WorldWideScience

Sample records for rapid dna extraction

  1. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  2. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  3. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  4. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  5. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  6. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  7. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  8. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  9. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  10. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  11. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  12. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  13. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  14. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  15. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  16. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  17. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  18. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  19. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  20. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  1. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  2. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  3. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  4. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  5. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  6. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  7. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  8. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  9. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  11. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  12. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  13. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  14. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  15. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  16. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  17. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  18. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  19. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  20. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  1. DNA extraction from herbarium specimens.

    Science.gov (United States)

    Drábková, Lenka Záveská

    2014-01-01

    With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

  2. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  3. A simple and rapid micromethod for genomic DNA extraction from jugal epithelial cells. Application to human lymphocyte antigen typing in one large family of atopic/asthmatic probands.

    Science.gov (United States)

    Aron, Y; Swierczewski, E; Lockhart, A

    1994-10-01

    We describe a rapid and reliable micromethod for DNA isolation from buccal epithelial cells from the interior mouth mucosa. This convenient, noninvasive method could be applied to genetic typing in a small number of cells (about 2000 cells per cheek). We have shown that DNA released by this method is suitable for further amplification by polymerase chain reaction (PCR). Using this protocol, coupled with the PCR-RFLP (restriction fragment length polymorphism) method, we analyzed the allelic sequence diversity of the human lymphocyte antigen (HLA) class II genes in an extended family of 33 persons containing 14 asthmatic or atopic members. Six of eight DQA1 alleles, and 11 DQB1, 20 DPB1, and 10 DR haplotypes could be identified in a single DNA sample. Our results suggest that the DR53 group haplotype is frequently associated with allergic asthma and atopy. The micromethod described here may be useful in genetic epidemiology, especially in family studies involving small children.

  4. DNA Extraction Techniques for Use in Education

    Science.gov (United States)

    Hearn, R. P.; Arblaster, K. E.

    2010-01-01

    DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

  5. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  6. 大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

    Institute of Scientific and Technical Information of China (English)

    朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

    2009-01-01

    High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809~1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

  7. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  8. Automated extraction of DNA from clothing

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

    2011-01-01

    Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing...

  9. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  10. Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

  11. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  12. Overcoming DNA extraction problems from carnivorous plants

    Directory of Open Access Journals (Sweden)

    Fleischmann, Andreas

    2009-12-01

    Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

    Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

  13. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  14. Extraction of Chromosomal DNA from Schizosaccharomyces pombe.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-05-02

    Extraction of DNA from Schizosaccharomyces pombe cells is required for various uses, including templating polymerase chain reactions (PCRs), Southern blotting, library construction, and high-throughput sequencing. To purify high-quality DNA, the cell wall is removed by digestion with Zymolyase or Lyticase and the resulting spheroplasts lysed using sodium dodecyl sulfate (SDS). Cell debris, SDS, and SDS-protein complexes are subsequently precipitated by the addition of potassium acetate and removed by centrifugation. Finally, DNA is precipitated using isopropanol. At this stage, purity is usually sufficient for PCR. However, for more sensitive procedures, such as restriction enzyme digestion, additional purification steps, including proteinase K digestion and phenol-chloroform extraction, are recommended. All of these steps are described in detail here. © 2016 Cold Spring Harbor Laboratory Press.

  15. Rapid analytical extraction of volatile fermentation products

    Energy Technology Data Exchange (ETDEWEB)

    Jansen, N B; Flickinger, M C; Tsao, G T

    1979-10-01

    With renewed interest in production of liquid fuels and chemical feedstocks from carbohydrates, numerous authors have utilized gas-liquid chromatography (GC) for quantification of volatile products. Poor separation and short column life will result if residual sugars present in the medium are not separated from the volatile compounds before injection. In our current investigation of 2,3-butanediol production from xylose, we have developed a rapid GC assay for 2,3-butanediol, acetyl methyl carbinol (acetoin), 2,3-butanedione (diacetyl), and ethanol. This method extracts the fermentation products at high pH from residual xylose before injection into the GC. This routine is a modification of the method of Kolfenbach et al. and is more rapid than the method of separation of diacetyl and acetoin from carbohydrates by distillation reported by Gupta et al. Their erroneous reports of yields of 640 mg diacetyl + acetoin/g sugar are 30% higher than the theoretical maximum for Enterobacter cloacae (ATCC 27613) and points out the need for a reliable, accurate assay for these products.

  16. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  17. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  18. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  19. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  20. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

  1. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  2. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  3. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  4. An efficient method for DNA extraction from Cladosporioid fungi

    OpenAIRE

    Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de, P.J.G.M.

    2010-01-01

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A260/A280 ratio ranging between 1.6 and 2.0. Isolated genomic DNA w...

  5. Comparative analysis of protocols for DNA extraction from soybean caterpillars.

    Science.gov (United States)

    Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

    2016-04-07

    Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

  6. Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

    Science.gov (United States)

    Kar, Indrani; Chattopadhyaya, Rajagopal

    2017-11-01

    The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

  7. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  8. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

    African Journals Online (AJOL)

    BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

  10. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

  11. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  12. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  13. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  14. Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

    Science.gov (United States)

    Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

    2006-09-18

    A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

  15. Necessity of purification during bacterial DNA extraction with environmental soils

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Lim

    2017-08-01

    Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

  16. Extraction of DNA from plant and fungus tissues in situ

    Directory of Open Access Journals (Sweden)

    Abu Almakarem Amal S

    2012-06-01

    Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

  17. Rapid extraction of virus-contaminated hemocytes from oysters

    Science.gov (United States)

    Rapid viral detection methods are necessary to employ diagnostic testing for viral contamination in shellfish to prevent and control foodborne illness. Current shellfish viral RNA extraction methods, which are time-consuming and not applicable for routine monitoring, require the testing of whole or ...

  18. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  19. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  20. Rapid Statistical Learning Supporting Word Extraction From Continuous Speech.

    Science.gov (United States)

    Batterink, Laura J

    2017-07-01

    The identification of words in continuous speech, known as speech segmentation, is a critical early step in language acquisition. This process is partially supported by statistical learning, the ability to extract patterns from the environment. Given that speech segmentation represents a potential bottleneck for language acquisition, patterns in speech may be extracted very rapidly, without extensive exposure. This hypothesis was examined by exposing participants to continuous speech streams composed of novel repeating nonsense words. Learning was measured on-line using a reaction time task. After merely one exposure to an embedded novel word, learners demonstrated significant learning effects, as revealed by faster responses to predictable than to unpredictable syllables. These results demonstrate that learners gained sensitivity to the statistical structure of unfamiliar speech on a very rapid timescale. This ability may play an essential role in early stages of language acquisition, allowing learners to rapidly identify word candidates and "break in" to an unfamiliar language.

  1. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  2. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  3. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  4. Digital PCR for direct quantification of viruses without DNA extraction

    OpenAIRE

    Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

    2015-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

  5. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  6. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  7. Digital PCR for direct quantification of viruses without DNA extraction.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

  8. Rapid automatic keyword extraction for information retrieval and analysis

    Science.gov (United States)

    Rose, Stuart J [Richland, WA; Cowley,; E, Wendy [Richland, WA; Crow, Vernon L [Richland, WA; Cramer, Nicholas O [Richland, WA

    2012-03-06

    Methods and systems for rapid automatic keyword extraction for information retrieval and analysis. Embodiments can include parsing words in an individual document by delimiters, stop words, or both in order to identify candidate keywords. Word scores for each word within the candidate keywords are then calculated based on a function of co-occurrence degree, co-occurrence frequency, or both. Based on a function of the word scores for words within the candidate keyword, a keyword score is calculated for each of the candidate keywords. A portion of the candidate keywords are then extracted as keywords based, at least in part, on the candidate keywords having the highest keyword scores.

  9. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  10. Application of FTA technology to extraction of sperm DNA from mixed body fluids containing semen.

    Science.gov (United States)

    Fujita, Yoshihiko; Kubo, Shin-ichi

    2006-01-01

    FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. In this study, we report a rapid and simple method of extracting DNA from sperm when body fluids mixed with semen were collected using FTA cards. After proteinase K digestion of the sperm and body fluid mixture, the washed pellet suspension as the sperm fraction and the concentrated supernatant as the epithelial cell fraction were respectively applied to FTA cards containing DTT. The FTA cards were dried, then directly added to a polymerase chain reaction (PCR) mix and processed by PCR. The time required from separation of the mixed fluid into sperm and epithelial origin DNA extractions was only about 2.5-3h. Furthermore, the procedure was extremely simple. It is considered that our designed DNA extraction procedure using an FTA card is available for application to routine work.

  11. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    Arachis hypogaea L.) is particularly problematic due to the presence of phenolic compounds and polysaccharides. Inconsistencies in extraction results can be attributed to the age and growth stages of the plant material analyzed. Mature leaves ...

  12. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  13. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  14. Rapid extraction and assay of uranium from environmental surface samples

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Christopher A.; Chouyyok, Wilaiwan; Speakman, Robert J.; Olsen, Khris B.; Addleman, Raymond Shane

    2017-10-01

    Extraction methods enabling faster removal and concentration of uranium compounds for improved trace and low-level assay are demonstrated for standard surface sampling material in support of nuclear safeguards efforts, health monitoring, and other nuclear analysis applications. A key problem with the existing surface sampling swipes is the requirement for complete digestion of sample and sampling matrix. This is a time-consuming and labour-intensive process that limits laboratory throughput, elevates costs, and increases background levels. Various extraction methods are explored for their potential to quickly and efficiently remove different chemical forms of uranium from standard surface sampling material. A combination of carbonate and peroxide solutions is shown to give the most rapid and complete form of uranyl compound extraction and dissolution. This rapid extraction process is demonstrated to be compatible with standard inductive coupled plasma mass spectrometry methods for uranium isotopic assay as well as screening techniques such as x-ray fluorescence. The general approach described has application beyond uranium to other analytes of nuclear forensic interest (e.g., rare earth elements and plutonium) as well as heavy metals for environmental and industrial hygiene monitoring.

  15. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  16. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  17. Nonhomologous DNA End Joining in Cell-Free Extracts

    Directory of Open Access Journals (Sweden)

    Sheetal Sharma

    2010-01-01

    Full Text Available Among various DNA damages, double-strand breaks (DSBs are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems.

  18. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    OpenAIRE

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-01-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cell...

  19. Extraction of DNA from Forensic Biological Samples for Genotyping.

    Science.gov (United States)

    Stray, J E; Liu, J Y; Brevnov, M G; Shewale, J G

    2010-07-01

    Biological forensic samples constitute evidence with probative organic matter. Evidence believed to contain DNA is typically processed for extraction and purification of its nucleic acid content. Forensic DNA samples are composed of two things, a tissue and the substrate it resides on. Compositionally, a sample may contain almost anything and for each, the type, integrity, and content of both tissue and substrate will vary, as will the contaminant levels. This fact makes the success of extraction one of the most unpredictable steps in genotypic analysis. The development of robust genotyping systems and analysis platforms for short tandem repeat (STR) and mitochondrial DNA sequencing and the acceptance of results generated by these methods in the court system, resulted in a high demand for DNA testing. The increasing variety of sample submissions created a need to isolate DNA from forensic samples that may be compromised or contain low levels of biological material. In the past decade, several robust chemistries and isolation methods have been developed to safely and reliably recover DNA from a wide array of sample types in high yield and free of PCR inhibitors. In addition, high-throughput automated workflows have been developed to meet the demand for processing increasing numbers of samples. This review summarizes a number of the most widely adopted methods and the best practices for DNA isolation from forensic biological samples, including manual, semiautomated, and fully automated platforms. Copyright © 2010 Central Police University.

  20. Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

    Science.gov (United States)

    Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

    2012-11-20

    The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

  1. Comparison of different methodologies for DNA extraction from Aegla longirostri

    Directory of Open Access Journals (Sweden)

    João Vitor Trindade Bitencourt

    2007-11-01

    Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

  2. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  3. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

  4. Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

    Science.gov (United States)

    Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

    2016-04-01

    Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

    Science.gov (United States)

    Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

    2010-04-01

    Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

  6. DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

    Science.gov (United States)

    Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

    2018-04-01

    Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

  7. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  8. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  9. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  10. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  11. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    Directory of Open Access Journals (Sweden)

    Shirleny Monserrat Sandoval-Arias

    2014-11-01

    Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

  12. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    Energy Technology Data Exchange (ETDEWEB)

    Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

  13. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  14. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  15. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  16. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  17. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  18. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  19. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  20. Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

    NARCIS (Netherlands)

    Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

    2010-01-01

    The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were

  1. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    was conducted to examine if sufficient DNA could be successfully extracted from malaria rapid diagnostic tests (RDTs), used and collected as part of routine case management services in health facilities, and thus forming the basis for molecular analyses, surveillance and quality control (QC) testing of RDTs....... continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  2. Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.

    Science.gov (United States)

    Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P

    2017-06-01

    Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.

  3. Rapid transfer of DNA from agarose gels to nylon membranes.

    OpenAIRE

    Reed, K C; Mann, D A

    1985-01-01

    The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...

  4. Presidential Rapid Commercialization Initiative for mixed waste solvent extraction

    International Nuclear Information System (INIS)

    Honigford, L.; Dilday, D.; Cook, D.

    1997-01-01

    Recently, the Fernald Environmental Management Project (FEMP) has made some major steps in mixed waste treatment which have taken it closer to meeting final remediation goals. However, one major hurdle remains for the FEMP mixed waste treatment program, and that hurdle is tri-mixed waste. Tri-mixed is a term coined to describe low-level waste containing RCRA hazardous constituents along with polychlorinated biphenyls (PCB). The prescribed method for disposal of PCBs is incineration. In mixed waste treatment plans developed by the FEMP with public input, the FEMP committed to pursue non-thermal treatment methods and avoid the use of incineration. Through the SITE Program, the FEMP identified a non-thermal treatment technology which uses solvents to extract PCBs. The technology belongs to a small company called Terra-Kleen Response Group, Inc. A question arose as to how can this new and innovative technology be implemented by a small company at a Department of Energy (DOE) facility. The answer came in the form of the Rapid Commercialization Initiative (RCI) and the Mixed Waste Focus Area (MWFA). RCI is a program sponsored by the Department of commerce (DOC), DOE, Department of Defense (DOD), US EPA and various state agencies to aid companies to market new and innovative technologies

  5. Evaluation of four automated protocols for extraction of DNA from FTA cards.

    Science.gov (United States)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-10-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

  6. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  7. Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

    Science.gov (United States)

    Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

    2013-07-01

    Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

  8. Designing easy DNA extraction: Teaching creativity through laboratory practice.

    Science.gov (United States)

    Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

    2017-05-01

    Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  9. DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

    Science.gov (United States)

    Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

    2015-01-01

    Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

  10. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  11. Electromembrane extraction as a rapid and selective miniaturized sample preparation technique for biological fluids

    DEFF Research Database (Denmark)

    Gjelstad, Astrid; Pedersen-Bjergaard, Stig; Seip, Knut Fredrik

    2015-01-01

    This special report discusses the sample preparation method electromembrane extraction, which was introduced in 2006 as a rapid and selective miniaturized extraction method. The extraction principle is based on isolation of charged analytes extracted from an aqueous sample, across a thin film....... Technical aspects of electromembrane extraction, important extraction parameters as well as a handful of examples of applications from different biological samples and bioanalytical areas are discussed in the paper....

  12. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  13. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Nicole L Podnecky

    Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

  14. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.

    OpenAIRE

    Swerdlow, H; Gesteland, R

    1990-01-01

    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  15. A simple Chelex protocol for DNA extraction from Anopheles spp.

    Science.gov (United States)

    Musapa, Mulenga; Kumwenda, Taida; Mkulama, Mtawa; Chishimba, Sandra; Norris, Douglas E; Thuma, Philip E; Mharakurwa, Sungano

    2013-01-09

    Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens. We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km(2) vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol(9,10). The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction(9). Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality, a PCR for identification of Anopheles gambiae sibling species(10) and a nested PCR for typing of Plasmodium falciparum infection

  16. A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

    Directory of Open Access Journals (Sweden)

    Trzewik Aleksandra

    2016-01-01

    Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

  17. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  18. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

    2013-01-01

    protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore......, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already...

  19. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  20. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Evelio Ángel

    2014-04-01

    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  1. A Fluorescent Tile DNA Diagnocode System for In Situ Rapid and Selective Diagnosis of Cytosolic RNA Cancer Markers

    Science.gov (United States)

    Park, Kyung Soo; Shin, Seung Won; Jang, Min Su; Shin, Woojung; Yang, Kisuk; Min, Junhong; Cho, Seung-Woo; Oh, Byung-Keun; Bae, Jong Wook; Jung, Sunghwan; Choi, Jeong-Woo; Um, Soong Ho

    2015-01-01

    Accurate cancer diagnosis often requires extraction and purification of genetic materials from cells, and sophisticated instrumentations that follow. Otherwise in order to directly treat the diagnostic materials to cells, multiple steps to optimize dose concentration and treatment time are necessary due to diversity in cellular behaviors. These processes may offer high precision but hinder fast analysis of cancer, especially in clinical situations that need rapid detection and characterization of cancer. Here we present a novel fluorescent tile DNA nanostructure delivered to cancer cytosol by employing nanoparticle technology. Its structural anisotropicity offers easy manipulation for multifunctionalities, enabling the novel DNA nanostructure to detect intracellular cancer RNA markers with high specificity within 30 minutes post treatment, while the nanoparticle property bypasses the requirement of treatment optimization, effectively reducing the complexity of applying the system for cancer diagnosis. Altogether, the system offers a precise and rapid detection of cancer, suggesting the future use in the clinical fields. PMID:26678430

  2. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Science.gov (United States)

    Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

    2016-01-01

    The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  3. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Directory of Open Access Journals (Sweden)

    Junya Yamagishi

    Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  4. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  5. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  6. Comparison of DNA quantification methodology used in the DNA extraction protocol for the UK Biobank cohort.

    Science.gov (United States)

    Welsh, Samantha; Peakman, Tim; Sheard, Simon; Almond, Rachael

    2017-01-05

    UK Biobank is a large prospective cohort study in the UK established by the Medical Research Council (MRC) and the Wellcome Trust to enable approved researchers to investigate the role of genetic factors, environmental exposures and lifestyle in the causes of major diseases of late and middle age. A wide range of phenotypic data has been collected at recruitment and has recently been enhanced by the UK Biobank Genotyping Project. All UK Biobank participants (500,000) have been genotyped on either the UK Biobank Axiom® Array or the Affymetrix UK BiLEVE Axiom® Array and the workflow for preparing samples for genotyping is described. The genetic data is hoped to provide further insight into the genetics of disease. All data, including the genetic data, is available for access to approved researchers. Data for two methods of DNA quantification (ultraviolet-visible spectroscopy [UV/Vis]) measured on the Trinean DropSense™ 96 and PicoGreen®) were compared by two laboratories (UK Biobank and Affymetrix). The sample processing workflow established at UK Biobank, for genotyping on the custom Affymetrix Axiom® array, resulted in high quality DNA (average DNA concentration 38.13 ng/μL, average 260/280 absorbance 1.91). The DNA generated high quality genotype data (average call rate 99.48% and pass rate 99.45%). The DNA concentration measured on the Trinean DropSense™ 96 at UK Biobank correlated well with DNA concentration measured by PicoGreen® at Affymetrix (r = 0.85). The UK Biobank Genotyping Project demonstrated that the high throughput DNA extraction protocol described generates high quality DNA suitable for genotyping on the Affymetrix Axiom array. The correlation between DNA concentration derived from UV/Vis and PicoGreen® quantification methods suggests, in large-scale genetic studies involving two laboratories, it may be possible to remove the DNA quantification step in one laboratory without affecting downstream analyses. This would result in

  7. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  8. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  9. An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.

    Science.gov (United States)

    Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin

    2017-12-19

    Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.

  10. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  11. Comparative analysis of environmental DNA extraction and purification methods from different humic acid rich soils

    CSIR Research Space (South Africa)

    Lakay, FM

    2007-01-01

    Full Text Available Three different soil DNA isolation and four purification strategies were compared on different soil samples with variable rates of success. Bead beating extraction gave significantly higher DNA yields than microwave-based and liquid nitrogen...

  12. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  13. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  14. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  15. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  16. A simple, rapid and efficient method for the extraction of genomic ...

    African Journals Online (AJOL)

    The isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including long range PCR, endonuclease restriction digestion, southern blot analysis, and genomic library construction. Many protocols are available for the extraction of DNA from plant material, but obtain it is ...

  17. Rapid DNA sequencing by horizontal ultrathin gel electrophoresis.

    OpenAIRE

    Brumley, R L; Smith, L M

    1991-01-01

    A horizontal polyacrylamide gel electrophoresis apparatus has been developed that decreases the time required to separate the DNA fragments produced in enzymatic sequencing reactions. The configuration of this apparatus and the use of circulating coolant directly under the glass plates result in heat exchange that is approximately nine times more efficient than passive thermal transfer methods commonly used. Bubble-free gels as thin as 25 microns can be routinely cast on this device. The appl...

  18. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

    2015-01-01

    ) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

  19. [Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

    Science.gov (United States)

    Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

    2013-08-01

    To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

  20. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  1. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei

    2018-05-01

    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

  2. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  3. A pneumatic device for rapid loading of DNA sequencing gels.

    Science.gov (United States)

    Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R

    1998-05-01

    This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

  4. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  5. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Directory of Open Access Journals (Sweden)

    D.C.A. Leite

    2014-01-01

    Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

  6. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Science.gov (United States)

    Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

    2014-01-01

    Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

  7. rapid extraction of volatile compounds from citrus fruits using a ...

    African Journals Online (AJOL)

    M.A. Ferhat , M.N. Boukhatem, M. Hazzit 3, F.Chemat

    1 sept. 2016 ... que l'industrie chimique utilise des procédés utilisant les propriétés thermiques spécifiques ... moins de solvant, moins d'énergie et diminuant les rejets. ...... expression à froid à l'aide d'un appareil d'extraction semi industriel ...

  8. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  9. Facile preparation of a DNA sensor for rapid herpes virus detection

    International Nuclear Information System (INIS)

    Tam, Phuong Dinh; Tuan, Mai Anh; Huy, Tran Quang; Le, Anh-Tuan; Hieu, Nguyen Van

    2010-01-01

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  10. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    International Nuclear Information System (INIS)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.

    1991-01-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  11. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  12. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  13. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Directory of Open Access Journals (Sweden)

    Hong Chen

    Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  14. Photoelectrochemical Sensors for the Rapid Detection of DNA Damage Induced by Some Nanoparticles

    Directory of Open Access Journals (Sweden)

    M. Jamaluddin Ahmed

    2010-06-01

    Full Text Available Photoelectrochemcal sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy2 (dppz2+ [bpy=2, 2′ -bipyridine, dppz=dipyrido( 3, 2-a: 2′ 3′-c phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy2 (dppz2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time – dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polysterene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals.

  15. Photoelectrochemical sensors for the rapid detection of DNA damage Induced by some nanoparticles

    International Nuclear Information System (INIS)

    Ahmed, M.J.; Zhang, B.T.; Guo, L.H.

