015-07-07
Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.
Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran
2010-12-01
Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.
Benitez, Alvaro J; Winchell, Jonas M
2016-04-01
We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.
Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.
Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro
2014-01-01
A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.
Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota
Directory of Open Access Journals (Sweden)
Lingyang Tian
2014-01-01
Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.
Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib
2017-01-01
Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong
2011-01-01
Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.
Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne
2009-11-18
Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz
2017-01-01
Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Directory of Open Access Journals (Sweden)
Qing Fan
Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi
2011-01-01
In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.
A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.
Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer
2016-08-01
A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.
Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro
2015-01-01
Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Kim, S A; Park, S H; Lee, S I; Ricke, S C
2017-12-01
The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in
Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV
2008-01-01
Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lisha, V.
2017-01-01
Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Directory of Open Access Journals (Sweden)
Abdelfattah M. Selim
2014-12-01
Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.
Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro
2018-06-01
Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.
Multiplex real-time PCR for identification of canine parvovirus antigenic types.
Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti
2016-07-01
Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Parida Manmohan
2008-01-01
Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Multiplex PCR identification of Taenia spp. in rodents and carnivores.
Al-Sabi, Mohammad N S; Kapel, Christian M O
2011-11-01
The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.
Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan
2012-11-01
In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR
Luo, Guizhen; Mitchell, Thomas G.
2002-01-01
A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...
Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh
2018-04-23
Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.
Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer
Energy Technology Data Exchange (ETDEWEB)
Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.
2000-05-05
Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.
Directory of Open Access Journals (Sweden)
Elena Mettifogo
2015-01-01
Full Text Available Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS are the mycoplasma infections of most concern for commercial poultry industry. MG infection is commonly designated as chronic respiratory disease (CRD of chickens and infections sinusitis of turkeys. MS causes sub clinical upper respiratory infection and tenosynovitis or bursitis in chickens and turkeys. The multiplex PCR was standardized to detect simultaneously the MS, MG field strains and MG F-vaccine strain specific. The generic PCR for detection of any species of Mollicutes Class was performed and compared to the multiplex PCR and to PCR using species-specific primers. A total of 129 avian tracheal swabs were collected from broiler-breeders, layer hens and broilers in seven different farms and were examined by multiplex PCR methods. The system (multiplex PCR demonstrated to be very rapid, sensitive, and specific. Therefore, the results showed a high prevalence of MS in the flocks examined (27.9%, and indicate that the MS is a recurrent pathogen in Brazilian commercial poultry flocks.
DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR
Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira
2004-01-01
Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M
2018-04-01
Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.
Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W
2017-09-15
Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo
Directory of Open Access Journals (Sweden)
Peng Xia
2009-01-01
Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.
Comparison of multiplex reverse transcription-PCR-enzyme ...
African Journals Online (AJOL)
Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.
Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.
Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G
2016-05-01
The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.
Reich, J D; Alexander, T W; Chatterton, S
2016-05-01
Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2) = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the
Directory of Open Access Journals (Sweden)
Aris Haryanto
2010-12-01
Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.
Directory of Open Access Journals (Sweden)
Whyte Paul
2008-09-01
Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.
Jahan, F; Shamsuzzaman, S M; Akter, S
2014-12-01
Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.
Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao
2015-01-01
The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh
2015-05-01
Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.
Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis
Directory of Open Access Journals (Sweden)
V Hallur
2015-01-01
Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.
Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong
2017-10-01
Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.
Authentication of Meat Species in Sucuk by Multiplex PCR
Directory of Open Access Journals (Sweden)
Osman İrfan İLHAK
2015-01-01
Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.
Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra
2018-03-16
Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.
Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P
2016-01-01
Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.
Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N
2016-03-12
Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex
A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.
Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli
2015-07-07
Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.
Directory of Open Access Journals (Sweden)
Feroze Ahmed Ganaie
2015-01-01
Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.
DEFF Research Database (Denmark)
Iftner, Thomas; Germ, Liesje; Swoyer, Ryan
2009-01-01
methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...
Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples
Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris
2002-01-01
A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951
Hasanpour, Mojtaba; Najafi, Akram
2017-06-01
Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.
Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu
2017-08-01
Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Directory of Open Access Journals (Sweden)
Chung Hyun-Jae
2010-09-01
Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.
da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui
2016-05-01
To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Wei Hu
2015-01-01
Full Text Available Ancylostoma ceylanicum, A. caninum, and Giardia lamblia assemblage A are common intestinal parasites of dogs and cats; they can also infect humans, causing parasitic zoonoses. In this study, a multiplex PCR method was developed for simultaneous identification and detection of those three zoonotic parasites. Three pairs of specific primers were designed based on ITS sequence of A. ceylanicum and A. caninum and TPI gene of G. lamblia available in the GenBank. The multiplex PCR reaction system was established by optimizing the reaction condition, and a series of tests on the sensitivity, specificity, and clinical application were also conducted. Results showed that three target fragments were amplified specifically; the detection limit was 10 eggs for both A. ceylanicum and A. caninum, 72 pg DNA for G. lamblia. Of 112 clinical fecal samples, 34.8% and 17.8% samples were positive for A. caninum and A. ceylanicum, respectively, while only 2.7% samples were positive for G. lamblia assemblage A. It is concluded that the established multiplex PCR assay is a convenient, rapid, cost-effective, and high-efficiency method for molecular detection and epidemiological investigation of three zoonotic parasites.
Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi
Directory of Open Access Journals (Sweden)
Danielle C. Leal
2011-07-01
Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.
Directory of Open Access Journals (Sweden)
Rosemary S Turingan
Full Text Available Nucleic acid amplification tests (NAATs are recommended by the CDC for detection of Chlamydia trachomatis (Ct urogenital infections. Current commercial NAATs require technical expertise and sophisticated laboratory infrastructure, are time-consuming and expensive, and do not differentiate the lymphogranuloma venereum (LGV strains that require a longer duration of treatment than non-LGV strains. The multiplexed microfluidic PCR-based assay presented in this work simultaneously interrogates 13 loci to detect Ct and identify LGV and non-LGV strain-types. Based on amplified fragment length polymorphisms, the assay differentiates LGV, ocular, urogenital, and proctocolitis clades, and also serovars L1, L2, and L3 within the LGV group. The assay was evaluated in a blinded fashion using 95 clinical swabs, with 76 previously reported as urogenital Ct-positive samples and typed by ompA genotyping and/or Multi-Locus Sequence Typing. Results of the 13-plex assay showed that 51 samples fell within urogenital clade 2 or 4, 24 samples showed both clade 2 and 4 signatures, indicating possible mixed infection, gene rearrangement, or inter-clade recombination, and one sample was a noninvasive trachoma biovar (either a clade 3 or 4. The remaining 19 blinded samples were correctly identified as LGV clade 1 (3, ocular clade 3 (4, or as negatives (12. To date, no NAAT assay can provide a point-of-care applicable turnaround time for Ct detection while identifying clinically significant Ct strain types to inform appropriate treatment. Coupled with rapid DNA processing of clinical swabs (approximately 60 minutes from swab-in to result-out, the assay has significant potential as a rapid POC diagnostic for Ct infections.
Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.
Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D
1996-11-01
A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.
Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H
2010-09-01
The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to
Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin
2015-01-01
To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.
Directory of Open Access Journals (Sweden)
K. Kurta
2017-12-01
Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous
Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella
International Nuclear Information System (INIS)
Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar
2013-01-01
We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)
Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae
2017-09-01
The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.
Detection of four important Eimeria species by multiplex PCR in a single assay.
You, Myung-Jo
2014-06-01
The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis
Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.
2015-01-01
A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus
Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
Mahnaz Mahmoudi Rad
2012-01-01
Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.
Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai
2012-06-10
Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A
2015-06-01
The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David
2017-08-17
Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.
Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong
2018-02-28
A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.
Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C
2017-06-01
For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4 CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.
Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S
2013-10-01
A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.
Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay
2015-01-01
An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.
Directory of Open Access Journals (Sweden)
Kor-jent van Dijk
2014-11-01
Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.
Phan, T G; Nguyen, T A; Yan, H; Okitsu, S; Ushijima, H
2005-06-01
A novel reverse transcription-multiplex polymerase chain reaction (RT-multiplex PCR) assay that can detect enteroviruses, hepatitis A and E viruses and influenza A virus from various hosts (avian species, human, swine and horse) was developed. The identification of that group of viruses was performed with the mixture of four pairs of published specific primers (F1 and R1, P3 and P4, 2s and 2as, MMU42 and MMU43) for amplifying viral genomes and specifically generated four different amplicon sizes of 440, 267, 146 and 219 bp for enteroviruses, hepatitis A and E viruses and influenza A virus, respectively. A total of 276 fecal specimens (previously screened for rotavirus, adenovirus, norovirus, sapovirus and astrovirus-negative) from infants and children admitted into hospital with acute gastroenteritis in Ho Chi Minh city, Vietnam during October 2002 and September 2003 were collected and further tested for the presence of those viruses by RT-multiplex PCR. Enteroviruses were identified in 27 specimens and this represented 9.8%. No hepatitis A and E viruses and influenza A virus was found among these subjects. The sensitivity and specificity of RT-multiplex PCR were also assessed and demonstrated the strong validation against RT-monoplex PCR. Taken together, the findings clearly indicated that this novel RT-multiplex PCR is a simple and potential assay for rapid, sensitive, specific and cost-effective laboratory diagnosis to investigate molecular epidemiology of acute gastroenteritis caused by enteroviruses, hepatitis A and E viruses and influenza A virus. This report is the first, to our knowledge, detecting these kinds of viruses in diarrheal feces from infants and children in Vietnam.
Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang
2003-09-01
A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.
Practical implementation of a multiplex PCR for acute respiratory tract infections in children
Gruteke, Paul; Glas, Afina S.; Dierdorp, Mirjam; Vreede, Willem B.; Pilon, Jan-Willem; Bruisten, Sylvia M.
2004-01-01
Molecular testing for acute respiratory infections (ARIs) has documented value but limited implementation due to questions that typically slow the acceptance of new tests. This study sought to address these questions and achieve implementation. Rhinovirus was added to a nested multiplex PCR (M-PCR),
Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M
2016-05-01
For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.
Gangwar, Maulshree
2012-09-23
A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.
Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia
2012-01-01
A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.
Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G
2008-05-01
Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.
Directory of Open Access Journals (Sweden)
Zahra Gharibi
2017-10-01
Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.
Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR
Directory of Open Access Journals (Sweden)
Kelly Grace Magalhães
2004-06-01
Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.
Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli
2014-05-30
Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.
Directory of Open Access Journals (Sweden)
Kerstin Wernike
Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.
Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method
Directory of Open Access Journals (Sweden)
Javad Mohammadi
2017-06-01
Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary
Qu, X S; Wanner, L A; Christ, B J
2011-03-01
To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene
2009-07-01
The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated
Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora
2018-02-01
Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Tian Ding
2017-05-01
Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.
Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho
2018-01-01
Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.
A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.
Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V
2014-01-01
Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.
Development of a multiplex PCR assay detecting 52 autosomal SNPs
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus
2006-01-01
for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...
Directory of Open Access Journals (Sweden)
Rodolakis Annie
2009-07-01
Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and
Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee
2017-08-15
The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hirohito Ogawa
Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.
Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej
2017-12-01
Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.
Directory of Open Access Journals (Sweden)
Parija Subhash C
2007-05-01
Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.
Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.
2007-01-01
Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT
Screening for circulating RAS/RAF mutations by multiplex digital PCR
DEFF Research Database (Denmark)
Andersen, Rikke Fredslund; Jakobsen, Anders
2016-01-01
by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...
Directory of Open Access Journals (Sweden)
Ki Young Yoo
2010-03-01
Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
Giri, Sidhartha; Rajan, Anand K; Kumar, Nirmal; Dhanapal, Pavithra; Venkatesan, Jayalakshmi; Iturriza-Gomara, Miren; Taniuchi, Mami; John, Jacob; Abraham, Asha Mary; Kang, Gagandeep
2017-08-01
Although, culture is considered the gold standard for poliovirus detection from stool samples, real-time PCR has emerged as a faster and more sensitive alternative. Detection of poliovirus from the stool of recently vaccinated children by culture, single and multiplex real-time PCR was compared. Of the 80 samples tested, 55 (68.75%) were positive by culture compared to 61 (76.25%) and 60 (75%) samples by the single and one step multiplex real-time PCR assays respectively. Real-time PCR (singleplex and multiplex) is more sensitive than culture for poliovirus detection in stool, although the difference was not statistically significant. © 2017 Wiley Periodicals, Inc.
Clostridium perfringens isolate typing by multiplex PCR
Directory of Open Access Journals (Sweden)
MR Ahsani
2010-01-01
Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.
Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana
2016-10-01
The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
Benitez, Alvaro J.; Winchell, Jonas M.
2014-01-01
We developed a single-tube multiplex real-time PCR assay capable of simultaneously detecting and discriminating Legionella spp., Legionella pneumophila, and Legionella pneumophila serogroup 1 in primary specimens. Evaluation of 21 clinical specimens and 115 clinical isolates demonstrated this assay to be a rapid, high-throughput diagnostic test with 100% specificity that may aid during legionellosis outbreaks and epidemiologic investigations.
Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong
2015-01-01
Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification
Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M
2008-10-01
The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.
Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro
2014-07-21
Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.
Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
M Heiat
2010-07-01
Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.
Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can
2009-06-08
A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.
Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes
TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...
Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu
2018-02-01
For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The
Directory of Open Access Journals (Sweden)
Henrich Birgit
2008-04-01
Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.
Schaeffer, Anke; Henrich, Birgit
2008-01-01
Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917
Energy Technology Data Exchange (ETDEWEB)
Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T
2007-04-11
We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.
Directory of Open Access Journals (Sweden)
Jiyun Li
2017-10-01
Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.
Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia
2017-08-14
The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan
2013-05-01
This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.
Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli
Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki
2003-01-01
A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.
Directory of Open Access Journals (Sweden)
Dehghan fatemeh
2014-05-01
Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.
Jiao, Wei; Xie, Li; Li, Hailan; Lan, Jiao; Mo, Zhuning; Yang, Ziji; Liu, Fei; Xiao, Ruiping; He, Yunlei; Ye, Luyi; Zhu, Ziyan
2014-04-01
To screen rare blood groups Fy(a-), s-, k-, Di(b-) and Js(b-) in an ethnic Zhuang population. Sequence-specific primers were designed based on single nucleotide polymorphism (SNP) sites of blood group antigens Fy(b) and s. A specific multiplex PCR system I was established. Multiplex PCR system II was applied to detect alleles antigens Di(b), k, Js(b)1910 and Js(b) 2019 at the same time. The two systems was were used to screen for rare blood group antigens in 4490 randomly selected healthy donors of Guangxi Zhuang ethnic origin. We successfully made the multiplex PCR system I. We detected the rare blood group antigens using the two PCR system. There are five Fy(a-), three s(-), two Di(b-) in 4490 Guangxi zhuang random samples. The multiplex PCR system I has achieved good accuracy and stability. With multiplex PCR systems I and II, 4490 samples were screened. Five Fy(a-), three s(-) and two Di(b-) samples were discovered. Multiplex PCR is an effective methods, which can be used for high throughput screening of rare blood groups. The rare blood types of Guangxi Zhuang ethnic origin obtained through the screening can provide valuable information for compatible blood transfusion. Through screening we obtained precious rare blood type materials which can be used to improve the capability of compatible infusion and reduce the transfusion reactions.
Multiplex PCR for the detection and identification of dairy bacteriophages in milk.
del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A
2007-02-01
Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.
ddPCRclust - An R package and Shiny app for automated analysis of multiplexed ddPCR data.
Brink, Benedikt G; Meskas, Justin; Brinkman, Ryan R
2018-03-09
Droplet digital PCR (ddPCR) is an emerging technology for quantifying DNA. By partitioning the target DNA into ∼20000 droplets, each serving as its own PCR reaction compartment, a very high sensitivity of DNA quantification can be achieved. However, manual analysis of the data is time consuming and algorithms for automated analysis of non-orthogonal, multiplexed ddPCR data are unavailable, presenting a major bottleneck for the advancement of ddPCR transitioning from low-throughput to high- throughput. ddPCRclust is an R package for automated analysis of data from Bio-Rad's droplet digital PCR systems (QX100 and QX200). It can automatically analyse and visualise multiplexed ddPCR experiments with up to four targets per reaction. Results are on par with manual analysis, but only take minutes to compute instead of hours. The accompanying Shiny app ddPCRvis provides easy access to the functionalities of ddPCRclust through a web-browser based GUI. R package: https://github.com/bgbrink/ddPCRclust; Interface: https://github.com/bgbrink/ddPCRvis/; Web: https://bibiserv.cebitec.uni-bielefeld.de/ddPCRvis/. bbrink@cebitec.uni-bielefeld.de.
Directory of Open Access Journals (Sweden)
Bester Rachelle
2012-09-01
Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM
Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella
2005-01-01
The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650
Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...
Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz; Gray, Darren J.; Verweij, Jaco J.; Clements, Archie C. A.; Gomes, Santina J.; Traub, Rebecca; McCarthy, James S.
2016-01-01
Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation for identification and quantification of STH eggs, and zinc sulphate centrifugal flotation for detection of protozoan parasites. Higher parasite prevalence was detected by multiplex PCR (hookworms 2.9 times higher, Ascaris 1.2, Giardia 1.6, along with superior polyparasitism detection with this effect magnified as the number of parasites present increased (one: 40.2% vs. 38.1%, two: 30.9% vs. 12.9%, three: 7.6% vs. 0.4%, four: 0.4% vs. 0%). Although, all STH positive samples were low intensity infections by microscopy as defined by WHO guidelines the DNA-load detected by multiplex PCR suggested higher intensity infections. Conclusions/Significance Multiplex PCR, in addition to superior sensitivity, enabled more accurate determination of infection intensity for Ascaris, hookworms and
Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease
Energy Technology Data Exchange (ETDEWEB)
Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M
2007-06-26
A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.
LENUS (Irish Health Repository)
O'Callaghan, Isabelle
2010-05-01
To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.
Czech Academy of Sciences Publication Activity Database
Wicht, B.; Yanagida, T.; Scholz, Tomáš; Ito, A.; Jiménez, J. A.; Brabec, Jan
2010-01-01
Roč. 48, č. 9 (2010), s. 3111-3116 ISSN 0095-1137 R&D Projects: GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : MOLECULAR EVIDENCE * PACIFIC SALMON * NIHONKAIENSE * Diphyllobothrium * multiplex PCR * the cytochrome c oxidase subunit 1 * mitochondrial DNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 4.220, year: 2010
A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection
Directory of Open Access Journals (Sweden)
Van Neste Leander
2012-06-01
Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.
Ikten, Cengiz; Ustun, Rustem; Catal, Mursel; Yol, Engin; Uzun, Bulent
2016-01-01
Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.). Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.
E. Ghaznavi Rad (Ehsanollah); N.S. Mariana (Nor Shamsudin); Z. Sekawi (Zamberi); A.F. van Belkum (Alex); V. Neela (Vasanthakumari)
2010-01-01
textabstractA multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus
Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.
2012-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that
Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.
2012-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that
Directory of Open Access Journals (Sweden)
Nicole Roschanski
Full Text Available Beta-lactamase resistant bacteria and especially ESBL producing Enterobacteriaceae are an increasing problem worldwide. For this reason a major interest in efficient and reliable methods for rapid screening of high sample numbers is recognizable. Therefore, a multiplex real-time PCR was developed to detect the predominant class A beta-lactamase genes blaCTX-M, blaSHV, blaTEM and CIT-type AmpCs in a one-step reaction. A set of 114 Enterobacteriaceae containing previously identified resistance gene subtypes and in addition 20 undefined animal and environmental isolates were used for the validation of this assay. To confirm the accessibility in variable settings, the real-time runs were performed analogous in two different laboratories using different real-time cyclers. The obtained results showed complete accordance between the real-time data and the predetermined genotypes. Even if sequence analyses are further necessary for a comprehensive characterization, this method was proofed to be reliable for rapid screening of high sample numbers and therefore could be an important tool for e. g. epidemiological purposes or support infection control measures.
Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich
2010-12-01
This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.
Detection of Shiga toxins genes by Multiplex PCR in clinical samples
Directory of Open Access Journals (Sweden)
2013-09-01
Full Text Available Background: Different methods have been used for detection of shiga toxins; such as, cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR. For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results: Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences. The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.
Directory of Open Access Journals (Sweden)
Takao Ito
Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.
Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J.; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.
2011-01-01
Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...
Directory of Open Access Journals (Sweden)
Kelly J. Henrickson
2009-10-01
surrogate sensitivities of these two assays were 100% (95%CI 83-100 for FT, BA (pX02, YP, VM, VZV, dengue 2,3,4 and 95% (95%CI 75-100 for BA (pX01 and dengue 1 using spiked clinical specimens. The specificity of both BioT multiplex assays on spiked specimens was 100% (95% CI 99-100. Compared to other available assays (culture, serology, PCR, etc. both the BioT DNA mPCR-EHA and BioT RNA mRT-PCR-EHA are rapid, sensitive and specific assays for detecting many category “A” Bioterrorism agents using a standard thermocycler.
Wong, Anita A; Pabbaraju, Kanti; Wong, Sallene; Tellier, Raymond
2016-03-01
Herpes simplex viruses (HSV) and varicella zoster virus (VZV) can have very similar and wide-ranging clinical presentations. Rapid identification is necessary for timely antiviral therapy, especially with infections involving the central nervous system, neonates, and immunocompromised individuals. Detection of HSV-1, HSV-2 and VZV was combined into one real-time PCR reaction utilizing hydrolysis probes. The assay was validated on the LightCycler(®) (Roche) and Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific Inc.) to detect alphaherpesviruses in cerebral spinal fluid (CSF) and lesion swab specimens, respectively. Validation data on blood and tissue samples are also presented. The multiplex assay showed excellent sensitivity, specificity and reproducibility when compared to two singleplex real-time PCR assays for CSF samples and direct fluorescent antigen/culture for lesion swab samples. Implementation of the multiplex assay has facilitated improved sensitivity and accuracy as well as reduced turn-around-times and costs. The results from a large data set of 16,622 prospective samples tested between August 16, 2012 to February 1, 2014 at the Provincial Laboratory for Public Health (Alberta, Canada) are presented here. Copyright © 2015 Elsevier B.V. All rights reserved.
Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E
2014-06-01
The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
Directory of Open Access Journals (Sweden)
Fatemeh Dehghan
2014-11-01
Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.
Directory of Open Access Journals (Sweden)
Cengiz Ikten
Full Text Available Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.. Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.
Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.
Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin
2017-05-01
Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.
Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N
2017-06-01
This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in
Ciofi, Claudio; Tzika, Athanasia C; Natali, Chiara; Watts, Phillip C; Sulandari, Sri; Zein, Moch S A; Milinkovitch, Michel C
2011-05-01
Multiplex PCR assays for the coamplification of microsatellite loci allow rapid and cost-effective genetic analyses and the production of efficient screening protocols for international breeding programs. We constructed a partial genomic library enriched for di-nucleotide repeats and characterized 14 new microsatellite loci for the Komodo monitor (or Komodo dragon, Varanus komodoensis). Using these novel microsatellites and four previously described loci, we developed multiplex PCR assays that may be loaded on a genetic analyser in three separate panels. We tested the novel set of microsatellites for polymorphism using 69 individuals from three island populations and evaluated the resolving power of the entire panel of 18 loci by conducting (i) a preliminary assignment test to determine population(s) of origin and (ii) a parentage analysis for 43 captive Komodo monitors. This panel of polymorphic loci proved useful for both purposes and thus can be exploited for fine-scale population genetic analyses and as part of international captive breeding programs directed at maintaining genetically viable ex situ populations and reintroductions. © 2011 Blackwell Publishing Ltd.
Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola
2016-03-01
HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.
Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon
2017-01-01
A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.
DEFF Research Database (Denmark)
Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni
2017-01-01
and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. Methods: A real-time multiplex PCR method with internal inhibition control...... microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Conclusions: Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof...
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
DEFF Research Database (Denmark)
Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren
2005-01-01
Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....
Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method
Directory of Open Access Journals (Sweden)
Eva Renčová
2014-01-01
Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.
International Nuclear Information System (INIS)
Settypalli, T.B.K.; Lamien, C.; Spergser, J.; Lelenta, M.; Wade, A.; Gelaye, E.; Loitsch, A.; Minoungou, G.; Thiaucourt, F.; Diallo, A.
2016-01-01
17 samples, PPRV in 45, and PM in six samples. In addition, three samples showed a co-infection of PPRV and PM. Overall, the one-step multiplex RT-qPCR assay developed will be a valuable tool for rapid detection of individual and co-infections of the targeted pathogens with high specificity and sensitivity. (author)
Directory of Open Access Journals (Sweden)
Tirumala Bharani Kumar Settypalli
17 samples, PPRV in 45, and PM in six samples. In addition, three samples showed a co-infection of PPRV and PM. Overall, the one-step multiplex RT-qPCR assay developed will be a valuable tool for rapid detection of individual and co-infections of the targeted pathogens with high specificity and sensitivity.
Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J
2014-06-01
Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.
Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael
2009-01-01
A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.
Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...
National Research Council Canada - National Science Library
McDonough, E. A; Barrozo, C. P; Russell, K. L; Metzgar, D
2005-01-01
A multiplex PCR was developed that is capable of detecting four of the most important bacterial agents of atypical pneumophia, Mycaplasma pneumoniae, Chlamydophia pneumoniae, Legionella pneumophila...
Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.
2016-01-01
Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8
Directory of Open Access Journals (Sweden)
Tanja Pasanen
Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.
Directory of Open Access Journals (Sweden)
Ke Feng
Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.
Li, Baoguang; Liu, Huanli; Wang, Weimin
2017-11-09
enterica, Shigella strains, or any other pathogenic strains tested. A multiplex real-time PCR assay that can rapidly and simultaneously detect E. coli O157:H7 and screen for non-O157 STEC strains has been developed and assessed for efficacy. The inclusivity and exclusivity tests demonstrated high sensitivity and specificity of the multiplex real-time PCR assay. In addition, this multiplex assay was shown to be effective for the detection of E. coli O157:H7 from two common food matrices, beef and spinach, and may be applied for detection of E. coli O157:H7 and screening for non-O157 STEC strains from other food matrices as well.
Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.
2014-01-01
The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using
Directory of Open Access Journals (Sweden)
Valeria Velasco
Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA
van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L
2018-04-26
Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.
Directory of Open Access Journals (Sweden)
Fabrícia Gimenes
Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.
Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya
2017-10-10
Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.
Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests
Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.
1999-01-01
Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815
DEFF Research Database (Denmark)
Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S
2007-01-01
A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA...
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Directory of Open Access Journals (Sweden)
Heath Sekou
2007-02-01
Full Text Available Abstract Background The human bacterial pathogen Campylobacter jejuni contains two subspecies: C. jejuni subsp. jejuni (Cjj and C. jejuni subsp. doylei (Cjd. Although Cjd strains are isolated infrequently in many parts of the world, they are obtained primarily from human clinical samples and result in an unusual clinical symptomatology in that, in addition to gastroenteritis, they are associated often with bacteremia. In this study, we describe a novel multiplex PCR method, based on the nitrate reductase (nap locus, that can be used to unambiguously subspeciate C. jejuni isolates. Results Internal and flanking napA and napB primer sets were designed, based on existing C. jejuni and Campylobacter coli genome sequences to create two multiplex PCR primer sets, nap mpx1 and nap mpx2. Genomic DNA from 161 C. jejuni subsp. jejuni (Cjj and 27 C. jejuni subsp. doylei (Cjd strains were amplified with these multiplex primer sets. The Cjd strains could be distinguished clearly from the Cjj strains using either nap mpx1 or mpx2. In addition, combination of either nap multiplex method with an existing lpxA speciation multiplex method resulted in the unambiguous and simultaneous speciation and subspeciation of the thermophilic Campylobacters. The Cjd nap amplicons were also sequenced: all Cjd strains tested contained identical 2761 bp deletions in napA and several Cjd strains contained deletions in napB. Conclusion The nap multiplex PCR primer sets are robust and give a 100% discrimination of C. jejuni subspecies. The ability to rapidly subspeciate C. jejuni as well as speciate thermophilic Campylobacter species, most of which are pathogenic in humans, in a single amplification will be of value to clinical laboratories in strain identification and the determination of the environmental source of campylobacterioses caused by Cjd. Finally, the sequences of the Cjd napA and napB loci suggest that Cjd strains arose from a common ancestor, providing clues as to
Validation of the multiplex PCR for identification of Brucella spp.
Directory of Open Access Journals (Sweden)
Lívia de Lima Orzil
2016-05-01
Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.
DEFF Research Database (Denmark)
Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik
2005-01-01
and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...
International Nuclear Information System (INIS)
Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM
2012-01-01
Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions
Ghaznavi-Rad, Ehsanollah; Nor Shamsudin, Mariana; Sekawi, Zamberi; van Belkum, Alex; Neela, Vasanthakumari
2010-10-01
A multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus identification and detection of meticillin resistance. All 389 clinical MRSA isolates from Malaysia and 18 European isolates from the Harmony collection harbouring different SCCmec types that we tested were correctly characterized by our PCR assay. SCCmec type III and V were by far the most common types among both hospital- and community-acquired Malaysian MRSA isolates, with an apparent emergence of MRSA harbouring the IVh type.
Nielsen, Alex Christian Yde; Böttiger, Blenda; Midgley, Sofie Elisabeth; Nielsen, Lars Peter
2013-11-01
As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay. The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses in 171 (8%) and 66 (3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause similar clinical symptoms. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ravi Prakash
2014-12-01
Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.
Group-specific multiplex PCR detection systems for the identification of flying insect prey.
Directory of Open Access Journals (Sweden)
Daniela Sint
Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.
Energy Technology Data Exchange (ETDEWEB)
Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P
2007-07-26
A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.
Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M
2007-11-01
The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.
Davidson, Irit; Raibshtein, I; Al-Touri, A
2013-06-01
The worldwide distribution of chicken anemia virus (CAV) and Marek's disease virus (MDV) is well documented. In addition to their economic significance in single- or dual-virus infections, the two viruses can often accompany various other pathogens and affect poultry health either directly, by causing tumors, anemia, and delayed growth, or indirectly, by aggravating other diseases, as a result of their immunosuppressive effects. After a decade of employing the molecular diagnosis of those viruses, which replaced conventional virus isolation, we present the development of a real-time multiplex PCR for the simultaneous detection of both viruses. The real-time PCRs for MDV and for CAV alone are more sensitive than the respective end-point PCRs. In addition, the multiplex real-time shows a similar sensitivity when compared to the single real-time PCR for each virus. The newly developed real-time multiplex PCR is of importance in terms of the diagnosis and detection of low copies of each virus, MDV and CAV in single- and in multiple-virus infections, and its applicability will be further evaluated.
A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR
Energy Technology Data Exchange (ETDEWEB)
Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others
1996-07-01
Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.
Shariff, S; Ibrahim, N J; Md-Zain, B M; Idris, A B; Suhana, Y; Roff, M N; Yaakop, S
2014-01-23
Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. This is an
In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...
Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N
2016-05-01
To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.
Compston, Lara Isobel; Sarkobie, Francis; Li, Chengyao; Candotti, Daniel; Opare-Sem, Ohene; Allain, Jean-Pierre
2008-07-01
In common with latent viruses such as herpesviruses, parvovirus B19, HBV and GBV-C are contained successfully by the immune response and persist in the host. When immune control breaks down, reactivation of both latent and persistent viruses occurs. Two multiplex assays were developed (B19, HBV, HHV-8), (EBV, CMV, VZV) for blood screening, and tested on blood donor samples from Ghana to determine baseline prevalence of viraemia in immunocompetent persons. Single-virus real-time quantitative PCR (qPCR) assays were optimised for viral load determination of positive initial screening. The qPCR method utilised was absolute quantification with external standards. Multiplex and single-virus qPCR assays had similar sensitivity, except for the B19 assay in which sensitivity was 100-fold lower. Assays were optimised for reproducibility and repeatability, with R(2) of 0.9 being obtained for most assays. With the exception of B19 and CMV, assays had 100% detection limit ranging between 10(1) and 10(2) copies, IU or arbitrary units under single-virus and multiplex assay conditions. The prevalence of viraemia was 1.6% HBV (0.8% DNA+/HBsAg-, 0.8% DNA+/HBsAg+), 0.8% parvovirus B19, and 3.3% GBV-C viraemia in the plasma fraction. The prevalence of four herpesviruses was 1.0% HHV-8, 0.85% CMV, and 8.3% EBV, and no detectable VZV viraemia.
Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N
2008-01-01
Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory
The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR
Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.
2015-01-01
Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708
The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.
Directory of Open Access Journals (Sweden)
Michael S Bartsch
Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Directory of Open Access Journals (Sweden)
Alex Galanis
2015-10-01
Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Directory of Open Access Journals (Sweden)
Enjalbert Jérôme
2011-07-01
Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.
Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T
2011-01-01
The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.
Hamoy, I G; Santos, E J M; Santos, S E B
2008-01-22
The aim of the present study was the development of a multiplex genotyping panel of eight microsatellite markers of Arapaima gigas, previously described. Specific primer pairs were developed, each one of them marked with either FAM-6, HEX or NED. The amplification conditions using the new primers were standardized for a single reaction. The results obtained demonstrate high heterozygosity (average of 0.69) in a Lower Amazon population. The multiplex system described can thus be considered a fast, efficient and inexpensive method for the investigation of genetic variability in Arapaima populations.
Directory of Open Access Journals (Sweden)
Ngo Tat Trung
2018-02-01
Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.
Template preparation for rapid PCR in Colletotrichum lindemuthianum
Directory of Open Access Journals (Sweden)
Roca M. Gabriela
2003-01-01
Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.
Rocchetti, Talita T; Silbert, Suzane; Gostnell, Alicia; Kubasek, Carly; Campos Pignatari, Antonio C; Widen, Raymond
2017-03-01
A new multiplex PCR test was designed to detect Mycobacterium chelonae, Mycobacterium abscessus group, and Mycobacterium fortuitum complex on the BD MAX System. A total of 197 clinical samples previously submitted for mycobacterial culture were tested using the new protocol. Samples were first treated with proteinase K, and then each sample was inoculated into the BD MAX Sample Buffer Tube. Extraction and multiplex PCR were performed by the BD MAX System, using the BD MAX ExK TNA-3 extraction kit and BD TNA Master Mix, along with specific in-house designed primers and probes for each target. The limit of detection of each target, as well as specificity, was evaluated. Of 197 clinical samples included in this study, 133 were positive and 60 were negative for mycobacteria by culture, and another 4 negative samples were spiked with M. chelonae ATCC 35752. The new multiplex PCR on the BD MAX had 97% concordant results with culture for M. abscessus group detection, 99% for M. chelonae, and 100% for M. fortuitum complex. The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect M. chelonae, M. abscessus group, and M. fortuitum complex by real-time PCR on an automated sample-in results-out platform. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Ambroise, Jérôme; Butoescu, Valentina; Robert, Annie; Tombal, Bertrand; Gala, Jean-Luc
2015-06-25
Single Nucleotide Polymorphisms (SNPs) identified in Genome Wide Association Studies (GWAS) have generally moderate association with related complex diseases. Accordingly, Multilocus Genetic Risk Scores (MGRSs) have been computed in previous studies in order to assess the cumulative association of multiple SNPs. When several SNPs have to be genotyped for each patient, using successive uniplex pyrosequencing reactions increases analytical reagent expenses and Turnaround Time (TAT). While a set of several pyrosequencing primers could theoretically be used to analyze multiplex amplicons, this would generate overlapping primer-specific pyro-signals that are visually uninterpretable. In the current study, two multiplex assays were developed consisting of a quadruplex (n=4) and a quintuplex (n=5) polymerase chain reaction (PCR) each followed by multiplex pyrosequencing analysis. The aim was to reliably but rapidly genotype a set of prostate cancer-related SNPs (n=9). The nucleotide dispensation order was selected using SENATOR software. Multiplex pyro-signals were analyzed using the new AdvISER-MH-PYRO software based on a sparse representation of the signal. Using uniplex assays as gold standard, the concordance between multiplex and uniplex assays was assessed on DNA extracted from patient blood samples (n = 10). All genotypes (n=90) generated with the quadruplex and the quintuplex pyroquencing assays were perfectly (100 %) concordant with uniplex pyrosequencing. Using multiplex genotyping approach for analyzing a set of 90 patients allowed reducing TAT by approximately 75 % (i.e., from 2025 to 470 min) while reducing reagent consumption and cost by approximately 70 % (i.e., from ~229 US$ /patient to ~64 US$ /patient). This combination of quadruplex and quintuplex pyrosequencing and PCR assays enabled to reduce the amount of DNA required for multi-SNP analysis, and to lower the global TAT and costs of SNP genotyping while providing results as reliable as uniplex
Bottari, Benedetta; Agrimonti, Caterina; Gatti, Monica; Neviani, Erasmo; Marmiroli, Nelson
2013-01-01
A multiplex real time PCR (mRealT-PCR) useful to rapidly screen microbial composition of thermophilic starter cultures for hard cooked cheeses and to compare samples with potentially different technological properties was developed. Novel primers directed toward pheS gene were designed and optimized for multiple detection of Lactobacillus helveticus, Lactobacillus delbrueckii, Streptococcus thermophilus and Lactobacillus fermentum. The assay was based on SYBR Green chemistry followed by melting curves analysis. The method was then evaluated for applications in the specific detection of the 4 lactic acid bacteria (LAB) in 29 different natural whey starters for Parmigiano Reggiano cheese production. The results obtained by mRealT-PCR were also compared with those obtained on the same samples by Fluorescence in Situ Hybridization (FISH) and Length-Heterogeneity PCR (LH-PCR). The mRealT-PCR developed in this study, was found to be effective for analyzing species present in the samples with an average sensitivity down to less than 600 copies of DNA and therefore sensitive enough to detect even minor LAB community members of thermophilic starter cultures. The assay was able to describe the microbial population of all the different natural whey starter samples analyzed, despite their natural variability. A higher number of whey starter samples with S. thermophilus and L. fermentum present in their microbial community were revealed, suggesting that these species could be more frequent in Parmigiano Reggiano natural whey starter samples than previously shown. The method was more effective than LH-PCR and FISH and, considering that these two techniques have to be used in combination to detect the less abundant species, the mRealT-PCR was also faster. Providing a single step sensitive detection of L. helveticus, L. delbrueckii, S. thermophilus and L. fermentum, the developed mRealT-PCR could be used for screening thermophilic starter cultures and to follow the presence of
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
Directory of Open Access Journals (Sweden)
Nayereh Nouri
2014-01-01
Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.
Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon
2015-03-01
A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara
2007-01-01
, multiplex PCR with minisequencing (MPMS), on 92 DNA extractions performed on six archival FFPE samples of variable DNA quality, which date between 9 and 25 years old. On the three extracts with highest quality, we found the assay efficiency to be near 100%. However, the efficiency of the lowest quality...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...
[Application of rapid PCR to authenticate medicinal snakes].
Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man
2014-10-01
To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.
DEFF Research Database (Denmark)
Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.
2013-01-01
As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay....... The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel...... testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...
Use of Multiplex PCR for Diagnosis of Bacterial Infection Respiratory Mixed
Directory of Open Access Journals (Sweden)
Al-ssum, R. M.
2010-01-01
Full Text Available Atypical bacteria grow very slowly in culture or they do not grow at all leading to delays in detection and diagnosis. PCR multiplex was performed on template DNAs extracted from seventy three collected specimens. Thirty seven showed positive indication for the presence of bacterial infection. The incidence of Mycoplasma pneumoniae, Chlamydia pneumonia and Legionella pneumophila as a single infecting agent was 31.5%, 27.5% and 20 % respectively. Dual agent infection caused by Mycoplasma + Chlamydia, Mycoplasma + Legionella and Legionella + Chlamydia was 24%, 20% and 15% respectively. Triple agent infection caused by Legionella + Mycoplasma + Chlamydia was 17.5%. The etiology of the infection was M. pneumoniae, L. pneumophila or C. pneumoniae as a single etiology or in combination of two or three organisms.
Directory of Open Access Journals (Sweden)
Tatiana Rochat
2017-09-01
Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.
Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.
2016-01-01
Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...
Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Trisadee Khamlor
2014-10-01
Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.
Directory of Open Access Journals (Sweden)
Xingmei Xie
Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.
Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong
2017-02-01
There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.
DEFF Research Database (Denmark)
Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S
2007-01-01
A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA......). SCCmec type IV was by far the most common SCCmec type among both hospital- and community-acquired MRSA isolates in Denmark....
Directory of Open Access Journals (Sweden)
Rahimi M.T.
2016-09-01
Full Text Available The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %. Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.
Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.
2006-01-01
Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...
Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.
Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia
2012-01-27
Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Directory of Open Access Journals (Sweden)
Chang Chieh-Ting
2008-06-01
Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.
Directory of Open Access Journals (Sweden)
K. Rathore
2018-04-01
Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.
Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith
2017-01-01
Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.
Ranjan, R K; Singh, Dinesh; Baranwal, V K
2016-11-01
Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.
Directory of Open Access Journals (Sweden)
Zhiyuan Wu
2014-01-01
Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook
2014-07-01
A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.
Detection of Salmonella enterica Serovar Typhimurium from Avians Using Multiplex-PCR
Directory of Open Access Journals (Sweden)
Alireza Talebi
2011-09-01
Full Text Available Abstract Salmonella enterica serovar Typhimurium and S.enterica serovar Enteritidis are the most frequently isolated serovars from food-borne diseases throughout the world. According to their antigenic profiles, salmonella shows different disease syndromes and host specificities. It is necessary and important to discriminate salmonella serovars from each other in order to ensure that each pathogen and its epidemiology are correctly recognized. Many PCR-based methods have been developed to identify salmonella serovars. The objective of present study was to identify S. Typhimurium in avians from different regions including: North, Northwest and capital city (Tehran of Iran. Also in this research, the quality of CHROMagar™ Salmonella medium (CAS medium in veterinary medicine was evaluated. The results of present study showed that out of 1870 intestine samples, fifty two S. Typhimurium including broiler (n=13, layer (n=12, duck (n=5, goose (n=5, sparrow (n=8, canary (n=3, pigeon (n=5 and African grey parrot (n=1 were identified using serotyping as well as multiplex-PCR. In conclusion, important measures must be taken on prevention and propagation of S. Typhimurium among avians. CHROMagar™ Salmonella medium has high levels of sensitivity and specificity and reduced the time to final identification of salmonella spp. in comparison with biochemical tests.
DEFF Research Database (Denmark)
Adriko, John; Aritua, V.; Mortensen, Carmen Nieves
2012-01-01
The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...
Jean, Julie; D'Souza, Doris H.; Jaykus, Lee-Ann
2004-01-01
Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10−1 reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 100 to 102 reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods. PMID:15528524
Jean, Julie; D'Souza, Doris H; Jaykus, Lee-Ann
2004-11-01
Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10(-1) reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 10(0) to 10(2) reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods.
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara
2010-01-01
Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857
A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.
1999-01-01
The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...
The Prevalence of Human Papilloma Virus(HPV in Malignant Cervical Lesion, Using Multiplex PCR
Directory of Open Access Journals (Sweden)
M. R. Keyhkhaee
2006-07-01
Full Text Available Background: Cervical cancer is the second leading cause of cancer death among women. In this cancer, the effects of prevention, early diagnosis and treatment more than other cancers decrease the mortality rate. In 1970 human papilloma virus (HPV was introduction as major etiologic factor of cervical cancer. Different studies throughout the world revealed strong correlation between HPV and cancerous & precancerous changes in epithelial cells. Since cell culture and serological methods can not recognize the virus and its subtypes, the importance of the molecular methods including polymerase chain reaction (PCR in early and definite diagnosis of virus is obvious. Methods: In this study, after patient selection using the related protocol and completion of the questionnaires, 100 samples from cancer lesions of cervix selected. Then DNA extraction from paraffin blocks performed using standard method. Multiplex PCR with two pairs of primer (one as internal control performed and the PCR product run on 8% polyacrylamid gel. Results: The results showed that 73% of the tissues were infected by HPV. Conclusion: This finding confirm the previous results based of correlation between HPV,and cervical cancer.
Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.
Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng
2017-10-11
To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.
Rapid, Time-Division Multiplexed, Direct Absorption- and Wavelength Modulation-Spectroscopy
Directory of Open Access Journals (Sweden)
Alexander Klein
2014-11-01
Full Text Available We present a tunable diode laser spectrometer with a novel, rapid time multiplexed direct absorption- and wavelength modulation-spectroscopy operation mode. The new technique allows enhancing the precision and dynamic range of a tunable diode laser absorption spectrometer without sacrificing accuracy. The spectroscopic technique combines the benefits of absolute concentration measurements using calibration-free direct tunable diode laser absorption spectroscopy (dTDLAS with the enhanced noise rejection of wavelength modulation spectroscopy (WMS. In this work we demonstrate for the first time a 125 Hz time division multiplexed (TDM-dTDLAS-WMS spectroscopic scheme by alternating the modulation of a DFB-laser between a triangle-ramp (dTDLAS and an additional 20 kHz sinusoidal modulation (WMS. The absolute concentration measurement via the dTDLAS-technique allows one to simultaneously calibrate the normalized 2f/1f-signal of the WMS-technique. A dTDLAS/WMS-spectrometer at 1.37 µm for H2O detection was built for experimental validation of the multiplexing scheme over a concentration range from 50 to 3000 ppmV (0.1 MPa, 293 K. A precision of 190 ppbV was achieved with an absorption length of 12.7 cm and an averaging time of two seconds. Our results show a five-fold improvement in precision over the entire concentration range and a significantly decreased averaging time of the spectrometer.
Hall, R N; Mahar, J E; Read, A J; Mourant, R; Piper, M; Huang, N; Strive, T
2018-04-01
Rabbit haemorrhagic disease virus (RHDV, or GI.1) is a calicivirus in the genus Lagovirus that has been widely utilized in Australia as a biological control agent for the management of overabundant wild European rabbit (Oryctolagus cuniculus) populations since 1996. Recently, two exotic incursions of pathogenic lagoviruses have been reported in Australia; GI.1a-Aus, previously called RHDVa-Aus, is a GI.1a virus detected in January 2014, and the novel lagovirus GI.2 (previously known as RHDV2). Furthermore, an additional GI.1a strain, GI.1a-K5 (also known as 08Q712), was released nationwide in March 2017 as a supplementary tool for wild rabbit management. To discriminate between these lagoviruses, a highly sensitive strain-specific multiplex RT-PCR assay was developed, which allows fast, cost-effective and sensitive detection of the four pathogenic lagoviruses currently known to be circulating in Australia. In addition, we developed a universal RT-qPCR assay to be used in conjunction with the multiplex assay that broadly detects all four viruses and facilitates quantification of viral RNA load in samples. These assays enable rapid detection, identification and quantification of pathogenic lagoviruses in the Australian context. Using these assays, a novel recombinant lagovirus was detected in rabbit tissue samples, which contained the non-structural genes of GI.1a-Aus and the structural genes of GI.2. This variant was also recovered from the liver of a European brown hare (Lepus europaeus). The impact of this novel recombinant on Australian wild lagomorph populations and its competitiveness in relation to circulating field strains, particularly GI.2, requires further studies. © 2017 Blackwell Verlag GmbH.
Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R
2018-03-23
Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Majumder, S; Baranwal, V K
2014-06-01
Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Juthika Mandal
2014-09-01
Full Text Available Objective: To develop a multiplex polymerase chain reaction (PCR protocol for the simultaneous detection of Salmonella enterica serovar Typhi (S. Typhi and Class 1 integron, so as to aid rapid diagnosis of S. Typhi cases and help in the selection of treatment options based on the presence of the Class 1 integron that can carry resistance cassettes to a range of antibiotics. Methods: PCR for amplification of specific regions was done using fliC-d and intl primers and agarose gel electrophoresis was used for resolution of PCR products. Results: The fliC-d primer (S. Typhi specific amplified a 587 bp region and the intl primer (Class 1 integron specific amplified two bands approximately 500 and 550 bps. The developed method was specific for S. Typhi and did not amplify any products with Salmonella enterica serovar Typhimurium ATCC 14028, Salmonella enterica serovar Paratyphi and Escherichia coli O157:H7. Conclusions: The developed multiplex PCR protocol can be used for rapid diagnosis and aid in proper treatment strategies for patients infected with S. Typhi.
Directory of Open Access Journals (Sweden)
Anita Chakravarti
2016-01-01
Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.
Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas
2002-03-15
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.
2012-01-01
The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.
Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O
2018-04-01
Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional
Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci
International Nuclear Information System (INIS)
Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.
2004-01-01
Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis
Isolation and identification of Enterococcus faecalis from necrotic root canals using multiplex PCR.
Mahmoudpour, Ali; Rahimi, Saeed; Sina, Mahmood; Soroush, Mohammad H; Shahi, Shahriar; Shahisa, Shahriar; Asl-Aminabadi, Naser
2007-09-01
This study was designed to survey the incidence of Enterococcus faecalis infection in symptomatic and asymptomatic root canals of necrotic teeth using PCR and to isolate the bacterium for further screening. Sixty patients categorized according to their clinical symptoms were used for sampling by insertion of paper points into the root canals and absorbing all the fluids present within them. The samples were incubated in 1.0 ml 2xYT (containing 16 g bacto tryptone, 10 g yeast extract and 5.0 g NaCl per liter) for 24 h at 37 degrees C without aeration prior to multiplex PCR analysis. To assist the isolation of E. faecalis, sub-samples were further grown in the same medium supplemented with 6.5% NaCl and back-inoculated into bile esculin. Using multiple cultivation-dependent and PCR analyses, 6 cases (10%) of E. faecalis were identified. Four isolates were obtained from asymptomatic cases of chronic apical periodontitis, and the other two were associated with phoenix abscess and acute apical abscess, respectively. No E. faecalis infection was found in 5 patients with acute apical periodontitis or in 9 with chronic suppurative periodontitis. Our results indicate that there is no significant difference in the incidence of E. faecalis between symptomatic and asymptomatic necrotic dental root canals (P > 0.05).
Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En
2017-08-01
We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Rubio, Marcela da Silva; Penha Filho, Rafael Antonio Casarin; Almeida, Adriana Maria de; Berchieri, Angelo
2017-12-01
Currently there are 2659 Salmonella serovars. The host-specific biovars Salmonella Pullorum and Salmonella Gallinarum cause systemic infections in food-producing and wild birds. Fast diagnosis is crucial to control the dissemination in avian environments. The present work describes the development of a multiplex qPCR in real time using a low-cost DNA dye (SYBr Green) to identify and quantify these biovars. Primers were chosen based on genomic regions of difference (RoD) and optimized to control dimers. Primers pSGP detect both host-specific biovars but not other serovars and pSG and pSP differentiate biovars. Three amplicons showed different melting temperatures (Tm), allowing differentiation. The pSGP amplicon (97 bp) showed Tm of 78°C for both biovars. The pSG amplicon (273 bp) showed a Tm of 86.2°C for S. Gallinarum and pSP amplicon (260 bp) dissociated at 84.8°C for S. Pullorum identification. The multiplex qPCR in real time showed high sensitivity and was capable of quantifying 10 8 -10 1 CFU of these biovars.
Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong
2013-08-01
Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.
Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva
2007-01-01
Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.
Directory of Open Access Journals (Sweden)
Rosemary S Turingan
Full Text Available BACKGROUND: The intentional release of Bacillus anthracis in the United States in 2001 has heightened concern about the use of pathogenic microorganisms in bioterrorism attacks. Many of the deadliest bacteria, including the Class A Select Agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis, are highly infectious via the pulmonary route when released in aerosolized form. Hence, rapid, sensitive, and reliable methods for detection of these biothreats and characterization of their potential impact on the exposed population are of critical importance to initiate and support rapid military, public health, and clinical responses. METHODOLOGY/PRINCIPAL FINDINGS: We have developed microfluidic multiplexed PCR and sequencing assays based on the simultaneous interrogation of three pathogens per assay and ten loci per pathogen. Microfluidic separation of amplified fluorescently labeled fragments generated characteristic electrophoretic signatures for identification of each agent. The three sets of primers allowed significant strain typing and discrimination from non-pathogenic closely-related species and environmental background strains based on amplicon sizes alone. Furthermore, sequencing of the 10 amplicons per pathogen, termed "Rapid Focused Sequencing," allowed an even greater degree of strain discrimination and, in some cases, can be used to determine virulence. Both amplification and sequencing assays were performed in microfluidic biochips developed for fast thermal cycling and requiring 7 µL per reaction. The 30-plex sequencing assay resulted in genotypic resolution of 84 representative strains belonging to each of the three biothreat species. CONCLUSIONS/SIGNIFICANCE: The microfluidic multiplexed assays allowed identification and strain differentiation of the biothreat agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis and clear discrimination from closely-related species and several environmental
Directory of Open Access Journals (Sweden)
Ghalia Boubaker
Full Text Available Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10 and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3, E. equinus (G4, E. ortleppi (G5, and E. canadensis (G6-G10. The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR allowing three levels of discrimination: (i Echinococcus genus, (ii E. granulosus complex in common, and (iii the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20 and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13. The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%. Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus.
Fourour, Sarah; Fablet, Christelle; Tocqueville, Véronique; Dorenlor, Virginie; Eono, Florent; Eveno, Eric; Kempf, Isabelle; Marois-Créhan, Corinne
2018-03-30
A new multiplex qPCR targeting Mycoplasma (M.) hyopneumoniae, M. hyorhinis and M. flocculare was developed and the relationship between the detection of those mycoplasma species and the extent of gross pneumonia like lesions in slaughtered pigs lungs were investigated. The multiplex qPCR method targets the p102, p37 and fruA genes and has detection limits of 14, 146, and 16 genome equivalents μl -1 for M. hyopneumoniae, M. hyorhinis and M. flocculare, respectively. In all, 671 lungs were collected and analysed, among them 666 were scored for macroscopic pneumonia and categorized according to the extent of the lesions (no or minor lesions, moderate lesions, and extensive lesions). According to results of multiplex qPCR, 59.5% were positive for M. hyopneumoniae, 3.4% for M. hyorhinis and 34.7% for M. flocculare, with on average, 3.1x10 7 , 9.7x10 6 and 5.7x10 6 genome equivalents of mycoplasma ml -1 , respectively. More results showed that no or minor lesions were associated with multiplex qPCR-negative results or qPCR-positive results for M. flocculare. Moderate to extensive lesions were positively correlated with qPCR-positive results for M. hyopneumoniae. Extensive lesions were associated with qPCR-positive results for at least two mycoplasma species (M. hyopneumoniae and M. hyorhinis). The findings also indicated that M. hyopneumoniae and M. hyorhinis significantly increased the odds for a lung to have macroscopic pneumonia. No relationship was found between the extent of lesions and the mycoplasma genome load. This new multiplex qPCR appears to be specific, sufficiently sensitive and repeatable. The validation of this method with field samples guarantees its use for field epidemiological investigations, particularly to gain more insight into the etiology of the porcine respiratory disease complex. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Schmidt, Katarzyna; Cybulski, Zefiryn; Roszak, Andrzej; Grabiec, Alicja; Talaga, Zofia; Urbański, Bartosz; Odważna, Joanna; Wojciechowicz, Jacek
2015-05-01
Bacterial vaginosis (BV) and vaginitis in cervical cancer patients might becaused by mixed aerobic, anaerobic, and atypical bacteria. Since genital tract infections can be complicated, early and accurate identification of causal pathogens is vital. The purpose of this study was i) to determinate if currently used aerobic culture methods are sufficiently sensitive to identify pathogens that can appear in the cervix of women after cancer treatment; ii) to investigate if molecular methods can improve the diagnostic process of BV and vaginitis, as well as broaden the range of detectable pathogens that would otherwise be difficult to cultivate. A one-year hospital-based study was conducted in 2011/2012. Cervical swabs from 130 patients were examined by microbiological culture and multiplex PCR. Swab samples were positive for 107 and 93 women by microbiological culture and multiplex PCR, respectively The most common bacteria isolated from culture were: Escherichia coli, Enterococcus faecalis, Streptococcus agalactiae, and Staphylococcus aureus, and using the molecular technique were: Gardnerella vaginalis, Bacteroides fragilis, Ureoplasma ureoliticum/parvum, Mobiluncus curtisii and Atopobium vaginae. Multiplex PCR might contribute to the diagnosis of genital tract infections and it broadens the number of detectable microorganisms responsible for BV. Combination of these two methods may become the basis for standardized diagnosis of BV and vaginitis.
Kowada, Kazuaki; Takeuchi, Kenji; Hirano, Eiko; Toho, Miho; Sada, Kiyonao
2018-01-01
There are many varieties of gastroenteritis viruses, of which norovirus (NoV) accounts for over 90% of the viral food poisoning incidents in Japan. However, protocols for rapidly identifying other gastroenteritis viruses need to be established to investigate NoV-negative cases intensively. In this study, a multiplex real-time PCR assay targeting rotavirus A, rotavirus C, sapovirus, astrovirus, adenovirus, and enterovirus was developed using stool samples collected from gastroenteritis patients between 2010 and 2013 in Fukui Prefecture, Japan. Of the 126 samples collected sporadically from pediatric patients with suspected infectious gastroenteritis, 51 were positive for non-NoV target viruses, whereas 27 were positive for NoV, showing a high prevalence of non-NoV viruses in pediatric patients. In contrast, testing in 382 samples of 58 gastroenteritis outbreaks showed that non-NoV viruses were detected in 13 samples, with NoV in 267. Of the 267 NoV-positive patients, only two were co-infected with non-NoV target viruses, suggesting that testing for non-NoV gastroenteritis viruses in NoV-positive samples was mostly unnecessary in outbreak investigations. Given these results, multiplex real-time PCR testing for non-NoV gastroenteritis viruses, conducted separately from NoV testing, may be helpful to deal with two types of epidemiological investigations, regular surveillance of infectious gastroenteritis and urgent testing when gastroenteritis outbreaks occur. © 2017 Wiley Periodicals, Inc.
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
A Multiplex PCR for the Simultaneous Detection and Genotyping of the Echinococcus granulosus Complex
Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A.; Rosenzvit, Mara C.; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus
2013-01-01
Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1–G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1–G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6–G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus. PMID:23350011
Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A; Rosenzvit, Mara C; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus
2013-01-01
Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6-G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus.
Directory of Open Access Journals (Sweden)
Chi Zhang
2018-04-01
Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.
Chiapponi, Chiara; Moreno, Ana; Barbieri, Ilaria; Merenda, Marianna; Foni, Emanuela
2012-09-01
In Europe, three major swine influenza viral (SIV) subtypes (H1N1, H1N2 and H3N2) have been isolated in pigs. Developing a test that is able to detect and identify the subtype of the circulating strain rapidly during an outbreak of respiratory disease in the pig population is of essential importance. This study describes two multiplex RT-PCRs which distinguish the haemagglutinin (HA) gene and the neuraminidase (NA) gene of the three major subtypes of SIV circulating in Europe. The HA PCR was able to identify the lineage (avian or human) of the HA of H1 subtypes. The analytical sensitivity of the test, considered to be unique, was assessed using three reference viruses. The detection limit corresponded to 1×10(-1) TCID(50)/200μl for avian-like H1N1, 1×10(0) TCID(50)/200μl for human-like H1N2 and 1×10(1) TCID(50)/200μl for H3N2 SIV. The multiplex RT-PCR was first carried out on a collection of 70 isolated viruses showing 100% specificity and then on clinical samples, from which viruses had previously been isolated, resulting in an 89% positive specificity of the viral subtype. Finally, the test was able to identify the viral subtype correctly in 56% of influenza A positive samples, from which SIV had not been isolated previously. It was also possible to identify mixed viral infections and the circulation of a reassortant strain before performing genomic studies. Copyright © 2012 Elsevier B.V. All rights reserved.
Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
Directory of Open Access Journals (Sweden)
Shan Wei
2018-05-01
Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Laummaunwai, Porntip; Lulitanond, Viraphong; Doanh, Pham Ngoc; Maleewong, Wanchai
2013-12-01
Opisthorchis viverrini and Clonorchis sinensis are parasites known to be carcinogenic and causative agents of cholangiocarcinoma in Asia. The standard method for diagnosis for those parasite infections is stool examination to detect parasite eggs. However, the method has low sensitivity, and eggs of O. viverrini and C. sinensis are difficult to distinguish from each other and from those of some other trematodes. Here, we report a multiplex real-time PCR coupled with high resolution melting (HRM) analysis for the differentiation of O. viverrini and C. sinensis eggs in fecal samples. Using 2 pairs of species-specific primers, DNA sequences from a portion of the mitochondrial NADH dehydrogenase subunit 2 (nad 2) gene, were amplified to generate 209 and 165 bp products for O. viverrini and C. sinensis, respectively. The distinct characteristics of HRM patterns were analyzed, and the melting temperatures peaked at 82.4±0.09℃ and 85.9±0.08℃ for O. viverrini and C. sinensis, respectively. This technique was able to detect as few as 1 egg of O. viverrini and 2 eggs of C. sinensis in a 150 mg fecal sample, which is equivalent to 7 and 14 eggs per gram of feces, respectively. The method is species-specific, rapid, simple, and does not require fluorescent probes or post-PCR processing for discrimination of eggs of the 2 species. It offers a new tool for differentiation and detection of Asian liver fluke infections in stool specimens.
Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn
2010-12-03
Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased
Directory of Open Access Journals (Sweden)
Welinder-Olsson Christina
2010-12-01
Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both
DEFF Research Database (Denmark)
Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong
2009-01-01
In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...
van den Brand, Marre; van den Dungen, Frank A M; Bos, Martine P; van Weissenbruch, Mirjam M; van Furth, A Marceline; de Lange, Annemieke; Rubenjan, Anna; Peters, Remco P H; Savelkoul, Paul H M
2018-04-22
Rapid and accurate diagnosis of neonatal sepsis is highly warranted because of high associated morbidity and mortality. The aim of this study was to evaluate the performance of a novel multiplex PCR assay for diagnosis of late-onset sepsis and to investigate the value of bacterial DNA load (BDL) determination as a measure of infection severity. This cross-sectional study was conducted in a neonatal intensive care unit. Preterm and/or very low birth weight infants suspected for late-onset sepsis were included. Upon suspicion of sepsis, a whole blood sample was drawn for multiplex PCR to detect the eight most common bacteria causing neonatal sepsis, as well as for blood culture. BDL was determined in episodes with a positive multiplex PCR. In total, 91 episodes of suspected sepsis were investigated, and PCR was positive in 53 (58%) and blood culture in 60 (66%) episodes, yielding no significant difference in detection rate (p = 0.17). Multiplex PCR showed a sensitivity of 77%, specificity of 81%, positive predictive value of 87%, and negative predictive value of 68% compared with blood culture. Episodes with discordant results of PCR and blood culture included mainly detection of coagulase-negative staphylococci (CoNS). C-reactive protein (CRP) level and immature to total neutrophil (I/T) ratio were lower in these episodes, indicating less severe disease or even contamination. Median BDL was high (4.1 log 10 cfu Eq/ml) with a wide range, and was it higher in episodes with a positive blood culture than in those with a negative blood culture (4.5 versus 2.5 log 10 cfu Eq/ml; p PCR provides a powerful assay to enhance rapid identification of the causative pathogen in late-onset sepsis. BDL measurement may be a useful indicator of severity of infection.
Moraes, Julio Cesar; França, Marciél; Sartor, Amélia Aparecida; Bellato, Valdomiro; de Moura, Anderson Barbosa; de Lourdes Borba Magalhães, Maria; de Souza, Antonio Pereira; Miletti, Luiz Claudio
2015-06-01
Parasitic infections caused by Eimeria species are responsible for most economic losses in poultry production. Prevalence studies can adequately assist the design of prophylaxis strategies for disease control. Therefore, stool samples from 251 flocks of broilers from 28 to 48 days old were collected in 21 municipalities in the state of Santa Catarina, Brazil, to detect and examine the prevalence of Eimeria acervulina, Eimeria maxima, Eimeria tenella, Eimeria mitis, Eimeria praecox, Eimeria necatrix, and Eimeria brunetti. The oocysts were recovered and quantified, and the species were identified by a multiplex PCR technique. Amplicons of seven Eimeria species originating from the PCR-positive samples were cloned. Microscopy studies demonstrated that 96% of the farms were positive for the Eimeria. Seven species were identified, as follows: E. maxima (63.7%) and E. acervulina (63.3%) were the most prevalent species, followed by E. tenella (54.6%), E. mitis (38.6%), E. praecox (25.1%), E. necatrix (24.3%), and E. brunetti (13.1%). The average number of species detected per farm was 2.96, and the most common were E. acervulina, E. maxima, and E. tenella (9.16%). The sequencing of the clones confirmed the specificity and effectiveness of multiplex PCR for the identification of seven species of Eimeria, so this tool can be useful in studying circulating species in poultry farms, thereby assisting prophylactic measures against coccidiosis.
Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li
2017-07-20
Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.
DEFF Research Database (Denmark)
Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.
2018-01-01
Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...
Directory of Open Access Journals (Sweden)
Raquel M. Fernández
2013-01-01
Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.
Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry
2017-10-01
Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.
Hanson, Erin K; Ballantyne, Jack
2013-01-01
Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA) profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE) or quantitative RT-PCR (qRT-PCR) platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM) assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions), IL1F7 (skin), ALAS2 (blood), MMP10 (menstrual blood), HTN3 (saliva) and TGM4 (semen). The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green). Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively inexpensive
Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg
2017-10-01
Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.