    2010-01-01

    Photoelectrochemical sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy)2 (dppz)2+ [bpy=2, 2' -bipyridine, dppz=dipyrido (3, 2-a: 2' 3'-c) phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy)2 (dppz)2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine) was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time . dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polystyrene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals. (author)

  16. Two mini-preparation protocols to DNA extraction from plants with ...

    African Journals Online (AJOL)

    Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

  17. Effect of Cassia hirsuta (L) extract on DNA profile of some ...

    African Journals Online (AJOL)

    The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

  18. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  19. Modifying and adapting a plant-based DNA extraction protocol for ...

    African Journals Online (AJOL)

    ... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.

  20. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

  1. Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

    Science.gov (United States)

    Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

    2015-12-28

    Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

  2. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  3. Rapid extraction and x-ray fluorescence determination of gold in rock

    International Nuclear Information System (INIS)

    Lobanov, F.I.; Logunova, S.A.; Popov, A.M.; Krasnopevtseva, E.V.

    1994-01-01

    The optimal conditions for gold extractional recovery by melts of aliphatic monocarboxylic acids mixtures (C ≥ 16) with additions of di-2-ethylhexyldithiophosphoric acid, di-n-oxtylsulfide and alkylaniline were determined. A rapid method of extraction and X-ray fluorescence detection of gold in the presence of considerable amounts of Fe, Cu, Pb, Cd, Zn and Bi was developed

  4. Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

    Science.gov (United States)

    Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.

    2015-01-01

    Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

  5. DNA in ancient bone - where is it located and how should we extract it?

    DEFF Research Database (Denmark)

    Campos, Paula; Craig, Oliver E.; Turner-Walker, Gordon

    2012-01-01

    Despite the widespread use of bones in ancient DNA (aDNA) studies, relatively little concrete information exists in regard to how the DNA in mineralised collagen degrades, or where it survives in the material's architecture. While, at the macrostructural level, physical exclusion of microbes...... and other external contaminants may be an important feature, and, at the ultrastructural level, the adsorption of DNA to hydroxyapatite and/or binding of DNA to Type I collagen may stabilise the DNA, the relative contribution of each, and what other factors may be relevant, are unclear....... The question arises as to whether this may be due to post-collection preservation or just an artefact of the extraction methods used in these different studies? In an attempt to resolve these questions, we examine the efficacy of DNA extraction methods, and the quality and quantity of DNA recovered from both...

  6. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  7. Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

    Directory of Open Access Journals (Sweden)

    TIJANA SAVIC

    2006-02-01

    Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

  8. Rapid detection of cancer related DNA nanoparticulate biomarkers and nanoparticles in whole blood

    Science.gov (United States)

    Heller, Michael J.; Krishnan, Raj; Sonnenberg, Avery

    2010-08-01

    The ability to rapidly detect cell free circulating (cfc) DNA, cfc-RNA, exosomes and other nanoparticulate disease biomarkers as well as drug delivery nanoparticles directly in blood is a major challenge for nanomedicine. We now show that microarray and new high voltage dielectrophoretic (DEP) devices can be used to rapidly isolate and detect cfc-DNA nanoparticulates and nanoparticles directly from whole blood and other high conductance samples (plasma, serum, urine, etc.). At DEP frequencies of 5kHz-10kHz both fluorescent-stained high molecular weight (hmw) DNA, cfc-DNA and fluorescent nanoparticles separate from the blood and become highly concentrated at specific DEP highfield regions over the microelectrodes, while blood cells move to the DEP low field-regions. The blood cells can then be removed by a simple fluidic wash while the DNA and nanoparticles remain highly concentrated. The hmw-DNA could be detected at a level of <260ng/ml and the nanoparticles at <9.5 x 109 particles/ml, detection levels that are well within the range for viable clinical diagnostics and drug nanoparticle monitoring. Disease specific cfc-DNA materials could also be detected directly in blood from patients with Chronic Lymphocytic Leukemia (CLL) and confirmed by PCR genotyping analysis.

  9. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Rapid liquid–liquid extraction of thallium(III from succinate media with 2-octylaminopyridine in chloroform as the extractant

    Directory of Open Access Journals (Sweden)

    SANDIP V. MAHAMUNI

    2008-04-01

    Full Text Available A simple solvent extraction study of thallium(III was conducted. Selective and quantitative extraction of thallium(III by 2-octylaminopyridine (2-OAP in chloroform occurred from aqueous sodium succinate medium (0.0075 M at pH 3.0. Thallium(III was back extracted with acetate buffer (pH 4.63. The effect of the concentration of succinate and 2-OAP, the role of various diluents, stripping agents, loading capacity of 2-OAP, equilibrium time and aqueous:organic volume ratio on the extraction of thallium(III was studied. The stoichiometry of the extracted species was determined based on the slope analysis method and found to be 1: 2: 1 (metal:acid:extractant. The temperature dependence of the extraction equilibrium constant was also examined to estimate the apparent thermodynamic functions ∆H, ∆G and ∆S for the extraction reaction. The method is free from interference of a large number of cations and anions. The method was used for the selective extraction of thallium(III from its binary mixture with Zn(II, Cd(II, Hg(II, Bi(III, Pb(II, Se(IV, Te(IV, Sb(III, Ga(III, In(III, Al(III, Tl(I and Fe(III. The proposed method was applied to the synthetic mixtures and alloys. It is simple, selective, rapid and eco-friendly.

  11. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  12. How Severely Is DNA Quantification Hampered by RNA Co-extraction?

    Science.gov (United States)

    Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

    2015-10-01

    The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

  13. Extraction and identification of cyclobutanones from irradiated cheese employing a rapid direct solvent extraction method.

    Science.gov (United States)

    Tewfik, Ihab

    2008-01-01

    2-Alkylcyclobutanones (cyclobutanones) are accepted as chemical markers for irradiated foods containing lipid. However, current extraction procedures (Soxhlet-florisil chromatography) for the isolation of these markers involve a long and tedious clean-up regime prior to gas chromatography-mass spectrophotometry identification. This paper outlines an alternative isolation and clean-up method for the extraction of cyclobutanones in irradiated Camembert cheese. The newly developed direct solvent extraction method enables the efficient screening of large numbers of food samples and is not as resource intensive as the BS EN 1785:1997 method. Direct solvent extraction appears to be a simple, robust method and has the added advantage of a considerably shorter extraction time for the analysis of foods containing lipid.

  14. Simple practical approach for sample loading prior to DNA extraction using a silica monolith in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-12-07

    A novel DNA loading methodology is presented for performing DNA extraction on a microfluidic system. DNA in a chaotropic salt solution was manually loaded onto a silica monolith orthogonal to the subsequent flow of wash and elution solutions. DNA was successfully extracted from buccal swabs using electro-osmotic pumping (EOP) coupled with in situ reagents contained within a 1.5% agarose gel matrix. The extracted DNA was of sufficient quantity and purity for polymerase chain reaction (PCR) amplification.

  15. Rapid DNA multi-analyte immunoassay on a magneto-resistance biosensor

    NARCIS (Netherlands)

    Koets, M.; Wijk, van der T.; Eemeren, van J.T.W.M.; Amerongen, van A.; Prins, M.W.J.

    2009-01-01

    We present the rapid and sensitive detection of amplified DNA on a giant magneto-resistance sensor using superparamagnetic particles as a detection label. The one-step assay is performed on an integrated and miniaturized detection platform suitable for application into point-of-care devices. A

  16. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    Science.gov (United States)

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

    2014-11-01

    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  17. Rapid Solid-Liquid Dynamic Extraction (RSLDE): a New Rapid and Greener Method for Extracting Two Steviol Glycosides (Stevioside and Rebaudioside A) from Stevia Leaves.

    Science.gov (United States)

    Gallo, Monica; Vitulano, Manuela; Andolfi, Anna; DellaGreca, Marina; Conte, Esterina; Ciaravolo, Martina; Naviglio, Daniele

    2017-06-01

    Stevioside and rebaudioside A are the main diterpene glycosides present in the leaves of the Stevia rebaudiana plant, which is used in the production of foods and low-calorie beverages. The difficulties associated with their extraction and purification are currently a problem for the food processing industries. The objective of this study was to develop an effective and economically viable method to obtain a high-quality product while trying to overcome the disadvantages derived from the conventional transformation processes. For this reason, extractions were carried out using a conventional maceration (CM) and a cyclically pressurized extraction known as rapid solid-liquid dynamic extraction (RSLDE) by the Naviglio extractor (NE). After only 20 min of extraction using the NE, a quantity of rebaudioside A and stevioside equal to 1197.8 and 413.6 mg/L was obtained, respectively, while for the CM, the optimum time was 90 min. From the results, it can be stated that the extraction process by NE and its subsequent purification developed in this study is a simple, economical, environmentally friendly method for producing steviol glycosides. Therefore, this method constitutes a valid alternative to conventional extraction by reducing the extraction time and the consumption of toxic solvents and favouring the use of the extracted metabolites as food additives and/or nutraceuticals. As an added value and of local interest, the experiment was carried out on stevia leaves from the Benevento area (Italy), where a high content of rebaudioside A was observed, which exhibits a sweet taste compared to stevioside, which has a significant bitter aftertaste.

  18. Noninvasive genetic sampling of endangered muriqui (Primates, Atelidae: efficiency of fecal DNA extraction

    Directory of Open Access Journals (Sweden)

    Paulo B. Chaves

    2006-01-01

    Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.

  19. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  20. RBE comparison between rapid electrons of 20 MeV and 45 MeV with survival rate, DNA synthesis, DNA reparation and nucleoid sedimentation

    International Nuclear Information System (INIS)

    Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)

    1982-01-01

    In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de

  1. Comparison of DNA extraction methods for human gut microbial community profiling.

    Science.gov (United States)

    Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

    2018-03-01

    The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  2. DNA extraction methods for detecting genetically modified foods: A comparative study.

    Science.gov (United States)

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

    2011-06-15

    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples.

    Science.gov (United States)

    Miller, D N; Bryant, J E; Madsen, E L; Ghiorse, W C

    1999-11-01

    We compared and statistically evaluated the effectiveness of nine DNA extraction procedures by using frozen and dried samples of two silt loam soils and a silt loam wetland sediment with different organic matter contents. The effects of different chemical extractants (sodium dodecyl sulfate [SDS], chloroform, phenol, Chelex 100, and guanadinium isothiocyanate), different physical disruption methods (bead mill homogenization and freeze-thaw lysis), and lysozyme digestion were evaluated based on the yield and molecular size of the recovered DNA. Pairwise comparisons of the nine extraction procedures revealed that bead mill homogenization with SDS combined with either chloroform or phenol optimized both the amount of DNA extracted and the molecular size of the DNA (maximum size, 16 to 20 kb). Neither lysozyme digestion before SDS treatment nor guanidine isothiocyanate treatment nor addition of Chelex 100 resin improved the DNA yields. Bead mill homogenization in a lysis mixture containing chloroform, SDS, NaCl, and phosphate-Tris buffer (pH 8) was found to be the best physical lysis technique when DNA yield and cell lysis efficiency were used as criteria. The bead mill homogenization conditions were also optimized for speed and duration with two different homogenizers. Recovery of high-molecular-weight DNA was greatest when we used lower speeds and shorter times (30 to 120 s). We evaluated four different DNA purification methods (silica-based DNA binding, agarose gel electrophoresis, ammonium acetate precipitation, and Sephadex G-200 gel filtration) for DNA recovery and removal of PCR inhibitors from crude extracts. Sephadex G-200 spin column purification was found to be the best method for removing PCR-inhibiting substances while minimizing DNA loss during purification. Our results indicate that for these types of samples, optimum DNA recovery requires brief, low-speed bead mill homogenization in the presence of a phosphate-buffered SDS-chloroform mixture, followed

  4. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    Science.gov (United States)

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  5. Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

    Directory of Open Access Journals (Sweden)

    Imelda Kristina Sutrisno

    2013-06-01

    Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

  6. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  7. [DNA Extraction from Old Bones by AutoMate Express™ System].

    Science.gov (United States)

    Li, B; Lü, Z

    2017-08-01

    To establish a method for extracting DNA from old bones by AutoMate Express™ system. Bones were grinded into powder by freeze-mill. After extraction by AutoMate Express™, DNA were amplified and genotyped by Identifiler®Plus and MinFiler™ kits. DNA were extracted from 10 old bone samples, which kept in different environments with the postmortem interval from 10 to 20 years, in 3 hours by AutoMate Express™ system. Complete STR typing results were obtained from 8 samples. AutoMate Express™ system can quickly and efficiently extract DNA from old bones, which can be applied in forensic practice. Copyright© by the Editorial Department of Journal of Forensic Medicine

  8. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  9. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  10. Evaluation of antimicrobial activity of selected plant extracts by rapid XTT colorimetry and bacterial enumeration.

    Science.gov (United States)

    Al-Bakri, Amal G; Afifi, Fatma U

    2007-01-01

    The aim of this study was to screen and evaluate the antimicrobial activity of indigenous Jordanian plant extracts, dissolved in dimethylsulfoxide, using the rapid XTT assay and viable count methods. XTT rapid assay was used for the initial screening of antimicrobial activity for the plant extracts. Antimicrobial activity of potentially active plant extracts was further assessed using the "viable plate count" method. Four degrees of antimicrobial activity (high, moderate, weak and inactive) against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa, respectively, were recorded. The plant extracts of Hypericum triquetrifolium, Ballota undulata, Ruta chalepensis, Ononis natrix, Paronychia argentea and Marrubium vulgare had shown promising antimicrobial activity. This study showed that while both XTT and viable count methods are comparable when estimating the overall antimicrobial activity of experimental substances, there is no strong linear correlation between the two methods.

  11. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  12. The DNA 'comet assay' as a rapid screening technique to control irradiated food

    International Nuclear Information System (INIS)

    Cerda, H.; Delincee, H.; Haine, H.; Rupp, H.

    1997-01-01

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded

  13. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  14. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2017-01-01

    Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

  16. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  17. Comparison of seven DNA extraction and ampliffication protocols in historical herbarium specimens of Juncaceae

    Czech Academy of Sciences Publication Activity Database

    Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír

    2002-01-01

    Roč. 20, - (2002), s. 161-175 ISSN 0735-9640 R&D Projects: GA MŠk LN00A079; GA ČR GA206/02/0355 Institutional research plan: CEZ:AV0Z6005908 Keywords : cpDNA * DNA extraction * herbarium specimens Subject RIV: EF - Botanics Impact factor: 0.803, year: 2002

  18. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  19. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Science.gov (United States)

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  1. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  2. Effect of DNA extraction and sample preservation method on rumen bacterial population.

    Science.gov (United States)

    Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

    2014-10-01

    The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

    Science.gov (United States)

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  4. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    Directory of Open Access Journals (Sweden)

    Paula Baptista

    2011-06-01

    Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  5. A rapid and quantitative method to determine the tritium content in DNA from small tissue sampes

    International Nuclear Information System (INIS)

    Kasche, V.; Zoellner, R.

    1979-01-01

    A rapid and quantitative two-step procedure to isolate double-strand DNA from small (10-100 mg) animal tissue samples is presented. The method is developed for investigations to evaluate the relative importance of organically bound tritium for the dose factors used to calculate dose commitments due to this nuclide. In the first step the proteins in the homogenized sample are hydrolysed, at a high pH (9.0) and ionic strength (1.5) to dissociate protein from DNA, using immobilized Proteinase K as a proteolytic enzyme. The DNA is then absorbed to hydroxylapatite and separated from impurities by step-wise elution with buffers of increasing ionic strength. More than 90% of the DNA in the samples could be isolated in double-strand form by this procedure. The method has been applied to determine pool-sizes and biological half-life times of tritium in DNA from various animal (mouse) tissues. It has also been shown to be suitable in other radiobiological studies where effects on DNA are investigated. (author)

  6. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  7. The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

    Science.gov (United States)

    Kasu, Mohaimin; Shires, Karen

    2015-07-01

    The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

    Directory of Open Access Journals (Sweden)

    Gilda ESLAMI

    2017-06-01

    Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

  9. A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

    Directory of Open Access Journals (Sweden)

    Aqeela S. Abuidrees

    2016-06-01

    Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

  10. Lab-on-capillary: a rapid, simple and quantitative genetic analysis platform integrating nucleic acid extraction, amplification and detection.

    Science.gov (United States)

    Fu, Yu; Zhou, Xiaoming; Xing, Da

    2017-12-05

    In this work, we describe for the first time a genetic diagnosis platform employing a polydiallyldimethylammonium chloride (PDDA)-modified capillary and a liquid-based thermalization system for rapid, simple and quantitative DNA analysis with minimal user interaction. Positively charged PDDA is modified on the inner surface of the silicon dioxide capillary by using an electrostatic self-assembly approach that allows the negatively charged DNA to be separated from the lysate in less than 20 seconds. The capillary loaded with the PCR mix is incorporated in the thermalization system, which can achieve on-site real-time PCR. This system is based on the circulation of pre-heated liquids in the chamber, allowing for high-speed thermalization of the capillary and fast amplification. Multiple targets can be simultaneously analysed with multiplex spatial melting. Starting with live Escherichia coli (E. coli) cells in milk, as a realistic sample, the current method can achieve DNA extraction, amplification, and detection within 40 min.

  11. DNA extraction from wings as a suitable approach for queen bees genotyping

    Directory of Open Access Journals (Sweden)

    Elena Facchini

    2018-06-01

    Full Text Available In livestock, genomics has been used since a decade in combination with phenotypic information for the estimation of breeding values. In honey bees (Apis mellifera, the advantage for including genomics in selective breeding programmes is represented by the possibility to reduce the generation interval and increase the accuracies of estimated breeding values resulting in higher genetic gain (Brascamp et al., 2018. The limit for this application is DNA extraction. Extraction methods for small animals such as insects often rely upon destructive approaches. The challenge is to develop tissue sampling methods that permit the survival of the animal while providing adequate quality DNA for genotyping. Along with previous reports of DNA extraction from several matrices, this study aims to contribute in developing suitable methodologies for genotyping honey bees queens using DNA extracted from wing cuttings (Chaline et al., 2004; Gregory and Rinderer, 2004; Gould et al., 2011. The clipping of the queen wings in beekeeping is a common practice and it ensures the survival and normal activities of the animal (Forster, 1971. A total of 57 queens with known pedigree were enrolled for this study. Wings from each queen were cut and stored at -20°C until processed (Fig. 1. Extractions were carried out using a modified protocol provided by Qiagen (DNeasy® Blood & Tissue. The modification consists in an initial incubation of the samples with proteinase K for 20 minutes, further steps are carried out following the manufacturer’s instructions. To test the suitability of the extracted DNA for genotyping, PCR was performed on Esterase FE4 like gene. Although quantification with NanoDrop™ resulted in <20 ng/μL of DNA in solution, the extracted material was sufficient for PCR amplification of candidate genes for sequencing and genotyping. Our results show that it is possible to extract DNA from wings’ cuttings permitting to implement genomic approaches in honey

  12. Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

    Science.gov (United States)

    Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

    2017-03-01

    In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

  13. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  14. Rapid turnover of 2-LTR HIV-1 DNA during early stage of highly active antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Weijun Zhu

    Full Text Available BACKGROUND: Despite prolonged treatment with highly active antiretroviral therapy (HAART, the infectious HIV-1 continues to replicate and resides latently in the resting memory CD4+ T lymphocytes, which blocks the eradication of HIV-1. The viral persistence of HIV-1 is mainly caused by its proviral DNA being either linear nonintegrated, circular nonintegrated, or integrated. Previous reports have largely focused on the dynamics of HIV-1 DNA from the samples collected with relatively long time intervals during the process of disease and HAART treatment, which may have missed the intricate changes during the intervals in early treatment. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we investigated the dynamics of HIV-1 DNA in patients during the early phase of HARRT treatment. Using optimized real time PCR, we observed significant changes in 2-LTR during the first 12-week of treatment, while total and integrated HIV-1 DNA remained stable. The doubling time and half-life of 2-LTR were not correlated with the baseline and the rate of changes in plasma viral load and various CD4+ T-cell populations. Longitudinal analyses on 2-LTR sequences and plasma lipopolysaccharide (LPS levels did not reveal any significant changes in the same treatment period. CONCLUSIONS/SIGNIFICANCE: Our study revealed the rapid changes in 2-LTR concentration in a relatively large number of patients during the early HAART treatment. The rapid changes indicate the rapid infusion and clearance of cells bearing 2-LTR in the peripheral blood. Those changes are not expected to be caused by the blocking of viral integration, as our study did not include the integrase inhibitor raltegravir. Our study helps better understand the dynamics of HIV-DNA and its potential role as a biomarker for the diseases and for the treatment efficacy of HAART.

  15. Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

    Science.gov (United States)

    The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

  16. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

    OpenAIRE

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

  17. Evaluation of methods for the extraction and purification of DNA from the human microbiome.

    Directory of Open Access Journals (Sweden)

    Sanqing Yuan

    Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

  18. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  19. Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

    International Nuclear Information System (INIS)

    Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

    2012-01-01

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials.

  20. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  1. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  2. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

    Directory of Open Access Journals (Sweden)

    Åkerlund Monika

    2010-01-01

    Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

  4. Comparison of two commercial DNA extraction kits for the analysis of nasopharyngeal bacterial communities

    Directory of Open Access Journals (Sweden)

    Keith A. Crandall

    2016-04-01

    Full Text Available Characterization of microbial communities via next-generation sequencing (NGS requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagenfor the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732.Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests and taxa proportions (Kruskal-Wallis test were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001 between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

  5. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  6. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  7. Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building.

    Science.gov (United States)

    Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

    2018-04-01

    Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.

  8. Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

    International Nuclear Information System (INIS)

    Hincks, J.R.; Coulombe, R.A. Jr.

    1989-01-01

    Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

  9. Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.

    Science.gov (United States)

    Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang

    2011-06-15

    Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Science.gov (United States)

    Li, Shikuo; Shen, Yuhua; Xie, Anjian; Yu, Xuerong; Zhang, Xiuzhen; Yang, Liangbao; Li, Chuanhao

    2007-10-01

    We describe the formation of amorphous selenium (α-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO32-) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO32- ions to Se0, but also controls the nucleation and growth of Se0, and even participates in the formation of α-Se/protein composites. The size and shell thickness of the α-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO32- ions by Capsicum annuum L extract.

  11. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  12. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  13. Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

    Science.gov (United States)

    Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao

    2018-05-25

    Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

  14. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  15. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  16. DNA extraction from hair shafts of wild Brazilian felids and canids.

    Science.gov (United States)

    Alberts, C C; Ribeiro-Paes, J T; Aranda-Selverio, G; Cursino-Santos, J R; Moreno-Cotulio, V R; Oliveira, A L D; Porchia, B F M M; Santos, W F; Souza, E B

    2010-12-21

    Wild felids and canids are usually the main predators in the food chains where they dwell and are almost invisible to behavior and ecology researchers. Due to their grooming behavior, they tend to swallow shed hair, which shows up in the feces. DNA found in hair shafts can be used in molecular studies that can unravel, for instance, genetic variability, reproductive mode and family structure, and in some species, it is even possible to estimate migration and dispersion rates in given populations. First, however, DNA must be extracted from hair. We extracted successfully and dependably hair shaft DNA from eight wild Brazilian felids, ocelot, margay, oncilla, Geoffroy's cat, pampas cat, jaguarundi, puma, and jaguar, as well as the domestic cat and from three wild Brazilian canids, maned wolf, crab-eating fox, and hoary fox, as well as the domestic dog. Hair samples came mostly from feces collected at the São Paulo Zoo and were also gathered from non-sedated pet or from recently dead wild animals and were also collected from museum specimens. Fractions of hair samples were stained before DNA extraction, while most samples were not. Our extraction protocol is based on a feather DNA extraction technique, based in the phenol:chloroform:isoamyl alcohol general method, with proteinase K as digestive enzyme.

  17. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  18. N-nitrosodimethylamine in drinking water using a rapid, solid-phase extraction method

    Energy Technology Data Exchange (ETDEWEB)

    Jenkins, S W.D. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Koester, C J [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Taguchi, V Y [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Wang, D T [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Palmentier, J P.F.P. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Hong, K P [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch

    1995-12-01

    A simple, rapid method for the extraction of N-nitrosodimethylamine (NDMA) from drinking and surface waters was developed using Ambersorb 572. Development of an alternative method to classical liquid-liquid extraction techniques was necessary to handle the workload presented by implementation of a provincial guideline of 9 ppt for drinking water and a regulatory level of 200 ppt for effluents. A granular absorbent, Ambersorb 572, was used to extract the NDMA from the water in the sample bottle. The NDMA was extracted from the Ambersorb 572 with dichloromethane in the autosampler vial. Method characteristics include a precision of 4% for replicate analyses, and accuracy of 6% at 10 ppt and a detection limit of 1.0 ppt NDMA in water. Comparative data between the Ambersorb 572 method and liquid-liquid extraction showed excellent agreement (average difference of 12%). With the Ambersorb 572 method, dichloromethane use has been reduced by a factor of 1,000 and productivity has been increased by a factor of 3-4. Monitoring of a drinking water supply showed rapidly changing concentrations of NDMA from day to day. (orig.)

  19. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    Administrator

    2007-02-19

    Feb 19, 2007 ... RNA transcription, nucleic acid labeling (random primer labeling) etc. Hence ... form extraction are “tried and true” and nearly always work. Many modified versions of ... Effect (mean ± SE) of starting blood sample (µl) on variables studied. Blood sample ..... PhD Thesis submitted to University of. Agricultural ...

  20. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    Science.gov (United States)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (pextract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (pextract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  1. Impact of two different commercial DNA extraction methods on BK virus viral load

    Directory of Open Access Journals (Sweden)

    Massimiliano Bergallo

    2016-03-01

    Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

  2. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively ( P pleural effusion showed the highest sensitivity of 95.0% but the lowest specificity of 38.9%. The cell-free Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS 6110 per ml of pleural effusion and showed good accordance of the results between repeated tests ( r = 0.978, P = 2.84 × 10 -10 ). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  3. Comparative analysis of different DNA extraction protocols in fresh and herbarium specimens of the genus Dalbergia.

    Science.gov (United States)

    Ribeiro, R A; Lovato, M B

    2007-03-29

    Five published DNA extraction protocols were compared for their ability to produce good quality DNA from fresh and herbarium leaves of several species of the genus Dalbergia. The leaves of these species contain high amounts of secondary metabolites, which make it difficult to perform a clean DNA extraction and thereby interfering with subsequent PCR amplification. The protocol that produced the best DNA quality in most of the Dalbergia species analyzed, utilizes polyvinylpyrrolidone to bind the phenolic compounds, a high molar concentration of NaCl to inhibit co-precipitation of polysaccharides and DNA, and LiCl for removing RNA by selective precipitation. The DNA quality of herbarium specimens was worse than that for fresh leaves, due to collecting conditions and preservation of samples. We analyzed 54 herbarium specimens, but the recovered DNA allowed successful PCR amplification in only eight. For the genus Dalbergia, the herbarium is an important source of material for phylogenetic and evolutionary studies; due to the occurrence of the different species in various geographical regions in Brazil, it is difficult to obtain fresh material in nature. Our results demonstrated that for Dalbergia species the methods used for the collection and preservation of herbarium specimens have a mayor influence on DNA quality and in the success of phylogenetic studies of the species.

  4. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  5. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

  6. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  7. Automated extraction of DNA and PCR setup using a Tecan Freedom EVO® liquid handler

    DEFF Research Database (Denmark)

    Frøslev, Tobias Guldberg; Hansen, Anders Johannes; Stangegaard, Michael

    2009-01-01

    We have implemented and validated automated protocols for DNA extraction and PCR setup using a Tecan Freedom EVO® liquid handler mounted with the TeMagS magnetic separation device. The methods were validated for accredited, forensic genetic work according to ISO 17025 using the Qiagen Mag...... genetic DNA typing can be implemented on a simple robot leading to the reduction of manual work as well as increased quality and throughput....

  8. DNA Damage Protecting Activity and Antioxidant Potential of Launaea taraxacifolia Leaves Extract.

    Science.gov (United States)

    Adinortey, Michael Buenor; Ansah, Charles; Weremfo, Alexander; Adinortey, Cynthia Ayefoumi; Adukpo, Genevieve Etornam; Ameyaw, Elvis Ofori; Nyarko, Alexander Kwadwo

    2018-01-01

    The leaf extract of Launaea taraxacifolia commonly known as African Lettuce is used locally to treat dyslipidemia and liver diseases, which are associated with oxidative stress. Methanol extract from L. taraxacifolia leaves was tested for its antioxidant activity and its ability to protect DNA from oxidative damage. In vitro antioxidant potential of the leaf extract was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), nitric oxide (NO), and hydroxyl (OH) radical scavenging assays. Ferric reducing power, total antioxidant capacity (TAC), metal chelating, and anti-lipid peroxidation ability of the extract were also examined using gallic acid, ascorbic acid, citric acid, and ethylenediaminetetraacetic acid as standards. L. taraxacifolia leaves extract showed antioxidant activity with IC 50 values of 16.18 μg/ml (DPPH), 123.3 μg/ml (NO), 128.2 μg/ml (OH radical), 97.94 μg/ml (metal chelating), 80.28 μg/ml (TAC), and 23 μg/ml (anti-lipid peroxidation activity). L. taraxacifolia leaves extract exhibited a strong capability for DNA damage protection at 20 mg/ml concentration. These findings suggest that the methanolic leaf extract of L. taraxacifolia could be used as a natural antioxidant and also as a preventive therapy against diseases such as arteriosclerosis associated with DNA damage.

  9. A histogram-based technique for rapid vector extraction from PIV photographs

    Science.gov (United States)

    Humphreys, William M., Jr.

    1991-01-01

    A new analysis technique, performed totally in the image plane, is proposed which rapidly extracts all available vectors from individual interrogation regions on PIV photographs. The technique avoids the need for using Fourier transforms with the associated computational burden. The data acquisition and analysis procedure is described, and results of a preliminary simulation study to evaluate the accuracy of the technique are presented. Recently obtained PIV photographs are analyzed.

  10. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  11. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  12. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

    2012-01-01

    Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

  14. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  15. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  16. A rapid method to estimate uranium using ionic liquid as extracting agent from basic aqueous media

    International Nuclear Information System (INIS)

    Prabhath Ravi, K.; Sathyapriya, R.S.; Rao, D.D.; Ghosh, S.K.

    2016-01-01

    Room temperature ionic liquids, as their name suggests are salts with a low melting point typically less than 100 °C and exist as liquid at room temperature. The common cationic parts of ionic liquids are imidazolium, pyridinium, pyrrolidinium, quaternary ammonium, or phosphonium ions, and common anionic parts are chloride, bromide, boron tetrafluorate, phosphorous hexafluorate, triflimide etc. The physical properties of ionic liquids can be tuned by choosing appropriate cations with differing alkyl chain lengths and anions. Application of ionic liquids in organic synthesis, liquid-liquid extractions, electrochemistry, catalysis, speciation studies, nuclear reprocessing is being studied extensively in recent times. In this paper a rapid method to estimate the uranium content in aqueous media by extraction with room temperature ionic liquid tricaprylammoniumthiosalicylate ((A- 336)(TS)) followed by liquid scintillation analysis is described. Re-extraction of uranium from ionic liquid phase to aqueous phase was also studied

  17. Rapid determination of ions by combined solid-phase extraction--diffuse reflectance spectroscopy

    Science.gov (United States)

    Fritz, James S.; Arena, Matteo P.; Steiner, Steven A.; Porter, Marc D.

    2003-01-01

    We introduce colorimetric solid-phase extraction (C-SPE) for the rapid determination of selected ions. This new technique links the exhaustive concentration of an analyte by SPE onto a membrane disk surface for quantitative measurement with a hand-held diffuse reflectance spectrometer. The concentration/measurement procedure is complete in approximately 1 min and can be performed almost anywhere. This method has been used to monitor iodine and iodide in spacecraft water in the 0.1-5.0 ppm range and silver(I) in the range of 5.0-1000 microg/l. Applications to the trace analysis of copper(II), nickel(II), iron(III) and chromium(VI) are described. Studies on the mechanism of extraction showed that impregnation of the disk with a surfactant as well as a complexing reagent results in uptake of additional water, which markedly improves the extraction efficiency.

  18. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  19. Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

    Science.gov (United States)

    Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

    2009-10-01

    Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

  20. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  1. Ancient DNA extracted from Danish aurochs (Bos primigenius)

    DEFF Research Database (Denmark)

    Nielsen, Peter Gravlund; Aaris-Sørensen, Kim; Hofreiter, Michael

    2012-01-01

    study of genetic variation of Danish aurochs. In addition, for all specimens we address correlations between the ability to obtain DNA sequences and various parameters such as the age of the sample, the collagen content, the museum storage period, Danish geography and whether the specimens were found...... in an archeological or geological context. We find that aurochs from southern Scandinavia display a star-shaped population genetic structure, that is indicative of a local and relatively recent diversification from a few ancestral haplotypes that may have originated in the ancestral Western European population before...... migration northwards during the retreat of the glaciers. Scenarios suggesting several invasions of genetically distinct aurochs are not supported by these analyses. Rather, our results suggest that a single continuous migration northward occurred. Our findings also suggest, although with only limited...

  2. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...... methodologies and the supremacy of our method was confirmed. Maximum recovery of genomic DNA in the absence of substantial amount of impurities made the method convenient for nucleic acid extraction. The nucleic acids obtained using this method are suitable for different downstream applications. This improved...

  3. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-01-01

    Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

  4. Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-06-16

    As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  5. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Directory of Open Access Journals (Sweden)

    Schnabel Robert D

    2009-06-01

    Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  6. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  7. Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

    DEFF Research Database (Denmark)

    Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

    2013-01-01

    Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......-time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

  8. Rapid and simple purification of elastin-like polypeptides directly from whole cells and cell lysates by organic solvent extraction.

    Science.gov (United States)

    VerHeul, Ross; Sweet, Craig; Thompson, David H

    2018-03-26

    Elastin-like polypeptides (ELP) are a well-known class of proteins that are being increasingly utilized in a variety of biomedical applications, due to their beneficial physicochemical properties. A unifying feature of ELP is their demonstration of a sequence tunable inverse transition temperature (Tt) that enables purification using a simple, straightforward process called inverse transition cycling (ITC). Despite the utility of ITC, the process is inherently limited to ELP with an experimentally accessible Tt. Since the underlying basis for the ELP Tt is related to its high overall hydrophobicity, we anticipated that ELP would be excellent candidates for purification by organic extraction. We report the first method for rapidly purifying ELP directly from whole E. coli cells or clarified lysates using pure organic solvents and solvent mixtures, followed by aqueous back extraction. Our results show that small ELP and a large ELP-fusion protein can be isolated in high yield from whole cells or cell lysates with greater than 95% purity in less than 30 min and with very low levels of LPS and DNA contamination.

  9. DNA extraction in Echinococcus granulosus and Taenia spp. eggs in dogs stool samples applying thermal shock.

    Science.gov (United States)

    Hidalgo, Alejandro; Melo, Angélica; Romero, Fernando; Hidalgo, Víctor; Villanueva, José; Fonseca-Salamanca, Flery

    2018-03-01

    The extraction of DNA in taeniid eggs shows complications attached to the composition of stool samples and the high resistance of eggs to degradation. The objective of this study was to test a method of DNA extraction in taeniid eggs by applying a thermal shock to facilitate the chemical-enzymatic degradation of these elements. A group of six tubes containing 1 ml of dog stool sample was spiked with eggs of Echinococcus granulosus and another group of six with Taenia pisiformis. Samples were floated with supersaturated sugar solution and centrifuged. The upper portion of each tube (500 μl) was aspirated and deposited in 1.5 ml tubes. Three tubes from each group were incubated at -20 °C and then at 90 °C, the remaining three from each group, incubated at room temperature. Proteinase K and lysis buffer were added to each tube and incubated for 12 h at 58 °C. The lysis effect was evaluated by microscopy at 3, 6 and 12 h and integrity by electrophoresis in 1% agarose gels. With the same experimental scheme, the thermal shock effect was evaluated in extractions of 1, 2, 3 and 4 eggs of each species and the DNA was quantified. Additionally, the protocol was applied in samples of 4 dogs diagnosed with natural infection by Taeniidae worms. Finally, all the extractions were tested by PCR amplification. Both E. granulosus and T. pisiformis eggs showed a similar response in the tests. In samples without treatment, the lysis effect was poor and showed no differences over time, but in those subjected to thermal shock, eggs degradation increased with time. In both treatments, there was no DNA loss integrity. The protocol applied to limited amounts of eggs yielded PCR products in 100% of the samples exposed to thermal shock, allowing PCR amplifications up to 1 egg. In non-exposed samples, the results were not replicable. However, DNA quantification showed low values in both treatments. In turn, DNA extractions with thermal shock in infected dog samples

  10. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  11. Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

    Directory of Open Access Journals (Sweden)

    Shichu Huang

    Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

  12. Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

    Science.gov (United States)

    Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

    2013-01-01

    In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

  13. Rapid detection of Ganoderma-infected oil palms by microwave ergosterol extraction with HPLC and TLC.

    Science.gov (United States)

    Muniroh, M S; Sariah, M; Zainal Abidin, M A; Lima, N; Paterson, R R M

    2014-05-01

    Detection of basal stem rot (BSR) by Ganoderma of oil palms was based on foliar symptoms and production of basidiomata. Enzyme-Linked Immunosorbent Assays-Polyclonal Antibody (ELISA-PAB) and PCR have been proposed as early detection methods for the disease. These techniques are complex, time consuming and have accuracy limitations. An ergosterol method was developed which correlated well with the degree of infection in oil palms, including samples growing in plantations. However, the method was capable of being optimised. This current study was designed to develop a simpler, more rapid and efficient ergosterol method with utility in the field that involved the use of microwave extraction. The optimised procedure involved extracting a small amount of Ganoderma, or Ganoderma-infected oil palm suspended in low volumes of solvent followed by irradiation in a conventional microwave oven at 70°C and medium high power for 30s, resulting in simultaneous extraction and saponification. Ergosterol was detected by thin layer chromatography (TLC) and quantified using high performance liquid chromatography with diode array detection. The TLC method was novel and provided a simple, inexpensive method with utility in the field. The new method was particularly effective at extracting high yields of ergosterol from infected oil palm and enables rapid analysis of field samples on site, allowing infected oil palms to be treated or culled very rapidly. Some limitations of the method are discussed herein. The procedures lend themselves to controlling the disease more effectively and allowing more effective use of land currently employed to grow oil palms, thereby reducing pressure to develop new plantations. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    Science.gov (United States)

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  15. Simple DNA extraction of urine samples: Effects of storage temperature and storage time.

    Science.gov (United States)

    Ng, Huey Hian; Ang, Hwee Chen; Hoe, See Ying; Lim, Mae-Lynn; Tai, Hua Eng; Soh, Richard Choon Hock; Syn, Christopher Kiu-Choong

    2018-06-01

    Urine samples are commonly analysed in cases with suspected illicit drug consumption. In events of alleged sample mishandling, urine sample source identification may be necessary. A simple DNA extraction procedure suitable for STR typing of urine samples was established on the Promega Maxwell ® 16 paramagnetic silica bead platform. A small sample volume of 1.7mL was used. Samples were stored at room temperature, 4°C and -20°C for 100days to investigate the influence of storage temperature and time on extracted DNA quantity and success rate of STR typing. Samples stored at room temperature exhibited a faster decline in DNA yield with time and lower typing success rates as compared to those at 4°C and -20°C. This trend can likely be attributed to DNA degradation. In conclusion, this study presents a quick and effective DNA extraction protocol from a small urine volume stored for up to 100days at 4°C and -20°C. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. A new method to extract dental pulp DNA: application to universal detection of bacteria.

    Directory of Open Access Journals (Sweden)

    Lam Tran-Hung

    Full Text Available BACKGROUND: Dental pulp is used for PCR-based detection of DNA derived from host and bacteremic microorganims. Current protocols require odontology expertise for proper recovery of the dental pulp. Dental pulp specimen exposed to laboratory environment yields contaminants detected using universal 16S rDNA-based detection of bacteria. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new protocol by encasing decontaminated tooth into sterile resin, extracting DNA into the dental pulp chamber itself and decontaminating PCR reagents by filtration and double restriction enzyme digestion. Application to 16S rDNA-based detection of bacteria in 144 teeth collected in 86 healthy people yielded a unique sequence in only 14 teeth (9.7% from 12 individuals (14%. Each individual yielded a unique 16S rDNA sequence in 1-2 teeth per individual. Negative controls remained negative. Bacterial identifications were all confirmed by amplification and sequencing of specific rpoB sequence. CONCLUSIONS/SIGNIFICANCE: The new protocol prevented laboratory contamination of the dental pulp. It allowed the detection of bacteria responsible for dental pulp colonization from blood and periodontal tissue. Only 10% such samples contained 16S rDNA. It provides a new tool for the retrospective diagnostic of bacteremia by allowing the universal detection of bacterial DNA in animal and human, contemporary or ancient tooth. It could be further applied to identification of host DNA in forensic medicine and anthropology.

  17. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... The effects of three different grinding methods in DNA extraction of cowpea .... 100 mg of the leaf tissues were weighed in an electronic balance. CTAB method .... The primers were synthesized by Life Technologies (AB & Invitrogen). .... This work was supported by 'Shuang-Zhi Plan' of Sichuan. Agricultural ...

  18. Efficient recovery of environmental DNA for expression cloning by indirect extraction methods

    NARCIS (Netherlands)

    Gabor, Esther; de Vries, Erik; Janssen, DB

    2003-01-01

    Using direct and cell extraction-based (indirect) isolation methods, DNA was obtained from environmental samples with largely differing characteristics (loam soil, sand soil, sediment, activated sludge, and compost) and evaluated with respect to the comprised bacterial diversity and its suitability

  19. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... This makes coffee seed as one of the important material for molecular marker ... homogenised in 10 ml of freshly prepared extraction buffer (200. mM Tris-HCl pH 8.0, .... DNA material for particular molecular analysis. This method will be ... Pharmawati M, Yan G, Sedgley R, Finnegan PM (2004). Chloroplast.

  20. Land subsidence caused by a single water extraction well and rapid water infiltration

    Directory of Open Access Journals (Sweden)

    I. Martinez-Noguez

    2015-11-01

    Full Text Available Nowadays several parts of the world suffer from land subsidence. This setting of the earth surface occurs due to different factors such as earth quakes, mining activities, and gas, oil and water withdrawal. This research presents a numerical study of the influence of land subsidence caused by a single water extraction well and rapid water infiltration into structural soil discontinuities. The numerical simulation of the infiltration was based on a two-phase flow-model for porous media, and for the deformation a Mohr–Coulomb model was used. A two-layered system with a fault zone is presented. First a single water extraction well is simulated producing a cone-shaped (conical water level depletion, which can cause land subsidence. Land Subsidence can be further increased if a hydrological barrier as a result of a discontinuity, exists. After water extraction a water column is applied on the top boundary for one hours in order to represent a strong storm which produces rapid water infiltration through the discontinuity as well as soil deformation. Both events are analysed and compared in order to characterize deformation of both elements and to get a better understanding of the land subsidence and new fracture formations.

  1. Rapid green synthesis of silver nanoparticles and nanorods using Piper nigrum extract

    International Nuclear Information System (INIS)

    Mohapatra, Bandita; Kuriakose, Sini; Mohapatra, Satyabrata

    2015-01-01

    Highlights: • Silver nanorods were synthesized by photoreduction using Piper nigrum extract. • The morphological and structural properties were studied by XRD and AFM. • Silver nanoparticles were formed at lower AgNO 3 concentration. • Increase in AgNO 3 concentration resulted in formation of silver nanorods. - Abstract: We report sun light driven rapid green synthesis of stable aqueous dispersions of silver nanoparticles and nanorods at room temperature using photoreduction of silver ions with Piper nigrum extract. Silver nanoparticles were formed within 3 min of sun light irradiation following addition of Piper nigrum extract to the AgNO 3 solution. The effects of AgNO 3 concentration and irradiation time on the formation and plasmonic properties of biosynthesized silver nanoparticles were studied using UV–visible absorption spectroscopy. The morphology and structure of silver nanoparticles were well characterized by atomic force microscopy (AFM) and X-ray diffraction (XRD). The size of Ag nanoparticles increased with increase in irradiation time, leading to the formation of anisotropic nanostructures. Increasing the AgNO 3 concentration resulted in the formation of Ag nanorods. UV–visible absorption studies revealed the presence of surface plasmon resonance (SPR) peaks which red shift and broaden with increasing AgNO 3 concentration. We have demonstrated a facile, energy efficient and rapid green synthetic route to synthesize stable aqueous dispersions of silver nanoparticles and nanorods

  2. Rapid green synthesis of silver nanoparticles and nanorods using Piper nigrum extract

    Energy Technology Data Exchange (ETDEWEB)

    Mohapatra, Bandita [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Kuriakose, Sini [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Mohapatra, Satyabrata, E-mail: smiuac@gmail.com [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India)

    2015-07-15

    Highlights: • Silver nanorods were synthesized by photoreduction using Piper nigrum extract. • The morphological and structural properties were studied by XRD and AFM. • Silver nanoparticles were formed at lower AgNO{sub 3} concentration. • Increase in AgNO{sub 3} concentration resulted in formation of silver nanorods. - Abstract: We report sun light driven rapid green synthesis of stable aqueous dispersions of silver nanoparticles and nanorods at room temperature using photoreduction of silver ions with Piper nigrum extract. Silver nanoparticles were formed within 3 min of sun light irradiation following addition of Piper nigrum extract to the AgNO{sub 3} solution. The effects of AgNO{sub 3} concentration and irradiation time on the formation and plasmonic properties of biosynthesized silver nanoparticles were studied using UV–visible absorption spectroscopy. The morphology and structure of silver nanoparticles were well characterized by atomic force microscopy (AFM) and X-ray diffraction (XRD). The size of Ag nanoparticles increased with increase in irradiation time, leading to the formation of anisotropic nanostructures. Increasing the AgNO{sub 3} concentration resulted in the formation of Ag nanorods. UV–visible absorption studies revealed the presence of surface plasmon resonance (SPR) peaks which red shift and broaden with increasing AgNO{sub 3} concentration. We have demonstrated a facile, energy efficient and rapid green synthetic route to synthesize stable aqueous dispersions of silver nanoparticles and nanorods.