Caballero, S; Cardeñosa, D; Soler, G; Hyde, J
2012-03-01
Here we describe the application of new and existing multiplex PCR methodologies for shark species molecular identification. Four multiplex systems (group ID, thresher sharks, hammerhead sharks and miscellaneous shark) were employed with primers previously described and some designed in this study, which allow for species identification after running PCR products through an agarose gel. This system was implemented for samples (bodies and fins) collected from unidentified sharks landed in the port of Buenaventura and from confiscated tissues obtained from illegal fishing around the Malpelo Island Marine Protected Area, Pacific Coast of Colombia. This method has allowed reliable identification, to date, of 407 samples to the genus and/or species levels, most of them (380) identified as the pelagic thresher shark (Alopias pelagicus). Another seven samples were identified as scalloped hammerhead sharks (Sphyrna lewini). This is an easy-to-implement and reliable identification method that could even be used locally to monitor shark captures in the main fishing ports of developed and developing countries. © 2011 Blackwell Publishing Ltd.
Detection of Human Bocavirus DNA by Multiplex PCR Analysis: Postmortem Case Report
Directory of Open Access Journals (Sweden)
Nihan Ziyade
2015-06-01
Full Text Available Background: Human bocavirus (HBoV is a virus belonging to the Parvoviridae family, which has been newly discovered to be associated with respiratory tract infections in children. There are many reports worldwide on the endemicity of this virus. Since it is relatively new, it is not routinely detected in clinical laboratory investigations. Case Report: We demonstrated that HBoV infection caused the death of a 5-month-old girl with a history of high fever and wheezing. Human bocavirus (HBoV 1/2/3/4 was found in a nasopharyngeal swab, paraffin-embedded lung tissue and stool samples by multiplex PCR methods using postmortem microbiological analysis. Conclusion: This case suggests that lower respiratory tract infections due to HBoV may cause severe and life-threatening diseases. Postmortem microbiology is useful in both clinical and forensic autopsies, and allows a suspected infection to be confirmed. To our knowledge, this report is the first document of a HBoV postmortem case in Turkey.
Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun
2018-04-01
Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.
Disentangling mite predator-prey relationships by multiplex PCR.
Pérez-Sayas, Consuelo; Pina, Tatiana; Gómez-Martínez, María A; Camañes, Gemma; Ibáñez-Gual, María V; Jaques, Josep A; Hurtado, Mónica A
2015-11-01
Gut content analysis using molecular techniques can help elucidate predator-prey relationships in situations in which other methodologies are not feasible, such as in the case of trophic interactions between minute species such as mites. We designed species-specific primers for a mite community occurring in Spanish citrus orchards comprising two herbivores, the Tetranychidae Tetranychus urticae and Panonychus citri, and six predatory mites belonging to the Phytoseiidae family; these predatory mites are considered to be these herbivores' main biological control agents. These primers were successfully multiplexed in a single PCR to test the range of predators feeding on each of the two prey species. We estimated prey DNA detectability success over time (DS50), which depended on the predator-prey combination and ranged from 0.2 to 18 h. These values were further used to weight prey detection in field samples to disentangle the predatory role played by the most abundant predators (i.e. Euseius stipulatus and Phytoseiulus persimilis). The corrected predation value for E. stipulatus was significantly higher than for P. persimilis. However, because this 1.5-fold difference was less than that observed regarding their sevenfold difference in abundance, we conclude that P. persimilis is the most effective predator in the system; it preyed on tetranychids almost five times more frequently than E. stipulatus did. The present results demonstrate that molecular tools are appropriate to unravel predator-prey interactions in tiny species such as mites, which include important agricultural pests and their predators. © 2015 John Wiley & Sons Ltd.
Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR
Directory of Open Access Journals (Sweden)
Neng Chen
2014-07-01
Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.
Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.
Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki
2018-01-01
ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.
Bello Gonzalez, Teresita; Rivera-Olivero, Ismar Alejandra; Sisco, María Carolina; Spadola, Enza; Hermans, Peter W; de Waard, Jacobus H
2014-04-15
Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPCR), resolving 24 serotypes in four PCR reactions and optimally targeting the most prevalent invasive and colonizing pneumococcal serotypes found in Venezuela. A total of 223 pneumococcal isolates, 140 invasive and 83 carriage isolates, previously serotyped by the Quellung reaction and representing the 18 most common serotypes/groups identified in Venezuela, were serotyped with the adapted mPCR. The mPCR serotyped 76% of all the strains in the first two PCR reactions and 91% after four reactions, correctly identifying 17 serotypes/groups. An isolate could be serotyped with mPCR in less than 2 minutes versus 15 minutes for the Quellung reaction, considerably lowering labor costs. A restrictive weakness of mPCR was found for the detection of 19F strains. Most Venezuelan 19F strains were not typeable using the mPCR, and two 19F cps serotype variants were identified. The mPCR assay is an accurate, rapid, and economical method for the identification of the vast majority of the serotypes from Venezuela and can be used in place of the standard Quellung reaction. An exception is the identification of serotype 19F. In this setting, most 19F strains were not detectable with mPCR, demonstrating a need of serology-based quality control for PCR-based serotyping.
Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa
2017-08-01
A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.
Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni; Ursing, Johan; Rombo, Lars; Kofoed, Poul-Erik; Kantele, Anu
2017-09-01
In developing countries, diarrhoea is the most common cause of death for children under five years of age, with Giardia lamblia, Cryptosporidium and Entamoeba histolytica as the most frequent pathogenic parasites. Traditional microscopy for stool parasites has poor sensitivity and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. A real-time multiplex PCR method with internal inhibition control was developed for detecting Giardia lamblia, Cryptosporidium hominis/parvum and Entamoeba histolytica directly from stool specimens. Applicability to dried samples was checked by comparing with fresh ones in a small test material. Finally, the assay was applied to dried specimens collected from Guinea-Bissauan children with diarrhoea. The PCR's analytical sensitivity limit was 0.1 ng/ml for G. lamblia DNA, 0.01 ng/ml for E. histolytica DNA and 0.1 ng/ml for Cryptosporidium sp. In the test material, the assay performed similarly with fresh and dried stools. Of the 52 Guinea-Bissauan samples, local microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof of concept, it worked well on stools collected from Guinea-Bissauan children with diarrhoea. It provides an epidemiological tool for analysing dried specimens from regions poor in resources.
Directory of Open Access Journals (Sweden)
Abu Hena Hasanoor Reja
2013-01-01
Full Text Available Background: The diagnosis of pure neural leprosy (PNL remained subjective because of over-dependence of clinical expertise and a lack of simple yet reliable diagnostic tool. The criteria for diagnosis, proposed by Jardim et al., are not routinely done by clinicians in developing country as it involves invasive nerve biopsy and sophisticated anti-PGL-1 detection. We conducted a study using fine needle aspiration cytology (FNAC coupled with Ziehl Neelsen staining (ZN staining and Multiplex- Polymerase Chain Reaction (PCR specific for M. leprae for an objective diagnosis of pure neural leprosy (PNL, which may be simpler and yet reliable. Aim: The aim of the study is to couple FNAC with ZN staining and multiplex PCR to diagnose pure neural leprosy patients rapidly, in simpler and yet reliable way. Methods: Thirteen patients of PNL as diagnosed by two independent consultants were included as case, and 5 patients other than PNL were taken as control in the study. Fine needle aspiration was done on the affected nerve, and aspirates were evaluated for cytology, ZN staining and multiplex- PCR. Results: Out of the 13 cases where fine needle aspiration was done, M. leprae could be elicited in the nerve tissue aspirates in 5 cases (38.4% with the help of conventional acid-fast staining and 11 cases (84.6% with the help of multiplex PCR. On cytological examination of the aspirates, only 3 (23% cases showed specific epithelioid cells, whereas 8 (61.5% cases showed non-specific inflammation, and 2 (15.3% cases had no inflammatory cells. Conclusion: Our study demonstrates that in the field of laboratory diagnosis of PNL cases, FNAC in combination with ZN staining for acid-fast bacilli (AFB and Multiplex-PCR can provide a rapid and definitive diagnosis for the majority of PNL cases. FNAC is a less-invasive, outdoor-based and simpler technique than invasive nerve biopsy procedure. Thus, this study may enlighten the future path for easy and reliable diagnosis of
Energy Technology Data Exchange (ETDEWEB)
Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B
2007-08-06
Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox
Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F
2017-05-01
The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi
2016-01-01
technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP...
Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition
Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji
2010-04-01
Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.
Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients
Directory of Open Access Journals (Sweden)
Aziza Sbiti
2002-01-01
Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.
Dörries, Hans-Henno; Remus, Ivonne; Grönewald, Astrid; Grönewald, Cordt; Berghof-Jäger, Kornelia
2010-03-01
The number of commercially available genetically modified organisms (GMOs) and therefore the diversity of possible target sequences for molecular detection techniques are constantly increasing. As a result, GMO laboratories and the food production industry currently are forced to apply many different methods to reliably test raw material and complex processed food products. Screening methods have become more and more relevant to minimize the analytical effort and to make a preselection for further analysis (e.g., specific identification or quantification of the GMO). A multiplex real-time PCR kit was developed to detect the 35S promoter of the cauliflower mosaic virus, the terminator of the nopaline synthase gene of Agrobacterium tumefaciens, the 35S promoter from the figwort mosaic virus, and the bar gene of the soil bacterium Streptomyces hygroscopicus as the most widely used sequences in GMOs. The kit contains a second assay for the detection of plant-derived DNA to control the quality of the often processed and refined sample material. Additionally, the plant-specific assay comprises a homologous internal amplification control for inhibition control. The determined limits of detection for the five assays were 10 target copies/reaction. No amplification products were observed with DNAs of 26 bacterial species, 25 yeasts, 13 molds, and 41 not genetically modified plants. The specificity of the assays was further demonstrated to be 100% by the specific amplification of DNA derived from reference material from 22 genetically modified crops. The applicability of the kit in routine laboratory use was verified by testing of 50 spiked and unspiked food products. The herein described kit represents a simple and sensitive GMO screening method for the reliable detection of multiple GMO-specific target sequences in a multiplex real-time PCR reaction.
Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.
Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco
2016-01-01
Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.
Williams, D Ross; Chanos, Panagiotis
2012-12-01
Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.
Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR
Directory of Open Access Journals (Sweden)
Cattoir Vincent
2010-08-01
Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (
Directory of Open Access Journals (Sweden)
Loo Keat
2012-05-01
Full Text Available Abstract Background Hyperhomocysteinemia as a consequence of the MTHFR 677 C > T variant is associated with cardiovascular disease and stroke. Another factor that can potentially contribute to these disorders is a depleted nitric oxide level, which can be due to the presence of eNOS +894 G > T and eNOS −786 T > C variants that make an individual more susceptible to endothelial dysfunction. A number of genotyping methods have been developed to investigate these variants. However, simultaneous detection methods using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis are still lacking. In this study, a novel multiplex PCR-RFLP method for the simultaneous detection of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants was developed. A total of 114 healthy Malay subjects were recruited. The MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants were genotyped using the novel multiplex PCR-RFLP and confirmed by DNA sequencing as well as snpBLAST. Allele frequencies of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C were calculated using the Hardy Weinberg equation. Methods The 114 healthy volunteers were recruited for this study, and their DNA was extracted. Primer pair was designed using Primer 3 Software version 0.4.0 and validated against the BLAST database. The primer specificity, functionality and annealing temperature were tested using uniplex PCR methods that were later combined into a single multiplex PCR. Restriction Fragment Length Polymorphism (RFLP was performed in three separate tubes followed by agarose gel electrophoresis. PCR product residual was purified and sent for DNA sequencing. Results The allele frequencies for MTHFR 677 C > T were 0.89 (C allele and 0.11 (T allele; for eNOS +894 G > T, the allele frequencies were 0.58 (G allele and 0.43 (T allele; and for eNOS −786 T > C, the allele
Directory of Open Access Journals (Sweden)
Dafni-Maria Kagkli
Full Text Available Escherichia coli is a group of bacteria which has raised a lot of safety concerns in recent years. Five major intestinal pathogenic groups have been recognized amongst which the verocytotoxin or shiga-toxin (stx1 and/or stx2 producing E. coli (VTEC or STEC respectively have received a lot of attention recently. Indeed, due to the high number of outbreaks related to VTEC strains, the European Food Safety Authority (EFSA has requested the monitoring of the "top-five" serogroups (O26, O103, O111, O145 and O157 most often encountered in food borne diseases and addressed the need for validated VTEC detection methods. Here we report the development of a set of intercalating dye Real-time PCR methods capable of rapidly detecting the presence of the toxin genes together with intimin (eae in the case of VTEC, or aggregative protein (aggR, in the case of the O104:H4 strain responsible for the outbreak in Germany in 2011. All reactions were optimized to perform at the same annealing temperature permitting the multiplex application in order to minimize the need of material and to allow for high-throughput analysis. In addition, High Resolution Melting (HRM analysis allowing the discrimination among strains possessing similar virulence traits was established. The development, application to food samples and the flexibility in use of the methods are thoroughly discussed. Together, these Real-time PCR methods facilitate the detection of VTEC in a new highly efficient way and could represent the basis for developing a simple pathogenic E. coli platform.
DEFF Research Database (Denmark)
Hoegh, A M; Nielsen, J B; Lester, A
2012-01-01
The purpose of this study was to validate a multiplex real-time PCR assay capable of detecting toxigenic Clostridium difficile and simultaneously identifying C. difficile ribotype 027/ST-1 by targeting the toxin genes tcdA, tcdB and cdtA in one reaction and in a separate reaction identifying the Δ...... to confirm the correct identification of the Δ117 deletion in tcdC and C. difficile ribotype 027/ST-1, respectively. The PCR assay displayed a sensitivity, specificity, PPV and NPV of 99.0%, 97.4%, 87.4% and 99.8%, respectively, compared to toxigenic culture on 665 samples evaluable both by PCR and culture....... Sequencing of tcdC, ribotyping and MLST of cultured isolates validated the genotyping assay and confirmed the ability of the assay to correctly identify C. difficile ribotype 027/ST-1 in our current epidemiological setting. We describe the use of a combination of two separate PCR assays for sensitive...
Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep
2012-02-01
Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
Macarena Parra
Full Text Available The International Space Station (ISS National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for
Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo
2014-12-01
Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.
Directory of Open Access Journals (Sweden)
Hae-Ryun Kwak
2014-12-01
Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.
Evaluation of Palm PCRTM G1-12 System: a portable battery-operated PCR thermal cycler
Directory of Open Access Journals (Sweden)
Siti Aminah Ahmed
2016-08-01
Full Text Available Polymerase chain reaction (PCR is the basis of recombinant and other molecular biological techniques. Availability of cheap and robust PCR platforms enables the tests to be performed easily, even in resource constrained settings. Herein we compared the efficacy of a portable thermal cycler ( Palm PCRTM G1-12 System for rapid DNA amplification against the standard Peltier-based thermal cycler using plasmid DNA and genomic DNA in single and multiplex PCR experiments. Our study revealed that the Palm PCRTM G1-12 System could be a portable DNA amplification system to conduct various molecular techniques, especially in places where resources are limited.
Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.
Singh, Prashant; Mustapha, Azlin
2013-09-02
Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.
Hubalkova, Zora; Rencova, Eva
2011-10-01
A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.
A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.
Directory of Open Access Journals (Sweden)
Grace Wong
Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular
Directory of Open Access Journals (Sweden)
Kyusik Jeong
2011-04-01
Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.
Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.
2013-01-01
Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707
Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin
2013-10-01
A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
Haudenshield, James S; Song, Jeong Y; Hartman, Glen L
2017-01-01
Phytophthora root rot of soybean [Glycine max (L.) Merr.] is caused by the oomycete Phytophthora sojae (Kaufm. & Gerd.). P. sojae has a narrow host range, consisting primarily of soybean, and it is a serious pathogen worldwide. It exists in root and stem tissues as mycelium, wherein it can form oospores which subsequently germinate to release motile, infectious zoospores. Molecular assays detecting DNA of P. sojae are useful in disease diagnostics, and for determining the presence of the organism in host tissues, soils, and runoff or ponded water from potentially infested fields. Such assays as published have utilized ITS sequences from the nuclear ribosomal RNA genes in conventional PCR or dye-binding quantitative PCR (Q-PCR) but are not amenable to multiplexing, and some of these assays did not utilize control strategies for type I or type II errors. In this study, we describe primers and a bifunctional probe with specificity to a gypsy-like retroelement in the P. sojae genome to create a fluorogenic 5'-exonuclease linear hydrolysis assay, with a multiplexed internal control reaction detecting an exogenous target to validate negative calls, and with uracil-deglycosylase-mediated protection against carryover contamination. The assay specifically detected 13 different P. sojae isolates, and excluded 17 other Phytophthora species along with 20 non-Phytophthora fungal and oomycete species pathogenic on soybean. A diagnostic limit of detection of 34 fg total P. sojae DNA was observed in serial dilutions, equivalent to 0.3 genome, and a practical detection sensitivity of four zoospores per sample was achieved, despite losses during DNA extraction.
A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.
Directory of Open Access Journals (Sweden)
Diego Cardeñosa
Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.
Directory of Open Access Journals (Sweden)
Dabisch-Ruthe Mareike
2012-07-01
Full Text Available Abstract Background A broad spectrum of pathogens is causative for respiratory tract infections, but symptoms are mostly similar. Therefore, the identification of the causative viruses and bacteria is only feasible using multiplex PCR or several monoplex PCR tests in parallel. Methods The analytical sensitivity of three multiplex PCR assays, RespiFinder-19, RespiFinder-SMART-22 and xTAG-Respiratory-Virus-Panel-Fast-Assay (RVP, were compared to monoplex real-time PCR with quantified standardized control material. All assays include the most common respiratory pathogens. Results To compare the analytical sensitivity of the multiplex assays, samples were inoculated with 13 different quantified viruses in the range of 101 to 105 copies/ml. Concordant results were received for rhinovirus, whereas the RVP detected influenzavirus, RSV and hMPV more frequently in low concentrations. The RespiFinder-19 and the RespiFinder-SMART-22 showed a higher analytical sensitivity for adenoviruses and coronaviruses, whereas the RVP was incapable to detect adenovirus and coronavirus in concentrations of 104 copies/ml. The RespiFinder-19 and RespiFinder-SMART-22A did not detect influenzaviruses (104 copies/ml and RSV (103 copies/ml. The detection of all 13 viruses in one sample was only achieved using monoplex PCR. To analyze possible competitive amplification reactions between the different viruses, samples were further inoculated with only 4 different viruses in one sample. Compared to the detection of 13 viruses in parallel, only a few differences were found. The incidence of respiratory viruses was compared in tracheal secretion (TS samples (n = 100 of mechanically ventilated patients in winter (n = 50 and summer (n = 50. In winter, respiratory viruses were detected in 32 TS samples (64% by RespiFinder-19, whereas the detection rate with RVP was only 22%. The most frequent viruses were adenovirus (32% and PIV-2 (20%. Multiple infections were detected
Leski, T. A.; Ansumana, R.; Jimmy, D. H.; Bangura, U.; Malanoski, A. P.; Lin, B.; Stenger, D. A.
2011-06-01
Multiplexed microbial diagnostic assays are a promising method for detection and identification of pathogens causing syndromes characterized by nonspecific symptoms in which traditional differential diagnosis is difficult. Also such assays can play an important role in outbreak investigations and environmental screening for intentional or accidental release of biothreat agents, which requires simultaneous testing for hundreds of potential pathogens. The resequencing pathogen microarray (RPM) is an emerging technological platform, relying on a combination of massively multiplex PCR and high-density DNA microarrays for rapid detection and high-resolution identification of hundreds of infectious agents simultaneously. The RPM diagnostic system was deployed in Sierra Leone, West Africa in collaboration with Njala University and Mercy Hospital Research Laboratory located in Bo. We used the RPM-Flu microarray designed for broad-range detection of human respiratory pathogens, to investigate a suspected outbreak of avian influenza in a number of poultry farms in which significant mortality of chickens was observed. The microarray results were additionally confirmed by influenza specific real-time PCR. The results of the study excluded the possibility that the outbreak was caused by influenza, but implicated Klebsiella pneumoniae as a possible pathogen. The outcome of this feasibility study confirms that application of broad-spectrum detection platforms for outbreak investigation in low-resource locations is possible and allows for rapid discovery of the responsible agents, even in cases when different agents are suspected. This strategy enables quick and cost effective detection of low probability events such as outbreak of a rare disease or intentional release of a biothreat agent.
Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.
Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing
2015-06-15
Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kyusik Jeong
2011-04-01
Full Text Available The aim of this study was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant seed infection pathogenic bacteria and virus, Xanthomonns campestris pv. vesicatoria (Xcv, Clavibacter michiganensis subsp. michiganensis (Cmm, Erwinia carotovora subsp. carotovora (Ecc, Pepper mild mottle virus (PMMoV and Tobacco mild green mosaic virus (TMGMV in pepper and tomato seeds. Most of pepper and tomato bacterial and virus diseases are responsible for germination and growth obstruction. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcv, Cmm, Ecc, PMMoV and TMGMV in pepper and tomato seeds, five pairs (Cmm-F/R, Ecc-F/R, Xcv-F/R, PMMoV-F/R, TMGMV-F/R of specific primer were synthesized by primer-blast program. The multiplex PCR for the five pathogens in pepper and tomato seeds could detect specially without interference among primers and/or cDNA of plant seeds and other plant pathogens. The PCR result for pathogen detection using 20 commercial pepper and 10 tomato seed samples, Ecc was detected from 4 pepper and 2 tomato seed samples, PMMoV was detected from 1 pepper seed sample, and PMMoV and TMGMV were simultaneously detected from 1 pepper seed sample.
Directory of Open Access Journals (Sweden)
Owen Higgins
2018-02-01
Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.
Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert
2018-01-01
Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124
Mittal, M; Chakravarti, S; Sharma, V; Sanjeeth, B S; Churamani, C P; Kanwar, N S
2014-04-01
Bovine tuberculosis, caused by Mycobacterium bovis, remains one of the most important zoonotic health concerns worldwide. The transmission of Mycobacterium tuberculosis from humans to animals also occurs especially in countries where there is close interaction of humans with the animals. In the present study, thirty bovine lung tissue autopsy samples from an organized dairy farm located in North India were screened for the presence of Mycobacterium tuberculosis complex by smear microscopy, histopathological findings and PCR. Differential diagnosis of M. tuberculosis and M. bovis was made based on the deletion of mce-3 operon in M. bovis. The present study found eight of these samples positive for M. tuberculosis by multiplex PCR. Sequencing was performed on two PCR-positive representative samples and on annotation, and BLAST analysis confirmed the presence of gene fragment specific to Mycobacterium tuberculosis. The presence of M. tuberculosis in all the positive samples raises the possibility of human-to-cattle transmission and possible adaptation of this organism in bovine tissues. This study accentuates the importance of screening and differential diagnosis of Mycobacterium tuberculosis complex in humans and livestock for adopting effective TB control and eradication programmes. © 2014 Blackwell Verlag GmbH.
Škereňová, Markéta; Mikulová, Veronika; Čapoun, Otakar; Zima, Tomáš
2016-01-01
Nowadays, on-a-chip capillary electrophoresis is a routine method for the detection of PCR fragments. The Agilent 2100 Bioanalyzer was one of the first commercial devices in this field. Our project was designed to study the characteristics of Agilent DNA 1000 kit in PCR fragment analysis as a part of circulating tumour cell (CTC) detection technique. Despite the common use of this kit a complex analysis of the results from a long-term project is still missing. A commercially available Agilent DNA 1000 kit was used as a final step in the CTC detection (AdnaTest) for the determination of the presence of PCR fragments generated by Multiplex PCR. Data from 30 prostate cancer patients obtained during two years of research were analyzed to determine the trueness and precision of the PCR fragment size determination. Additional experiments were performed to demonstrate the precision (repeatability, reproducibility) and robustness of PCR fragment concentration determination. The trueness and precision of the size determination was below 3% and 2% respectively. The repeatability of the concentration determination was below 15%. The difference in concentration determination increases when Multiplex-PCR/storage step is added between the two measurements of one sample. The characteristics established in our study are in concordance with the manufacturer's specifications established for a ladder as a sample. However, the concentration determination may vary depending on chip preparation, sample storage and concentration. The 15% variation of concentration determination repeatability was shown to be partly proportional and can be suppressed by proper normalization.
Directory of Open Access Journals (Sweden)
Natali Moreno
2010-12-01
and multiplex PCR methods (using primers directed against lipl32 and secY/flaB genes, respectively. To assess the capacity of PCR methods to identify pathogenic and saprophytic species of Leptospira ssp. Material and methods. 22 international reference strains and 12 colombian isolates were used. DNA was extracted with a commercial kit (Wizard. Specificity and sensitivity of both PCR methods were evaluated. Results. The maximum dilution of DNA samples allowing the detection of Leptospira ssp was determined to be 1:10000 for the PCR lipL32 and 1:100/1:1000 for the multiplex PCR secY/flaB. Both PCR didn’t detect DNA from microorganisms unrelated to Leptospira ssp. The lipL32 PCR specifically amplified a 423bp fragment from all pathogenic Leptospira reference strains, while the secY/flaB PCR amplified both 285bp (secY and 793bp (flaB fragments from 18 reference strains. The lipL32 PCR detected 7/12 colombian isolates, while secY/flaB PCR detected both secY and flaB genes from 6/12 isolates. Conclusions. Best results were obtained with the lipL32 PCR, which displayed a better sensitivity and a better capacity to detect different strains than the multiplex PCR. The secY primers showed a poor specificity to pathogenic species and a poor sensitivity. Thus, lipL32 primers show high potential for molecular diagnosis of Leptospira spp in clinical and environmental samples.
Directory of Open Access Journals (Sweden)
Marcos Roberto Buim
2009-07-01
Full Text Available Mycoplasmas are important avian pathogens, which cause respiratory and joint diseases that result in large economic losses in Brazilian and world-wide poultry industry. This investigation regarding the main species of mycoplasmas, Mycoplasma gallisepticum (MG and M. synoviae (MS, responsible for the above mentioned conditions, was carried out through PCR Multiplex analysis. One thousand and forty-six (1,046 samples of tracheal swabs and piped embryos were collected from 33 farms with laying hens, breeders, broilers or hatchery, located in the Brazilian states of São Paulo, Paraná and Pernambuco, where respiratory problems or drops in egg production had occurred. The MG and MS prevalence on the farms was 72.7%. These results indicated (1 high dissemination of mycoplasmas in the evaluated farms, with predominance of MS, either as single infectious agent or associated with other mycoplasmas in 20 farms (60.6%, and (2 an increase of MS and decrease of MG infection in Brazilian commercial poultry.Os Micoplasmas são importantes patógenos aviários que causam doenças respiratórias e de articulações que resultam em grandes perdas econômicas para a indústria avícola brasileira e mundial. O estudo das principais espécies de Mycoplasma, Mycoplasma gallisepticum (MG e M. synoviae (MS, responsáveis pelas doenças mencionadas acima, foram analisadas pela técnica de PCR Multiplex. Foram colhidas 1046 amostras de suabe traqueal e embriões bicados de 33 estabelecimentos de aves de postura, matrizes, frangos de corte e um incubatório, localizados nos Estados brasileiros de São Paulo, Paraná e Pernambuco, as quais apresentavam problemas respiratórios ou queda na produção de ovos. A prevalência de MS e MG nas granjas foi de 72,7%. Os resultados indicaram uma alta disseminação de Mycoplasma nas granjas avaliadas, com predominância de MS, como um único agente infeccioso ou associado com outros micoplasmas em 20 granjas (60,6%. Assim, este
Wilkinson, Ray; Wang, Xiangju; Kassianos, Andrew J.; Zuryn, Steven; Roper, Kathrein E.; Osborne, Andrew; Sampangi, Sandeep; Francis, Leo; Raghunath, Vishwas; Healy, Helen
2014-01-01
Interstitial fibrosis, a histological process common to many kidney diseases, is the precursor state to end stage kidney disease, a devastating and costly outcome for the patient and the health system. Fibrosis is historically associated with chronic kidney disease (CKD) but emerging evidence is now linking many forms of acute kidney disease (AKD) with the development of CKD. Indeed, we and others have observed at least some degree of fibrosis in up to 50% of clinically defined cases of AKD. Epithelial cells of the proximal tubule (PTEC) are central in the development of kidney interstitial fibrosis. We combine the novel techniques of laser capture microdissection and multiplex-tandem PCR to identify and quantitate “real time” gene transcription profiles of purified PTEC isolated from human kidney biopsies that describe signaling pathways associated with this pathological fibrotic process. Our results: (i) confirm previous in-vitro and animal model studies; kidney injury molecule-1 is up-regulated in patients with acute tubular injury, inflammation, neutrophil infiltration and a range of chronic disease diagnoses, (ii) provide data to inform treatment; complement component 3 expression correlates with inflammation and acute tubular injury, (iii) identify potential new biomarkers; proline 4-hydroxylase transcription is down-regulated and vimentin is up-regulated across kidney diseases, (iv) describe previously unrecognized feedback mechanisms within PTEC; Smad-3 is down-regulated in many kidney diseases suggesting a possible negative feedback loop for TGF-β in the disease state, whilst tight junction protein-1 is up-regulated in many kidney diseases, suggesting feedback interactions with vimentin expression. These data demonstrate that the combined techniques of laser capture microdissection and multiplex-tandem PCR have the power to study molecular signaling within single cell populations derived from clinically sourced tissue. PMID:24475278
Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka
2017-06-01
Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui
2016-11-22
Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.
A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.
Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin
2017-01-01
This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.
DEFF Research Database (Denmark)
Lundberg, Martin; Thorsen, Stine Buch; Assarsson, Erika
2011-01-01
A high throughput protein biomarker discovery tool has been developed based on multiplexed proximity ligation assays (PLA) in a homogeneous format in the sense of no washing steps. The platform consists of four 24-plex panels profiling 74 putative biomarkers with sub pM sensitivity each consuming...... sequences are united by DNA ligation upon simultaneous target binding forming a PCR amplicon. Multiplex PLA thereby converts multiple target analytes into real-time PCR amplicons that are individually quantificatied using microfluidic high capacity qPCR in nano liter volumes. The assay shows excellent...
Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.
Directory of Open Access Journals (Sweden)
Xiangdong Kong
Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.
Directory of Open Access Journals (Sweden)
Maryam Dehghani
2017-02-01
Full Text Available Background: AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods: 243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results: Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion: Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.
Directory of Open Access Journals (Sweden)
Chih-Ping Chen
2011-03-01
Conclusions: Prenatal diagnosis of major congenital malformations should alert one to the possibility of chromosomal abnormalities. Multiplex ligation-dependent probe amplification and aCGH have the advantage of rapid aneuploidy diagnosis of common aneuploidies in cases with major congenital malformations.
Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua
2009-03-01
A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.
Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.
Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A
2017-12-01
Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.
Mainil, J G; Bardiau, M; Ooka, T; Ogura, Y; Murase, K; Etoh, Y; Ichihara, S; Horikawa, K; Buvens, G; Piérard, D; Itoh, T; Hayashi, T
2011-09-01
This study evaluated a typing method of O26:H11 enterohaemorrhagic and enteropathogenic Escherichia coli (EHEC and EPEC) based on the variation in genomic location and copy numbers of IS621. Two multiplex PCRs, targeting either the left (5') or right (3') IS/chromosome junction of 12 IS621 insertion sites and one PCR specific of another truncated copy, were developed. Thirty-eight amplification profiles were observed amongst a collection of 69 human and bovine O26:H11 EHEC and EPEC. Seventy-one per cent of the 45 EHEC and EPEC with identical IS621 fingerprints within groups of two, three or four isolates had >85% pulsed field gel electrophoresis (PFGE) profile similarity, including four groups of epidemiologically related EHEC or EPEC, while most of the groups had identical IS621 fingerprints and PFGE profiles. The IS621 fingerprinting and the PFGE are complementary typing assays of EHEC and EPEC; though, the former is less discriminatory. The IS621 printing method represents a rapid (24 h) first-line surveillance and typing assay, to compare and trace back O26:H11 EHEC and EPEC during surveys in farms, multiple human cases and outbreaks. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology. No claim to Belgian Government works.
Directory of Open Access Journals (Sweden)
Eun Jeong Won
Full Text Available Intestinal parasitic diseases occur worldwide and can cause diarrhea or gastroenteritis; however, their diagnosis is quite difficult, especially in low-endemism countries. We developed a multiplex real-time PCR assay for detection of eight intestinal parasites and prospectively evaluated it for patients with gastroenteritis. The assay targeted Cryptosporidium parvum, Giardia lamblia, Entamoeba histolytica, Blastocystis hominis, Dientamoeba fragilis, Clonorchis sinensis, Metagonimus yokogawai, and Gymnophalloides seoi. Performance characteristics were evaluated based on recovery after DNA extraction, analytical sensitivity, specificity, reproducibility, cross-reactivity, and interference characteristics. Clinical performance was validated against microscopy on 123 diarrheal samples. The assay demonstrated strong correlations between DNA concentrations and Ct values (R2, 0.9924-0.9998, and had a high PCR efficiency (83.3%-109.5%. Polymerase chain reactions detected as few as 10-30 copies of genomic DNA, and coefficient of variance was 0-7%. There was no cross-reactivity to the other 54 microorganisms tested. Interference occurred only in presence of high concentrations of erythrocytes or leukocytes. This assay had a higher correct identification rate (100.0% vs. 90.2% and lower incorrect ID rate (0.0% vs. 9.8% when compared to microscopy. Overall, this assay showed a higher sensitivity (100.0%; 95% confidence interval [CI] of 80.5-100.0 than microscopy (29.4%; 95% CI 10.31-55.96, and the specificity levels were comparable for both methods (100.0%; 95% CI 96.58-100.0. This newly developed multiplex real-time PCR assay offers a potential use for detecting intestinal parasitic pathogens customized to the Korean population.
Watanabe, S; Melzer, M J
2017-04-01
The coconut rhinoceros beetle, Oryctes rhinoceros (L.), is a major pest of coconut and other palm trees. An incipient coconut rhinoceros beetle population was recently discovered on the island of Oahu, Hawaii and is currently the target of a large, mutiagency eradication program. Confounding this program is the widespread presence of another scarab beetle on Oahu, the oriental flower beetle, Protaetia orientalis (Gory and Percheron 1833). Eggs, early life stages, and fecal excrement of coconut rhinoceros beetle and oriental flower beetle are morphologically indistinguishable, thereby creating uncertainty when such specimens are discovered in the field. Here, we report the development of a multiplex PCR assay targeting cytochrome oxidase I of coconut rhinoceros beetle and oriental flower beetle that can rapidly detect and distinguish between these insects. This assay also features an internal positive control to ensure DNA of sufficient quantity and quality is used in the assay, increasing its reliability and reducing the chances of false negative results. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila
2015-01-01
Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich
1996-06-01
Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
Tegli, Stefania; Cerboneschi, Matteo; Libelli, Ilaria Marsili; Santilli, Elena
2010-05-28
Pseudomonas savastanoi pv. savastanoi is the causal agent of olive knot disease. The strains isolated from oleander and ash belong to the pathovars nerii and fraxini, respectively. When artificially inoculated, pv. savastanoi causes disease also on ash, and pv. nerii attacks also olive and ash. Surprisingly nothing is known yet about their distribution in nature on these hosts and if spontaneous cross-infections occur. On the other hand sanitary certification programs for olive plants, also including P. savastanoi, were launched in many countries. The aim of this work was to develop several PCR-based tools for the rapid, simultaneous, differential and quantitative detection of these P. savastanoi pathovars, in multiplex and in planta. Specific PCR primers and probes for the pathovars savastanoi, nerii and fraxini of P. savastanoi were designed to be used in End Point and Real-Time PCR, both with SYBR Green or TaqMan chemistries. The specificity of all these assays was 100%, as assessed by testing forty-four P. savastanoi strains, belonging to the three pathovars and having different geographical origins. For comparison strains from the pathovars phaseolicola and glycinea of P. savastanoi and bacterial epiphytes from P. savastanoi host plants were also assayed, and all of them tested always negative. The analytical detection limits were about 5 - 0.5 pg of pure genomic DNA and about 102 genome equivalents per reaction. Similar analytical thresholds were achieved in Multiplex Real-Time PCR experiments, even on artificially inoculated olive plants. Here for the first time a complex of PCR-based assays were developed for the simultaneous discrimination and detection of P. savastanoi pv. savastanoi, pv. nerii and pv. fraxini. These tests were shown to be highly reliable, pathovar-specific, sensitive, rapid and able to quantify these pathogens, both in multiplex reactions and in vivo. Compared with the other methods already available for P. savastanoi, the identification
[Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].
Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi
2009-11-01
We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira
2013-05-27
Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.
A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2.
Gatto, Francesca; Cassina, Giulia; Broccolo, Francesco; Morreale, Giuseppe; Lanino, Edoardo; Di Marco, Eddi; Vardas, Efthiya; Bernasconi, Daniela; Buttò, Stefano; Principi, Nicola; Esposito, Susanna; Scarlatti, Gabriella; Lusso, Paolo; Malnati, Mauro S
2011-12-01
Accurate and highly sensitive tests for the diagnosis of active Epstein-Barr virus (EBV) infection are essential for the clinical management of individuals infected with EBV. A calibrated quantitative real-time PCR assay for the measurement of EBV DNA of both EBV-1 and 2 subtypes was developed, combining the detection of the EBV DNA and a synthetic DNA calibrator in a multiplex PCR format. The assay displays a wide dynamic range and a high degree of accuracy even in the presence of 1μg of human genomic DNA. This assay measures with the same efficiency EBV DNA from strains prevalent in different geographic areas. The clinical sensitivity and specificity of the system were evaluated by testing 181 peripheral blood mononuclear cell (PBMCs) and plasma specimens obtained from 21 patients subjected to bone marrow transplantation, 70 HIV-seropositive subjects and 23 healthy controls. Patients affected by EBV-associated post-transplant lymphoprolipherative disorders had the highest frequency of EBV detection and the highest viral load. Persons infected with HIV had higher levels of EBV DNA load in PBMCs and a higher frequency of EBV plasma viremia compared to healthy controls. In conclusion, this new assay provides a reliable high-throughput method for the quantitation of EBV DNA in clinical samples. Copyright © 2011 Elsevier B.V. All rights reserved.
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
A rapid and direct real time PCR-based method for identification of Salmonella spp
DEFF Research Database (Denmark)
Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.
2003-01-01
The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...
Liang, Fang; Browne, Daniel J; Gray, Megan J; Gartlan, Kate H; Smith, David D; Barnard, Ross T; Hill, Geoffrey R; Corrie, Simon R; Markey, Kate A
2018-05-11
Bloodstream infection is a significant clinical problem, particularly in vulnerable patient groups such as those undergoing chemotherapy and bone marrow transplantation. Clinical diagnostics for suspected bloodstream infection remain centered around blood culture (highly variable timing, in the order of hours to days to become positive), and empiric use of broad-spectrum antibiotics is therefore employed for patients presenting with febrile neutropenia. Gram-typing provides the first opportunity to target therapy (e.g., combinations containing vancomycin or teicoplanin for Gram-positives; piperacillin-tazobactam or a carbapenem for Gram-negatives); however, current approaches require blood culture. In this study, we describe a multiplexed microsphere-PCR assay with flow cytometry readout, which can distinguish Gram-positive from Gram-negative bacterial DNA in a 3.5 h time period. The combination of a simple assay design (amplicon-dependent release of Gram-type specific Cy3-labeled oligonucleotides) and the Luminex-based readout (for quantifying each specific Cy3-labeled sequence) opens opportunities for further multiplexing. We demonstrate the feasibility of detecting common Gram-positive and Gram-negative organisms after spiking whole bacteria into healthy human blood prior to DNA extraction. Further development of DNA extraction methods is required to reach detection limits comparable to blood culture.
Cura, Carolina I.; Duffy, Tomas; Lucero, Raúl H.; Bisio, Margarita; Péneau, Julie; Jimenez-Coello, Matilde; Calabuig, Eva; Gimenez, María J.; Valencia Ayala, Edward; Kjos, Sonia A.; Santalla, José; Mahaney, Susan M.; Cayo, Nelly M.; Nagel, Claudia; Barcán, Laura; Málaga Machaca, Edith S.; Acosta Viana, Karla Y.; Brutus, Laurent; Ocampo, Susana B.; Aznar, Christine; Cuba Cuba, Cesar A.; Gürtler, Ricardo E.; Ramsey, Janine M.; Ribeiro, Isabela; VandeBerg, John L.; Yadon, Zaida E.; Osuna, Antonio; Schijman, Alejandro G.
2015-01-01
Background Trypanosoma cruzi has been classified into six Discrete Typing Units (DTUs), designated as TcI–TcVI. In order to effectively use this standardized nomenclature, a reproducible genotyping strategy is imperative. Several typing schemes have been developed with variable levels of complexity, selectivity and analytical sensitivity. Most of them can be only applied to cultured stocks. In this context, we aimed to develop a multiplex Real-Time PCR method to identify the six T. cruzi DTUs using TaqMan probes (MTq-PCR). Methods/Principal Findings The MTq-PCR has been evaluated in 39 cultured stocks and 307 biological samples from vectors, reservoirs and patients from different geographical regions and transmission cycles in comparison with a multi-locus conventional PCR algorithm. The MTq-PCR was inclusive for laboratory stocks and natural isolates and sensitive for direct typing of different biological samples from vectors, reservoirs and patients with acute, congenital infection or Chagas reactivation. The first round SL-IR MTq-PCR detected 1 fg DNA/reaction tube of TcI, TcII and TcIII and 1 pg DNA/reaction tube of TcIV, TcV and TcVI reference strains. The MTq-PCR was able to characterize DTUs in 83% of triatomine and 96% of reservoir samples that had been typed by conventional PCR methods. Regarding clinical samples, 100% of those derived from acute infected patients, 62.5% from congenitally infected children and 50% from patients with clinical reactivation could be genotyped. Sensitivity for direct typing of blood samples from chronic Chagas disease patients (32.8% from asymptomatic and 22.2% from symptomatic patients) and mixed infections was lower than that of the conventional PCR algorithm. Conclusions/Significance Typing is resolved after a single or a second round of Real-Time PCR, depending on the DTU. This format reduces carryover contamination and is amenable to quantification, automation and kit production. PMID:25993316
Gopaul, Krishna K; Sells, Jessica; Lee, Robin; Beckstrom-Sternberg, Stephen M; Foster, Jeffrey T; Whatmore, Adrian M
2014-12-11
The zoonosis brucellosis causes economically significant reproductive problems in livestock and potentially debilitating disease of humans. Although the causative agent, organisms from the genus Brucella, can be differentiated into a number of species based on phenotypic characteristics, there are also significant differences in genotype that are concordant with individual species. This paper describes the development of a five target multiplex assay to identify five terrestrial Brucella species using real-time polymerase chain reaction (PCR) and subsequent high resolution melt curve analysis. This technology offers a robust and cost effective alternative to previously described hydrolysis-probe Single Nucleotide Polymorphism (SNP)-based species defining assays. Through the use of Brucella whole genome sequencing five species defining SNPs were identified. Individual HRM assays were developed to these target these changes and, following optimisation of primer concentrations, it was possible to multiplex all five assays in a single tube. In a validation exercise using a panel of 135 Brucella strains of terrestrial and marine origin, it was possible to distinguish the five target species from the other species within this panel. The HRM multiplex offers a number of diagnostic advantages over previously described SNP-based typing approaches. Further, and uniquely for HRM, the successful multiplexing of five assays in a single tube allowing differentiation of five Brucella species in the diagnostic laboratory in a cost-effective and timely manner is described. However there are possible limitations to using this platform on DNA extractions direct from clinical material.