  3. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Wang

    Full Text Available BACKGROUND: In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. METHODOLOGY/PRINCIPAL FINDINGS: We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. CONCLUSIONS/SIGNIFICANCE: We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN, indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  4. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Science.gov (United States)

    Wang, Xiao-Dong; Liu, A-Ping; Wu, Yin-Yuan; Wang, Peng

    2013-01-01

    In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN), indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  5. Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs

    Directory of Open Access Journals (Sweden)

    Ana Cristina dos Reis Ferreira

    2015-06-01

    Full Text Available ABSTRACT. Ferreira A.C.dosR. & dos Santos B.M. [Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs.] Avaliação de três métodos de extração de DNA de Salmonella sp. em ovos de galinhas contaminados artificialmente. Revista Brasileira de Medicina Veterinária, 37(2:115-119, 2015. Departamento de Veterinária, Universidade Federal de Viçosa, Campus Universitário, Av. Peter Henry Rolfs, s/n, Viçosa, MG 36571-000, Brasil. E-mail: bmsantos@ufv.br The present study evaluated the efficiency of different protocols for the genomic DNA extraction of Salmonella bacteria in chicken eggs free of specific pathogens – SPF. Seventy-five eggs were used and divided into five groups with fifteen eggs each. Three of the five groups of eggs were inoculated with enteric Salmonella cultures. One of the five groups was inoculated with Escherichia coli bacterium culture. And another group of eggs was the negative control that received saline solution 0.85% infertile. The eggs were incubated on a temperature that varied from 20 to 25°C during 24, 48 and 72 hours. Five yolks of each group were collected every 24 hours. These yolks were homogenized and centrifuged during 10 minutes. The supernatant was rejected. After the discard, PBS ph 7.2 was added and centrifuged again. The sediment obtained of each group was used for the extraction of bacterial genomic DNA. Silica particles and a commercial kit were utilized as the extraction methods. The extracted DNA was kept on a temperature of 20°C until the evaluation through PCR. The primers utilized were related with the invA gene and they were the following: 5’ GTA AAA TTA TCG CCA CGT TCG GGC AA 3’ and 5’ TCA TCG CAC CGT CAA AGG AAC C 3’. The amplification products were visualized in transilluminator with ultraviolet light. The obtained results through the bacterial DNA extractions demonstrated that the extraction method utilizing silica particles was

  6. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    Science.gov (United States)

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  7. A DNA Barcode-Based RPA Assay (BAR-RPA for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao

    Directory of Open Access Journals (Sweden)

    Enwei Tian

    2017-12-01

    Full Text Available Background: Wuzhimaotao (the dry root of Ficus hirta is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans, which contains gelsemine that is extremely neurotoxic and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA with species–specific primers targeting the internal transcribed spacer (ITS region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species–specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min of the ITS region under a constant and mild temperature range of 37–42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  8. An Improved DNA Extraction Method for Efficient and Quantitative Recovery of Phytoplankton Diversity in Natural Assemblages.

    Directory of Open Access Journals (Sweden)

    Jian Yuan

    Full Text Available Marine phytoplankton are highly diverse with different species possessing different cell coverings, posing challenges for thoroughly breaking the cells in DNA extraction yet preserving DNA integrity. While quantitative molecular techniques have been increasingly used in phytoplankton research, an effective and simple method broadly applicable to different lineages and natural assemblages is still lacking. In this study, we developed a bead-beating protocol based on our previous experience and tested it against 9 species of phytoplankton representing different lineages and different cell covering rigidities. We found the bead-beating method enhanced the final yield of DNA (highest as 2 folds in comparison with the non-bead-beating method, while also preserving the DNA integrity. When our method was applied to a field sample collected at a subtropical bay located in Xiamen, China, the resultant ITS clone library revealed a highly diverse assemblage of phytoplankton and other micro-eukaryotes, including Archaea, Amoebozoa, Chlorophyta, Ciliphora, Bacillariophyta, Dinophyta, Fungi, Metazoa, etc. The appearance of thecate dinoflagellates, thin-walled phytoplankton and "naked" unicellular organisms indicates that our method could obtain the intact DNA of organisms with different cell coverings. All the results demonstrate that our method is useful for DNA extraction of phytoplankton and environmental surveys of their diversity and abundance.

  9. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Wang, Z.; Wu, X.; Friedberg, E.C.

    1993-01-01

    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  10. Grape (Vitis vinifera) extracts protect against radiation-induced oxidative stress and DNA damage

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar; Saxena, S.; Gautam, S.

    2016-01-01

    Ionizing radiation (IR) causes oxidative stress through the overwhelming generation of reactive oxygen species (ROS) in the living cells leading further to the oxidative damage to biomolecules. Grapes (Vitis vinifera) contain several bioactive phytochemicals and are the richest source of antioxidant. In this study, we investigated and compared in vitro antioxidant activity and DNA damage protective property of the grape extracts of four different cultivars, including the Thompson seedless, Flame seedless, Kishmish chorni and Red globe. The activities of ascorbic acid oxidase and catalase significantly (p<0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly among extracts of any cultivar. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay and ABTS. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. DNA damage was evaluated in acellular system using pBR322 plasmid relaxation. Grape extract was able to effectively scavenge free radicals in vitro. It could significantly prevent radiation-induced DNA damage. Furthermore, the protective action of grape depends on the source of extract and type of the cultivars. (author)

  11. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  12. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  13. Comparison of eight methods for the extraction of Bacillus atrophaeus spore DNA from eleven common interferents and a common swab.

    Directory of Open Access Journals (Sweden)

    Helen L Rose

    Full Text Available Eight DNA extraction products or methods (Applied Biosystems PrepFiler Forensic DNA Extraction Kit; Bio-Rad Instagene Only, Bio-Rad Instagene & Spin Column Purification; EpiCentre MasterPure DNA & RNA Kit; FujiFilm QuickGene Mini80; Idaho Technologies 1-2-3 Q-Flow Kit; MoBio UltraClean Microbial DNA Isolation Kit; Sigma Extract-N-Amp Plant and Seed Kit were adapted to facilitate extraction of DNA under BSL3 containment conditions. DNA was extracted from 12 common interferents or sample types, spiked with spores of Bacillus atropheaus. Resulting extracts were tested by real-time PCR. No one method was the best, in terms of DNA extraction, across all sample types. Statistical analysis indicated that the PrepFiler method was the best method from six dry powders (baking, biological washing, milk, plain flour, filler and talcum and one solid (Underarm deodorant, the UltraClean method was the best from four liquids (aftershave, cola, nutrient broth, vinegar, and the MasterPure method was the best from the swab sample type. The best overall method, in terms of DNA extraction, across all sample types evaluated was the UltraClean method.

  14. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    2012-01-01

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  15. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  16. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    NARCIS (Netherlands)

    Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

  17. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

    2015-01-01

    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  18. Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

    Directory of Open Access Journals (Sweden)

    Gemma Henderson

    Full Text Available Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However

  19. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Science.gov (United States)

    Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

    2011-01-01

    Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  20. An improved protocol and a new grinding device for extraction of genomic DNA from microorganisms by a two-step extraction procedure.

    Science.gov (United States)

    Zhang, S S; Chen, D; Lu, Q

    2012-05-21

    Current protocols to extract genomic DNA from microorganisms are still laborious, tedious and costly, especially for the species with thick cell walls. In order to improve the effectiveness of extracting DNA from microbial samples, a novel protocol, defined as two-step extraction method, along with an improved tissue-grinding device, was developed. The protocol included two steps, disruption of microbial cells or spores by grinding the sample together with silica sand in a new device and extraction of DNA with an effective buffer containing cell lysis chemicals. The device was prepared by using a commercial electric mini-grinder, adapted with a grinding stone, and a sample cup processed by lathing from a polytetrafluoroethylene rod. We tested the method with vegetative cells of four microbial species and two microbial spores that have thick cell walls and are therefore hard to process; these included Escherichia coli JM109, Bacillus subtilis WB600, Sacchromyces cerevisiae INVSc1, Trichoderma viride AS3.3711, and the spores of S. cerevisiae and T. viride, respectively, representing Gram-positive bacteria, Gram-negative bacteria, yeast, filamentous fungi. We found that this new method and device extracted usable quantities of genomic DNA from the samples. The DNA fragments that were extracted exceeded 23 kb. The target sequences up to about 5 kb were successfully and exclusively amplified by PCR using extracted DNA as the template. In addition, the DNA extraction was finalized within 1.5 h. Thus, we conclude that this two-step extraction method is an effective and improved protocol for extraction of genomic DNA from microbial samples.

  1. A Swellable Microneedle Patch to Rapidly Extract Skin Interstitial Fluid for Timely Metabolic Analysis.

    Science.gov (United States)

    Chang, Hao; Zheng, Mengjia; Yu, Xiaojun; Than, Aung; Seeni, Razina Z; Kang, Rongjie; Tian, Jingqi; Khanh, Duong Phan; Liu, Linbo; Chen, Peng; Xu, Chenjie

    2017-10-01

    Skin interstitial fluid (ISF) is an emerging source of biomarkers for disease diagnosis and prognosis. Microneedle (MN) patch has been identified as an ideal platform to extract ISF from the skin due to its pain-free and easy-to-administrated properties. However, long sampling time is still a serious problem which impedes timely metabolic analysis. In this study, a swellable MN patch that can rapidly extract ISF is developed. The MN patch is made of methacrylated hyaluronic acid (MeHA) and further crosslinked through UV irradiation. Owing to the supreme water affinity of MeHA, this MN patch can extract sufficient ISF in a short time without the assistance of extra devices, which remarkably facilitates timely metabolic analysis. Due to covalent crosslinked network, the MN patch maintains the structure integrity in the swelling hydrated state without leaving residues in skin after usage. More importantly, the extracted ISF metabolites can be efficiently recovered from MN patch by centrifugation for the subsequent offline analysis of metabolites such as glucose and cholesterol. Given the recent trend of easy-to-use point-of-care devices for personal healthcare monitoring, this study opens a new avenue for the development of MN-based microdevices for sampling ISF and minimally invasive metabolic detection. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Energy Technology Data Exchange (ETDEWEB)

    Li Shikuo; Shen Yuhua; Xie Anjian; Yu Xuerong; Zhang Xiuzhen; Yang Liangbao; Li Chuanhao [School of Chemistry and Chemical Engineering, Anhui University, Hefei 230039 (China)

    2007-10-10

    We describe the formation of amorphous selenium ({alpha}-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO{sub 3}{sup 2-}) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO{sub 3}{sup 2-} ions to Se{sup 0}, but also controls the nucleation and growth of Se{sup 0}, and even participates in the formation of {alpha}-Se/protein composites. The size and shell thickness of the {alpha}-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO{sub 3}{sup 2-} ions by Capsicum annuum L extract.

  3. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    International Nuclear Information System (INIS)

    Li Shikuo; Shen Yuhua; Xie Anjian; Yu Xuerong; Zhang Xiuzhen; Yang Liangbao; Li Chuanhao

    2007-01-01

    We describe the formation of amorphous selenium (α-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO 3 2- ) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO 3 2- ions to Se 0 , but also controls the nucleation and growth of Se 0 , and even participates in the formation of α-Se/protein composites. The size and shell thickness of the α-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO 3 2- ions by Capsicum annuum L extract

  4. An Optimized Protocol for DNA Extraction from Wheat Seeds and Loop-Mediated Isothermal Amplification (LAMP to Detect Fusarium graminearum Contamination of Wheat Grain

    Directory of Open Access Journals (Sweden)

    Mohamed Moslem

    2011-06-01

    Full Text Available A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  5. An optimized protocol for DNA extraction from wheat seeds and Loop-Mediated Isothermal Amplification (LAMP) to detect Fusarium graminearum contamination of wheat grain.

    Science.gov (United States)

    Abd-Elsalam, Kamel; Bahkali, Ali; Moslem, Mohamed; Amin, Osama E; Niessen, Ludwig

    2011-01-01

    A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs) were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP) procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  6. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Science.gov (United States)

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

    2012-05-01

    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  8. Antioxidant Activity of Lawsonia inermis Extracts Inhibits Chromium(VI-Induced Cellular and DNA Toxicity

    Directory of Open Access Journals (Sweden)

    Gunjan Guha

    2011-01-01

    Full Text Available Hexavalent chromium Cr(VI is a very strong oxidant which consequently causes high cytotoxicity through oxidative stress. Prevention of Cr(VI-induced cellular damage has been sought in this study in aqueous and methanolic extracts of Lawsonia inermis Linn. (Lythraceae, commonly known as Henna. The extracts showed significant (P < .05 potential in scavenging free radicals (DPPH• and ABTS•+ and Fe3+, and in inhibiting lipid peroxidation. DNA damage caused by exposure of pBR322 to Cr(VI-UV is markedly inhibited by both extracts in varying degrees. A distinct decline in Cr(VI-induced cytotoxicity was noticed in MDA-MB-435S (human breast carcinoma cells with an increase in dosage of both extracts individually. Furthermore, both extracts proved to contain a high content of phenolic compounds which were found to have a strong and significant (P < .05 positive correlation to the radical scavenging potential, lipid peroxidation inhibition capacity and cyto-protective efficiency against Cr(VI-induced oxidative cellular damage. HPLC analysis identified some of the major phenolic compounds in both extracts, which might be responsible for the antioxidant potential and the properties of DNA and cyto-protection. This study contributes to the search for natural resources that might yield potent therapeutic drugs against Cr(VI-induced oxidative cell damage.

  9. High-capacity conductive nanocellulose paper sheets for electrochemically controlled extraction of DNA oligomers.

    Directory of Open Access Journals (Sweden)

    Aamir Razaq

    Full Text Available Highly porous polypyrrole (PPy-nanocellulose paper sheets have been evaluated as inexpensive and disposable electrochemically controlled three-dimensional solid phase extraction materials. The composites, which had a total anion exchange capacity of about 1.1 mol kg(-1, were used for extraction and subsequent release of negatively charged fluorophore tagged DNA oligomers via galvanostatic oxidation and reduction of a 30-50 nm conformal PPy layer on the cellulose substrate. The ion exchange capacity, which was, at least, two orders of magnitude higher than those previously reached in electrochemically controlled extraction, originated from the high surface area (i.e. 80 m(2 g(-1 of the porous composites and the thin PPy layer which ensured excellent access to the ion exchange material. This enabled the extractions to be carried out faster and with better control of the PPy charge than with previously employed approaches. Experiments in equimolar mixtures of (dT(6, (dT(20, and (dT(40 DNA oligomers showed that all oligomers could be extracted, and that the smallest oligomer was preferentially released with an efficiency of up to 40% during the reduction of the PPy layer. These results indicate that the present material is very promising for the development of inexpensive and efficient electrochemically controlled ion-exchange membranes for batch-wise extraction of biomolecules.

  10. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    Alyssa D. Ammazzalorso

    2015-08-01

    Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  11. UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract

    International Nuclear Information System (INIS)

    Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh

    2016-01-01

    UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)

  12. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  13. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    International Nuclear Information System (INIS)

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.

    2001-01-01

    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7

  14. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Science.gov (United States)

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  15. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  16. Pomegranate extract protects against cerebral ischemia/reperfusion injury and preserves brain DNA integrity in rats.

    Science.gov (United States)

    Ahmed, Maha A E; El Morsy, Engy M; Ahmed, Amany A E

    2014-08-21

    Interruption to blood flow causes ischemia and infarction of brain tissues with consequent neuronal damage and brain dysfunction. Pomegranate extract is well tolerated, and safely consumed all over the world. Interestingly, pomegranate extract has shown remarkable antioxidant and anti-inflammatory effects in experimental models. Many investigators consider natural extracts as novel therapies for neurodegenerative disorders. Therefore, this study was carried out to investigate the protective effects of standardized pomegranate extract against cerebral ischemia/reperfusion-induced brain injury in rats. Adult male albino rats were randomly divided into sham-operated control group, ischemia/reperfusion (I/R) group, and two other groups that received standardized pomegranate extract at two dose levels (250, 500 mg/kg) for 15 days prior to ischemia/reperfusion (PMG250+I/R, and PMG500+I/R groups). After I/R or sham operation, all rats were sacrificed and brains were harvested for subsequent biochemical analysis. Results showed reduction in brain contents of MDA (malondialdehyde), and NO (nitric oxide), in addition to enhancement of SOD (superoxide dismutase), GPX (glutathione peroxidase), and GRD (glutathione reductase) activities in rats treated with pomegranate extract prior to cerebral I/R. Moreover, pomegranate extract decreased brain levels of NF-κB p65 (nuclear factor kappa B p65), TNF-α (tumor necrosis factor-alpha), caspase-3 and increased brain levels of IL-10 (interleukin-10), and cerebral ATP (adenosine triphosphate) production. Comet assay showed less brain DNA (deoxyribonucleic acid) damage in rats protected with pomegranate extract. The present study showed, for the first time, that pre-administration of pomegranate extract to rats, can offer a significant dose-dependent neuroprotective activity against cerebral I/R brain injury and DNA damage via antioxidant, anti-inflammatory, anti-apoptotic and ATP-replenishing effects. Copyright © 2014 Elsevier Inc

  17. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  18. CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

    Directory of Open Access Journals (Sweden)

    MacKinnon Ruth N

    2012-02-01

    Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

  19. Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

    Science.gov (United States)

    Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

    2016-01-01

    FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

  20. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    OpenAIRE

    Sandoval-Arias, Shirleny Monserrat

    2014-01-01

    La identificación de sospechosos en casos criminales se ha facilitado desde la aplicación de pruebas de ADN a diferentes muestras. El uso de esta técnica para la tipificación forense a partir de muestras fecales humanas aún presenta complicaciones, por lo que en esta investigación se evaluaron dos protocolos de extracción de ADN con ciertas modificaciones para determinar el de mayor efectividad. Se realizaron extracciones orgánicas y mediante el kit comercial “DNA IQTM Casework Sample Kit par...

  1. The fruit extract of Berberis crataegina DC: exerts potent antioxidant activity and protects DNA integrity.

    Science.gov (United States)

    Charehsaz, Mohammad; Sipahi, Hande; Celep, Engin; Üstündağ, Aylin; Cemiloğlu Ülker, Özge; Duydu, Yalçın; Aydın, Ahmet; Yesilada, Erdem

    2015-04-17

    Dried fruits of Berberis crataegina (Berberidaceae) have been frequently consumed as food garniture in Turkish cuisine, while its fruit paste has been used to increase stamina and in particular to prevent from cardiovascular dysfunctions in Northeastern Black Sea region of Turkey. This study investigated this folkloric information in order to explain the claimed healing effects as well as to evaluate possible risks. Total phenolic, flavonoid and proanthocyanidin contents and antioxidant capacity of the methanolic fruit extract were evaluated through several in vitro assays. The cytotoxic and genotoxic effects of B. crataegina fruit extract were also assessed in both cervical cancer cell line (HeLa) and human peripheral blood lymphocytes. The extract showed protective effects against ferric-induced oxidative stress and had a relatively good antioxidant activity. It also ameliorated the H2O2 mediated DNA damage in lymphocytes, suggesting the protective effect against oxidative DNA damage. The methanolic extract of B. crataegina fruits may be a potential antioxidant nutrient and also may exert a protective role against lipid peroxidation as well as oxidative DNA damage.

  2. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  3. Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

    Science.gov (United States)

    Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

    2010-01-01

    Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

  4. AFSC/RACE/SAP/Shavey: DNA extraction from archived Giemsa-stained blood smears using polymerase chain reaction to detect host and parasitic DNA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...

  5. Solvent extraction method for rapid separation of strontium-90 in milk and food samples

    International Nuclear Information System (INIS)

    Hingorani, S.B.; Sathe, A.P.

    1991-01-01

    A solvent extraction method, using tributyl phosphate, for rapid separation of strontium-90 in milk and other food samples has been presented in this report in view of large number of samples recieved after Chernobyl accident for checking radioactive contamination. The earlier nitration method in use for the determination of 90 Sr through its daughter 90 Y takes over two weeks for analysis of a sample. While by this extraction method it takes only 4 to 5 hours for sample analysis. Complete estimation including initial counting can be done in a single day. The chemical recovery varies between 80-90% compared to nitration method which is 65-80%. The purity of the method has been established by following the decay of yttrium-90 separated. Some of the results obtained by adopting this chemical method for food analysis are included. The method is, thus, found to be rapid and convenient for accurate estimation of strontium-90 in milk and food samples. (author). 2 tabs., 1 fig

  6. DNA extraction from dry museum beetles without conferring external morphological damage

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

    2007-01-01

    undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

  7. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction

    Directory of Open Access Journals (Sweden)

    Jitendra Kumar

    2016-12-01

    Full Text Available Microbes are ubiquitously distributed in nature, and recent culture-independent studies have highlighted the significance of gut microbiota in human health and disease. Fecal DNA is the primary source for the majority of human gut microbiome studies. However, further improvement is needed to obtain fecal metagenomic DNA with sufficient amount and good quality but low host genomic DNA contamination. In the current study, we demonstrate a quick, robust, unbiased, and cost-effective method for the isolation of high molecular weight (>23 kb metagenomic DNA (260/280 ratio >1.8 with a good yield (55.8 ± 3.8 ng/mg of feces. We also confirm that there is very low human genomic DNA contamination (eubacterial: human genomic DNA marker genes = 227.9:1 in the human feces. The newly-developed method robustly performs for fresh as well as stored fecal samples as demonstrated by 16S rRNA gene sequencing using 454 FLX+. Moreover, 16S rRNA gene analysis indicated that compared to other DNA extraction methods tested, the fecal metagenomic DNA isolated with current methodology retains species richness and does not show microbial diversity biases, which is further confirmed by qPCR with a known quantity of spike-in genomes. Overall, our data highlight a protocol with a balance between quality, amount, user-friendliness, and cost effectiveness for its suitability toward usage for culture-independent analysis of the human gut microbiome, which provides a robust solution to overcome key issues associated with fecal metagenomic DNA isolation in human gut microbiome studies.

  8. Preclinical evidence of rapid-onset antidepressant-like effect in Radix Polygalae extract.

    Directory of Open Access Journals (Sweden)

    Im-Joon Shin

    Full Text Available Radix Polygalae (the root of Polygala tenuifolia is a herb widely used in traditional Asian medicine that is thought to exert a variety of neuropsychiatric effects. Radix Polygalae extract can protect against N-methyl D-aspartate (NMDA neurotoxicity and induce brain-derived neurotrophic factor (BDNF expression, suggesting modulatory roles at glutamatergic synapses and possible antidepressant action. In accordance with this hypothesis, Radix Polygalae extract demonstrated antidepressant-like effects in 8-week-old male C57Bl/6 mice by decreasing behavioral despair in the forced swim and tail suspension tasks and increasing hedonic-like behavior in the female urine sniffing test 30 minutes after a single oral administration of 0.1 mg/kg. Reduced latency to acquire a food pellet in the novely suppressed feeding paradigm, without change in anxiety-like behaviors suggested a rapid-onset nature of the antidepressant-like effect. In addition, it decreased the number of failed escapes in the learned helplessness paradigm after two oral administrations 24 hours and 30 minutes before the first test. Finally, it reversed anhedonia as measured by saccharin preference in mice exposed to the chronic stress model after two administrations of 0.1 mg/kg, in contrast to the repeated administration generally needed for similar effect by monoamergic antidepressants. Immobility reduction in tail suspension task was blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA receptor antagonist NBQX, a pattern previously demonstrated by ketamine and other ketamine-like rapid-onset antidepressants. Also similarly to ketamine, Radix Polygalae appeared to acutely decrease phosphorylation of GluR1 serine-845 in the hippocampus while leaving the phosphorylation of hippocampal mTOR serine 2448 unchanged. These findings serve as preclinical evidence that Radix Polygalae extract exerts rapid-onset antidepressant effects by modulating glutamatergic synapses in

  9. DNA immunoprecipitation semiconductor sequencing (DIP-SC-seq) as a rapid method to generate genome wide epigenetic signatures

    OpenAIRE

    Thomson, John P.; Fawkes, Angie; Ottaviano, Raffaele; Hunter, Jennifer M.; Shukla, Ruchi; Mjoseng, Heidi K.; Clark, Richard; Coutts, Audrey; Murphy, Lee; Meehan, Richard R.

    2015-01-01

    Modification of DNA resulting in 5-methylcytosine (5 mC) or 5-hydroxymethylcytosine (5hmC) has been shown to influence the local chromatin environment and affect transcription. Although recent advances in next generation sequencing technology allow researchers to map epigenetic modifications across the genome, such experiments are often time-consuming and cost prohibitive. Here we present a rapid and cost effective method of generating genome wide DNA modification maps utilising commercially ...

  10. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  11. Development of a Rapid and Simple Method to Remove Polyphenols from Plant Extracts

    Directory of Open Access Journals (Sweden)

    Imali Ranatunge

    2017-01-01

    Full Text Available Polyphenols are secondary metabolites of plants, which are responsible for prevention of many diseases. Polyvinylpolypyrrolidone (PVPP has a high affinity towards polyphenols. This method involves the use of PVPP column to remove polyphenols under centrifugal force. Standards of gallic acid, epigallocatechin gallate, vanillin, and tea extracts (Camellia sinensis were used in this study. PVPP powder was packed in a syringe with different quantities. The test samples were layered over the PVPP column and subjected to centrifugation. Supernatant was tested for the total phenol content. The presence of phenolic compounds and caffeine was screened by HPLC and measuring the absorbance at 280. The antioxidant capacity of standards and tea extracts was compared with the polyphenol removed fractions using DPPH scavenging assay. No polyphenols were found in polyphenolic standards or tea extracts after PVPP treatment. The method described in the present study to remove polyphenols is simple, inexpensive, rapid, and efficient and can be employed to investigate the contribution of polyphenols present in natural products to their biological activity.

  12. Rapid column extraction method for actinides and strontium in fish and other animal tissue samples

    International Nuclear Information System (INIS)

    Maxwell III, S.L.; Faison, D.M.

    2008-01-01

    The analysis of actinides and radiostrontium in animal tissue samples is very important for environmental monitoring. There is a need to measure actinide isotopes and strontium with very low detection limits in animal tissue samples, including fish, deer, hogs, beef and shellfish. A new, rapid separation method has been developed that allows the measurement of plutonium, neptunium, uranium, americium, curium and strontium isotopes in large animal tissue samples (100-200 g) with high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin R , TRU Resin R and DGA Resin R cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), and curium (Cm) using a single multi-stage column combined with alphaspectrometry. Strontium is collected on Sr Resin R from Eichrom Technologies (Darien, IL, USA). After acid digestion and furnace heating of the animal tissue samples, the actinides and 89/90 Sr are separated using column extraction chromatography. This method has been shown to be effective over a wide range of animal tissue matrices. Vacuum box cartridge technology with rapid flow rates is used to minimize sample preparation time. (author)

  13. A three-phase microfluidic chip for rapid sample clean-up of alkaloids from plant extracts

    NARCIS (Netherlands)

    Tetala, K.K.R.; Swarts, J.W.; Chen, B.; Janssen, A.E.M.; Beek, van T.A.

    2009-01-01

    A three-phase microchip was developed for the rapid and efficient small-scale purification of alkaloids from plant extracts. As part of the development of such a three-phase microchip, first a two-phase microchip with two channels (3.2 cm and 9.3 cm) was used to study the extraction efficiency of

  14. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    Science.gov (United States)

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  15. Development of Novel Method for Rapid Extract of Radionuclides from Solution Using Polymer Ligand Film

    Science.gov (United States)

    Rim, Jung H.

    Accurate and fast determination of the activity of radionuclides in a sample is critical for nuclear forensics and emergency response. Radioanalytical techniques are well established for radionuclides measurement, however, they are slow and labor intensive, requiring extensive radiochemical separations and purification prior to analysis. With these limitations of current methods, there is great interest for a new technique to rapidly process samples. This dissertation describes a new analyte extraction medium called Polymer Ligand Film (PLF) developed to rapidly extract radionuclides. Polymer Ligand Film is a polymer medium with ligands incorporated in its matrix that selectively and rapidly extract analytes from a solution. The main focus of the new technique is to shorten and simplify the procedure necessary to chemically isolate radionuclides for determination by alpha spectrometry or beta counting. Five different ligands were tested for plutonium extraction: bis(2-ethylhexyl) methanediphosphonic acid (H2DEH[MDP]), di(2-ethyl hexyl) phosphoric acid (HDEHP), trialkyl methylammonium chloride (Aliquat-336), 4,4'(5')-di-t-butylcyclohexano 18-crown-6 (DtBuCH18C6), and 2-ethylhexyl 2-ethylhexylphosphonic acid (HEH[EHP]). The ligands that were effective for plutonium extraction further studied for uranium extraction. The plutonium recovery by PLFs has shown dependency on nitric acid concentration and ligand to total mass ratio. H2DEH[MDP] PLFs performed best with 1:10 and 1:20 ratio PLFs. 50.44% and 47.61% of plutonium were extracted on the surface of PLFs with 1M nitric acid for 1:10 and 1:20 PLF, respectively. HDEHP PLF provided the best combination of alpha spectroscopy resolution and plutonium recovery with 1:5 PLF when used with 0.1M nitric acid. The overall analyte recovery was lower than electrodeposited samples, which typically has recovery above 80%. However, PLF is designed to be a rapid field deployable screening technique and consistency is more important

  16. DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, K.R. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Borba, J.C. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Meija, M. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Mills, D.L. [TeGrex Technologies, Sperryville, VA 22740 (United States); Haverstick, D.M. [Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States); Olson, K.E.; Aranda, R. [Office of the Chief Scientist, Defense Forensic Science Center, N 31st Street, Atlanta, GA 30297 (United States); Garner, G.T. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Carrilho, E. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Landers, J.P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-09-21

    We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. - Highlights: • dSPE design on centrifugal PeT device with a unique mixing strategy was proposed. • Increased fluidic control with novel adhesive tape valves on a PeT device. • Multiplexed spin-dSPE device to run up to 4 samples simultaneously. • Demonstrated strong singleplexed and multiplexed amplification following chip dSPE.

  17. A Simple Thermoplastic Substrate Containing Hierarchical Silica Lamellae for High-Molecular-Weight DNA Extraction.

    Science.gov (United States)

    Zhang, Ye; Zhang, Yi; Burke, Jeffrey M; Gleitsman, Kristin; Friedrich, Sarah M; Liu, Kelvin J; Wang, Tza-Huei

    2016-12-01

    An inexpensive, magnetic thermoplastic nanomaterial is developed utilizing a hierarchical layering of micro- and nanoscale silica lamellae to create a high-surface-area and low-shear substrate capable of capturing vast amounts of ultrahigh-molecular-weight DNA. Extraction is performed via a simple 45 min process and is capable of achieving binding capacities up to 1 000 000 times greater than silica microparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Evaluation of simplified dna extraction methods for EMM typing of group a streptococci

    Directory of Open Access Journals (Sweden)

    Jose JJM

    2006-01-01

    Full Text Available Simplified methods of DNA extraction for amplification and sequencing for emm typing of group A streptococci (GAS can save valuable time and cost in resource crunch situations. To evaluate this, we compared two methods of DNA extraction directly from colonies with the standard CDC cell lysate method for emm typing of 50 GAS strains isolated from children with pharyngitis and impetigo. For this, GAS colonies were transferred into two sets of PCR tubes. One set was preheated at 94oC for two minutes in the thermal cycler and cooled while the other set was frozen overnight at -20oC and then thawed before adding the PCR mix. For the cell lysate method, cells were treated with mutanolysin and hyaluronidase before heating at 100oC for 10 minutes and cooling immediately as recommended in the CDC method. All 50 strains could be typed by sequencing the hyper variable region of the emm gene after amplification. The quality of sequences and the emm types identified were also identical. Our study shows that the two simplified DNA extraction methods directly from colonies can conveniently be used for typing a large number of GAS strains easily in relatively short time.

  19. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  20. PROTOCOL FOR EXTRACTION OF BACTERIAL METAGENOME DNA TO PRAWN Macrobrachium carcinus L

    Directory of Open Access Journals (Sweden)

    J U González de la Cruz

    2011-07-01

    Full Text Available In this work we adapted a protocol for the extraction of metagenomic DNA (ADNmg bacteria in the digestive system (intestines, stomach and hepatopancreas of Macrobrachium carcinus L., with reference to the method of extracting bacterial DNA from soils and sediments (Rojas-Herrera et al., 2008. This methodology consisted of enzymatic, physics, mechanics and chemistry after a series of tests was abolished enzymatic lysis. However, the success ADNmg extraction was influenced mainly by the preparation of the samples, in particular the hepatopancreas, where it was necessary to remove the fat by thermal shock temperature and phase separation by centrifugation with the sample frozen.The effectiveness of isolated DNA fragmentation was verified by gel electrophoresis in denaturing gradient (DGGE after amplification with universal primers. In general, it had a low diversity (19 phylotypes between the different organs analyzed of 13.5 ± 1 (intestines to 11.7 ± 0.96 (stomach. The Shannon-Weaver index (2.45, Simpsons (10.88 and equity (0972 obtained from the digitization of the image of the gel, suggested that the phylotypes that form the gut microflora M. carcinus, is distributed unevenly between the different organs analyzed.

  1. A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

    DEFF Research Database (Denmark)

    Lever, Mark; Torti, Andrea; Eickenbusch, Philip

    2015-01-01

    tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world...... DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample...

  2. Feasibility of RNA and DNA Extraction from Fresh Pipelle and Archival Endometrial Tissues for Use in Gene Expression and SNP Arrays

    Directory of Open Access Journals (Sweden)

    Heather D. Kissel

    2013-01-01

    Full Text Available Identifying molecular markers of endometrial hyperplasia (neoplasia progression is critical to cancer prevention. To assess RNA and DNA quantity and quality from routinely collected endometrial samples and evaluate the performance of RNA- and DNA-based arrays across endometrial tissue types, we collected fresh frozen (FF Pipelle, FF curettage, and formalin-fixed paraffin-embedded (FFPE hysterectomy specimens (benign indications from eight women. Additionally, neoplastic and uninvolved tissues from 24 FFPE archival hysterectomy specimens with endometrial hyperplasias and carcinomas were assessed. RNA was extracted from 15 of 16 FF and 51 of 51 FFPE samples, with yields >1.2 μg for 13/15 (87% FF and 50/51 (98% FFPE samples. Extracted RNA was of high quality; all samples performed successfully on the Illumina whole-genome cDNA-mediated annealing, selection, extension, and ligation (WG-DASL array and performance did not vary by tissue type. While DNA quantity from FFPE samples was excellent, quality was not sufficient for successful performance on the Affymetrix SNP Array 6.0. In conclusion, FF Pipelle samples, which are minimally invasive, yielded excellent quantity and quality of RNA for gene expression arrays (similar to FF curettage and should be considered for use in genomic studies. FFPE-derived DNA should be evaluated on new rapidly evolving sequencing platforms.

  3. Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

    Directory of Open Access Journals (Sweden)

    Elena Ordoñez

    2013-01-01

    Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

  4. DNA microarray unravels rapid changes in transcriptome of MK-801 treated rat brain

    Science.gov (United States)

    Kobayashi, Yuka; Kulikova, Sofya P; Shibato, Junko; Rakwal, Randeep; Satoh, Hiroyuki; Pinault, Didier; Masuo, Yoshinori

    2015-01-01

    AIM: To investigate the impact of MK-801 on gene expression patterns genome wide in rat brain regions. METHODS: Rats were treated with an intraperitoneal injection of MK-801 [0.08 (low-dose) and 0.16 (high-dose) mg/kg] or NaCl (vehicle control). In a first series of experiment, the frontoparietal electrocorticogram was recorded 15 min before and 60 min after injection. In a second series of experiments, the whole brain of each animal was rapidly removed at 40 min post-injection, and different regions were separated: amygdala, cerebral cortex, hippocampus, hypothalamus, midbrain and ventral striatum on ice followed by DNA microarray (4 × 44 K whole rat genome chip) analysis. RESULTS: Spectral analysis revealed that a single systemic injection of MK-801 significantly and selectively augmented the power of baseline gamma frequency (30-80 Hz) oscillations in the frontoparietal electroencephalogram. DNA microarray analysis showed the largest number (up- and down- regulations) of gene expressions in the cerebral cortex (378), midbrain (376), hippocampus (375), ventral striatum (353), amygdala (301), and hypothalamus (201) under low-dose (0.08 mg/kg) of MK-801. Under high-dose (0.16 mg/kg), ventral striatum (811) showed the largest number of gene expression changes. Gene expression changes were functionally categorized to reveal expression of genes and function varies with each brain region. CONCLUSION: Acute MK-801 treatment increases synchrony of baseline gamma oscillations, and causes very early changes in gene expressions in six individual rat brain regions, a first report. PMID:26629322

  5. The coupling of rapidly synergistic cloud point extraction with thermospray flame furnace atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Wen, X.; Deng, Q.; Guo, J.; Zhao, X.; Zhao, Y.; Ji, S.

    2012-01-01

    Rapidly synergistic cloud point extraction (RS-CPE) was coupled with thermospray flame furnace atomic absorption spectrometry (TS-FF-AAS) to result in new CPE patterns and accelerated (1 min) protocols. It is demonstrated, for the case of copper (II) ion, that TS-FF-AAS improves the sampling efficiency and the sensitivity of FAAS determinations. Problems of nebulization associated with previous methods based on the coupling of FAAS and RS-CPE are overcome. TS-FF-AAS also improves sensitivity and gives a limit of detection for copper of 0.20 μg L -1 , which is better by a factor of 32. Compared to direct FAAS, the factor is 114. (author)

  6. Toxic reagents and expensive equipment: are they really necessary for the extraction of good quality fungal DNA?

    Science.gov (United States)

    Rodrigues, P; Venâncio, A; Lima, N

    2018-01-01

    The aim of this work was to evaluate a fungal DNA extraction procedure with the lowest inputs in terms of time as well as of expensive and toxic chemicals, but able to consistently produce genomic DNA of good quality for PCR purposes. Two types of fungal biological material were tested - mycelium and conidia - combined with two protocols for DNA extraction using Sodium Dodecyl Sulphate (SDS) and Cetyl Trimethyl Ammonium Bromide as extraction buffers and glass beads for mechanical disruption of cell walls. Our results showed that conidia and SDS buffer was the combination that lead to the best DNA quality and yield, with the lowest variation between samples. This study clearly demonstrates that it is possible to obtain high yield and pure DNA from pigmented conidia without the use of strong cell disrupting procedures and of toxic reagents. There are numerous methods for DNA extraction from fungi. Some rely on expensive commercial kits and/or equipments, unavailable for many laboratories, or make use of toxic chemicals such as chloroform, phenol and mercaptoethanol. This study clearly demonstrates that it is possible to obtain high yields of pure DNA from pigmented conidia without the use of strong and expensive cell disrupting procedures and of toxic reagents. The method herein described is simultaneously inexpensive and adequate to DNA extraction from several different types of fungi. © 2017 The Society for Applied Microbiology.

  7. Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

    International Nuclear Information System (INIS)

    Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

    2011-01-01

    Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

  8. Endonuclease activities in extracts of Micrococcus luteus that act on. gamma. -irradiated DNA

    Energy Technology Data Exchange (ETDEWEB)

    Schoen-Bopp, A; Schaefer, G; Hagen, U [Kernforschungszentrum Karlsruhe (Germany, F.R.). Inst. fuer Strahlenbiologie

    1977-03-01

    Several protein fractions containing endonuclease activity against ..gamma..-irradiated DNA (..gamma..-endonuclease) were isolated from M.luteus. The crude extract was eluted on a phosphocellulose column and chromatographed on TEAE cellulose and subsequently on hydroxypatite. Five peaks of ..gamma..-endonuclease were obtained from each preparation. Repeated experiments showed comparable chromatographic behaviour of the fractions. There was no detectable activity of uv-endonuclease in the fractions with ..gamma..-endonuclease but a small contamination of endonuclease against unirradiated DNA and against DNA with apurinic sites. The ..gamma..-endonuclease was stimulated by, but was not dependent on, magnesium. Several tests for endonuclease activity have been used: the analysis of strand breaks in calf-thymus DNA or in PM2 DNA, and the determination of end-groups formed by endonuclease, either 3'OH end-groups or phosphomonoester end groups. From the results obtained it can be assumed that the strand breaks induced by the ..gamma..-endonuclease carry 3'OH and 5' phosphate end groups.

  9. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  10. Camptosorus sibiricus rupr aqueous extract prevents lung tumorigenesis via dual effects against ROS and DNA damage.

    Science.gov (United States)

    He, Shugui; Ou, Rilan; Wang, Wensheng; Ji, Liyan; Gao, Hui; Zhu, Yuanfeng; Liu, Xiaomin; Zheng, Hongming; Liu, Zhongqiu; Wu, Peng; Lu, Linlin

    2018-06-28

    Camptosorus sibiricus Rupr (CSR) is a widely used herbal medicine with antivasculitis, antitrauma, and antitumor effects. However, the effect of CSR aqueous extract on B[a]P-initiated tumorigenesis and the underlying mechanism remain unclear. Moreover, the compounds in CSR aqueous extract need to be identified and structurally characterized. We aim to investigate the chemopreventive effect of CSR and the underlying molecular mechanism. A B[a]P-stimulated normal cell model (BEAS.2B) and lung adenocarcinoma animal model were established on A/J mice. In B[a]P-treated BEAS.2B cells, the protective effects of CSR aqueous extract on B[a]P-induced DNA damage and ROS production were evaluated through flow cytometry, Western blot, real-time quantitative PCR, single-cell gel electrophoresis, and immunofluorescence. Moreover, a model of B[a]P-initiated lung adenocarcinoma was established on A/J mice to determine the chemopreventive effect of CSR in vivo. The underlying mechanism was analyzed via immunohistochemistry and microscopy. Furthermore, the new compounds in CSR aqueous extract were isolated and structurally characterized using IR, HR-ESI-MS, and 1D and 2D NMR spectroscopy. CSR effectively suppressed ROS production by re-activating Nrf2-mediated reductases HO-1 and NQO-1. Simultaneously, CSR attenuated the DNA damage of BEAS.2B cells in the presence of B[a]P. Moreover, CSR at 1.5 and 3 g/kg significantly suppressed tumorigenesis with tumor inhibition ratios of 36.65% and 65.80%, respectively. The tumor volume, tumor size, and multiplicity of B[a]P-induced lung adenocarcinoma were effectively decreased by CSR in vivo. After extracting and identifying the compounds in CSR aqueous extract, three new triterpene saponins were isolated and characterized structurally. CSR aqueous extract prevents lung tumorigenesis by exerting dual effects against ROS and DNA damage, suggesting that CSR is a novel and effective agent for B[a]P-induced carcinogenesis. Moreover, by isolating

  11. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  12. Sources of pre-analytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC.

    Directory of Open Access Journals (Sweden)

    Elodie Caboux

    Full Text Available The European Prospective Investigation into Cancer and nutrition (EPIC is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88% performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies.

  13. KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

    Science.gov (United States)

    Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

    2011-12-01

    DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

  14. A simple and efficient total genomic DNA extraction method for individual zooplankton.

    Science.gov (United States)

    Fazhan, Hanafiah; Waiho, Khor; Shahreza, Md Sheriff

    2016-01-01

    Molecular approaches are widely applied in species identification and taxonomic studies of minute zooplankton. One of the most focused zooplankton nowadays is from Subclass Copepoda. Accurate species identification of all life stages of the generally small sized copepods through molecular analysis is important, especially in taxonomic and systematic assessment of harpacticoid copepod populations and to understand their dynamics within the marine community. However, total genomic DNA (TGDNA) extraction from individual harpacticoid copepods can be problematic due to their small size and epibenthic behavior. In this research, six TGDNA extraction methods done on individual harpacticoid copepods were compared. The first new simple, feasible, efficient and consistent TGDNA extraction method was designed and compared with the commercial kit and modified available TGDNA extraction methods. The newly described TGDNA extraction method, "Incubation in PCR buffer" method, yielded good and consistent results based on the high success rate of PCR amplification (82%) compared to other methods. Coupled with its relatively consistent and economical method the "Incubation in PCR buffer" method is highly recommended in the TGDNA extraction of other minute zooplankton species.

  15. Extractive Atmospheric Pressure Photoionization (EAPPI) Mass Spectrometry: Rapid Analysis of Chemicals in Complex Matrices.

    Science.gov (United States)

    Liu, Chengyuan; Yang, Jiuzhong; Wang, Jian; Hu, Yonghua; Zhao, Wan; Zhou, Zhongyue; Qi, Fei; Pan, Yang

    2016-10-01

    Extractive atmospheric pressure photoionization (EAPPI) mass spectrometry was designed for rapid qualitative and quantitative analysis of chemicals in complex matrices. In this method, an ultrasonic nebulization system was applied to sample extraction, nebulization, and vaporization. Mixed with a gaseous dopant, vaporized analytes were ionized through ambient photon-induced ion-molecule reactions, and were mass-analyzed by a high resolution time-of-flight mass spectrometer (TOF-MS). After careful optimization and testing with pure sample solution, EAPPI was successfully applied to the fast screening of capsules, soil, natural products, and viscous compounds. Analysis was completed within a few seconds without the need for preseparation. Moreover, the quantification capability of EAPPI for matrices was evaluated by analyzing six polycyclic aromatic hydrocarbons (PAHs) in soil. The correlation coefficients (R (2) ) for standard curves of all six PAHs were above 0.99, and the detection limits were in the range of 0.16-0.34 ng/mg. In addition, EAPPI could also be used to monitor organic chemical reactions in real time. Graphical Abstract ᅟ.