A rapid method for screening arrayed plasmid cDNA library by PCR
International Nuclear Information System (INIS)
Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong
1999-01-01
Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency
DEFF Research Database (Denmark)
Nyvold, Charlotte G; Bendix, Knud; Brandsborg, Margrethe
2007-01-01
prospectively been evaluated. Eleven patients (4%) were found t(11;14)+ and 37 patients (14%) t(14;18)+. Comparing these results to standard diagnostic methods of PB and/or BM identified PCR+ samples that were normal by morphology (BCL-1/IGH: 1/11; BCL-2/IGH: 17/37). Equally important, patients who were......We have designed a multiplex PCR, which allows for fast and high throughput demonstration of the BCL-1/IGH and BCL-2/IGH fusion DNA observed primarily in mantle cell- and follicular non-Hodgkin's lymphoma (NHL). Blood (PB) and/or bone marrow (BM) from 258 patients suspected of NHL have...... not clonal in PB and/or BM by flow cytometry were identified as PCR+ (BCL-1/IGH: 3/11; BCL-2/IGH: 23/37). We conclude that this multiplex approach allows for easy and sensitive molecular determination of molecular lesions in NHL, which have diagnostic and prognostic importance. Udgivelsesdato: 2007-null...
PCR specific for Actinobacillus pleuropneumoniae serotype 3
DEFF Research Database (Denmark)
Zhou, L.; Jones, S.C.P.; Angen, Øystein
2008-01-01
, but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...
Zarei, Mehdi; Maktabi, Siavash; Ghorbanpour, Masoud
2012-02-01
Although several etiological agents can be transmitted through seafood consumption, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. are considered among the most important pathogens in terms of public health and disease. In this study, multiplex polymerase chain reaction (PCR), as a rapid and cost-effective method, was used to determine the prevalence of these pathogens in 245 samples of raw/fresh, frozen, and ready-to-eat (RTE) seafood products marketed in Iran. The prevalence of L. monocytogenes in raw/fresh fish and shrimp samples was 1.4%, whereas 2.9% of the raw/fresh fish and 7.1% of the shrimp samples were contaminated with V. parahaemolyticus. No contamination with L. monocytogenes and V. parahaemolyticus was found in frozen and RTE seafood products. The prevalence of S. aureus was found to be higher than other investigated pathogens. S. aureus was detected in 5% of the raw/fresh samples of fish and shrimp, 17.5% of the frozen, and 12.3% of the RTE samples. Further, our findings indicate that 2.9% of the fish samples, 4.3% of the shrimp samples, and 1.5% of the RTE samples were contaminated with Salmonella spp. Owing to the potential hazard of these pathogenic bacteria, multiplex PCR can provide a rapid and cost-effective method for the surveillance of these pathogens in seafood products.
A rapid PCR-based approach for molecular identification of filamentous fungi.
Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang
2011-08-01
In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin
2016-05-01
Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy
2007-01-01
PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939
Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N
2008-06-01
We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.
Directory of Open Access Journals (Sweden)
Brisabois Anne
2011-06-01
Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.
Directory of Open Access Journals (Sweden)
Bettina Stieber
Full Text Available S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins.In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays.110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate.The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers.
Directory of Open Access Journals (Sweden)
C. Latha
2017-08-01
Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.
Directory of Open Access Journals (Sweden)
Sangmi Kim
Full Text Available Studies examining the association between telomere length and cancer risk have often relied on measurement of telomere length from a single blood draw using a real-time PCR technique. We examined the reliability of telomere length measurement using sequential samples collected over a 9-month period.Relative telomere length in peripheral blood was estimated using a single tube monochrome multiplex quantitative PCR assay in blood DNA samples from 27 non-pregnant adult women (aged 35 to 74 years collected in 7 visits over a 9-month period. A linear mixed model was used to estimate the components of variance for telomere length measurements attributed to variation among women and variation between time points within women. Mean telomere length measurement at any single visit was not significantly different from the average of 7 visits. Plates had a significant systematic influence on telomere length measurements, although measurements between different plates were highly correlated. After controlling for plate effects, 64% of the remaining variance was estimated to be accounted for by variance due to subject. Variance explained by time of visit within a subject was minor, contributing 5% of the remaining variance.Our data demonstrate good short-term reliability of telomere length measurement using blood from a single draw. However, the existence of technical variability, particularly plate effects, reinforces the need for technical replicates and balancing of case and control samples across plates.
Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette
2009-06-01
Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.
Identification of periodontopathogen microorganisms by PCR technique
Directory of Open Access Journals (Sweden)
Milićević Radovan
2008-01-01
Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks
Directory of Open Access Journals (Sweden)
Hiroshi Fukushima
2009-01-01
Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.
Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N
2017-09-01
Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.
Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R
2011-09-01
In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.
Molecular beacon probes-base multiplex NASBA Real-time for detection of HIV-1 and HCV.
Mohammadi-Yeganeh, S; Paryan, M; Mirab Samiee, S; Kia, V; Rezvan, H
2012-06-01
Developed in 1991, nucleic acid sequence-based amplification (NASBA) has been introduced as a rapid molecular diagnostic technique, where it has been shown to give quicker results than PCR, and it can also be more sensitive. This paper describes the development of a molecular beacon-based multiplex NASBA assay for simultaneous detection of HIV-1 and HCV in plasma samples. A well-conserved region in the HIV-1 pol gene and 5'-NCR of HCV genome were used for primers and molecular beacon design. The performance features of HCV/HIV-1 multiplex NASBA assay including analytical sensitivity and specificity, clinical sensitivity and clinical specificity were evaluated. The analysis of scalar concentrations of the samples indicated that the limit of quantification of the assay was beacon probes detected all HCV genotypes and all major variants of HIV-1. This method may represent a relatively inexpensive isothermal method for detection of HIV-1/HCV co-infection in monitoring of patients.
Directory of Open Access Journals (Sweden)
Touseef Hussain
2018-05-01
Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.
Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt
2017-10-07
We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...
Directory of Open Access Journals (Sweden)
Law eJodi Woan-Fei
2015-01-01
Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.
LENUS (Irish Health Repository)
O'Leary, James
2009-11-01
The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.
RAPID DETECTION OF -THALASSEMIA MUTATIONS IN THAILAND USING MULTIPLEX ARMS
Directory of Open Access Journals (Sweden)
D. Shimbhu
2017-11-01
Full Text Available The number of mutations underlining b-thalassemia generate a wide variety of different clinical phenotypes. An understanding of the genotype is important for medical personnel in order to provide proper counseling to patients and their families. Characterization of these mutations should aid the planning of a prenatal diagnosis program for bthalassemia. The heterogeneity of the mutations makes it difficult and time consuming to identify the mutation in some individuals. We developed a single-tube multiplex amplification refractory mutation system (multiplex ARMS to identify common ethnic- specific b-thalassemia mutations. Confirmation of multiplex ARMS results was carried out using direct sequencing. Three thousand three hundred twenty two people from Phitsanulok province were screened for the b-thalassemia trait by quantitation of HbA2 with microcolumn chromatography and the genotypes of mutations were characterized using multiplex ARMS and direct sequencing. We found that the deletion at codons 41/42 (-TCTT was the most frequent (48%, codon 17 (A®T (30%, -28 (A®G (6% and IVS-I-1(G®T (6% were the second and third in frequency respectively. A -87 (C®A mutation (4%, IVS II-654 (C®T (2%, codons 71/72 (+A (2% and codon 35 (C®A mutations (2% were also found. These techniques were found to be a valuable tool for analysis of b-thalassemia mutations because they are accurate, simple, and speedy in operation. The application for the diagnosis of severe thalassemia in high-risk pregnancies is promising.
Rumyantseva, Tatiana; Golparian, Daniel; Nilsson, Christian S; Johansson, Emma; Falk, My; Fredlund, Hans; Van Dam, Alje; Guschin, Alexander; Unemo, Magnus
2015-10-01
In this study, we performed an evaluation of the new CE-marked multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay compared to APTIMA tests, i.e., APTIMA COMBO 2 assay, APTIMA Trichomonas vaginalis assay (FDA-approved), and two different APTIMA Mycoplasma genitalium assays (research use only; one of them only used for discrepancy analysis). Vaginal swabs (n = 209) and first-void urine (FVU) specimens from females (n = 498) and males (n = 554), consecutive attendees (n = 1261) at a dermatovenerological clinic in Sweden, were examined. The sensitivity of the AmpliSens PCR assay for detection of C. trachomatis (6.3% prevalence), M. genitalium (5.7% prevalence), N. gonorrhoeae (0.3% prevalence), and T. vaginalis (0.08% prevalence) was 97.5% (95% confidence interval (CI): 91.2-99.6%), 81.9% (95% CI: 70.7-89.7%), 100% (95% CI: 40.2-100%) and 100% (95% CI: 16.5-100%), respectively. The specificity of the AmpliSens PCR assay was 100% (95% CI: 99.6-100%) for all agents. The analytical sensitivity and specificity for N. gonorrhoeae detection was excellent, i.e., 55 international gonococcal strains detected and 135 isolates of 13 non-gonococcal Neisseria species were negative. In conclusion, the multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay demonstrated high sensitivity and excellent specificity for the detection of C. trachomatis, N. gonorrhoeae, and T. vaginalis, and excellent specificity but suboptimal sensitivity for M. genitalium detection. © 2015 APMIS. Published by John Wiley & Sons Ltd.
Elges, Sandra; Arnold, Renate; Liesenfeld, Oliver; Kofla, Grzegorz; Mikolajewska, Agata; Schwartz, Stefan; Uharek, Lutz; Ruhnke, Markus
2017-12-01
We prospectively evaluated a multiplex real-time PCR assay (SeptiFast, SF) in a cohort of patients undergoing allo-BMT in comparison to an in-house PCR method (IH-PCR). Overall 847 blood samples (mean 8 samples/patient) from 104 patients with haematological malignancies were analysed. The majority of patients had acute leukaemia (62%) with a mean age of 52 years (54% female). Pathogens could be detected in 91 of 847 (11%) samples by SF compared to 38 of 205 (18.5%) samples by BC, and 57 of 847 (6.7%) samples by IH-PCR. Coagulase-negative staphylococci (n=41 in SF, n=29 in BC) were the most frequently detected bacteria followed by Escherichia coli (n=9 in SF, n=6 in BC). Candida albicans (n=17 in SF, n=0 in BC, n=24 in IH-PCR) was the most frequently detected fungal pathogen. SF gave positive results in 5% of samples during surveillance vs in 26% of samples during fever episodes. Overall, the majority of blood samples gave negative results in both PCR methods resulting in 93% overall agreement resulting in a negative predictive value of 0.96 (95% CI: 0.95-0.97), and a positive predictive value of 0.10 (95% CI: -0.01 to 0.21). SeptiFast appeared to be superior over BC and the IH-PCR method. © 2017 Blackwell Verlag GmbH.
A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.
2000-01-01
Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130
Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O
2017-10-01
Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.
Orlov, Alexey V; Znoyko, Sergey L; Cherkasov, Vladimir R; Nikitin, Maxim P; Nikitin, Petr I
2016-11-01
We present a multiplex quantitative lateral flow (LF) assay for simultaneous on-site detection of botulinum neurotoxin (BoNT) types A, B, and E in complex matrixes, which is innovative by virtually no sacrifice in performance while transition from the single-plex assays and by characteristics on the level of laboratory quantitative methods. The novel approach to easy multiplexing is realized via joining an on-demand set of single-plex LF strips, which employ magnetic nanolabels, into a miniature cylinder cartridge that mimics LF strip during all assay stages. The cartridge is read out by an original portable multichannel reader based on the magnetic particle quantification technique. The developed reader offers the unmatched 60 zmol detection limit and 7-order linear dynamic range for volumetric registration of magnetic labels inside a cartridge of several millimeters in diameter regardless of its optical transparency. Each of the test strips, developed here as building blocks for the multiplex assay, can be used "as is" for autonomous quantitative single-plex detection with the same measuring setup, exhibiting the limits of detection (LOD) of 0.22, 0.11, and 0.32 ng/mL for BoNT-A, -B, and -E, respectively. The proposed multiplex assay has demonstrated the remarkably similar LOD values of 0.20, 0.12, 0.35 ng/mL under the same conditions. The multiplex assay performance was successfully validated by BoNT detection in milk and apple and orange juices. The developed methods can be extended to other proteins and used for rapid multianalyte tests for point-of-care in vitro diagnostics, food analysis, biosafety and environmental monitoring, forensics, and security, etc.
Lu, Xuedong; Nie, Shuping; Xia, Chengjing; Huang, Lie; He, Ying; Wu, Runxiang; Zhang, Li
2014-07-01
Aiming to identify macrolide and beta-lactam resistance in clinical bacterial isolates rapidly and accurately, a two-step algorithm was developed based on detection of eight antibiotic resistance genes. Targeting at genes linked to bacterial macrolide (msrA, ermA, ermB, and ermC) and beta-lactam (blaTEM, blaSHV, blaCTX-M-1, blaCTX-M-9) antibiotic resistances, this method includes a multiplex real-time PCR, a melting temperature profile analysis as well as a liquid bead microarray assay. Liquid bead microarray assay is applied only when indistinguishable Tm profile is observed. The clinical validity of this method was assessed on clinical bacterial isolates. Among the total 580 isolates that were determined by our diagnostic method, 75% of them were identified by the multiplex real-time PCR with melting temperature analysis alone, while the remaining 25% required both multiplex real-time PCR with melting temperature analysis and liquid bead microarray assay for identification. Compared with the traditional phenotypic antibiotic susceptibility test, an overall agreement of 81.2% (kappa=0.614, 95% CI=0.550-0.679) was observed, with a sensitivity and specificity of 87.7% and 73% respectively. Besides, the average test turnaround time is 3.9h, which is much shorter in comparison with more than 24h for the traditional phenotypic tests. Having the advantages of the shorter operating time and comparable high sensitivity and specificity with the traditional phenotypic test, our two-step algorithm provides an efficient tool for rapid determination of macrolide and beta-lactam antibiotic resistances in clinical bacterial isolates. Copyright © 2014 Elsevier B.V. All rights reserved.
Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis
2014-06-01
Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.
Bliem, Rupert; Reischer, Georg; Linke, Rita; Farnleitner, Andreas; Kirschner, Alexander
2018-06-01
In recent years, global warming has led to a growing number of Vibrio cholerae infections in bathing water users in regions formerly unaffected by this pathogen. It is therefore of high importance to monitor V. cholerae in aquatic environments and to elucidate the main factors governing its prevalence and abundance. For this purpose, rapid and standardizable methods that can be performed by routine water laboratories are prerequisite. In this study, we applied a recently developed multiplex quantitative PCR (qPCR) strategy (i) to monitor the spatiotemporal variability of V. cholerae abundance in two small soda pools and a large lake that is intensively used for recreation and (ii) to elucidate the main factors driving V. cholerae dynamics in these environments. V. cholerae was detected with qPCR at high concentrations of up to 970,000 genomic units 100 ml -1 during the warm season, up to 2 orders of magnitude higher than values obtained by cultivation. An independent cytometric approach led to results comparable to qPCR data but with significantly more positive samples due to problems with DNA recovery for qPCR. Not a single sample was positive for toxigenic V. cholerae , indicating that only nontoxigenic V. cholerae (NTVC) was present. Temperature was the main predictor of NTVC abundance, but the quality and quantity of dissolved organic matter were also important environmental correlates. Based on this study, we recommend using the developed qPCR strategy for quantification of toxigenic and nontoxigenic V. cholerae in bathing waters with the need for improvements in DNA recovery. IMPORTANCE There is a definitive need for rapid and standardizable methods to quantify waterborne bacterial pathogens. Such methods have to be thoroughly tested for their applicability to environmental samples. In this study, we critically tested a recently developed multiplex qPCR strategy for its applicability to determine the spatiotemporal variability of V. cholerae abundance in
McClure, Jo-Ann; Zaal DeLongchamp, Johanna; Conly, John M; Zhang, Kunyan
2017-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a clinically significant pathogen that is resistant to a wide variety of antibiotics and responsible for a large number of nosocomial infections worldwide. The Agency for Healthcare Research and Quality and the Centers for Disease Control and Prevention recently recommended the adoption of universal mupirocin-chlorhexidine decolonization of all admitted intensive care unit patients rather than MRSA screening with targeted treatments, which raises a serious concern about the selection of resistance to mupirocin and chlorhexidine in strains of staphylococci. Thus, a simple, rapid, and reliable approach is paramount in monitoring the prevalence of resistance to these agents. We developed a simple multiplex PCR assay capable of screening Staphylococcus isolates for the presence of antiseptic resistance genes for chlorhexidine and quaternary ammonium compounds, as well as mupirocin and methicillin resistance genes, while simultaneously discriminating S. aureus from coagulase-negative staphylococci (CoNS). The assay incorporates 7 PCR targets, including the Staphylococcus 16S rRNA gene (specifically detecting Staphylococcus spp.), nuc (distinguishing S. aureus from CoNS), mecA (distinguishing MRSA from methicillin-susceptible S. aureus ), mupA and mupB (identifying high-level mupirocin resistance), and qac and smr (identifying chlorhexidine and quaternary ammonium resistance). Our assay demonstrated 100% sensitivity, specificity, and accuracy in a total of 23 variant antiseptic- and/or antibiotic-resistant control strains. Further validation of our assay using 378 randomly selected and previously well-characterized local clinical isolates confirmed its feasibility and practicality. This may prove to be a useful tool for multidrug-resistant Staphylococcus monitoring in clinical laboratories, particularly in the wake of increased chlorhexidine and mupirocin treatments. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Kang Feng-feng
2012-03-01
Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.
Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens
Directory of Open Access Journals (Sweden)
Mehmet Sarıer
2017-03-01
Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion
A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.
Govan, V A; Brözel, V; Allsopp, M H; Davison, S
1998-05-01
Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.
Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars
Directory of Open Access Journals (Sweden)
Ramadass P
2002-01-01
Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.
DEFF Research Database (Denmark)
Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz
2016-01-01
Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission...... of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity...... of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two...
Ertas, Nurhan; Gonulalan, Zafer; Yildirim, Yeliz; Kum, Erhan
2010-08-15
The aim of this study was to investigate the presence of Staphylococcus aureus (S. aureus) and staphylococcal enterotoxins (SEs) genes in sheep cheese and dairy dessert samples by multiplex PCR (mPCR) technique. A total of 150 samples were analyzed consisting of 50 dairy dessert samples and 100 sheep cheese. Coagulase positive staphylococci (CPS) were found in 86 (57.3%) out of 150 analyzed samples. S. aureus were isolated from 60 (60%), 26 (52%) of sheep cheese and from of dairy desserts, respectively. Five suspected colonies were tested from each sheep cheese and dairy dessert samples for phenotypic and genotypic characterizations. A total of 430 isolates from the 86 positive samples were investigated in this study. Eighty (18.6%) isolates were characterized as S. aureus. The enterotoxin genes (sea, seb, sec, sed) were found in 13 (3.02%) out of 80 isolates. From cheese isolates, sea, seb and sed were detected in 5 (1.6%), 2 (0.6%), 1 (0.3%), respectively. From dairy dessert isolates, sea, sec and sed were detected in 3 (2.3%), 1 (0.76%), 1 (0.76%), respectively. The presence of SEs was identified in 12 (2.8%) out of 80 isolates by using ELISA technique. It was determined that these SEs had a distribution of 7 (1.6%) SEA, 2 (0.46%) SEB, 1 (0.23%) SEC, and 2 (0.46%) SED. SEs were found in 7 (2.3%) cheese and 5 (3.8%) dairy dessert isolates. In conclusion, S.aureus and their SEs were found to be present in sheep cheese and dairy desserts in this study. It is emphasized that the presence of S. aureus and their SEs genes in sheep cheese and dairy desserts may be regarded as a potential risk for human health. Copyright 2010 Elsevier B.V. All rights reserved.
A novel IPTV program multiplex access system to EPON
Xu, Xian; Liu, Deming; He, Wei; Lu, Xi
2007-11-01
With the rapid development of high speed networks, such as Ethernet Passive Optical Network (EPON), traffic patterns in access networks have evolved from traditional text-oriented service to the mixed text-, voice- and video- based services, leading to so called "Triple Play". For supporting IPTV service in EPON access network infrastructure, in this article we propose a novel IPTV program multiplex access system to EPON, which enables multiple IPTV program source servers to seamlessly access to IPTV service access port of optical line terminal (OLT) in EPON. There are two multiplex schemes, namely static multiplex scheme and dynamic multiplex scheme, in implementing the program multiplexing. Static multiplex scheme is to multiplex all the IPTV programs and forward them to the OLT, regardless of the need of end-users. While dynamic multiplex scheme can dynamically multiplex and forward IPTV programs according to what the end-users actually demand and those watched by no end-user would not be multiplexed. By comparing these two schemes, a reduced traffic of EPON can be achieved by using dynamic multiplex scheme, especially when most end-users are watching the same few IPTV programs. Both schemes are implemented in our system, with their hardware and software designs described.