  16. Selection of the most suitable method for the extraction of DNA from foods and feeds for species identification

    Directory of Open Access Journals (Sweden)

    Michaela Nesvadbová

    2010-01-01

    Full Text Available High quality and purity of DNA isolated from food and feed is essential for species identification and has unpredictable influences an effect of analysis. In this study, the efficiency of eight different methods for DNA isolation was investigated. For DNA extraction, the raw chicken meet, ham, sausages, tinned lunch meat, pate, tinned feeds for dogs, complete granulated feeds for dogs and chicken flour were used. Kits of several different producers, i.e.: NucleoSpin Food (Marchery-Nagel, Wizard Genomic DNA Purification Kit (Promega, Invisorb Spin Food Kit I (Invitek, Wizard SV Genomic DNA Purification System (Promega, JetQuick Tissue DNA Spin Kit (Genomed, RNA Blue (Top-Bio, JetQuick Blood & Cell Culture Kit (Genomed, QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit (Qiagen were employed in the study. Gel agarose electrophoresis for primary verification of DNA quality was performed. The isolates were subsequently assessed for quantity and quality using by spectrophotometer Nanodrop 2000 (Thermo Scientific. To verify of template usability and quality of isolated DNA, the polymerase chain reaction (PCR was used.Differences between isolated DNA from tinned products and meat, ham, sausage, granulated dog feed and chicken flour were found. In tinned food and feed, the DNA was more degraded, DNA content and DNA purity was lower and also PCR amplification was the most difficult. Overall DNA yield and quality have important influence on PCR products amplification. The best results were obtained with NucleoSpin Food and JetQuick Tissue DNA Spin Kit. DNA extracted by these methods proved highest yields, purity and template quality in all foods and feeds and the results of PCR analysis are excellent reproducible. Analyses showed that results depended on different food or feed using and dif­fe­rent isolation system.The results of this work will be utilized to choose the suitable isolating kit for educational course, which is designed for students and

  17. Human Mobility Analysis for Extracting Local Interactions under Rapid Socio-Economic Transformation in Dawei, Myanmar

    Directory of Open Access Journals (Sweden)

    Satomi Kimijima

    2017-09-01

    Full Text Available Understanding human mobility patterns provides knowledge about impacts of a socio-economic transformation in a rapidly urbanizing environment. This study assesses a long-term mobility data which uses a face-to-face questionnaire and GPS logger-based method of data collection for extracting socio-economic impacts from the rapid transformation. Conversion of mobility related information such as travel distance, direction, and time from the questionnaire survey into spatiotemporal information was carried out by developing an algorithm. To illustrate the proposed approach, a case study in Dawei Special Economic Zone, Myanmar was conducted. The results show that the questionnaire-based mobility data can be associated with GPS-based mobility data and diverse mobility patterns are found for different social groups in the stage of urban formation. The results enabled an understanding of the human dynamics in interactions, which can be used for monitoring rural sustainability and its challenges in the future with the background of the accelerated project development in the area.

  18. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  19. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-01-01

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  20. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Directory of Open Access Journals (Sweden)

    Cássia Yumi Ikuta

    2016-11-01

    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  1. Effects of an extract from the sea squirt Ecteinascidia turbinata on DNA synthesis and excision repair in human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dunn, W.C.; Carrier, W.L.; Regan, J.D.

    1982-01-01

    An aqueous ethanol extract from the marine tunicate species Ecteinascidia turbinata was studied to determine its effect on semiconservative DNA synthesis in human skin fibroblast cultures as measured by (/sup 3/H) thymidine uptake in acid-insoluble cell fractions. In addition, the effect of this extract on DNA excision repair in ultraviolet light (254 nm) irradiated fibroblasts was measured by the bromodeoxyuridine photolysis assay, thymine dimer chromatography, and DNA single-strand break analysis on alkaline sucrose gradients. Repair inhibition was accompanied by an accumulation of single-strand DNA breaks which was enhanced by the addtion of 2 mM hydroxyurea. These results are discussed with respect to a mechanism of action of the marine tunicate extract at the level of DNA polymerases and are contrasted with previously studied inhibitory mechanisms of arabinofuranosyl nucleosides.

  2. Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

    Directory of Open Access Journals (Sweden)

    Zakia Khanam

    2015-10-01

    Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

  3. High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

    DEFF Research Database (Denmark)

    Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke

    2013-01-01

    the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

  4. Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers

    Science.gov (United States)

    Harika, Katakam; Mahla, Ranjeet Singh; Shivaji, Sisinthy

    2012-01-01

    Background Non-invasively collected samples allow a variety of genetic studies on endangered and elusive species. However due to low amplification success and high genotyping error rates fewer samples can be identified up to the individual level. Number of PCRs needed to obtain reliable genotypes also noticeably increase. Methods We developed a quantitative PCR assay to measure and grade amplifiable nuclear DNA in feline faecal extracts. We determined DNA degradation in experimentally aged faecal samples and tested a suite of pre-PCR protocols to considerably improve DNA retrieval. Results Average DNA concentrations of Grade I, II and III extracts were 982pg/µl, 9.5pg/µl and 0.4pg/µl respectively. Nearly 10% of extracts had no amplifiable DNA. Microsatellite PCR success and allelic dropout rates were 92% and 1.5% in Grade I, 79% and 5% in Grade II, and 54% and 16% in Grade III respectively. Our results on experimentally aged faecal samples showed that ageing has a significant effect on quantity and quality of amplifiable DNA (pDNA degradation occurs within 3 days of exposure to direct sunlight. DNA concentrations of Day 1 samples stored by ethanol and silica methods for a month varied significantly from fresh Day 1 extracts (p0.05). DNA concentrations of fresh tiger and leopard faecal extracts without addition of carrier RNA were 816.5pg/µl (±115.5) and 690.1pg/µl (±207.1), while concentrations with addition of carrier RNA were 49414.5pg/µl (±9370.6) and 20982.7pg/µl (±6835.8) respectively. Conclusions Our results indicate that carnivore faecal samples should be collected as freshly as possible, are better preserved by two-step method and should be extracted with addition of carrier RNA. We recommend quantification of template DNA as this facilitates several downstream protocols. PMID:23071624

  5. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    Science.gov (United States)

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  6. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  7. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

    Directory of Open Access Journals (Sweden)

    Wajhul Qamar

    2017-11-01

    Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

  8. The Extraction and Partial Purification of Bacterial DNA as a Practical Exercise for GCE Advanced Level Students.

    Science.gov (United States)

    Falconer, A. C.; Hayes, L. J.

    1986-01-01

    Describes a relatively simple method of extraction and purification of bacterial DNA. This technique permits advanced secondary-level science students to obtain adequate amounts of DNA from very small pellets of bacteria and to observe some of its polymer properties. (ML)

  9. The effect of DNA extraction methods on observed microbial communities from fibrous and liquid rumen fractions of dairy cows

    NARCIS (Netherlands)

    Vaidya, Jueeli D.; Bogert, van den Bartholomeus; Boekhorst, Jos; Saccenti, Edoardo; Plugge, Caroline M.; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of

  10. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Science.gov (United States)

    Adamowicz, Michael S; Stasulli, Dominique M; Sobestanovich, Emily M; Bille, Todd W

    2014-01-01

    Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  11. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Directory of Open Access Journals (Sweden)

    Michael S Adamowicz

    Full Text Available Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  12. Acanthus ilicifolius plant extract prevents DNA alterations in a transplantable Ehrlich ascites carcinoma-bearing murine model.

    Science.gov (United States)

    Chakraborty, Tridib; Bhuniya, Dipak; Chatterjee, Mary; Rahaman, Mosiur; Singha, Dipak; Chatterjee, Baidya Nath; Datta, Subrata; Rana, Ajay; Samanta, Kartick; Srivastawa, Sunil; Maitra, Sankar K; Chatterjee, Malay

    2007-12-28

    To investigate the chemopreventive efficacy of the Indian medicinal plant Acanthus ilicifolius L Acanthaceae in a transplantable Ehrlich ascites carcinoma (EAC)-bearing murine model. Male Swiss albino mice were divided into four groups: Group A was the untreated normal control; Group B was the EAC control mice group that received serial, intraperitoneal (ip) inoculations of rapidly proliferating 2 x 10(5) viable EAC cells in 0.2 mL of sterile phosphate buffered saline; Group C was the plant extract-treated group that received the aqueous leaf extract (ALE) of the plant at a dose of 2.5 mg/kg body weight by single ip injections, once daily for 10, 20 and 30 consecutive days following tumour inoculation (ALE control); and Group D was the EAC + ALE-treatment group. The chemopreventive potential of the ALE was evaluated in a murine model by studying various biological parameters and genotoxic markers, such as tumour cell count, mean survival of the animals, haematological indices, hepatocellular histology, immunohistochemical expression of liver metallothionein (MT) protein, sister-chromatid exchanges (SCEs), and DNA alterations. Treatment of the EAC-bearing mice with the ALE significantly (P decrement (P single-strand breaks (SSBs) by 38.53% (3.14 +/- 0.31 vs 1.93 +/- 0.23, P < 0.01) in EAC-bearing murine liver. Our data indicate that, ALE is beneficial in restoring haematological and hepatic histological profiles and in lengthening the survival of the animals against the proliferation of ascites tumour in vivo. Finally, the chemopreventive efficacy of the ALE is manifested in limiting MT expression and in preventing DNA alterations in murine liver. The promising results of this study suggest further investigation into the chemopreventive mechanisms of the medicinal plant A. ilicifolius in vivo and in vitro.

  13. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Directory of Open Access Journals (Sweden)

    Yingwei Zhang

    Full Text Available In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs assembled from Cu(II and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1 RCPN binds dye-labeled single-stranded DNA (ssDNA probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2 Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  14. Direct-acting DNA alkylating agents present in aqueous extracts of areca nut and its products.

    Science.gov (United States)

    Hu, Chiung-Wen; Chao, Mu-Rong

    2012-11-19

    Areca nut is a carcinogen to humans and has been strongly associated with oral premalignant and malignant diseases. Previous studies speculated the presence of unknown direct-acting mutagens present in aqueous extracts of areca nut. We hypothesized whether any direct-acting alkylating agents are present in areca nut and its commercial products. In this study, calf thymus DNA was treated with four different aqueous extracts obtained from unripe and ripe areca nuts or their commercial products, namely, pan masala (without tobacco) and gutkha (with tobacco). Three N-alkylated purines including N7-methylguanine (N7-MeG), N3-methyladenine (N3-MeA), and N7-ethylguanine (N7-EtG) were detected using sensitive and specific isotope-dilution liquid chromatography-tandem-mass spectrometry (LC-MS/MS) methods. The results showed that four types of aqueous extracts significantly induced the formation of N7-MeG and N3-MeA in a linear dose-response manner. Extracts from unripe areca nut exhibited higher methylating potency than those of ripe areca nut, while gutkha had higher methylating potency than pan masala. Meanwhile, gutkha made with areca nut and tobacco, was the only extract found to induce the formation of N7-EtG. Overall, this study first demonstrated that the presence of direct-acting alkylating agents in areca nut and its commercial products exist at a level that is able to cause significant DNA damage. Our findings may provide another mechanistic rationale for areca nut-mediated oral carcinogenesis and also highlight the importance and necessity of the identification of these direct-acting alkylating agents.

  15. Rapid extraction of PCDD/Fs from soil and fly ash samples. Pressurized fluid extraction (PFE) and microwave-assisted extraction (MAE)

    Energy Technology Data Exchange (ETDEWEB)

    Sanz, P.; Fabrellas, B. [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas (CIEMAT), Madrid (Spain)

    2004-09-15

    The main reference extraction method in the analysis of polychlorinated dibenzop- dioxins and dibenzofurans (PCDD/Fs) is still the Soxhlet extraction. But it requires long extraction times (up to 24 hs), large volumes of hazardous organic solvents (100-300 ml) and its automation is limited. Pressurized Fluid Extraction (PFE) and Microwave-Assisted Extraction (MAE) are two relatively new extraction techniques that reduce the time and the volume of solvent required for extraction. However, very different PFE extraction conditions are found for the same enviromental matrices in the literature. MAE is not a extraction technique very applied for the analysis of PCDD/Fs yet, although it is used for the determination of other organic compounds, such as PCBs and PAHs. In this study, PFE and MAE extraction conditions were optimized to determine PCDDs y PCDFs in fly ash and soil/sediment samples. Conventional Soxhlet extraction with toluene was used to compare the extraction efficiency of both techniques.

  16. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  17. DNA agarose gel electrophoresis for antioxidant analysis: Development of a quantitative approach for phenolic extracts.

    Science.gov (United States)

    Silva, Sara; Costa, Eduardo M; Vicente, Sandra; Veiga, Mariana; Calhau, Conceição; Morais, Rui M; Pintado, Manuela E

    2017-10-15

    Most of the fast in vitro assays proposed to determine the antioxidant capacity of a compound/extract lack either biological context or employ complex protocols. Therefore, the present work proposes the improvement of an agarose gel DNA electrophoresis in order to allow for a quantitative estimation of the antioxidant capacity of pure phenolic compounds as well as of a phenolic rich extract, while also considering their possible pro-oxidant effects. The result obtained demonstrated that the proposed method allowed for the evaluation of the protection of DNA oxidation [in the presence of hydrogen peroxide (H 2 O 2 ) and an H 2 O 2 /iron (III) chloride (FeCl 3 ) systems] as well as for the observation of pro-oxidant activities, with the measurements registering interclass correlation coefficients above 0.9. Moreover, this method allowed for the characterization of the antioxidant capacity of a blueberry extract while demonstrating that it had no perceived pro-oxidant effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  19. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  20. Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

    Science.gov (United States)

    Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

    2014-02-27

    Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

  1. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  2. Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

    Science.gov (United States)

    Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

    2006-02-09

    Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

  3. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability.

    Science.gov (United States)

    Raieta, Katia; Muccillo, Livio; Colantuoni, Vittorio

    2015-04-01

    Extra virgin olive oil production has a worldwide economic impact. The use of this brand, however, is of great concern to Institutions and private industries because of the increasing number of fraud and adulteration attempts to the market products. Here, we present a novel, reliable and not expensive method for extracting the DNA from commercial virgin and extra virgin olive oils. The DNA is stable overtime and amenable for molecular analyses; in fact, by carrying out simple sequence repeats (SSRs) markers analysis, we characterise the genetic profile of monovarietal olive oils. By comparing the oil-derived pattern with that of the corresponding tree, we can unambiguously identify four cultivars from Samnium, a region of Southern Italy, and distinguish them from reference and more widely used varieties. Through a parentage statistical analysis, we also identify the putative pollinators, establishing an unprecedented and powerful tool for olive oil traceability. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Extraction, amplification and detection of DNA in microfluidic chip-based assays

    KAUST Repository

    Wu, Jinbo

    2013-12-20

    This review covers three aspects of PCR-based microfluidic chip assays: sample preparation, target amplification, and product detection. We also discuss the challenges related to the miniaturization and integration of each assay and make a comparison between conventional and microfluidic schemes. In order to accomplish these essential assays without human intervention between individual steps, the micro-components for fluid manipulation become critical. We therefore summarize and discuss components such as microvalves (for fluid regulation), pumps (for fluid driving) and mixers (for blending fluids). By combining the above assays and microcomponents, DNA testing of multi-step bio-reactions in microfluidic chips may be achieved with minimal external control. The combination of assay schemes with the use of micro-components also leads to rapid methods for DNA testing via multi-step bioreactions. Contains 259 references.

  5. Rapid Screening of Natural Plant Extracts with Calcium Diacetate for Differential Effects Against Foodborne Pathogens and a Probiotic Bacterium.

    Science.gov (United States)

    Colonna, William; Brehm-Stecher, Byron; Shetty, Kalidas; Pometto, Anthony

    2017-12-01

    This study focused on advancing a rapid turbidimetric bioassay to screen antimicrobials using specific cocktails of targeted foodborne bacterial pathogens. Specifically, to show the relevance of this rapid screening tool, the antimicrobial potential of generally recognized as safe calcium diacetate (DAX) and blends with cranberry (NC) and oregano (OX) natural extracts was evaluated. Furthermore, the same extracts were evaluated against beneficial lactic acid bacteria. The targeted foodborne pathogens evaluated were Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus using optimized initial cocktails (∼10 8 colony-forming unit/mL) containing strains isolated from human food outbreaks. Of all extracts evaluated, 0.51% (w/v) DAX in ethanol was the most effective against all four pathogens. However, DAX when reduced to 0.26% and with added blends from ethanol extractions consisting of DAX:OX (3:1), slightly outperformed or was equal to same levels of DAX alone. Subculture of wells in which no growth occurred after 1 week indicated that all water and ethanol extracts were bacteriostatic against the pathogens tested. All the targeted antimicrobials had no effect on the probiotic organism Lactobacillus plantarum. The use of such rapid screening methods combined with the use of multistrain cocktails of targeted foodborne pathogens from outbreaks will allow rapid large-scale screening of antimicrobials and enable further detailed studies in targeted model food systems.

  6. Optimisation of pressurised liquid extraction (PLE) for rapid and efficient extraction of superficial and total mineral oil contamination from dry foods.

    Science.gov (United States)

    Moret, Sabrina; Scolaro, Marianna; Barp, Laura; Purcaro, Giorgia; Sander, Maren; Conte, Lanfranco S

    2014-08-15

    Pressurised liquid extraction (PLE) represents a powerful technique which can be conveniently used for rapid extraction of mineral oil saturated (MOSH) and aromatic hydrocarbons (MOAH) from dry foods with a low fat content, such as semolina pasta, rice, and other cereals. Two different PLE methods, one for rapid determination of superficial contamination mainly from the packaging, the other for efficient extraction of total contamination from different sources, have been developed and optimised. The two methods presented good performance characteristics in terms of repeatability (relative standard deviation lower than 5%) and recoveries (higher than 95%). To show their potentiality, the two methods have been applied in combination on semolina pasta and rice packaged in direct contact with recycled cardboard. In the case of semolina pasta it was possible to discriminate between superficial contamination coming from the packaging, and pre-existing contamination (firmly enclosed into the matrix). Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Can the rapid identification of mature spermatozoa during microdissection testicular sperm extraction guide operative planning?

    Science.gov (United States)

    Alrabeeah, K; Doucet, R; Boulet, E; Phillips, S; Al-Hathal, N; Bissonnette, F; Kadoch, I J; Zini, A

    2015-05-01

    The minimum sperm count and quality that must be identified during microdissection testicular sperm extraction (micro-TESE) to deem the procedure successful remains to be established. We conducted a retrospective study of 81 consecutive men with non-obstructive azoospermia who underwent a primary (first) micro-TESE between March 2007 and October 2013. Final assessment of sperm recovery [reported on the day of (intracytoplasmic sperm injection) ICSI] was recorded as (i) successful (available spermatozoa for ICSI) or (ii) unsuccessful (no spermatozoa for ICSI). The decision to perform a unilateral (with limited or complete microdissection) or bilateral micro-TESE was guided by the intra-operative identification of sperm recovery (≥5 motile or non-motile sperm) from the first testicle. Overall, sperm recovery was successful in 56% (45/81) of the men. A unilateral micro-TESE was performed in 47% (38/81) of the men (based on intra-operative identification of sperm) and in 100% (38/38) of these men, spermatozoa was found on final assessment. In 42% (16/38) of the unilateral cases, a limited microdissection was performed (owing to the rapid intra-operative identification of sperm). The remaining 43 men underwent a bilateral micro-TESE and 16% (7/43) of these men had sperm identified on final assessment. The cumulative ICSI pregnancy rates (per cycle started and per embryo transfer) were 47% (21/45) and 60% (21/35), respectively, with a mean (±SD) of 1.9 ± 1.0 embryos transferred. The data demonstrate that intra-operative assessment of sperm recovery can correctly identify those men that require a unilateral micro-TESE. Moreover, the rapid identification of sperm recovery can allow some men to undergo a limited unilateral micro-TESE and avoid the need for complete testicular microdissection. © 2015 American Society of Andrology and European Academy of Andrology.

  8. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  9. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  10. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren

    2010-09-01

    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  11. A simple and rapid infrared-assisted self enzymolysis extraction method for total flavonoid aglycones extraction from Scutellariae Radix and mechanism exploration.

    Science.gov (United States)

    Wang, Liping; Duan, Haotian; Jiang, Jiebing; Long, Jiakun; Yu, Yingjia; Chen, Guiliang; Duan, Gengli

    2017-09-01

    A new, simple, and fast infrared-assisted self enzymolysis extraction (IRASEE) approach for the extraction of total flavonoid aglycones (TFA) mainly including baicalein, wogonin, and oroxylin A from Scutellariae Radix is presented to enhance extraction yield. Extraction enzymolysis temperature, enzymolysis liquid-to-solid ratio, enzymolysis pH, enzymolysis time and infrared power, the factors affecting IRASEE procedure, were investigated in a newly designed, temperature-controlled infrared-assisted extraction (TC-IRAE) system to acquire the optimum analysis conditions. The results illustrated that IRASEE possessed great advantages in terms of efficiency and time compared with other conventional extraction techniques. Furthermore, the mechanism of IRASEE was preliminarily explored by observing the microscopic change of the samples surface structures, studying the main chemical compositions change of the samples before and after extraction and investigating the kinetics and thermodynamics at three temperature levels during the IRASEE process. These findings revealed that IRASEE can destroy the surface microstructures to accelerate the mass transfer and reduce the activation energy to intensify the chemical process. This integrative study presents a simple, rapid, efficient, and environmental IRASEE method for TFA extraction which has promising prospects for other similar herbal medicines. Graphical Abstract ᅟ.

  12. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions.

    Science.gov (United States)

    Fior, Simone; Li, Mingai; Oxelman, Bengt; Viola, Roberto; Hodges, Scott A; Ometto, Lino; Varotto, Claudio

    2013-04-01

    Aquilegia is a well-known model system in the field of evolutionary biology, but obtaining a resolved and well-supported phylogenetic reconstruction for the genus has been hindered by its recent and rapid diversification. Here, we applied 454 next-generation sequencing to PCR amplicons of 21 of the most rapidly evolving regions of the plastome to generate c. 24 kb of sequences from each of 84 individuals from throughout the genus. The resulting phylogeny has well-supported resolution of the main lineages of the genus, although recent diversification such as in the European taxa remains unresolved. By producing a chronogram of the whole Ranunculaceae family based on published data, we inferred calibration points for dating the Aquilegia radiation. The genus originated in the upper Miocene c. 6.9 million yr ago (Ma) in Eastern Asia, and diversification occurred c. 4.8 Ma with the split of two main clades, one colonizing North America, and the other Western Eurasia through the mountains of Central Asia. This was followed by a back-to-Asia migration, originating from the European stock using a North Asian route. These results provide the first backbone phylogeny and spatiotemporal reconstruction of the Aquilegia radiation, and constitute a robust framework to address the adaptative nature of speciation within the group. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  13. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms.

    Science.gov (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae

    2018-01-01

    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  14. Development of a micropulverized extraction method for rapid toxicological analysis of methamphetamine in hair.

    Science.gov (United States)

    Miyaguchi, Hajime; Kakuta, Masaya; Iwata, Yuko T; Matsuda, Hideaki; Tazawa, Hidekatsu; Kimura, Hiroko; Inoue, Hiroyuki

    2007-09-07

    We developed a rapid sample preparation method for the toxicological analysis of methamphetamine and amphetamine (the major metabolite of methamphetamine) in human hair by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS), to facilitate fast screening and quantitation. Two milligrams of hair were mechanically micropulverized for 5 min in a 2-ml plastic tube together with 100 microl of an aqueous solvent containing 10% acetonitrile, 100 mM trifluoroacetic acid and the corresponding deuterium analogues as internal standards. The pulverizing highly disintegrated the hair components, simultaneously allowing the extraction of any drugs present in the hair. After filtering the suspension with a membrane-filter unit, the clear filtrate was directly analyzed by HPLC-MS/MS. No evaporation processes were required for sample preparation. Method optimization and validation study were carried out using real-case specimens and fortified samples in which the drugs had been artificially absorbed, respectively. Concentration ranges for quantitation were 0.040-125 and 0.040-25 ng/mg for methamphetamine and amphetamine, respectively. Real-case specimens were analyzed by the method presented here and by conventional ones to verify the applicability of our method to real-world analysis. Our method took less than 30 min for a set of chromatograms to be obtained from a washed hair sample.

  15. Recyclable bio-reagent for rapid and selective extraction of contaminants from soil

    International Nuclear Information System (INIS)

    Lomasney, H.L.

    1997-01-01

    This Phase I Small Business Innovation Research program is confirming the effectiveness of a bio-reagent to cost-effectively and selectively extract a wide range of heavy metals and radionuclide contaminants from soil. This bioreagent solution, developed by ISOTRON reg-sign Corporation (New Orleans, LA), is flushed through the soil and recycled after flowing through an electrokinetic separation module, also developed by ISOTRON reg-sign. The process is ex situ, and the soil remains in its transport container through the decontamination process. The transport container can be a fiberglass box, or a bulk bag or open-quotes super sack.close quotes Rocks, vegetation, roots, etc. need not be removed. High clay content soils are accommodated. The process provides rapid injection of reagent solution, and when needed, sand is introduced to speed up the heap leach step. The concentrated waste form is eventually solidified. The bio-reagent is essentially a natural product, therefore any solubizer residual in soil is not expected to cause regulatory concern. The Phase I work will confirm the effectiveness of this bio-reagent on a wide range of contaminants, and the engineering parameters that are needed to carry out a full-scale demonstration of the process. ISOTRON reg-sign scientists will work with contaminated soil from Los Alamos National Laboratory. LANL is in the process of decontaminating and decommissioning more than 300 sites within its complex, many of which contain heavy metals or radionuclides; some are mixed wastes containing TCE, PCB, and metals

  16. Recyclable bio-reagent for rapid and selective extraction of contaminants from soil

    Energy Technology Data Exchange (ETDEWEB)

    Lomasney, H.L. [ISOTRON Corp., New Orleans, LA (United States)

    1997-10-01

    This Phase I Small Business Innovation Research program is confirming the effectiveness of a bio-reagent to cost-effectively and selectively extract a wide range of heavy metals and radionuclide contaminants from soil. This bioreagent solution, developed by ISOTRON{reg_sign} Corporation (New Orleans, LA), is flushed through the soil and recycled after flowing through an electrokinetic separation module, also developed by ISOTRON{reg_sign}. The process is ex situ, and the soil remains in its transport container through the decontamination process. The transport container can be a fiberglass box, or a bulk bag or {open_quotes}super sack.{close_quotes} Rocks, vegetation, roots, etc. need not be removed. High clay content soils are accommodated. The process provides rapid injection of reagent solution, and when needed, sand is introduced to speed up the heap leach step. The concentrated waste form is eventually solidified. The bio-reagent is essentially a natural product, therefore any solubizer residual in soil is not expected to cause regulatory concern. The Phase I work will confirm the effectiveness of this bio-reagent on a wide range of contaminants, and the engineering parameters that are needed to carry out a full-scale demonstration of the process. ISOTRON{reg_sign} scientists will work with contaminated soil from Los Alamos National Laboratory. LANL is in the process of decontaminating and decommissioning more than 300 sites within its complex, many of which contain heavy metals or radionuclides; some are mixed wastes containing TCE, PCB, and metals.

  17. Reconstitution of the cellular response to DNA damage in vitro using damage-activated extracts from mammalian cells

    International Nuclear Information System (INIS)

    Roper, Katherine; Coverley, Dawn

    2012-01-01

    In proliferating mammalian cells, DNA damage is detected by sensors that elicit a cellular response which arrests the cell cycle and repairs the damage. As part of the DNA damage response, DNA replication is inhibited and, within seconds, histone H2AX is phosphorylated. Here we describe a cell-free system that reconstitutes the cellular response to DNA double strand breaks using damage-activated cell extracts and naïve nuclei. Using this system the effect of damage signalling on nuclei that do not contain DNA lesions can be studied, thereby uncoupling signalling and repair. Soluble extracts from G1/S phase cells that were treated with etoposide before isolation, or pre-incubated with nuclei from etoposide-treated cells during an in vitro activation reaction, restrain both initiation and elongation of DNA replication in naïve nuclei. At the same time, H2AX is phosphorylated in naïve nuclei in a manner that is dependent upon the phosphatidylinositol 3-kinase-like protein kinases. Notably, phosphorylated H2AX is not focal in naïve nuclei, but is evident throughout the nucleus suggesting that in the absence of DNA lesions the signal is not amplified such that discrete foci can be detected. This system offers a novel screening approach for inhibitors of DNA damage response kinases, which we demonstrate using the inhibitors wortmannin and LY294002. -- Highlights: ► A cell free system that reconstitutes the response to DNA damage in the absence of DNA lesions. ► Damage-activated extracts impose the cellular response to DNA damage on naïve nuclei. ► PIKK-dependent response impacts positively and negatively on two separate fluorescent outputs. ► Can be used to screen for inhibitors that impact on the response to damage but not on DNA repair. ► LY294002 and wortmannin demonstrate the system's potential as a pathway focused screening approach.

  18. Oxidants and not alkylating agents induce rapid mtDNA loss and mitochondrial dysfunction

    Science.gov (United States)

    Furda, Amy M.; Marrangoni, Adele M.; Lokshin, Anna; Van Houten, Bennett

    2013-01-01

    Mitochondrial DNA (mtDNA) is essential for proper mitochondrial function and encodes 22 tRNAs, 2 rRNAs and 13 polypeptides that make up subunits of complex I, III, IV, in the electron transport chain and complex V, the ATP synthase. Although mitochondrial dysfunction has been implicated in processes such as premature aging, neurodegeneration, and cancer, it has not been shown whether persistent mtDNA damage causes a loss of oxidative phosphorylation. We addressed this question by treating mouse embryonic fibroblasts with either hydrogen peroxide (H2O2) or the alkylating agent methyl methanesulfonate (MMS) and measuring several endpoints, including mtDNA damage and repair rates using QPCR, levels of mitochondrial- and nuclear-encoded proteins using antibody analysis, and a pharmacologic profile of mitochondria using the Seahorse Extracellular Flux Analyzer. We show that a 60 min treatment with H2O2 causes persistent mtDNA lesions, mtDNA loss, decreased levels of a nuclear-encoded mitochondrial subunit, a loss of ATP-linked oxidative phosphorylation and a loss of total reserve capacity. Conversely, a 60 min treatment with 2 mM MMS causes persistent mtDNA lesions but no mtDNA loss, no decrease in levels of a nuclear-encoded mitochondrial subunit, and no mitochondrial dysfunction. These results suggest that persistent mtDNA damage is not sufficient to cause mitochondrial dysfunction. PMID:22766155

  19. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows.

    Science.gov (United States)

    Vaidya, Jueeli D; van den Bogert, Bartholomeus; Edwards, Joan E; Boekhorst, Jos; van Gastelen, Sanne; Saccenti, Edoardo; Plugge, Caroline M; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini) differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100), 67% GS and 33% maize silage (GS67MS33), 33% GS and 67% MS (GS33MS67), or 100% MS (MS100). An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method ( p anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA) of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction ( p = 0.012), and that PBB ( p = 0.012) and FDSS ( p = 0.024) also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In summary, the comprehensive assessment of observed communities of bacteria, archaea and anaerobic fungi described here provides insight into a rational basis for selecting an optimal methodology to obtain a representative picture of the rumen microbiota.

  20. Comparison of QIAsymphony Automated and QIAamp Manual DNA Extraction Systems for Measuring Epstein-Barr Virus DNA Load in Whole Blood Using Real-Time PCR

    OpenAIRE

    Laus, Stella; Kingsley, Lawrence A.; Green, Michael; Wadowsky, Robert M.

    2011-01-01

    Automated and manual extraction systems have been used with real-time PCR for quantification of Epstein-Barr virus [human herpesvirus 4 (HHV-4)] DNA in whole blood, but few studies have evaluated relative performances. In the present study, the automated QIAsymphony and manual QIAamp extraction systems (Qiagen, Valencia, CA) were assessed using paired aliquots derived from clinical whole-blood specimens and an in-house, real-time PCR assay. The detection limits using the QIAsymphony and QIAam...

  1. New method for the rapid extraction of natural products: efficient isolation of shikimic acid from star anise.

    Science.gov (United States)

    Just, Jeremy; Deans, Bianca J; Olivier, Wesley J; Paull, Brett; Bissember, Alex C; Smith, Jason A

    2015-05-15

    A new, practical, rapid, and high-yielding process for the pressurized hot water extraction (PHWE) of multigram quantities of shikimic acid from star anise (Illicium verum) using an unmodified household espresso machine has been developed. This operationally simple and inexpensive method enables the efficient and straightforward isolation of shikimic acid and the facile preparation of a range of its synthetic derivatives.

  2. Development of rapid hemocyte-based extraction methods for detection of hepatitis A virus and murine norovirus in contaminated oysters

    Science.gov (United States)

    The human enteric pathogens, hepatitis A virus and human norovirus, have been shown to contaminate molluscan shellfish and cause foodborne disease in consumers. Rapid viral extraction methods are needed to replace current time consuming methods, which use whole oysters or dissected tissues. In our ...

  3. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    Science.gov (United States)

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-03-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

  4. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

    2013-01-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...

  5. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  6. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...

  7. Preservation and rapid purification of DNA from decomposing human tissue samples.

    Science.gov (United States)

    Sorensen, Amy; Rahman, Elizabeth; Canela, Cassandra; Gangitano, David; Hughes-Stamm, Sheree

    2016-11-01

    One of the key features to be considered in a mass disaster is victim identification. However, the recovery and identification of human remains are sometimes complicated by harsh environmental conditions, limited facilities, loss of electricity and lack of refrigeration. If human remains cannot be collected, stored, or identified immediately, bodies decompose and DNA degrades making genotyping more difficult and ultimately decreasing DNA profiling success. In order to prevent further DNA damage and degradation after collection, tissue preservatives may be used. The goal of this study was to evaluate three customized (modified TENT, DESS, LST) and two commercial DNA preservatives (RNAlater and DNAgard ® ) on fresh and decomposed human skin and muscle samples stored in hot (35°C) and humid (60-70% relative humidity) conditions for up to three months. Skin and muscle samples were harvested from the thigh of three human cadavers placed outdoors for up to two weeks. In addition, the possibility of purifying DNA directly from the preservative solutions ("free DNA") was investigated in order to eliminate lengthy tissue digestion processes and increase throughput. The efficiency of each preservative was evaluated based on the quantity of DNA recovered from both the "free DNA" in solution and the tissue sample itself in conjunction with the quality and completeness of downstream STR profiles. As expected, DNA quantity and STR success decreased with time of decomposition. However, a marked decrease in DNA quantity and STR quality was observed in all samples after the bodies entered the bloat stage (approximately six days of decomposition in this study). Similar amounts of DNA were retrieved from skin and muscle samples over time, but slightly more complete STR profiles were obtained from muscle tissue. Although higher amounts of DNA were recovered from tissue samples than from the surrounding preservative, the average number of reportable alleles from the "free DNA" was

  8. Rapid determination of carbohydrates, ash, and extractives contents of straw using attenuated total reflectance fourier transform mid-infrared spectroscopy.

    Science.gov (United States)

    Tamaki, Yukihiro; Mazza, Giuseppe

    2011-06-22

    Analysis of the chemical components of lignocellulosic biomass is essential to understanding its potential for utilization. Mid-infrared spectroscopy and partial least-squares regression were used for rapid measurement of the carbohydrate (total glycans; glucan; xylan; galactan; arabinan; mannan), ash, and extractives content of triticale and wheat straws. Calibration models for total glycans, glucan, and extractives showed good and excellent predictive performance on the basis of slope, r², RPD, and R/SEP criteria. The xylan model showed good and acceptable predictive performance. However, the ash model was evaluated as providing only approximate quantification and screening. The models for galactan, arabinan, and mannan indicated poor and insufficient prediction for application. Most models could predict both triticale and wheat straw samples with the same degree of accuracy. Mid-infrared spectroscopic techniques coupled with partial least-squares regression can be used for rapid prediction of total glycans, glucan, xylan, and extractives in triticale and wheat straw samples.

  9. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Directory of Open Access Journals (Sweden)

    Christina Gill

    Full Text Available Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating prior to chemical and enzyme-based DNA extraction with a commercial kit.After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering.An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of

  10. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Science.gov (United States)

    Gill, Christina; van de Wijgert, Janneke H H M; Blow, Frances; Darby, Alistair C

    2016-01-01

    Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating) prior to chemical and enzyme-based DNA extraction with a commercial kit. After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity) between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering. An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of epidemiological studies

  11. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows

    Directory of Open Access Journals (Sweden)

    Jueeli D. Vaidya

    2018-01-01

    Full Text Available DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF and fibrous content (FC fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100, 67% GS and 33% maize silage (GS67MS33, 33% GS and 67% MS (GS33MS67, or 100% MS (MS100. An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method (p < 0.001 and fraction (p < 0.001. The 260/280 ratio was not affected by extraction (p = 0.08 but was affected by fraction (p = 0.03. On the other hand, the 260/230 ratio was affected by extraction method (p < 0.001 but not affected by fraction (p = 0.8. However, all four extraction procedures yielded DNA suitable for further analysis of bacterial, archaeal and anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction (p = 0.012, and that PBB (p = 0.012 and FDSS (p = 0.024 also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In

  13. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  14. Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

    2011-02-07

    Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

  15. Rapid quantification of polycyclic aromatic hydrocarbons in hydroxypropyl-{beta}-cyclodextrin (HPCD) soil extracts by synchronous fluorescence spectroscopy (SFS)

    Energy Technology Data Exchange (ETDEWEB)

    Guoxiong, Hua [School of Biology and Psychology, Institute for Research on Environment and Sustainability, Newcastle University, Newcastle upon Tyne NE1 7RU (United Kingdom); Broderick, John [School of Biology and Psychology, Institute for Research on Environment and Sustainability, Newcastle University, Newcastle upon Tyne NE1 7RU (United Kingdom); Semple, Kirk T [Department of Environmental Science, Faculty of Science and Technology, University of Lancaster, Lancaster LA1 4YQ (United Kingdom); Killham, Ken [School of Biological Sciences, University of Aberdeen, Aberdeen AB24 3UU (United Kingdom); Singleton, Ian [School of Biology and Psychology, Institute for Research on Environment and Sustainability, Newcastle University, Newcastle upon Tyne NE1 7RU (United Kingdom)

    2007-07-15

    Synchronous fluorescence spectroscopy (SFS) was directly applied to rapidly quantify selected polycyclic aromatic hydrocarbons (PAHs: benzo[a]pyrene and pyrene) in aqueous hydroxypropyl-{beta}-cyclodextrin (HPCD) soil extract solutions from a variety of aged contaminated soils containing four different PAHs. The method was optimized and validated. The results show that SFS can be used to analyse benzo[a]pyrene and pyrene in HPCD based soil extracts with high sensitivity and selectivity. The linear calibration ranges were 4.0 x 10{sup -6}-1.0 x 10{sup -3} mM for benzo[a]pyrene and 6.0 x 10{sup -6}-1.2 x 10{sup -3} mM for pyrene in 10 mM HPCD aqueous solution alone. The detection limits according to the error propagation theory for benzo[a]pyrene and pyrene were 3.9 x 10{sup -6} and 5.4 x 10{sup -6} mM, respectively. A good agreement between SFS and HPLC was reached for both determinations of PAHs in HPCD alone and in soil HPCD extracts. Hence, SFS is a potential means to simplify the present non-exhaustive hydroxypropyl-{beta}-cyclodextrin (HPCD)-based extraction technique for the evaluation of PAH bioavailability in soil. - SFS can be used to rapidly quantify selected PAHs in soil extracts and to simplify the non-exhaustive HPCD-based extraction technique for the evaluation of PAH bioavailability.

  16. A novel automated device for rapid nucleic acid extraction utilizing a zigzag motion of magnetic silica beads

    International Nuclear Information System (INIS)

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Uehara, Masayuki; Honda, Takayuki; Saito, Yasunori

    2016-01-01

    We report a novel automated device for nucleic acid extraction, which consists of a mechanical control system and a disposable cassette. The cassette is composed of a bottle, a capillary tube, and a chamber. After sample injection in the bottle, the sample is lysed, and nucleic acids are adsorbed on the surface of magnetic silica beads. These magnetic beads are transported and are vibrated through the washing reagents in the capillary tube under the control of the mechanical control system, and thus, the nucleic acid is purified without centrifugation. The purified nucleic acid is automatically extracted in 3 min for the polymerase chain reaction (PCR). The nucleic acid extraction is dependent on the transport speed and the vibration frequency of the magnetic beads, and optimizing these two parameters provided better PCR efficiency than the conventional manual procedure. There was no difference between the detection limits of our novel device and that of the conventional manual procedure. We have already developed the droplet-PCR machine, which can amplify and detect specific nucleic acids rapidly and automatically. Connecting the droplet-PCR machine to our novel automated extraction device enables PCR analysis within 15 min, and this system can be made available as a point-of-care testing in clinics as well as general hospitals. - Highlights: • Automatic nucleic acid extraction is performed in 3 min. • Zigzag motion of magnetic silica beads yields rapid and efficient extraction. • The present our device provides better performance than the conventional procedure.

  17. Rapid quantification of polycyclic aromatic hydrocarbons in hydroxypropyl-β-cyclodextrin (HPCD) soil extracts by synchronous fluorescence spectroscopy (SFS)

    International Nuclear Information System (INIS)

    Hua Guoxiong; Broderick, John; Semple, Kirk T.; Killham, Ken; Singleton, Ian

    2007-01-01

    Synchronous fluorescence spectroscopy (SFS) was directly applied to rapidly quantify selected polycyclic aromatic hydrocarbons (PAHs: benzo[a]pyrene and pyrene) in aqueous hydroxypropyl-β-cyclodextrin (HPCD) soil extract solutions from a variety of aged contaminated soils containing four different PAHs. The method was optimized and validated. The results show that SFS can be used to analyse benzo[a]pyrene and pyrene in HPCD based soil extracts with high sensitivity and selectivity. The linear calibration ranges were 4.0 x 10 -6 -1.0 x 10 -3 mM for benzo[a]pyrene and 6.0 x 10 -6 -1.2 x 10 -3 mM for pyrene in 10 mM HPCD aqueous solution alone. The detection limits according to the error propagation theory for benzo[a]pyrene and pyrene were 3.9 x 10 -6 and 5.4 x 10 -6 mM, respectively. A good agreement between SFS and HPLC was reached for both determinations of PAHs in HPCD alone and in soil HPCD extracts. Hence, SFS is a potential means to simplify the present non-exhaustive hydroxypropyl-β-cyclodextrin (HPCD)-based extraction technique for the evaluation of PAH bioavailability in soil. - SFS can be used to rapidly quantify selected PAHs in soil extracts and to simplify the non-exhaustive HPCD-based extraction technique for the evaluation of PAH bioavailability

  18. Evaluation of the ISO standard 11063 DNA extraction procedure for assessing soil microbial abundance and community structure.

    Directory of Open Access Journals (Sweden)

    Pierre Plassart

    Full Text Available Soil DNA extraction has become a critical step in describing microbial biodiversity. Historically, ascertaining overarching microbial ecological theories has been hindered as independent studies have used numerous custom and commercial DNA extraction procedures. For that reason, a standardized soil DNA extraction method (ISO-11063 was previously published. However, although this ISO method is suited for molecular tools such as quantitative PCR and community fingerprinting techniques, it has only been optimized for examining soil bacteria. Therefore, the aim of this study was to assess an appropriate soil DNA extraction procedure for examining bacterial, archaeal and fungal diversity in soils of contrasting land-use and physico-chemical properties. Three different procedures were tested: the ISO-11063 standard; a custom procedure (GnS-GII; and a modified ISO procedure (ISOm which includes a different mechanical lysis step (a FastPrep ®-24 lysis step instead of the recommended bead-beating. The efficacy of each method was first assessed by estimating microbial biomass through total DNA quantification. Then, the abundances and community structure of bacteria, archaea and fungi were determined using real-time PCR and terminal restriction fragment length polymorphism approaches. Results showed that DNA yield was improved with the GnS-GII and ISOm procedures, and fungal community patterns were found to be strongly dependent on the extraction method. The main methodological factor responsible for differences between extraction procedure efficiencies was found to be the soil homogenization step. For integrative studies which aim to examine bacteria, archaea and fungi simultaneously, the ISOm procedure results in higher DNA recovery and better represents microbial communities.

  19. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    Science.gov (United States)

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  20. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences

    Directory of Open Access Journals (Sweden)

    Brett eWagner Mackenzie

    2015-02-01

    Full Text Available The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation, with a smaller proportion of variation associated with DNA extraction method (technical variation and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  1. Comparison of DNA Extraction Methods in Terms of Yield, Purity, Long-Term Storage, and Downstream Manipulation with Brewer's Yeast Chromosomal DNA

    Czech Academy of Sciences Publication Activity Database

    Kopecká, J.; Matoulková, D.; Němec, M.; Jelínková, Markéta; Felsberg, Jürgen

    2014-01-01

    Roč. 72, č. 1 (2014), s. 1-5 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Brewer's yeast * Isolation of DNA * Phenol/chloroform extraction Subject RIV: EE - Microbiology, Virology Impact factor: 0.886, year: 2014

  2. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

    Science.gov (United States)

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

  3. Direct extraction of genomic DNA from maize with aqueous ionic liquid buffer systems for applications in genetically modified organisms analysis.

    Science.gov (United States)

    Gonzalez García, Eric; Ressmann, Anna K; Gaertner, Peter; Zirbs, Ronald; Mach, Robert L; Krska, Rudolf; Bica, Katharina; Brunner, Kurt

    2014-12-01

    To date, the extraction of genomic DNA is considered a bottleneck in the process of genetically modified organisms (GMOs) detection. Conventional DNA isolation methods are associated with long extraction times and multiple pipetting and centrifugation steps, which makes the entire procedure not only tedious and complicated but also prone to sample cross-contamination. In recent times, ionic liquids have emerged as innovative solvents for biomass processing, due to their outstanding properties for dissolution of biomass and biopolymers. In this study, a novel, easily applicable, and time-efficient method for the direct extraction of genomic DNA from biomass based on aqueous-ionic liquid solutions was developed. The straightforward protocol relies on extraction of maize in a 10 % solution of ionic liquids in aqueous phosphate buffer for 5 min at room temperature, followed by a denaturation step at 95 °C for 10 min and a simple filtration to remove residual biopolymers. A set of 22 ionic liquids was tested in a buffer system and 1-ethyl-3-methylimidazolium dimethylphosphate, as well as the environmentally benign choline formate, were identified as ideal candidates. With this strategy, the quality of the genomic DNA extracted was significantly improved and the extraction protocol was notably simplified compared with a well-established method.

  4. Mutant analysis of Cdt1's function in suppressing nascent strand elongation during DNA replication in Xenopus egg extracts.