Singh, Prashant; Mustapha, Azlin
2015-12-23
Shiga toxin-producing Escherichia coli (STEC) are pathogenic strains of E. coli that can cause bloody diarrhea and kidney failure. Seven STEC serogroups, O157, O26, O45, O103, O111, O121 and O145 are responsible for more than 71% of the total infections caused by this group of pathogens. All seven serogroups are currently considered as adulterants in non-intact beef products in the U.S. In this study, two multiplex melt curve real-time PCR assays with internal amplification controls (IACs) were standardized for the detection of eight STEC serogroups. The first multiplex assay targeted E. coli serogroups O145, O121, O104, and O157; while the second set detected E. coli serogroups O26, O45, O103 and O111. The applicability of the assays was tested using 11 different meat and produce samples. For food samples spiked with a cocktail of four STEC serogroups with a combined count of 10 CFU/25 g food, all targets of the multiplex assays were detected after an enrichment period of 6h. The assays also worked efficiently when 325 g of food samples were spiked with 10 CFU of STECs. The assays are not dependent on fluorescent-labeled probes or immunomagnetic beads, and can be used for the detection of eight STEC serogroups in less than 11h. Routine preliminary screening of STECs in food samples is performed by testing for the presence of STEC virulence genes. The assays developed in this study can be useful as a first- or second-tier test for the identification of the eight O serogroup-specific genes in suspected food samples. Copyright © 2015. Published by Elsevier B.V.
Liu, Junlong; Guan, Guiquan; Liu, Aihong; Li, Youquan; Yin, Hong; Luo, Jianxun
2014-03-01
In this study, two pairs of oligonucleotide primers were designed according to the nucleotide sequence of the internal transcribed spacers (ITSs) of Babesia bigemina and B. bovis isolates from China. The primers were used in a multiplex PCR to detect parasite DNA in blood samples from cattle. There was no cross reactions with B. ovata, B. major, B. sp. Kashi, Theileria annulata, T. sergenti, T. sinensis or normal bovine DNA. The sensitivity of multiplex PCR assay was 1 pg and 10 pg DNA for B. bigemina and B. bovis, respectively. A total of 260 field blood samples collected from cattle in five provinces of China were analyzed by multiplex PCR and light microscopy. PCR testing revealed that 7.3% (19/260) and 5.8% (15/260) of cattle were positive for B. bigemina and B. bovis and 1.2% (3/260) of cattle were co-infected with B. bigemina and B. bovis. Using light microscopy, 2.3% (6/260) and 1.5% (4/260) of cattle were infected by B. bigemina and B. bovis, respectively, and no co-infection was found. The results showed that the multiplex PCR developed in the present study could be an alternative diagnostic tool for the detection of B. bovis and B. bigemina infection in cattle.
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Directory of Open Access Journals (Sweden)
Kirill V Sergueev
Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.
Monitoring bacterial faecal contamination in waters using multiplex ...
African Journals Online (AJOL)
Monitoring of sanitary quality or faecal pollution in water is currently based on quantifying some bacterial indicators such as Escherichia coli and faecal enterococci. Using a multiplex real-time PCR assay for faecal enterococci and Bacteroides spp., the detection of faecal contamination in non-treated water can be done in a ...
Validation of the performance of a GMO multiplex screening assay based on microarray detection
Leimanis, S.; Hamels, S.; Naze, F.; Mbongolo, G.; Sneyers, M.; Hochegger, R.; Broll, H.; Roth, L.; Dallmann, K.; Micsinai, A.; Dijk, van J.P.; Kok, E.J.
2008-01-01
A new screening method for the detection and identification of GMO, based on the use of multiplex PCR followed by microarray, has been developed and is presented. The technology is based on the identification of quite ubiquitous GMO genetic target elements first amplified by PCR, followed by direct
Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR
Directory of Open Access Journals (Sweden)
Van Esbroeck Marjan
2011-03-01
Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the
Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K
2011-07-01
The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. © 2011 American Academy of Forensic Sciences.
Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu
2017-10-27
Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.
Wan, Weijie; Yeow, John T W
2012-04-01
This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.
Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S
2012-08-01
Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.
Multiplex polymerase chain reaction (PCR) and fluorescence-based ...
African Journals Online (AJOL)
reading 7
2011-12-28
Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.
Energy Technology Data Exchange (ETDEWEB)
Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B
2007-08-06
Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis
Directory of Open Access Journals (Sweden)
Qureshi Nasib
2006-05-01
Full Text Available Abstract Background The field of plasmid-based functional proteomics requires the rapid assay of proteins expressed from plasmid libraries. Automation is essential since large sets of mutant open reading frames are being cloned for evaluation. To date no integrated automated platform is available to carry out the entire process including production of plasmid libraries, expression of cloned genes, and functional testing of expressed proteins. Results We used a functional proteomic assay in a multiplexed setting on an integrated plasmid-based robotic workcell for high-throughput screening of mutants of cellulase F, an endoglucanase from the anaerobic fungus Orpinomyces PC-2. This allowed us to identify plasmids containing optimized clones expressing mutants with improved activity at lower pH. A plasmid library of mutagenized clones of the celF gene with targeted variations in the last four codons was constructed by site-directed PCR mutagenesis and transformed into Escherichia coli. A robotic picker integrated into the workcell was used to inoculate medium in a 96-well deep well plate, combining the transformants into a multiplexed set in each well, and the plate was incubated on the workcell. Plasmids were prepared from the multiplexed culture on the liquid handler component of the workcell and used for in vitro transcription/translation. The multiplexed expressed recombinant proteins were screened for improved activity and stability in an azo-carboxymethylcellulose plate assay. The multiplexed wells containing mutants with improved activity were identified and linked back to the corresponding multiplexed cultures stored in glycerol. Spread plates were prepared from the glycerol stocks and the workcell was used to pick single colonies from the spread plates, prepare plasmid, produce recombinant protein, and assay for activity. The screening assay and subsequent deconvolution of the multiplexed wells resulted in identification of improved Cel
Escherichia coli H-Genotyping PCR: a Complete and Practical Platform for Molecular H Typing.
Banjo, Masaya; Iguchi, Atsushi; Seto, Kazuko; Kikuchi, Taisei; Harada, Tetsuya; Scheutz, Flemming; Iyoda, Sunao
2018-06-01
In Escherichia coli , more than 180 O groups and 53 H types have been recognized. The O:H serotyping of E. coli strains is an effective method for identifying strains with pathogenic potential and classifying them into clonal groups. In particular, the serotyping of Shiga toxin-producing E. coli (STEC) strains provides valuable information to evaluate the routes, sources, and prevalence of agents in outbreak investigations and surveillance. Here, we present a complete and practical PCR-based H-typing system, E. coli H-genotyping PCR, consisting of 10 multiplex PCR kits with 51 single PCR primer pairs. Primers were designed based on a detailed comparative analysis of sequences from all H-antigen (flagellin)-encoding genes, fliC and its homologs. The specificity of this system was confirmed by using all H type reference strains. Additionally, 362 serotyped wild strains were also used to evaluate its practicality. All 277 H-type-identified isolates gave PCR products that corresponded to the results of serological H typing. Moreover, 76 nonmotile and nine untypeable strains could be successfully subtyped into any H type by the PCR system. The E. coli H-genotyping PCR developed here allows broader, rapid, and low-cost subtyping of H types and will assist epidemiological studies as well as surveillance of pathogenic E. coli . Copyright © 2018 American Society for Microbiology.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.
Weßling, Ralf; Panstruga, Ralph
2012-08-31
The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.
Meggiolaro, Maira N; Ly, Anna; Rysnik-Steck, Benjamin; Silva, Carolina; Zhang, Joshua; Higgins, Damien P; Muscatello, Gary; Norris, Jacqueline M; Krockenberger, Mark; Šlapeta, Jan
2017-06-01
Canine parvovirus (CPV-2) remains an important cause of devastating enteritis in young dogs. It can be successfully prevented with live attenuated CPV-2 vaccines when given at the appropriate age and in the absence of maternal antibody interference. Rapid diagnosis of parvoviral enteritis in young dogs is essential to ensuring suitable barrier nursing protocols within veterinary hospitals. The current diagnostic trend is to use multiplexed PCR panels to detect an array of pathogens commonly responsible for diarrhea in dogs. The multiplexed PCR assays do not distinguish wild from vaccine CPV-2. They are highly sensitive and detect even a low level of virus shedding, such as those caused by the CPV-2 vaccine. The aim of this study was to identify the CPV-2 subtypes detected in diagnostic specimens and rule out occult shedding of CPV-2 vaccine strains. For a total of 21 samples that tested positive for CPV-2 in a small animal fecal pathogens diagnostic multiplexed tandem PCR (MT-PCR) panel during 2014-2016 we partially characterized the VP2 gene of CPV-2. Vaccine CPV-2 strain, wild type CPV-2a subtypes and vaccine-like CPV-2b subtypes were detected. High copy number was indicative of wild-type CPV-2a presence, but presence of vaccine-like CPV-2b had a variable copy number in fecal samples. A yardstick approach to a copy number or C t -value to discriminate vaccine strain from a wild type virus of CPV-2 can be, in some cases, potentially misleading. Therefore, discriminating vaccine strain from a wild type subtype of CPV-2 remains ambitious. Copyright © 2017 Elsevier Ltd. All rights reserved.
A high-throughput multiplex method adapted for GMO detection.
Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique
2008-12-24
A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.
DEFF Research Database (Denmark)
Clausen, Frederik Banch; Krog, Grethe Risum; Rieneck, Klaus
2011-01-01
and 5. We used the same fluorescent dye for the exon 7 and 10 probes to increase sensitivity; exon 5 was VIC labeled. We evaluated possible inhibition of DNA amplification with dilution experiments. We then tested the two multiplex assays with DNA extracted from 97 plasma samples from 38 RhD negative......OBJECTIVE: To evaluate two different multiplex real-time PCR assays detecting fetal RHD for screening of RhD negative women in relation to antenatal RhD prophylaxis. METHODS: We designed a duplex assay for the detection of RHD exon 7 and 10 and a triplex assay for the detection of RHD exon 7, 10...... assay (exon 7/10), accuracy was 94.2%. Detection of exon 5 was less reliable. CONCLUSION: The duplex assay using exon 7/10 was the most reliable for prenatal prediction of fetal RhD type as a candidate assay for screening of RhD negative women in relation to antenatal RhD prophylaxis. The triplex assay...
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
MiniX-STR multiplex system population study in Japan and application to degraded DNA analysis.
Asamura, H; Sakai, H; Kobayashi, K; Ota, M; Fukushima, H
2006-05-01
We sought to evaluate a more effective system for analyzing X-chromosomal short tandem repeats (X-STRs) in highly degraded DNA. To generate smaller amplicon lengths, we designed new polymerase chain reaction (PCR) primers for DXS7423, DXS6789, DXS101, GATA31E08, DXS8378, DXS7133, DXS7424, and GATA165B12 at X-linked short tandem repeat (STR) loci, devising two miniX-multiplex PCR systems. Among 333 Japanese individuals, these X-linked loci were detected in amplification products ranging in length from 76 to 169 bp, and statistical analyses of the eight loci indicated a high usefulness for the Japanese forensic practice. Results of tests on highly degraded DNA indicated the miniX-STR multiplex strategies to be an effective system for analyzing degraded DNA. We conclude that analysis by the current miniX-STR multiplex systems offers high effectiveness for personal identification from degraded DNA samples.
International Nuclear Information System (INIS)
Mashouf, Rasoul Y.; Farahani, Hadi S.; Zamani, A.
2008-01-01
Objective was to identify Pseudomonas aeruginosa (P. aeruginosa) from the skin biopsy specimens in burn wound infections by multiplex polymerase chain reaction (M-PCR) and detection of antimicrobial susceptibility of isolates from culture. We conducted the cross-sectional study in 140 patients with wound infections who admitted to referral burn center of Motahari, Tehran, Iran, during a 12-month period from 2005-2006. Skin biopsy specimens were aseptically taken from each patient, one for PCR and one for bacterial culture. A M-PCR test based on simultaneous amplification of 2 lipoprotein genes: oprI and oprL, was used to directly detect fluorescent pseudomonades and P. aeruginosa in skin biopsy specimens. The susceptibility of P. aeruginosa isolates to 16 antibiotics was determined using the disc diffusion method. Out of 140 biopsy specimens, M-PCR detected 66 (47.2%) isolates, while culture detected 57 (40.7%) isolates as P. aeruginosa. Positive results for both genes which observed only for P. aeruginosa, while only one gene, oprI, was amplified from other fluorescent pseudomonades (n=12) and all other bacterial tested (n=62) were negative by the amplification test. The most effective antibiotics against isolate of P. aeruginosa were cefepime (79%), azetreonam (76%), ticarcillin-clavulanic acid (68%), tobramycin (62%) and amikacin (61%). Multiplex PCR assay appears promising for the rapid and sensitive detection of P. aeruginosa from the burned skin biopsy specimens. Simultaneous amplification of 2 lipoprotein genes: oprI and oprL could detect P. aeruginosa and oprI gene only for other fluorescent pseudomonades. (author)
Leach, L; Zhu, Y; Chaturvedi, S
2018-02-01
Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.
Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe
2009-04-01
The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.
Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni
2017-09-01
Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jermaine Khumalo
Full Text Available Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children.We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis.From 292 samples, bacterial DNA was detected in 12 (4.1% and viral nucleic acids in 94 (32%. Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10% of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR.In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.
Molecular traceability of the species origin of meats using multiplex ...
African Journals Online (AJOL)
The objective of this study was the designing of a fast and reliable multiplex polymerase chain reaction (PCR) identification system for testing the pure and mixed species origin of meat samples. For conducting this research, different primers were designed for each species according to the conserved region of mitochondrial ...
Inazawa, Natsuko; Hori, Tsukasa; Nojima, Masanori; Saito, Makoto; Igarashi, Keita; Yamamoto, Masaki; Shimizu, Norio; Yoto, Yuko; Tsutsumi, Hiroyuki
2017-02-01
Several studies have indicated that viral reactivations following allogeneic hematopoietic stem cell transplantation (allo-HSCT) are frequent, but viral reactivations after autologous HSCT (auto-HSCT) have not been investigated in detail. We performed multiplex polymerase chain reaction (PCR) assay to examine multiple viral reactivations simultaneously in 24 patients undergoing auto-HSCT between September 2010 and December 2012. Weekly whole blood samples were collected from pre- to 42 days post-HSCT, and tested for the following 13 viruses; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, adeno virus (ADV), BK virus (BKV), JC virus (JCV), parvovirus B19 (B19V), and hepatitis B virus (HBV). Fifteen (63%) patients had at least one type of viral reactivation. HHV6 (n = 10; 41.7%) was most frequently detected followed by EBV (n = 7; 29.2%). HHV-6 peaked on day 21 after HSCT and promptly declined. In addition, HBV, CMV, HHV7, and B19V were each detected in one patient. HHV6 reactivation was detected in almost half the auto-HSCT patients, which was similar to the incidence in allo-HSCT patients. The incidence of EBV was unexpectedly high. Viral infections in patients undergoing auto-HSCT were higher than previously reported in other studies. Although there were no particular complications of viral infection, we should pay attention to possible viral reactivations in auto-HSCT patients. J. Med. Virol. 89:358-362, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov
2014-01-01
A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Directory of Open Access Journals (Sweden)
Maria Frølund
Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia; Pinelli, Elena
2017-03-01
A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular anthelminthic treatments. A total of 228 participants were included in this study. A multiplex RT-PCR was used for the detection of Dientamoeba fragilis, Giardia intestinalis, Cryptosporidium sp. and a monoplex RT-PCR for Entamoeba histolytica. Furthermore, a multiplex PCR was performed for detection of Ascaris lumbricoides, Strongyloides stercoralis, Necator americanus and Ancylostoma duodenale. Combined microscopy-PCR revealed prevalences of 49.3% for A. lumbricoides, 10.1% for N. americanus (no A. duodenale was detected), 2.0% for S. stercoralis, 40.4% for D. fragilis, 35.1% for G. intestinalis, and 7.9% for E. histolytica/dispar. Significant increases in prevalence at PCR vs. microscopy were found for A. lumbricoides, G. intestinalis and D. fragilis. Other parasites detected by microscopy alone were Trichuris trichiura (25.7%), Enterobius vermicularis (3.4%), Blastocystis sp. (65.8%), and the non-pathogenic Entamoeba coli (28.9%), Entamoeba hartmanni (12.3%), Endolimax nana (19.7%) and Iodamoeba bütschlii (7.5%). Age- but no gender-related differences in prevalences were found for A. lumbricoides, T. trichiura, G. intestinalis, and E. histolytica/dispar. The persistently high prevalences of intestinal helminths are probably related to the high faecal pollution as also evidenced by the high prevalences of non-pathogenic intestinal protozoans. These results highlight the importance of using sensitive diagnostic techniques in combination with microscopy to better estimate the prevalence of intestinal parasites, especially in the case of D. fragilis trophozoites, which deteriorate very rapidly and would be missed by microscopy. In addition, the differentiation between
Directory of Open Access Journals (Sweden)
Cátia Maria de Oliveira Lobo
2014-08-01
Full Text Available Nuclear and mitochondrial genes were used as molecular markers for verifying the iden-tity of fish fillets marketed as pintado (Pseudoplatystoma corruscans. Based on THE polymorphisms of nuclear DNA (RAG2, globin, and EF1 genes and mitochondrial regions (16S, we examined whether the fillets originated from inbred species of pintado or from hybrids derived from crosses between cachara (P. reticulatum and pintado. Nuclear genes from both species were detected in the analyzed fillets (n = 29. This clearly iden-tified these fish as interspecific hybrids (or F1/first filial generation of the type “cacha-pinta,” resulting from a cross between female cachara and male pintado. These results demonstrate that monitoring fish fillet trading is crucial for detecting discrepancies between the marketed species and related information declared on the label. Species that are frequently hybridized, such as pintado and cachara, require special attention. -------------------------------------------------------------------- Marcadores moleculares (PCR-Multiplex de genes nucleares e mitocondriais foram uti-lizados para verificar a identidade molecular de filés de peixe comercializados como pintado (Pseudoplatystoma corruscans com base em polimorfismos de regiões do DNA nuclear (genes RAG2, globina e EF1 e mitocondriais (16S para verificar se os filés per-tenciam a espécie pura de pintado ou se eram híbridos derivados do cruzamento entre cachara (Pseudoplatystoma reticulatum e pintado (Pseudoplatystoma corruscans. Os filés analisados (n = 29 apresentaram genes nucleares de ambas espécies P. corruscans e P. reticulatum, e desta forma, foram identificados como híbridos interespecíficos ou F1 (primeira geração filial do tipo “cachapinta” resultante do cruzamento entre uma fêmea de cachara e um macho de pintado. Estes resultados mostram que o monitora-mento da comercialização de filés de peixe é fundamental para identificar situações onde
A 50 SNP-multiplex mass spectrometry assay for human identification
DEFF Research Database (Denmark)
Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus
2008-01-01
We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...
Brazilian ground beef authentication by multiplex polymerase chain reaction
Directory of Open Access Journals (Sweden)
Andrey Carlos do Sacramento de Oliveira
2018-02-01
Full Text Available ABSTRACT: The aim of the present study was to assess the efficacy ofmultiplex PCR in detecting the adulterationof commercially available ground beefvia addition and/orsubstitution ofground buffalo meat. Experimentally adulterated ground beefsamples were prepared in triplicate, and dilutions of DNA from Bos taurus and Bubalusbubalis were prepared to determine the detection limit of the method. Concurrently, 91 ground meatsamples sold as “ground beef” were collected from differentstores in northern Brazil andanalyzed bymultiplex PCR. Buffalo DNA was detected in 17.5% of the collected ground meat samples.Our results showed that multiplex PCR is an efficient method for detectingthe incorporation of groundbuffalo meatatpercentages ranging from 10 to 100% and the incorporation of beef at percentages ranging from0.1 to 100% intoground meat samples.
Directory of Open Access Journals (Sweden)
Erin K. Hanson
2013-12-01
Full Text Available Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE or quantitative RT-PCR (qRT-PCR platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions, IL1F7 (skin, ALAS2 (blood, MMP10 (menstrual blood, HTN3 (saliva and TGM4 (semen. The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green. Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively
Tokman, Hrisi Bahar; İskeleli, Güzin; Dalar, Zeynep Güngördü; Kangaba, Achille Aime; Demirci, Mehmet; Akay, Hatice K; Borsa, Bariş Ata; Algingil, Reyhan Çalişkan; Kocazeybek, Bekir S; Torun, Müzeyyen Mamal; Kiraz, Nuri
2014-01-01
Anaerobic bacteria play an important role in eye infections; however, there is limited epidemiologic data based on the the role of these bacteria in the etiology of keratitis and endophthalmitis. The aim of this re- search is to determine the prevalence of anaerobic bacteria in perforated corneal ulcers of patients with keratitis and endophthalmitis and to evaluate their antimicrobial susceptibilities. Corneal scrapings were taken by the ophthalmologist using sterile needles. For the isolation of anaerobic bacteria, samples were inoculated on specific media and were incubated under anaerobic conditions obtained with Anaero-Gen (Oxoid & Mitsubishi Gas Company) in anaerobic jars (Oxoid USA, Inc. Columbia, MD, USA). The molecular identification of anaerobic bacteria was performed by multiplex PCR and the susceptibilities of an- aerobic bacteria to penicillin, chloramphenicol, and clindamycin were determined with the E test (bioMerieux). 51 strains of anaerobic bacteria belonging to four different genuses were detected by multiplex PCR and only 46 strains were isolated by culture. All of them were found susceptible to chloramphenicol whereas penicillin resistance was found in 13.3% of P.anaerobius strains, clindamycin resistance was found in 34.8% of P.acnes and 13.3% of P. anaerobius strains. Additionnaly, one strain of P. granulosum was found resistant to clindamycin, one strain of B. fragilis and one strain of P.melaninogenica were found resistant to penicillin and clindamycin. Routine analyses of anaerobes in perforated corneal ulcers is inevitable and usage of appropriate molecular methods, for the detection of bacteria responsible from severe infections which might not be deter- mined by cultivation, may serve for the early decision of the appropriate treatment. Taking into account the in- creasing antimicrobial resistance of anaerobic bacteria, alternative eye specific antibiotics effective against anaer- obes are needed to achieve a successful treatment.
Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé
2009-09-01
The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio
2016-01-01
Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.
Energy Technology Data Exchange (ETDEWEB)
Ouyang, Yiwen [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Duarte, Gabriela R.M. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Universidade Federal de Goiás, Goiânia, GO 74690-900 (Brazil); Poe, Brian L.; Riehl, Paul S. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Santos, Fernando M. dos; Martin-Didonet, Claudia C.G. [Universidade Estadual de Goiás, Anápolis, GO 75132-400 (Brazil); Carrilho, Emanuel [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos, SP 13566-590 (Brazil); Instituto Nacional de Ciência e Tecnologia de Bioanalítica, CP 6154, Campinas, SP 13083-970 (Brazil); Landers, James P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia Health Science Center, Charlottesville, VA (United States)
2015-12-11
Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s{sup −1} with a cooling rate of roughly −12 ± 0.9 °C s{sup −1} assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low
International Nuclear Information System (INIS)
Ouyang, Yiwen; Duarte, Gabriela R.M.; Poe, Brian L.; Riehl, Paul S.; Santos, Fernando M. dos; Martin-Didonet, Claudia C.G.; Carrilho, Emanuel; Landers, James P.
2015-01-01
Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s −1 with a cooling rate of roughly −12 ± 0.9 °C s −1 assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification
A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.
Directory of Open Access Journals (Sweden)
Kamfai Chan
Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.
Directory of Open Access Journals (Sweden)
Ralevski Filip
2009-12-01
Full Text Available Abstract Background Accurate laboratory diagnosis of malaria species in returning travelers is paramount in the treatment of this potentially fatal infectious disease. Materials and methods A total of 466 blood specimens from returning travelers to Africa, Asia, and South/Central America with suspected malaria infection were collected between 2007 and 2009 at the reference public health laboratory. These specimens were assessed by reference microscopy, multipex real-time quantitative polymerase chain reaction (QPCR, and two rapid diagnostic immuno-chromatographic tests (ICT in a blinded manner. Key clinical laboratory parameters such as limit of detection (LOD analysis on clinical specimens by parasite stage, inter-reader variability of ICTs, staffing implications, quality assurance and cost analysis were evaluated. Results QPCR is the most analytically sensitive method (sensitivity 99.41%, followed by CARESTART (sensitivity 88.24%, and BINAXNOW (sensitivity 86.47% for the diagnosis of malaria in returning travelers when compared to reference microscopy. However, microscopy was unable to specifically identify Plasmodia spp. in 18 out of 170 positive samples by QPCR. Moreover, the 17 samples that were negative by microscopy and positive by QPCR were also positive by ICTs. Quality assurance was achieved for QPCR by exchanging a blinded proficiency panel with another reference laboratory. The Kappa value of inter-reader variability among three readers for BINAXNOW and CARESTART was calculated to be 0.872 and 0.898 respectively. Serial dilution studies demonstrated that the QPCR cycle threshold correlates linearly with parasitemia (R2 = 0.9746 in a clinically relevant dynamic range and retains a LOD of 11 rDNA copies/μl for P. falciparum, which was several log lower than reference microscopy and ICTs. LOD for QPCR is affected not only by parasitemia but the parasite stage distribution of each clinical specimen. QPCR was approximately 6-fold more
Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.
Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer
2017-05-01
Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Uttenthal, Åse; Fernandez, Jovita
2005-01-01
In order to establish a rapid and reliable system for the detection of vesicular stomatitis virus (VSV), we developed a quantitative reverse transcription-PCR assay for the detection, quantification, and differentiation of the major serotypes, VSV Indiana and VSV New Jersey, using a closed......-tube multiplex format. The detection system is based on the recently invented primer-probe energy transfer (PriProET) system. A region of the gene encoding the RNA-dependent RNA polymerase was amplified by using VSV-specific primers in the presence of two serotype-specific fluorescent probes. By incorporating...... probes. The limits of detection ware found to be less than 10 50% tissue culture infective doses/ml for both serotypes. The diagnostic value of the new method was tested with clinical materials from experimentally infected pigs, and it is concluded that the method is a powerful tool for the rapid...
Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J
2010-07-07
A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.
Hahn, Andreas; Luetgehetmann, Marc; Landt, Olfert; Schwarz, Norbert Georg; Frickmann, Hagen
2017-11-01
Enteropathogenic, enterotoxigenic and enteroaggregative Escherichia coli (EPEC, ETEC, EAEC) are among the most frequent causes of diarrhoea during travel or on military deployments. Cost-efficient and reliable real-time multiplex PCR (mPCR) assays are desirable for surveillance or point prevalence studies in remote and resource-limited tropical settings. We compared one commercial PCR kit and two in-house assays without using a gold standard to estimate sensitivity and specificity of each assay. Residual materials from nucleic acid extractions of stool samples from two groups with presumably different prevalences and increased likelihood of being infected or colonised by diarrhoeagenic E. coli were included in the assessment. One group comprised samples from returnees from tropical deployments, the second group was of migrants and study participants from high-endemicity settings. Each sample was assessed with all of the PCR assays. Cycle threshold (Ct) values were descriptively compared. The calculated sensitivities for the commercial test vs. the in-house tests were for EPEC 0.84 vs. 0.89 and 0.96, for ETEC 0.83 vs. 0.76 and 0.61, and for EAEC 0.69 vs. 0.54 and 0.69. False positive results were rare - specificity was 0.94 and 0.97 for two EPEC tests and 1.0 for all other tests. Most positive samples had late Ct values corresponding to low quantities of pathogens. Discordant test results were associated with late Ct values. As commercial and in-house assays showed comparable results, in-house tests can be assumed to be safe while affording considerable savings, making them a valuable alternative for surveillance testing in resource-limited tropical areas. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Ma Mingxiao
Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.
A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.
Hanabara, Yutaro; Ueda, Yutaka
2016-11-22
A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.
Two-temperature LATE-PCR endpoint genotyping
Directory of Open Access Journals (Sweden)
Reis Arthur H
2006-12-01
Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of
Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely
2013-06-01
Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Bottari, Benedetta; Felis, Giovanna E; Salvetti, Elisa; Castioni, Anna; Campedelli, Ilenia; Torriani, Sandra; Bernini, Valentina; Gatti, Monica
2017-07-01
Lactobacillus casei,Lactobacillus paracasei and Lactobacillusrhamnosus form a closely related taxonomic group (the L. casei group) within the facultatively heterofermentative lactobacilli. Strains of these species have been used for a long time as probiotics in a wide range of products, and they represent the dominant species of nonstarter lactic acid bacteria in ripened cheeses, where they contribute to flavour development. The close genetic relationship among those species, as well as the similarity of biochemical properties of the strains, hinders the development of an adequate selective method to identify these bacteria. Despite this being a hot topic, as demonstrated by the large amount of literature about it, the results of different proposed identification methods are often ambiguous and unsatisfactory. The aim of this study was to develop a more robust species-specific identification assay for differentiating the species of the L. casei group. A taxonomy-driven comparative genomic analysis was carried out to select the potential target genes whose similarity could better reflect genome-wide diversity. The gene mutL appeared to be the most promising one and, therefore, a novel species-specific multiplex PCR assay was developed to rapidly and effectively distinguish L. casei, L. paracasei and L. rhamnosus strains. The analysis of a collection of 76 wild dairy isolates, previously identified as members of the L. casei group combining the results of multiple approaches, revealed that the novel designed primers, especially in combination with already existing ones, were able to improve the discrimination power at the species level and reveal previously undiscovered intraspecific biodiversity.
Cross, Kristen E; Mercante, Jeffrey W; Benitez, Alvaro J; Brown, Ellen W; Diaz, Maureen H; Winchell, Jonas M
2016-07-01
Legionnaires' disease is a severe respiratory disease that is estimated to cause between 8,000 and 18,000 hospitalizations each year, though the exact burden is unknown due to under-utilization of diagnostic testing. Although Legionella pneumophila is the most common species detected in clinical cases (80-90%), other species have also been reported to cause disease. However, little is known about Legionnaires' disease caused by these non-pneumophila species. We designed a multiplex real-time PCR assay for detection of all Legionella spp. and simultaneous specific identification of four clinically-relevant Legionella species, L. anisa, L. bozemanii, L. longbeachae, and L. micdadei, using 5'-hydrolysis probe real-time PCR. The analytical sensitivity for detection of nucleic acid from each target species was ≤50fg per reaction. We demonstrated the utility of this assay in spiked human sputum specimens. This assay could serve as a tool for understanding the scope and impact of non-pneumophila Legionella species in human disease. Published by Elsevier Inc.
Nanoscale Test Strips for Multiplexed Blood Analysis, Phase I
National Aeronautics and Space Administration — The goal of our nanoscale test strips, or nanostrips, is to provide rapid, low-cost, powerful multiplexed analyses in a diminutive form so that whole body health...
Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard
2017-09-01
Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.
Arandjelovic, M; Guschanski, K; Schubert, G; Harris, T R; Thalmann, O; Siedel, H; Vigilant, L
2009-01-01
Many studies in molecular ecology rely upon the genotyping of large numbers of low-quantity DNA extracts derived from noninvasive or museum specimens. To overcome low amplification success rates and avoid genotyping errors such as allelic dropout and false alleles, multiple polymerase chain reaction (PCR) replicates for each sample are typically used. Recently, two-step multiplex procedures have been introduced which drastically increase the success rate and efficiency of genotyping. However, controversy still exists concerning the amount of replication needed for suitable control of error. Here we describe the use of a two-step multiplex PCR procedure that allows rapid genotyping using at least 19 different microsatellite loci. We applied this approach to quantified amounts of noninvasive DNAs from western chimpanzee, western gorilla, mountain gorilla and black and white colobus faecal samples, as well as to DNA from ~100-year-old gorilla teeth from museums. Analysis of over 45 000 PCRs revealed average success rates of > 90% using faecal DNAs and 74% using museum specimen DNAs. Average allelic dropout rates were substantially reduced compared to those obtained using conventional singleplex PCR protocols, and reliable genotyping using low (< 25 pg) amounts of template DNA was possible. However, four to five replicates of apparently homozygous results are needed to avoid allelic dropout when using the lowest concentration DNAs (< 50 pg/reaction), suggesting that use of protocols allowing routine acceptance of homozygous genotypes after as few as three replicates may lead to unanticipated errors when applied to low-concentration DNAs. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.
Gebrekidan, Hagos; Gasser, Robin B; Stevenson, Mark A; McGrath, Sean; Jabbar, Abdul
2017-02-01
Oriental theileriosis caused by multiple genotypes of Theileria orientalis is an important tick-borne disease of bovines. Here, we assessed the performance of an established multiplexed tandem PCR (MT-PCR) for the diagnosis of the two recognized, pathogenic genotypes (chitose and ikeda) of T. orientalis in cattle using pooled blood samples. We used a total of 265 cattle blood samples, which were divided into two groups according to previous MT-PCR results for individual samples. Samples in group 1 (n = 155) were from a herd with a relatively high prevalence of T. orientalis infection; and those in group 2 (n = 110) were from four herds with a low prevalence. For group 1, 31 and 15 batches of five- and ten-pooled samples (selected at random), respectively, were formed. For group 2, 22 and 11 batches of five- and ten-pooled samples (selected at random), respectively, were formed. DNAs from individual pooled samples in each batch and group were then tested by MT-PCR. For group 1, the apparent prevalences estimated using the 31 batches of five-pooled samples (97%) and 15 batches of ten-pooled samples (100%) were significantly higher compared with individual samples (75%). For group 2, higher apparent prevalences (9% and 36%) were also recorded for the 22 and 11 batches of pooled samples, respectively, compared with individual samples (7%). Overall, the average infection intensity recorded for the genotypes of chitose and ikeda were considerably lower in pooled compared with individual samples. The diagnostic specificities of MT-PCR were estimated at 95% and 94%, respectively, when batches of five- and ten-pooled samples were tested, and 94% for individual samples. The diagnostic sensitivity of this assay was estimated at 98% same for all individual, five- and ten-pooled samples. This study shows that screening batches of five- and ten-pooled blood samples from cattle herds are similar to those obtained for individual samples, and, importantly, that the reduced cost
Furfaro, Lucy L; Chang, Barbara J; Payne, Matthew S
2017-09-01
Streptococcus agalactiae is the leading cause of early-onset neonatal sepsis. Culture-based screening methods lack the sensitivity of molecular assays and do not indicate serotype; a potentially important virulence marker. We aimed to develop a multiplex PCR to detect S. agalactiae while simultaneously identifying serotypes Ia, Ib, and III; commonly associated with infant disease. Primers were designed to target S. agalactiae serotype-specific cps genes and the dltS gene. The assay was validated with 512 vaginal specimens from pregnant women. 112 (21.9%) were dltS positive, with 14.3%, 0.9%, and 6.3% of these identified as cps Ia, Ib, and III, respectively. Our assay is a specific and sensitive method to simultaneously detect S. agalactiae and serotypes Ia, Ib, and III in a single step. It is of high significance for clinical diagnostic applications and also provides epidemiological data on serotype, information that may be important for vaccine development and other targeted non-antibiotic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
Tripodi, Amber D; Szalanski, Allen L; Strange, James P
2018-03-01
Crithidia bombi and Crithidia expoeki (Trypanosomatidae) are common parasites of bumble bees (Bombus spp.). Crithidia bombi was described in the 1980s, and C. expoeki was recently discovered using molecular tools. Both species have cosmopolitan distributions among their bumble bee hosts, but there have been few bumble bee studies that have identified infections to species since the original description of C. expoeki in 2010. Morphological identification of species is difficult due to variability within each stage of their complex lifecycles, although they can be easily differentiated through DNA sequencing. However, DNA sequencing can be expensive, particularly with many samples to diagnose. In order to reliably and inexpensively distinguish Crithidia species for a large-scale survey, we developed a multiplex PCR protocol using species-specific primers with a universal trypanosomatid primer set to detect unexpected relatives. We applied this method to 356 trypanosomatid-positive bumble bees from North America as a first-look at the distribution and host range of each parasite in the region. Crithidia bombi was more common (90.2%) than C. expoeki (21.3%), with most C. expoeki-positive samples existing as co-infections with C. bombi (13.8%). This two-step detection method also revealed that 2.2% samples were positive for trypanosmatids that were neither C. bombi nor C. expoeki. Sequencing revealed that two individuals were positive for C. mellificae, one for Lotmaria passim, and three for two unclassified trypanosomatids. This two-step method is effective in diagnosing known bumble bee infecting Crithidia species, and allowing for the discovery of unknown potential symbionts. Published by Elsevier Inc.
Noguchi, Akio; Nakamura, Kosuke; Sakata, Kozue; Sato-Fukuda, Nozomi; Ishigaki, Takumi; Mano, Junichi; Takabatake, Reona; Kitta, Kazumi; Teshima, Reiko; Kondo, Kazunari; Nishimaki-Mogami, Tomoko
2016-04-19
A number of genetically modified (GM) maize events have been developed and approved worldwide for commercial cultivation. A screening method is needed to monitor GM maize approved for commercialization in countries that mandate the labeling of foods containing a specified threshold level of GM crops. In Japan, a screening method has been implemented to monitor approved GM maize since 2001. However, the screening method currently used in Japan is time-consuming and requires generation of a calibration curve and experimental conversion factor (C(f)) value. We developed a simple screening method that avoids the need for a calibration curve and C(f) value. In this method, ΔC(q) values between the target sequences and the endogenous gene are calculated using multiplex real-time PCR, and the ΔΔC(q) value between the analytical and control samples is used as the criterion for determining analytical samples in which the GM organism content is below the threshold level for labeling of GM crops. An interlaboratory study indicated that the method is applicable independently with at least two models of PCR instruments used in this study.
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina; Chu, Wen-Shen
2015-12-01
This study described the use of species-specific PCR in combination with SNaPshot mini-sequencing to achieve species identification and strain differentiation in Lactobacillus rhamnosus. To develop species-specific PCR and strain subtyping primers, the dnaJ gene was used as a target, and its corresponding sequences were analyzed both in Lb. rhamnosus and in a subset of its phylogenetically closest species. The results indicated that the species-specific primer pair was indeed specific for Lb. rhamnosus, and the mini-sequencing assay was able to unambiguously distinguish Lb. rhamnosus strains into different haplotypes. In conclusion, we have successfully developed a rapid, accurate and cost-effective assay for inter- and intraspecies discrimination of Lb. rhamnosus, which can be applied to achieve efficient quality control of probiotic products. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Mini P Singh
2017-01-01
Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Directory of Open Access Journals (Sweden)
Warenholt Janina
2011-01-01
Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck
National Research Council Canada - National Science Library
Metzgar, David; Osuna, Miguel; Yingst, Samuel; Rakha, Magda; Earhart, Kenneth; Elyan, Diaa; Esmat, Hala; Saad, Magdi D; Kajon, Adriana; Wu, Jianguo; Gray, Gregory C; Ryan, Margaret A; Russell, Kevin L
2005-01-01
.... Species and serotype identities were determined using several well-validated multiplex PCR protocols culled from the literature and supplemented with a few novel primer sets designed to identify rare types...
Directory of Open Access Journals (Sweden)
Austin M. Wofford
2014-04-01
Full Text Available Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences ofycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group.
Directory of Open Access Journals (Sweden)
Qiuying Huang
2011-04-01
Full Text Available Probe-based fluorescence melting curve analysis (FMCA is a powerful tool for mutation detection based on melting temperature generated by thermal denaturation of the probe-target hybrid. Nevertheless, the color multiplexing, probe design, and cross-platform compatibility remain to be limited by using existing probe chemistries. We hereby explored two dual-labeled, self-quenched probes, TaqMan and shared-stem molecular beacons, in their ability to conduct FMCA. Both probes could be directly used for FMCA and readily integrated with closed-tube amplicon hybridization under asymmetric PCR conditions. Improved flexibility of FMCA by using these probes was illustrated in three representative applications of FMCA: mutation scanning, mutation identification and mutation genotyping, all of which achieved improved color-multiplexing with easy probe design and versatile probe combination and all were validated with a large number of real clinical samples. The universal cross-platform compatibility of these probes-based FMCA was also demonstrated by a 4-color mutation genotyping assay performed on five different real-time PCR instruments. The dual-labeled, self-quenched probes offered unprecedented combined advantage of enhanced multiplexing, improved flexibility in probe design, and expanded cross-platform compatibility, which would substantially improve FMCA in mutation detection of various applications.
Directory of Open Access Journals (Sweden)
Islay Rodríguez
2014-08-01
Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.
Oktem-Okullu, Sinem; Tiftikci, Arzu; Saruc, Murat; Cicek, Bahattin; Vardareli, Eser; Tozun, Nurdan; Kocagoz, Tanil; Sezerman, Ugur; Yavuz, Ahmet Sinan; Sayi-Yazgan, Ayca
2015-01-01
The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1), IL-17 (Th17), and FOXP3 (Treg) expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.
Species Authentication of Common Meat Based on PCR Analysis of the Mitochondrial COI Gene.
Dai, Zhenyu; Qiao, Jiao; Yang, Siran; Hu, Shen; Zuo, Jingjing; Zhu, Weifeng; Huang, Chunhong
2015-07-01
Adulteration of meat products and costly animal-derived commodities with their inferior/cheaper counterparts is a grievous global problem. Species authentication is still technical challenging, especially to those deep processed products. The present study described the design of seven sets of species-specific primer based on a high heterozygous region of mitochondrial cytochrome c oxidase subunit I (COI) gene. These primers were proven to have high species specificity and no cross-reactions and unexpected products to different DNA source. Multiplex PCR assay was achieved for rapid and economical identification of four commonly consumed meats (pork, beef, chicken, and mutton). The conventional PCR assay was sensitive down to 0.001 ng of DNA template in the reactant. The developed method was also powerful in detecting as low as 0.1-mg adulterated pork (0.05 % in wt/wt) in an artificial counterfeited mutton. Validation test showed that the assay is specific, reproducible, and robust in commercial deep processed meats, leatherware, and feather commodities. This proposed method will be greatly beneficial to the consumers, food industry, leather, and feather commodity manufacture.
The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.
Directory of Open Access Journals (Sweden)
Aili Cui
Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.
Kumar, Sravan; Agarwal, Ritesh; Bal, Amanjit; Sharma, Kusum; Singh, Navneet; Aggarwal, Ashutosh N; Verma, Indu; Rana, Satyawati V; Jha, Vivekanand
2015-03-01
Pleural effusion is a common occurrence in patients with late-stage chronic kidney disease (CKD). In developing countries, many effusions remain undiagnosed after pleural fluid analysis (PFA) and patients are empirically treated with antitubercular therapy. The aim of this study was to evaluate the role of adenosine deaminase (ADA), nucleic acid amplification tests (NAAT) and medical thoracoscopy in distinguishing tubercular and non-tubercular aetiologies in exudative pleural effusions complicating CKD. Consecutive stage 4 and 5 CKD patients with pleural effusions underwent PFA including ADA and PCR [65 kDa gene; multiplex (IS6110, protein antigen b, MPB64)]. Patients with exudative pleural effusion undiagnosed after PFA underwent medical thoracoscopy. All 107 patients underwent thoracocentesis with 45 and 62 patients diagnosed as transudative and exudative pleural effusions, respectively. Twenty six of the 62 patients underwent medical thoracoscopy. Tuberculous pleurisy was diagnosed in six while uraemic pleuritis was diagnosed in 20 subjects. The sensitivity and specificity of pleural fluid ADA, 65 kDa gene PCR, and multiplex PCR were 66.7 and 90 per cent, 100 and 50 per cent, and 100 and 100 per cent, respectively. Thoracoscopy was associated with five complications in three patients. Uraemia remains the most common cause of pleural effusion in CKD even in high TB prevalence country. Multiplex PCR and thoracoscopy are useful investigations in the diagnostic work-up of pleural effusions complicating CKD while the sensitivity and/or specificity of ADA and 65 kDa gene PCR is poor.
A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.
Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping
2018-01-24
Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible
Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H
2013-04-01
Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann
2014-01-01
• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625
Development of a qPCR method to rapidly assess the function of NKT cells.
Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J
2014-05-01
NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.