    Science.gov (United States)

    Nakazaki, Yuta; Tsuyama, Takashi; Azuma, Yutaro; Takahashi, Mikiko; Tada, Shusuke

    2017-09-02

    The initiation of DNA replication is strictly regulated by multiple mechanisms to ensure precise duplication of chromosomes. In higher eukaryotes, activity of the Cdt1 protein is temporally regulated during the cell cycle, and deregulation of Cdt1 induces DNA re-replication. In previous studies, we showed that excess Cdt1 inhibits DNA replication by suppressing progression of replication forks in Xenopus egg extracts. Here, we investigated the functional regions of Cdt1 that are required for the inhibition of DNA replication. We constructed a series of N-terminally or C-terminally deleted mutants of Cdt1 and examined their inhibitory effects on DNA replication in Xenopus egg extracts. Our results showed that the region spanning amino acids (a. a.) 255-620 is required for efficient inhibition of DNA replication, and that, within this region, a. a. 255-289 have a critical role in inhibition. Moreover, one of the Cdt1 mutants, Cdt1 R285A, was compromised with respect to the licensing activity but still inhibited DNA replication. This result suggests that Cdt1 has an unforeseen function in the negative regulation of DNA replication, and that this function is located within a molecular region that is distinct from those required for the licensing activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Evaluation of five DNA extraction methods for purification of DNA from atherosclerotic tissue and estimation of prevalence of Chlamydia pneumoniae in tissue from a Danish population undergoing vascular repair

    Directory of Open Access Journals (Sweden)

    Lindholt Jes S

    2003-09-01

    Full Text Available Abstract Background To date PCR detection of Chlamydia pneumoniae DNA in atherosclerotic lesions from Danish patients has been unsuccessful. To establish whether non-detection was caused by a suboptimal DNA extraction method, we tested five different DNA extraction methods for purification of DNA from atherosclerotic tissue. Results The five different DNA extraction methods were tested on homogenate of atherosclerotic tissue spiked with C. pneumoniae DNA or EB, on pure C. pneumoniae DNA samples and on whole C. pneumoniae EB. Recovery of DNA was measured with a C. pneumoniae-specific quantitative real-time PCR. A DNA extraction method based on DNA-binding to spin columns with a silica-gel membrane (DNeasy Tissue kit showed the highest recovery rate for the tissue samples and pure DNA samples. However, an automated extraction method based on magnetic glass particles (MagNA Pure performed best on intact EB and atherosclerotic tissue spiked with EB. The DNeasy Tissue kit and MagNA Pure methods and the highly sensitive real-time PCR were subsequently used on 78 atherosclerotic tissue samples from Danish patients undergoing vascular repair. None of the samples were positive for C. pneumoniae DNA. The atherosclerotic samples were tested for inhibition by spiking with two different, known amounts of C. pneumoniae DNA and no samples showed inhibition. Conclusion As a highly sensitive PCR method and an optimised DNA extraction method were used, non-detection in atherosclerotic tissue from the Danish population was probably not caused by use of inappropriate methods. However, more samples may need to be analysed per patient to be completely certain on this. Possible methodological and epidemiological reasons for non-detection of C. pneumoniae DNA in atherosclerotic tissue from the Danish population are discussed. Further testing of DNA extraction methods is needed as this study has shown considerable intra- and inter-method variation in DNA recovery.

  6. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  7. Design and performance testing of a DNA extraction assay for sensitive and reliable quantification of acetic acid bacteria directly in red wine using real time PCR

    Directory of Open Access Journals (Sweden)

    Cédric eLONGIN

    2016-06-01

    Full Text Available Although strategies exist to prevent AAB contamination, the increased interest for wines with low sulfite addition leads to greater AAB spoilage. Hence there is a real need for a rapid, specific, sensitive and reliable method for detecting these spoilage bacteria. All these requirements are met by real time Polymerase Chain Reaction (or quantitative PCR; qPCR. Here, we compare existing methods of isolating DNA and their adaptation to a red wine matrix. Two different protocols for isolating DNA and three PCR mix compositions were tested to select the best method. The addition of insoluble polyvinylpolypyrrolidone (PVPP at 1% (v/v during DNA extraction using a protocol succeeded in eliminating PCR inhibitors from red wine. We developed a bacterial internal control which was efficient in avoiding false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The specificity, linearity, repeatability and reproducibility of the method were evaluated. A standard curve was established for the enumeration of AAB inoculated into red wines. The limit of quantification in red wine was 3.7 log AAB/mL and about 2.8 log AAB/mL when the volume of the samples was increased from 1 mL to 10 mL. Thus the DNA extraction method developed in this paper allows sensitive and reliable AAB quantification without underestimation thanks to the presence of an internal control. Moreover, monitoring of both the AAB population and the amount of acetic acid in ethanol medium and red wine highlighted that a minimum about 6.0 log cells/mL of AAB is needed to significantly increase the production of acetic acid leading to spoilage.

  8. A rapid extraction and analysis method for the simultaneous determination of 26 bioflavonoids in Portulaca oleracea L.

    Science.gov (United States)

    Liang, Xiao; Li, Lingzhi; Tian, Jinlong; Wu, Yingying; Gao, Pinyi; Li, Danqi; Zhang, Qingyi; Song, Shaojiang

    2014-01-01

    Portulaca oleracea L. (P. oleracea, purslane) is an edible plant that is widely distributed around the world, and flavonoids are its main bioactive constituents. Therefore, the detection of flavonoids is very important for a better understanding of its pharmacological actions and to monitor the product quality control of P. oleracea. To develop a rapid method to extract and determine 26 bioflavonoids in P. oleracea, based on microwave extraction (MWE) and triple quadrupole-linear ion trap mass spectrometry. The optimal conditions of MWE for the extraction of flavonoids from P. oleracea involved the use of methanol as the extraction solvent, a microwave power of 300 W, an extraction time of 450 s, and a solvent-to-solid ratio of 30 mL/g. The samples were analysed using an ultra-performance liquid chromatograph coupled with a triple quadrupole-linear ion trap mass spectrometer (UPLC-MS/MS) system. The calibration curves of all 26 analytes showed good linearity (r ≥ 0.999) and the intra- and interday precisions and repeatability were all within required limits. The mean recoveries measured at three concentrations were higher than 94.2%, with RSDs lower than 2.94% for the targets. The established MWE/UPLC-MS/MS method is a rapid and effective method for quality evaluation of P. oleracea from different production regions and different harvest periods. Copyright © 2014 John Wiley & Sons, Ltd.

  9. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue.

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-10

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  10. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-01

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  11. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Žel Jana

    2006-08-01

    Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

  12. Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

    2006-08-14

    Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

  13. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Science.gov (United States)

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

  14. A rapid extraction of landslide disaster information research based on GF-1 image

    Science.gov (United States)

    Wang, Sai; Xu, Suning; Peng, Ling; Wang, Zhiyi; Wang, Na

    2015-08-01

    In recent years, the landslide disasters occurred frequently because of the seismic activity. It brings great harm to people's life. It has caused high attention of the state and the extensive concern of society. In the field of geological disaster, landslide information extraction based on remote sensing has been controversial, but high resolution remote sensing image can improve the accuracy of information extraction effectively with its rich texture and geometry information. Therefore, it is feasible to extract the information of earthquake- triggered landslides with serious surface damage and large scale. Taking the Wenchuan county as the study area, this paper uses multi-scale segmentation method to extract the landslide image object through domestic GF-1 images and DEM data, which uses the estimation of scale parameter tool to determine the optimal segmentation scale; After analyzing the characteristics of landslide high-resolution image comprehensively and selecting spectrum feature, texture feature, geometric features and landform characteristics of the image, we can establish the extracting rules to extract landslide disaster information. The extraction results show that there are 20 landslide whose total area is 521279.31 .Compared with visual interpretation results, the extraction accuracy is 72.22%. This study indicates its efficient and feasible to extract earthquake landslide disaster information based on high resolution remote sensing and it provides important technical support for post-disaster emergency investigation and disaster assessment.

  15. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    Science.gov (United States)

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  16. Replication of UV-irradiated DNA in human cell extracts: Evidence for mutagenic bypass of pyrimidine dimers

    International Nuclear Information System (INIS)

    Thomas, D.C.; Kunkel, T.A.

    1993-01-01

    The authors have examined the efficiency and fidelity of simian virus 40-origin-dependent replication of UV-irradiated double-stranded DNA in extracts of human cells. Using as a mutational target the α-complementation domain of the Escherichia coli lacZ gene in bacteriophage M13mp2DNA, replication of undamaged DNA in HeLa cell extracts was highly accurate, whereas replication of DNA irradiated with UV light (280-320 nm) was both less efficient and less accurate. Replication was inhibited by irradiation in a dose-dependent manner. Nonetheless, covalently closed, monomer-length circular products were generated that were resistant to digestion by Dpn I, showing that they resulted from semiconservative replication. These products were incised by T4 endonuclease V, whereas the undamaged replication products were not, suggesting that pyrimidine dimers were bypassed during replication. When replicated, UV-irradiated DNA was used to transfect an E. coli α-complementation host strain to score mutant M13mp2 plaques, the mutant plaque frequency was substantially higher than that obtained with either unirradiated, replicated DNA, or unreplicated, UV-irradiated DNA. Both the increased mutagenicity and the inhibition of replication associated with UV irradiation were reversed by treatment of the irradiated DNA with photolyase before replication. Sequence analysis of mutants resulting from replication of UV-irradiated DNA demonstrated that most mutants contained C → T transition errors at dipyrimidine sites. A few mutants contained 1-nt frameshift errors or tandem double CC → TT substitutions. The data are consistent with the interpretation that pyrimidine dimers are bypassed during replication by the multiprotein replication apparatus in human cell extracts and that this bypass is mutagenic primarily via misincorporation of dAMP opposite a cytosine (or uracil) in the dimer. 56 refs., 2 figs., 3 tabs

  17. Rapid Diminution in the Level and Activity of DNA-Dependent Protein Kinase in Cancer Cells by a Reactive Nitro-Benzoxadiazole Compound

    Directory of Open Access Journals (Sweden)

    Viviane A. O. Silva

    2016-05-01

    Full Text Available The expression and activity of DNA-dependent protein kinase (DNA-PK is related to DNA repair status in the response of cells to exogenous and endogenous factors. Recent studies indicate that Epidermal Growth Factor Receptor (EGFR is involved in modulating DNA-PK. It has been shown that a compound 4-nitro-7-[(1-oxidopyridin-2-ylsulfanyl]-2,1,3-benzoxadiazole (NSC, bearing a nitro-benzoxadiazole (NBD scaffold, enhances tyrosine phosphorylation of EGFR and triggers downstream signaling pathways. Here, we studied the behavior of DNA-PK and other DNA repair proteins in prostate cancer cells exposed to compound NSC. We showed that both the expression and activity of DNA-PKcs (catalytic subunit of DNA-PK rapidly decreased upon exposure of cells to the compound. The decline in DNA-PKcs was associated with enhanced protein ubiquitination, indicating the activation of cellular proteasome. However, pretreatment of cells with thioglycerol abolished the action of compound NSC and restored the level of DNA-PKcs. Moreover, the decreased level of DNA-PKcs was associated with the production of intracellular hydrogen peroxide by stable dimeric forms of Cu/Zn SOD1 induced by NSC. Our findings indicate that reactive oxygen species and electrophilic intermediates, generated and accumulated during the redox transformation of NBD compounds, are primarily responsible for the rapid modulation of DNA-PKcs functions in cancer cells.

  18. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    Science.gov (United States)

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan

    2010-01-01

    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  19. Measurement of cell proliferation in microculture using Hoechst 33342 for the rapid semiautomated microfluorimetric determination of chromatin DNA.

    Science.gov (United States)

    Richards, W L; Song, M K; Krutzsch, H; Evarts, R P; Marsden, E; Thorgeirsson, S S

    1985-07-01

    We report the development and characterization of a semiautomated method for measurement of cell proliferation in microculture using Hoechst 33342, a non-toxic specific vital stain for DNA. In this assay, fluorescence resulting from interaction of cell chromatin DNA with Hoechst 33342 dye was measured by an instrument that automatically reads the fluorescence of each well of a 96-well microtiter plate within 1 min. Each cell line examined was shown to require different Hoechst 33342 concentrations and time of incubation with the dye to attain optimum fluorescence in the assay. In all cell lines, cell chromatin-enhanced Hoechst 33342 fluorescence was shown to be a linear function of the number of cells or cell nuclei per well when optimum assay conditions were employed. Because of this linear relation, equivalent cell doubling times were calculated from growth curves based on changes in cell counts or changes in Hoechst/DNA fluorescence and the fluorimetric assay was shown to be useful for the direct assay of the influence of growth factors on cell proliferation. The fluorimetric assay also provided a means for normalizing the incorporation of tritiated thymidine ( [3H] TdR) into DNA; normalized values of DPM per fluorescence unit closely paralleled values of percent 3H-labelled nuclei when DNA synthesis was studied as a function of the concentration of rat serum in the medium. In summary, the chromatin-enhanced Hoechst 33342 fluorimetric assay provides a rapid, simple, and reproducible means for estimating cell proliferation by direct measurement of changes in cell fluorescence or by measurement of changes in the normalized incorporation of thymidine into DNA.

  20. Aqueous extract of Crataegus azarolus protects against DNA damage in human lymphoblast Cell K562 and enhances antioxidant activity.

    Science.gov (United States)

    Mustapha, Nadia; Bouhlel, Inès; Chaabane, Fadwa; Bzéouich, Imèn Mokdad; Ghedira, Kamel; Hennebelle, Thierry; Chekir-Ghedira, Leila

    2014-02-01

    The present study was carried out to characterize the cellular antioxidant effect of the aqueous extract of Crataegus azarolus and its antigenotoxic potential using human myelogenous cells, K562. The antioxidant capacity of this extract was evaluated by determining its cellular antioxidant activity (CAA) in K562 cells. Also, preceding antigenotoxicity assessment, its eventual genotoxicity property was investigated by evaluating its capacity to induce the DNA degradation of treated cell nuclei. As no genotoxicity was detected at different exposure times, its ability to protect cell DNA against H2O2 oxidative effect was investigated, using the "comet assay." It appears that 800 μg/mL of extract inhibited the genotoxicity induced by H2O2 with a rate of 41.30 %, after 4 h of incubation. In addition, this extract revealed a significant cellular antioxidant capacity against the reactive oxygen species in K562 cells.

  1. Rapid DNA Synthesis During Early Drosophila Embryogenesis Is Sensitive to Maternal Humpty Dumpty Protein Function.

    Science.gov (United States)

    Lesly, Shera; Bandura, Jennifer L; Calvi, Brian R

    2017-11-01

    Problems with DNA replication cause cancer and developmental malformations. It is not fully understood how DNA replication is coordinated with development and perturbed in disease. We had previously identified the Drosophila gene humpty dumpty ( hd ), and showed that null alleles cause incomplete DNA replication, tissue undergrowth, and lethality. Animals homozygous for the missense allele, hd 272-9 , were viable, but adult females had impaired amplification of eggshell protein genes in the ovary, resulting in the maternal effects of thin eggshells and embryonic lethality. Here, we show that expression of an hd transgene in somatic cells of the ovary rescues amplification and eggshell synthesis but not embryo viability. The germline of these mothers remain mutant for the hd 272-9 allele, resulting in reduced maternal Hd protein and embryonic arrest during mitosis of the first few S/M nuclear cleavage cycles with chromosome instability and chromosome bridges. Epistasis analysis of hd with the rereplication mutation plutonium indicates that the chromosome bridges of hd embryos are the result of a failed attempt to segregate incompletely replicated sister chromatids. This study reveals that maternally encoded Humpty dumpty protein is essential for DNA replication and genome integrity during the little-understood embryonic S/M cycles. Moreover, the two hd 272-9 maternal-effect phenotypes suggest that ovarian gene amplification and embryonic cleavage are two time periods in development that are particularly sensitive to mild deficits in DNA replication function. This last observation has broader relevance for interpreting why mild mutations in the human ortholog of humpty dumpty and other DNA replication genes cause tissue-specific malformations of microcephalic dwarfisms. Copyright © 2017 by the Genetics Society of America.

  2. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by {sup 32}P-postlabeling

    Energy Technology Data Exchange (ETDEWEB)

    Randerath, E. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Zhou, G.D. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Donnelly, K.C. [Department of Veterinary Anatomy and Public Health, Texas A and M University, College Station, TX (United States); Safe, S.H. [Department of Veterinary Physiology/Pharmacology, Texas A and M University, College Station, TX (United States); Randerath, K. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States)

    1996-09-01

    In the present study, a mouse bioassay was used in combination with {sup 32}P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10{sup 6} DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10{sup 7} or 1.2 x 10{sup 7} DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the {sup 32}P-labeled derivative of the reaction product of 7{beta}, 8{alpha}-dihydroxy-9{alpha}, 10{alpha}-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N{sup 2} of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs.

  3. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by 32P-postlabeling

    International Nuclear Information System (INIS)

    Randerath, E.; Zhou, G.D.; Donnelly, K.C.; Safe, S.H.; Randerath, K.

    1996-01-01

    In the present study, a mouse bioassay was used in combination with 32 P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10 6 DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10 7 or 1.2 x 10 7 DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the 32 P-labeled derivative of the reaction product of 7β, 8α-dihydroxy-9α, 10α-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N 2 of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs

  4. Radioprotective effect of methanolic root extract of Loeseneriella arnottiana on radiation induced DNA damage in human lymphocytes in vitro

    International Nuclear Information System (INIS)

    Prajna, P.S.

    2012-01-01

    Intense exposure to ionization radiation by accidental, occupational or therapeutical purpose causes cellular damage mainly by formation of excessive reactive oxygen species (ROS) or by free radicals. Humans are intentionally exposed to ionising radiation for diagnostic or therapeutic purposes. The use of ionising radiation in cancer therapy may lead to transient and/or permanent injury to normal tissues within the treatment field. To increase the therapeutic index of radiation therapy, various modes of radioprotection have been developed that selectively reduce cytotoxic effects to normal tissues. Because radiation-induced cellular damage is attributed primarily to the harmful effects of free radicals, molecules with radical scavenging properties are particularly promising as radioprotectors. Loeseneriella arnottiana, a member of family Hippocrateaceae, is a climbing shrub used by traditional medicine practitioners. To study the antioxidant activity and radioprotective effect of methanolic root extract of Loeseneriella arnottiana against electron beam radiation induced DNA damage in human lymphocytes. Loeseneriella arnottiana roots were dried and extracted using methanol by solvent extraction method. Antioxidant activity was measured by DPPH method. DNA damage was assessed by comet assay parameters. The lymphocytes were incubated for one hour with two different concentrations 10 μg and 50 μg of root extract before exposure to 2 Gy electron beam radiation. 30 μg of methanolic root extract of Loeseneriella arnottiana exhibited 96% radical scavenging activity comparable to 15 μg of ascorbic acid. In reducing power assay it showed dose dependent increase in absorbance indicating that extract is capable of donating hydrogen atoms. Pretreatment of lymphocytes with 10 μg and 50 μg of root extract before irradiation resulted in reduction in the Comet length, Olive tail moment, percentage of DNA in tail when compared to the radiation control group. Results of this

  5. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  6. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  7. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2016-10-01

    Full Text Available The spore-forming microbiota is mainly responsible for the deterioration of pasteurized milk with long shelf life in the United States. The identification of these microorganisms, using molecular tools, is of particular importance for the maintenance of the quality of milk. However, these molecular techniques are not only costly but also labor-intensive and time-consuming. The aim of this study was to compare the efficiency of boiling in conjunction with four other methods for the genomic DNA extraction of sporulated bacteria with proteolytic and lipolytic potential isolated from raw milk in the states of Paraná and Maranhão, Brazil. Protocols based on cellular lysis by enzymatic digestion, phenolic extraction, microwave-heating, as well as the use of guanidine isothiocyanate were used. This study proposes a method involving simple boiling for the extraction of genomic DNA from these microorganisms. Variations in the quality and yield of the extracted DNA among these methods were observed. However, both the cell lysis protocol by enzymatic digestion (commercial kit and the simple boiling method proposed in this study yielded sufficient DNA for successfully carrying out the Polymerase Chain Reaction (PCR of the rpoB and 16S rRNA genes for all 11 strains of microorganisms tested. Other protocols failed to yield sufficient quantity and quality of DNA from all microorganisms tested, since only a few strains have showed positive results by PCR, thereby hindering the search for new microorganisms. Thus, the simple boiling method for DNA extraction from sporulated bacteria in spoiled milk showed the same efficacy as that of the commercial kit. Moreover, the method is inexpensive, easy to perform, and much less time-consuming.

  8. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  9. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  10. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  11. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Comparison of four DNA extraction methods for the detection of Mycobacterium leprae from Ziehl-Neelsen-stained microscopic slides.

    Science.gov (United States)

    Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia

    2015-12-01

    The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  13. Towards a method of rapid extraction of strontium-90 from urine: urine pretreatment and alkali metal removal

    Energy Technology Data Exchange (ETDEWEB)

    Hawkins, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Dietz, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Kaminski, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Mertz, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Shkrob, I. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-03-01

    A technical program to support the Centers of Disease Control and Prevention is being developed to provide an analytical method for rapid extraction of Sr-90 from urine, with the intent of assessing the general population’s exposure during an emergency response to a radiological terrorist event. Results are presented on the progress in urine sample preparation and chemical separation steps that provide an accurate and quantitative detection of Sr-90 based upon an automated column separation sequence and a liquid scintillation assay. Batch extractions were used to evaluate the urine pretreatment and the column separation efficiency and loading capacity based upon commercial, extractant-loaded resins. An efficient pretreatment process for decolorizing and removing organics from urine without measurable loss of radiostrontium from the sample was demonstrated. In addition, the Diphonix® resin shows promise for the removal of high concentrations of common strontium interferents in urine as a first separation step for Sr-90 analysis.

  14. Rapid Antidepressant Activity of Ethanol Extract of Gardenia jasminoides Ellis Is Associated with Upregulation of BDNF Expression in the Hippocampus

    Directory of Open Access Journals (Sweden)

    Hailou Zhang

    2015-01-01

    Full Text Available Ethanol extract of Yueju pill, a Traditional Chinese Medicine herbal formula widely used to treat mood disorders, demonstrates rapid antidepressant effects similar to ketamine, likely via instant enhancement of brain-derived neurotrophic factor (BDNF expression in the hippocampus. Here we investigated ethanol extracts of the constituent herbs of Yueju responsible for rapid antidepressant effects. Screening with tail suspension test in Kunming mice at 24 hours after a single administration of five individual constituent herbs of Yueju, we found that only Gardenia jasminoides Ellis (GJ showed a significant effect. The antidepressant response started at 2 hours after GJ administration. Similar to Yueju and ketamine, a single administration of GJ significantly reduced the number of escape failures in the learned helplessness test. Furthermore, GJ decreased latency of food consumption in the novelty suppressed-feeding test. Additionally, starting from 2 hours and continuing for over 20 hours after GJ administration, BDNF expression in the hippocampus was upregulated, temporally linked with the antidepressant response. These findings suggest that GJ has rapid antidepressant effects, which are associated with the elevated expression of BDNF in the hippocampus. In Yueju formula, Yue represents GJ, as thus our study demonstrates the primary role of GJ in rapid antidepressant efficacy of Yueju.

  15. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic