Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

Science.gov (United States)

Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

2018-04-04

In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

African Journals Online (AJOL)

GRACE

2006-07-03

Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

Science.gov (United States)

McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

2016-08-06

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

Science.gov (United States)

Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

Rapid identification of DNA-binding proteins by mass spectrometry

DEFF Research Database (Denmark)

Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

1999-01-01

We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

Science.gov (United States)

Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

2005-01-01

A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

Science.gov (United States)

Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

2010-07-13

Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

Directory of Open Access Journals (Sweden)

Farkhondeh Saba

2017-01-01

Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

Directory of Open Access Journals (Sweden)

Farkhondeh Saba

2016-09-01

Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

The effects of three different grinding methods in DNA extraction of ...

African Journals Online (AJOL)

Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

OpenAIRE

Aljanabi, S M; Martinez, I

1997-01-01

A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

Science.gov (United States)

Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

2012-09-07

Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

Science.gov (United States)

Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

2014-12-01

Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

Science.gov (United States)

Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

2006-05-01

A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

Directory of Open Access Journals (Sweden)

Islay Rodríguez

2014-08-01

Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

Repeated extraction of DNA from FTA cards

DEFF Research Database (Denmark)

Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

2011-01-01

Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

Science.gov (United States)

Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

2006-09-18

A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

Science.gov (United States)

Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

2014-12-01

Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

Science.gov (United States)

Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

2010-07-01

We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

Science.gov (United States)

Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

2010-07-01

A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

Automated extraction of DNA from clothing

DEFF Research Database (Denmark)

Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

2011-01-01

Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing...

Extraction of ultrashort DNA molecules from herbarium specimens.

Science.gov (United States)

Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

2017-02-01

DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

Science.gov (United States)

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

Science.gov (United States)

El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

2014-01-01

Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

Science.gov (United States)

El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

2014-12-01

Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

Science.gov (United States)

Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

2010-04-01

Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

DNA Extraction Techniques for Use in Education

Science.gov (United States)

Hearn, R. P.; Arblaster, K. E.

2010-01-01

DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

Science.gov (United States)

Kar, Indrani; Chattopadhyaya, Rajagopal

2017-11-01

The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

Energy Technology Data Exchange (ETDEWEB)

Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

2004-09-01

A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

Institute of Scientific and Technical Information of China (English)

朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

2009-01-01

High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809～1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

Science.gov (United States)

Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

2017-01-01

Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

Science.gov (United States)

Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

2012-11-20

The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

DNA extraction from herbarium specimens.

Science.gov (United States)

Drábková, Lenka Záveská

2014-01-01

With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

Science.gov (United States)

Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

2016-04-01

Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

Directory of Open Access Journals (Sweden)

Stalis Norma Ethica

2013-12-01

Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

Science.gov (United States)

Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

2017-11-01

This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

Comparative analysis of protocols for DNA extraction from soybean caterpillars.

Science.gov (United States)

Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

2016-04-07

Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

Genomic DNA extraction from sapwood of Pinus roxburghii for ...

African Journals Online (AJOL)

A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

An efficient method for DNA extraction from Cladosporioid fungi

OpenAIRE

Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de, P.J.G.M.

2010-01-01

We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A260/A280 ratio ranging between 1.6 and 2.0. Isolated genomic DNA w...

A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

Directory of Open Access Journals (Sweden)

Trzewik Aleksandra

2016-01-01

Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

An efficient method for DNA extraction from Cladosporioid fungi.

Science.gov (United States)

Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

2010-11-23

We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

Application of FTA technology to extraction of sperm DNA from mixed body fluids containing semen.

Science.gov (United States)

Fujita, Yoshihiko; Kubo, Shin-ichi

2006-01-01

FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. In this study, we report a rapid and simple method of extracting DNA from sperm when body fluids mixed with semen were collected using FTA cards. After proteinase K digestion of the sperm and body fluid mixture, the washed pellet suspension as the sperm fraction and the concentrated supernatant as the epithelial cell fraction were respectively applied to FTA cards containing DTT. The FTA cards were dried, then directly added to a polymerase chain reaction (PCR) mix and processed by PCR. The time required from separation of the mixed fluid into sperm and epithelial origin DNA extractions was only about 2.5-3h. Furthermore, the procedure was extremely simple. It is considered that our designed DNA extraction procedure using an FTA card is available for application to routine work.

Extraction of DNA from plant and fungus tissues in situ

Directory of Open Access Journals (Sweden)

Abu Almakarem Amal S

2012-06-01

Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

Microbial diversity in fecal samples depends on DNA extraction method

DEFF Research Database (Denmark)

Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

2014-01-01

was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

Evaluation of four automated protocols for extraction of DNA from FTA cards.

Science.gov (United States)

Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

2013-10-01

Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

Directory of Open Access Journals (Sweden)

Van Esbroeck Marjan

2011-03-01

Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

Science.gov (United States)

Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

2017-08-12

Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

Study of microtip-based extraction and purification of DNA from human samples for portable devices

Science.gov (United States)

Fotouhi, Gareth

DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

Science.gov (United States)

Vojkovska, H; Kubikova, I; Kralik, P

2015-03-01

Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

Science.gov (United States)

Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

2016-01-01

The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

International Nuclear Information System (INIS)

Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.

1991-01-01

Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

Science.gov (United States)

Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

2014-01-01

Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

How Severely Is DNA Quantification Hampered by RNA Co-extraction?

Science.gov (United States)

Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

2015-10-01

The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

Directory of Open Access Journals (Sweden)

Pinto S.M.

2000-01-01

Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

OpenAIRE

Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

1997-01-01

The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

Food Fish Identification from DNA Extraction through Sequence Analysis

Science.gov (United States)

Hallen-Adams, Heather E.

2015-01-01

This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

OpenAIRE

Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

2013-01-01

Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cell...

Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

Directory of Open Access Journals (Sweden)

Junya Yamagishi

Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

A simple, rapid and efficient method of isolating DNA from ...

African Journals Online (AJOL)

Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

2011-01-31

Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

Directory of Open Access Journals (Sweden)

Alena V Makarova

2011-01-01

Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

[DNA Extraction from Old Bones by AutoMate Express™ System].

Science.gov (United States)

Li, B; Lü, Z

2017-08-01

To establish a method for extracting DNA from old bones by AutoMate Express™ system. Bones were grinded into powder by freeze-mill. After extraction by AutoMate Express™, DNA were amplified and genotyped by Identifiler®Plus and MinFiler™ kits. DNA were extracted from 10 old bone samples, which kept in different environments with the postmortem interval from 10 to 20 years, in 3 hours by AutoMate Express™ system. Complete STR typing results were obtained from 8 samples. AutoMate Express™ system can quickly and efficiently extract DNA from old bones, which can be applied in forensic practice. Copyright© by the Editorial Department of Journal of Forensic Medicine

Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

Science.gov (United States)

Kim, S A; Park, S H; Lee, S I; Ricke, S C

2017-12-01

The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

DEFF Research Database (Denmark)

Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

2013-01-01

of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

Science.gov (United States)

Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

2016-01-01

Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

Highly efficient DNA extraction method from skeletal remains

Directory of Open Access Journals (Sweden)

Irena Zupanič Pajnič

2011-03-01

Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

DNA extraction methods for detecting genetically modified foods: A comparative study.

Science.gov (United States)

Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

2011-06-15

The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

DEFF Research Database (Denmark)

Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

2013-01-01

protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore......, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already...

extraction of high quality dna from polysaccharides-secreting ...

African Journals Online (AJOL)

cistvr

A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

Genomic DNA extraction method from Annona senegalensis Pers ...

African Journals Online (AJOL)

Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

Necessity of purification during bacterial DNA extraction with environmental soils

Directory of Open Access Journals (Sweden)

Hyun Jeong Lim

2017-08-01

Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

Extraction of Chromosomal DNA from Schizosaccharomyces pombe.

Science.gov (United States)

Murray, Johanne M; Watson, Adam T; Carr, Antony M

2016-05-02

Extraction of DNA from Schizosaccharomyces pombe cells is required for various uses, including templating polymerase chain reactions (PCRs), Southern blotting, library construction, and high-throughput sequencing. To purify high-quality DNA, the cell wall is removed by digestion with Zymolyase or Lyticase and the resulting spheroplasts lysed using sodium dodecyl sulfate (SDS). Cell debris, SDS, and SDS-protein complexes are subsequently precipitated by the addition of potassium acetate and removed by centrifugation. Finally, DNA is precipitated using isopropanol. At this stage, purity is usually sufficient for PCR. However, for more sensitive procedures, such as restriction enzyme digestion, additional purification steps, including proteinase K digestion and phenol-chloroform extraction, are recommended. All of these steps are described in detail here. © 2016 Cold Spring Harbor Laboratory Press.

Genomic DNA extraction method from pearl millet ( Pennisetum ...

African Journals Online (AJOL)

DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

Energy Technology Data Exchange (ETDEWEB)

Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2016-05-01

Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

An optimized DNA extraction protocol for benthic Didymosphenia geminata.

Science.gov (United States)

Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

2014-09-01

Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

International Nuclear Information System (INIS)

Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

2014-01-01

Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

Extraction of DNA from honey and its amplification by PCR for botanical identification

Directory of Open Access Journals (Sweden)

Sona Arun Jain

2013-12-01

Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

Directory of Open Access Journals (Sweden)

Hong Chen

Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

Directory of Open Access Journals (Sweden)

Henry Perdigon

2004-06-01

Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

Directory of Open Access Journals (Sweden)

Jorge Evelio Ángel

2014-04-01

Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

Comparison of DNA extraction methods for human gut microbial community profiling.

Science.gov (United States)

Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

2018-03-01

The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

Overcoming DNA extraction problems from carnivorous plants

Directory of Open Access Journals (Sweden)

Fleischmann, Andreas

2009-12-01

Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

Science.gov (United States)

Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

2015-12-28

Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

Digital PCR for direct quantification of viruses without DNA extraction.

Science.gov (United States)

Pavšič, Jernej; Žel, Jana; Milavec, Mojca

2016-01-01

DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

Two mini-preparation protocols to DNA extraction from plants with ...

African Journals Online (AJOL)

Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

A novel method of genomic DNA extraction for Cactaceae1

Science.gov (United States)

Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

2013-01-01

• Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

Science.gov (United States)

Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

2012-04-20

In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

Science.gov (United States)

Klein, Sonja B; Buoncristiani, Martin R

2017-07-01

Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

Science.gov (United States)

Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

2013-01-02

Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

African Journals Online (AJOL)

BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

OpenAIRE

Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

1997-01-01

For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

Directory of Open Access Journals (Sweden)

Papa Mze Nasserdine

2016-01-01

Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

Science.gov (United States)

Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

2014-01-01

Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

Genomic DNA extraction protocols from ovine hair

Directory of Open Access Journals (Sweden)

Jennifer Nonato da Silva Prate

2013-12-01

Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

An improved protocol and a new grinding device for extraction of genomic DNA from microorganisms by a two-step extraction procedure.

Science.gov (United States)

Zhang, S S; Chen, D; Lu, Q

2012-05-21

Current protocols to extract genomic DNA from microorganisms are still laborious, tedious and costly, especially for the species with thick cell walls. In order to improve the effectiveness of extracting DNA from microbial samples, a novel protocol, defined as two-step extraction method, along with an improved tissue-grinding device, was developed. The protocol included two steps, disruption of microbial cells or spores by grinding the sample together with silica sand in a new device and extraction of DNA with an effective buffer containing cell lysis chemicals. The device was prepared by using a commercial electric mini-grinder, adapted with a grinding stone, and a sample cup processed by lathing from a polytetrafluoroethylene rod. We tested the method with vegetative cells of four microbial species and two microbial spores that have thick cell walls and are therefore hard to process; these included Escherichia coli JM109, Bacillus subtilis WB600, Sacchromyces cerevisiae INVSc1, Trichoderma viride AS3.3711, and the spores of S. cerevisiae and T. viride, respectively, representing Gram-positive bacteria, Gram-negative bacteria, yeast, filamentous fungi. We found that this new method and device extracted usable quantities of genomic DNA from the samples. The DNA fragments that were extracted exceeded 23 kb. The target sequences up to about 5 kb were successfully and exclusively amplified by PCR using extracted DNA as the template. In addition, the DNA extraction was finalized within 1.5 h. Thus, we conclude that this two-step extraction method is an effective and improved protocol for extraction of genomic DNA from microbial samples.

Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

International Nuclear Information System (INIS)

Hincks, J.R.; Coulombe, R.A. Jr.

1989-01-01

Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

Directory of Open Access Journals (Sweden)

Moulay Abdelaziz El Alaoui

Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

Directory of Open Access Journals (Sweden)

Shan Wei

2018-05-01

Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

Directory of Open Access Journals (Sweden)

Ivona Djurkin Kušec

2015-09-01

Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

Directory of Open Access Journals (Sweden)

D.C.A. Leite

2014-01-01

Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

Science.gov (United States)

Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

2018-04-01

Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

DEFF Research Database (Denmark)

Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

2011-01-01

was conducted to examine if sufficient DNA could be successfully extracted from malaria rapid diagnostic tests (RDTs), used and collected as part of routine case management services in health facilities, and thus forming the basis for molecular analyses, surveillance and quality control (QC) testing of RDTs....... continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

DNA extraction from hair shafts of wild Brazilian felids and canids.

Science.gov (United States)

Alberts, C C; Ribeiro-Paes, J T; Aranda-Selverio, G; Cursino-Santos, J R; Moreno-Cotulio, V R; Oliveira, A L D; Porchia, B F M M; Santos, W F; Souza, E B

2010-12-21

Wild felids and canids are usually the main predators in the food chains where they dwell and are almost invisible to behavior and ecology researchers. Due to their grooming behavior, they tend to swallow shed hair, which shows up in the feces. DNA found in hair shafts can be used in molecular studies that can unravel, for instance, genetic variability, reproductive mode and family structure, and in some species, it is even possible to estimate migration and dispersion rates in given populations. First, however, DNA must be extracted from hair. We extracted successfully and dependably hair shaft DNA from eight wild Brazilian felids, ocelot, margay, oncilla, Geoffroy's cat, pampas cat, jaguarundi, puma, and jaguar, as well as the domestic cat and from three wild Brazilian canids, maned wolf, crab-eating fox, and hoary fox, as well as the domestic dog. Hair samples came mostly from feces collected at the São Paulo Zoo and were also gathered from non-sedated pet or from recently dead wild animals and were also collected from museum specimens. Fractions of hair samples were stained before DNA extraction, while most samples were not. Our extraction protocol is based on a feather DNA extraction technique, based in the phenol:chloroform:isoamyl alcohol general method, with proteinase K as digestive enzyme.

Effect of DNA extraction and sample preservation method on rumen bacterial population.

Science.gov (United States)

Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

2014-10-01

The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

A rapid PCR-based approach for molecular identification of filamentous fungi.

Science.gov (United States)

Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

2011-08-01

In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

Comparison of two silica-based extraction methods for DNA isolation from bones.

Science.gov (United States)

Rothe, Jessica; Nagy, Marion

2016-09-01

One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

Directory of Open Access Journals (Sweden)

Shirleny Monserrat Sandoval-Arias

2014-11-01

Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

Arduino-based automation of a DNA extraction system.

Science.gov (United States)

Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

2015-01-01

There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

Effect of Cassia hirsuta (L) extract on DNA profile of some ...

African Journals Online (AJOL)

The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

Comparison of different methodologies for DNA extraction from Aegla longirostri

Directory of Open Access Journals (Sweden)

João Vitor Trindade Bitencourt

2007-11-01

Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

DNA Extraction by Isotachophoresis in a Microfluidic Channel

Energy Technology Data Exchange (ETDEWEB)

Stephenson, S J

2011-08-10

Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

A Fluorescent Tile DNA Diagnocode System for In Situ Rapid and Selective Diagnosis of Cytosolic RNA Cancer Markers

Science.gov (United States)

Park, Kyung Soo; Shin, Seung Won; Jang, Min Su; Shin, Woojung; Yang, Kisuk; Min, Junhong; Cho, Seung-Woo; Oh, Byung-Keun; Bae, Jong Wook; Jung, Sunghwan; Choi, Jeong-Woo; Um, Soong Ho

2015-01-01

Accurate cancer diagnosis often requires extraction and purification of genetic materials from cells, and sophisticated instrumentations that follow. Otherwise in order to directly treat the diagnostic materials to cells, multiple steps to optimize dose concentration and treatment time are necessary due to diversity in cellular behaviors. These processes may offer high precision but hinder fast analysis of cancer, especially in clinical situations that need rapid detection and characterization of cancer. Here we present a novel fluorescent tile DNA nanostructure delivered to cancer cytosol by employing nanoparticle technology. Its structural anisotropicity offers easy manipulation for multifunctionalities, enabling the novel DNA nanostructure to detect intracellular cancer RNA markers with high specificity within 30 minutes post treatment, while the nanoparticle property bypasses the requirement of treatment optimization, effectively reducing the complexity of applying the system for cancer diagnosis. Altogether, the system offers a precise and rapid detection of cancer, suggesting the future use in the clinical fields. PMID:26678430

Comparison of protocols for genomic DNA extraction from 'velame ...

African Journals Online (AJOL)

usuario

2013-07-24

Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

Modifying and adapting a plant-based DNA extraction protocol for ...

African Journals Online (AJOL)

... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.

DNA extraction from wings as a suitable approach for queen bees genotyping

Directory of Open Access Journals (Sweden)

Elena Facchini

2018-06-01

Full Text Available In livestock, genomics has been used since a decade in combination with phenotypic information for the estimation of breeding values. In honey bees (Apis mellifera, the advantage for including genomics in selective breeding programmes is represented by the possibility to reduce the generation interval and increase the accuracies of estimated breeding values resulting in higher genetic gain (Brascamp et al., 2018. The limit for this application is DNA extraction. Extraction methods for small animals such as insects often rely upon destructive approaches. The challenge is to develop tissue sampling methods that permit the survival of the animal while providing adequate quality DNA for genotyping. Along with previous reports of DNA extraction from several matrices, this study aims to contribute in developing suitable methodologies for genotyping honey bees queens using DNA extracted from wing cuttings (Chaline et al., 2004; Gregory and Rinderer, 2004; Gould et al., 2011. The clipping of the queen wings in beekeeping is a common practice and it ensures the survival and normal activities of the animal (Forster, 1971. A total of 57 queens with known pedigree were enrolled for this study. Wings from each queen were cut and stored at -20°C until processed (Fig. 1. Extractions were carried out using a modified protocol provided by Qiagen (DNeasy® Blood & Tissue. The modification consists in an initial incubation of the samples with proteinase K for 20 minutes, further steps are carried out following the manufacturer’s instructions. To test the suitability of the extracted DNA for genotyping, PCR was performed on Esterase FE4 like gene. Although quantification with NanoDrop™ resulted in <20 ng/μL of DNA in solution, the extracted material was sufficient for PCR amplification of candidate genes for sequencing and genotyping. Our results show that it is possible to extract DNA from wings’ cuttings permitting to implement genomic approaches in honey

Genomic DNA extraction from sapwood of Pinus roxburghii for ...

African Journals Online (AJOL)

Ashish

2013-02-22

Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

Directory of Open Access Journals (Sweden)

Jana Žiarovská

2017-01-01

Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

Science.gov (United States)

Kasu, Mohaimin; Shires, Karen

2015-07-01

The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

Directory of Open Access Journals (Sweden)

Enjalbert Jérôme

2011-07-01

Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice

Energy Technology Data Exchange (ETDEWEB)

Jackson, K.R. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Borba, J.C. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Meija, M. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Mills, D.L. [TeGrex Technologies, Sperryville, VA 22740 (United States); Haverstick, D.M. [Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States); Olson, K.E.; Aranda, R. [Office of the Chief Scientist, Defense Forensic Science Center, N 31st Street, Atlanta, GA 30297 (United States); Garner, G.T. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Carrilho, E. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Landers, J.P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States)

2016-09-21

We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. - Highlights: • dSPE design on centrifugal PeT device with a unique mixing strategy was proposed. • Increased fluidic control with novel adhesive tape valves on a PeT device. • Multiplexed spin-dSPE device to run up to 4 samples simultaneously. • Demonstrated strong singleplexed and multiplexed amplification following chip dSPE.

A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

Science.gov (United States)

Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

2017-12-18

Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

Science.gov (United States)

Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

2014-12-01

Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

NARCIS (Netherlands)

Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

2010-01-01

The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were

Impact of two different commercial DNA extraction methods on BK virus viral load

Directory of Open Access Journals (Sweden)

Massimiliano Bergallo

2016-03-01

Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

DEFF Research Database (Denmark)

Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

2013-01-01

in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

Science.gov (United States)

Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

2009-10-12

DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

Science.gov (United States)

Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

2018-01-01

DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

Sources of pre-analytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC.

Directory of Open Access Journals (Sweden)

Elodie Caboux

Full Text Available The European Prospective Investigation into Cancer and nutrition (EPIC is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88% performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies.

Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

Science.gov (United States)

Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

2010-01-01

Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

Genomic DNA extraction method from Annona senegalensis Pers ...

African Journals Online (AJOL)

aghomotsegin

2014-02-05

SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

Science.gov (United States)

McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

2009-01-01

Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

Science.gov (United States)

McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

2009-06-16

As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

Directory of Open Access Journals (Sweden)

Schnabel Robert D

2009-06-01

Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

Directory of Open Access Journals (Sweden)

Nemoda Zsofia

2011-12-01

Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

Science.gov (United States)

Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

2014-01-01

A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

Directory of Open Access Journals (Sweden)

Lingyang Tian

2014-01-01

Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.

Science.gov (United States)

Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P

2017-06-01

Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.

A simple, rapid and efficient method for the extraction of genomic ...

African Journals Online (AJOL)

The isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including long range PCR, endonuclease restriction digestion, southern blot analysis, and genomic library construction. Many protocols are available for the extraction of DNA from plant material, but obtain it is ...

[Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

Science.gov (United States)

Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

2012-01-01

Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

Science.gov (United States)

Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

2015-07-01

Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

Directory of Open Access Journals (Sweden)

Shichu Huang

Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

Science.gov (United States)

Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

2013-01-01

In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.

Science.gov (United States)

Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin

2017-12-19

Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.

[DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

Science.gov (United States)

Yang, Dian; Liu, Chao; Liu, Hong

2011-12-01

To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

An effective and low-cost method for DNA extraction from herbal ...

African Journals Online (AJOL)

Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

Extraction of DNA from Forensic Biological Samples for Genotyping.

Science.gov (United States)

Stray, J E; Liu, J Y; Brevnov, M G; Shewale, J G

2010-07-01

Biological forensic samples constitute evidence with probative organic matter. Evidence believed to contain DNA is typically processed for extraction and purification of its nucleic acid content. Forensic DNA samples are composed of two things, a tissue and the substrate it resides on. Compositionally, a sample may contain almost anything and for each, the type, integrity, and content of both tissue and substrate will vary, as will the contaminant levels. This fact makes the success of extraction one of the most unpredictable steps in genotypic analysis. The development of robust genotyping systems and analysis platforms for short tandem repeat (STR) and mitochondrial DNA sequencing and the acceptance of results generated by these methods in the court system, resulted in a high demand for DNA testing. The increasing variety of sample submissions created a need to isolate DNA from forensic samples that may be compromised or contain low levels of biological material. In the past decade, several robust chemistries and isolation methods have been developed to safely and reliably recover DNA from a wide array of sample types in high yield and free of PCR inhibitors. In addition, high-throughput automated workflows have been developed to meet the demand for processing increasing numbers of samples. This review summarizes a number of the most widely adopted methods and the best practices for DNA isolation from forensic biological samples, including manual, semiautomated, and fully automated platforms. Copyright © 2010 Central Police University.

Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

Directory of Open Access Journals (Sweden)

Gilda ESLAMI

2017-06-01

Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

Science.gov (United States)

Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.

2015-01-01

Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

Comparison of two commercial DNA extraction kits for the analysis of nasopharyngeal bacterial communities

Directory of Open Access Journals (Sweden)

Keith A. Crandall

2016-04-01

Full Text Available Characterization of microbial communities via next-generation sequencing (NGS requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagenfor the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732.Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests and taxa proportions (Kruskal-Wallis test were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001 between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

Directory of Open Access Journals (Sweden)

Elena Ordoñez

2013-01-01

Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

Directory of Open Access Journals (Sweden)

Nicole L Podnecky

Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

Science.gov (United States)

Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

2015-01-01

Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples.

Science.gov (United States)

Miller, D N; Bryant, J E; Madsen, E L; Ghiorse, W C

1999-11-01

We compared and statistically evaluated the effectiveness of nine DNA extraction procedures by using frozen and dried samples of two silt loam soils and a silt loam wetland sediment with different organic matter contents. The effects of different chemical extractants (sodium dodecyl sulfate [SDS], chloroform, phenol, Chelex 100, and guanadinium isothiocyanate), different physical disruption methods (bead mill homogenization and freeze-thaw lysis), and lysozyme digestion were evaluated based on the yield and molecular size of the recovered DNA. Pairwise comparisons of the nine extraction procedures revealed that bead mill homogenization with SDS combined with either chloroform or phenol optimized both the amount of DNA extracted and the molecular size of the DNA (maximum size, 16 to 20 kb). Neither lysozyme digestion before SDS treatment nor guanidine isothiocyanate treatment nor addition of Chelex 100 resin improved the DNA yields. Bead mill homogenization in a lysis mixture containing chloroform, SDS, NaCl, and phosphate-Tris buffer (pH 8) was found to be the best physical lysis technique when DNA yield and cell lysis efficiency were used as criteria. The bead mill homogenization conditions were also optimized for speed and duration with two different homogenizers. Recovery of high-molecular-weight DNA was greatest when we used lower speeds and shorter times (30 to 120 s). We evaluated four different DNA purification methods (silica-based DNA binding, agarose gel electrophoresis, ammonium acetate precipitation, and Sephadex G-200 gel filtration) for DNA recovery and removal of PCR inhibitors from crude extracts. Sephadex G-200 spin column purification was found to be the best method for removing PCR-inhibiting substances while minimizing DNA loss during purification. Our results indicate that for these types of samples, optimum DNA recovery requires brief, low-speed bead mill homogenization in the presence of a phosphate-buffered SDS-chloroform mixture, followed

A DNA Barcode-Based RPA Assay (BAR-RPA for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao

Directory of Open Access Journals (Sweden)

Enwei Tian

2017-12-01

Full Text Available Background: Wuzhimaotao (the dry root of Ficus hirta is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans, which contains gelsemine that is extremely neurotoxic and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA with species–specific primers targeting the internal transcribed spacer (ITS region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species–specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min of the ITS region under a constant and mild temperature range of 37–42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

[Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

Science.gov (United States)

Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

2013-08-01

To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

Science.gov (United States)

Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

2012-01-01

Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

Nonhomologous DNA End Joining in Cell-Free Extracts

Directory of Open Access Journals (Sweden)

Sheetal Sharma

2010-01-01

Full Text Available Among various DNA damages, double-strand breaks (DSBs are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems.

A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

Directory of Open Access Journals (Sweden)

Aqeela S. Abuidrees

2016-06-01

Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

Facile preparation of a DNA sensor for rapid herpes virus detection

Energy Technology Data Exchange (ETDEWEB)

Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

2010-10-12

In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

Facile preparation of a DNA sensor for rapid herpes virus detection

International Nuclear Information System (INIS)

Tam, Phuong Dinh; Tuan, Mai Anh; Huy, Tran Quang; Le, Anh-Tuan; Hieu, Nguyen Van

2010-01-01

In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

An improved method of DNA extraction from plants for pathogen ...

African Journals Online (AJOL)

Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

DNA Damage Protecting Activity and Antioxidant Potential of Launaea taraxacifolia Leaves Extract.

Science.gov (United States)

Adinortey, Michael Buenor; Ansah, Charles; Weremfo, Alexander; Adinortey, Cynthia Ayefoumi; Adukpo, Genevieve Etornam; Ameyaw, Elvis Ofori; Nyarko, Alexander Kwadwo

2018-01-01

The leaf extract of Launaea taraxacifolia commonly known as African Lettuce is used locally to treat dyslipidemia and liver diseases, which are associated with oxidative stress. Methanol extract from L. taraxacifolia leaves was tested for its antioxidant activity and its ability to protect DNA from oxidative damage. In vitro antioxidant potential of the leaf extract was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), nitric oxide (NO), and hydroxyl (OH) radical scavenging assays. Ferric reducing power, total antioxidant capacity (TAC), metal chelating, and anti-lipid peroxidation ability of the extract were also examined using gallic acid, ascorbic acid, citric acid, and ethylenediaminetetraacetic acid as standards. L. taraxacifolia leaves extract showed antioxidant activity with IC 50 values of 16.18 μg/ml (DPPH), 123.3 μg/ml (NO), 128.2 μg/ml (OH radical), 97.94 μg/ml (metal chelating), 80.28 μg/ml (TAC), and 23 μg/ml (anti-lipid peroxidation activity). L. taraxacifolia leaves extract exhibited a strong capability for DNA damage protection at 20 mg/ml concentration. These findings suggest that the methanolic leaf extract of L. taraxacifolia could be used as a natural antioxidant and also as a preventive therapy against diseases such as arteriosclerosis associated with DNA damage.

Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

International Nuclear Information System (INIS)

Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

2011-01-01

Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

Lab-on-capillary: a rapid, simple and quantitative genetic analysis platform integrating nucleic acid extraction, amplification and detection.

Science.gov (United States)

Fu, Yu; Zhou, Xiaoming; Xing, Da

2017-12-05

In this work, we describe for the first time a genetic diagnosis platform employing a polydiallyldimethylammonium chloride (PDDA)-modified capillary and a liquid-based thermalization system for rapid, simple and quantitative DNA analysis with minimal user interaction. Positively charged PDDA is modified on the inner surface of the silicon dioxide capillary by using an electrostatic self-assembly approach that allows the negatively charged DNA to be separated from the lysate in less than 20 seconds. The capillary loaded with the PCR mix is incorporated in the thermalization system, which can achieve on-site real-time PCR. This system is based on the circulation of pre-heated liquids in the chamber, allowing for high-speed thermalization of the capillary and fast amplification. Multiple targets can be simultaneously analysed with multiplex spatial melting. Starting with live Escherichia coli (E. coli) cells in milk, as a realistic sample, the current method can achieve DNA extraction, amplification, and detection within 40 min.

Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

OpenAIRE

Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

2017-01-01

Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

Science.gov (United States)

Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

2016-01-01

The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

Science.gov (United States)

Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

2015-04-07

Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

Evaluation of methods for the extraction and purification of DNA from the human microbiome.

Directory of Open Access Journals (Sweden)

Sanqing Yuan

Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

Science.gov (United States)

Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

2010-10-01

A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

RBE comparison between rapid electrons of 20 MeV and 45 MeV with survival rate, DNA synthesis, DNA reparation and nucleoid sedimentation

International Nuclear Information System (INIS)

Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)

1982-01-01

In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de

Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.

Science.gov (United States)

Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang

2011-06-15

Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.

Feasibility of RNA and DNA Extraction from Fresh Pipelle and Archival Endometrial Tissues for Use in Gene Expression and SNP Arrays

Directory of Open Access Journals (Sweden)

Heather D. Kissel

2013-01-01

Full Text Available Identifying molecular markers of endometrial hyperplasia (neoplasia progression is critical to cancer prevention. To assess RNA and DNA quantity and quality from routinely collected endometrial samples and evaluate the performance of RNA- and DNA-based arrays across endometrial tissue types, we collected fresh frozen (FF Pipelle, FF curettage, and formalin-fixed paraffin-embedded (FFPE hysterectomy specimens (benign indications from eight women. Additionally, neoplastic and uninvolved tissues from 24 FFPE archival hysterectomy specimens with endometrial hyperplasias and carcinomas were assessed. RNA was extracted from 15 of 16 FF and 51 of 51 FFPE samples, with yields >1.2 μg for 13/15 (87% FF and 50/51 (98% FFPE samples. Extracted RNA was of high quality; all samples performed successfully on the Illumina whole-genome cDNA-mediated annealing, selection, extension, and ligation (WG-DASL array and performance did not vary by tissue type. While DNA quantity from FFPE samples was excellent, quality was not sufficient for successful performance on the Affymetrix SNP Array 6.0. In conclusion, FF Pipelle samples, which are minimally invasive, yielded excellent quantity and quality of RNA for gene expression arrays (similar to FF curettage and should be considered for use in genomic studies. FFPE-derived DNA should be evaluated on new rapidly evolving sequencing platforms.

Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

Science.gov (United States)

Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

2017-02-01

An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

DEFF Research Database (Denmark)

Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

2012-01-01

Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

Digital PCR for direct quantification of viruses without DNA extraction

OpenAIRE

Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

2015-01-01

DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

Rapid Statistical Learning Supporting Word Extraction From Continuous Speech.

Science.gov (United States)

Batterink, Laura J

2017-07-01

The identification of words in continuous speech, known as speech segmentation, is a critical early step in language acquisition. This process is partially supported by statistical learning, the ability to extract patterns from the environment. Given that speech segmentation represents a potential bottleneck for language acquisition, patterns in speech may be extracted very rapidly, without extensive exposure. This hypothesis was examined by exposing participants to continuous speech streams composed of novel repeating nonsense words. Learning was measured on-line using a reaction time task. After merely one exposure to an embedded novel word, learners demonstrated significant learning effects, as revealed by faster responses to predictable than to unpredictable syllables. These results demonstrate that learners gained sensitivity to the statistical structure of unfamiliar speech on a very rapid timescale. This ability may play an essential role in early stages of language acquisition, allowing learners to rapidly identify word candidates and "break in" to an unfamiliar language.

Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

Science.gov (United States)

Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

2005-01-01

AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

A rapid method for screening arrayed plasmid cDNA library by PCR

International Nuclear Information System (INIS)

Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

1999-01-01

Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

Directory of Open Access Journals (Sweden)

Alyssa D. Ammazzalorso

2015-08-01

Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

Rapid extraction of virus-contaminated hemocytes from oysters

Science.gov (United States)

Rapid viral detection methods are necessary to employ diagnostic testing for viral contamination in shellfish to prevent and control foodborne illness. Current shellfish viral RNA extraction methods, which are time-consuming and not applicable for routine monitoring, require the testing of whole or ...

Noninvasive genetic sampling of endangered muriqui (Primates, Atelidae: efficiency of fecal DNA extraction

Directory of Open Access Journals (Sweden)

Paulo B. Chaves

2006-01-01

Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.

Designing easy DNA extraction: Teaching creativity through laboratory practice.

Science.gov (United States)

Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

2017-05-01

Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

Simple DNA extraction of urine samples: Effects of storage temperature and storage time.

Science.gov (United States)

Ng, Huey Hian; Ang, Hwee Chen; Hoe, See Ying; Lim, Mae-Lynn; Tai, Hua Eng; Soh, Richard Choon Hock; Syn, Christopher Kiu-Choong

2018-06-01

Urine samples are commonly analysed in cases with suspected illicit drug consumption. In events of alleged sample mishandling, urine sample source identification may be necessary. A simple DNA extraction procedure suitable for STR typing of urine samples was established on the Promega Maxwell ® 16 paramagnetic silica bead platform. A small sample volume of 1.7mL was used. Samples were stored at room temperature, 4°C and -20°C for 100days to investigate the influence of storage temperature and time on extracted DNA quantity and success rate of STR typing. Samples stored at room temperature exhibited a faster decline in DNA yield with time and lower typing success rates as compared to those at 4°C and -20°C. This trend can likely be attributed to DNA degradation. In conclusion, this study presents a quick and effective DNA extraction protocol from a small urine volume stored for up to 100days at 4°C and -20°C. Copyright © 2018 Elsevier B.V. All rights reserved.

Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

Directory of Open Access Journals (Sweden)

Imelda Kristina Sutrisno

2013-06-01

Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

DNA in ancient bone - where is it located and how should we extract it?

DEFF Research Database (Denmark)

Campos, Paula; Craig, Oliver E.; Turner-Walker, Gordon

2012-01-01

Despite the widespread use of bones in ancient DNA (aDNA) studies, relatively little concrete information exists in regard to how the DNA in mineralised collagen degrades, or where it survives in the material's architecture. While, at the macrostructural level, physical exclusion of microbes...... and other external contaminants may be an important feature, and, at the ultrastructural level, the adsorption of DNA to hydroxyapatite and/or binding of DNA to Type I collagen may stabilise the DNA, the relative contribution of each, and what other factors may be relevant, are unclear....... The question arises as to whether this may be due to post-collection preservation or just an artefact of the extraction methods used in these different studies? In an attempt to resolve these questions, we examine the efficacy of DNA extraction methods, and the quality and quantity of DNA recovered from both...

Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

DEFF Research Database (Denmark)

Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

2017-01-01

Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

DEFF Research Database (Denmark)

Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

2011-01-01

of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

Science.gov (United States)

Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

2008-12-01

A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

International Nuclear Information System (INIS)

Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

1995-01-01

The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

OpenAIRE

Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

2016-01-01

ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

Simplified extraction of good quality genomic DNA from a variety of ...

African Journals Online (AJOL)

Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

Simple practical approach for sample loading prior to DNA extraction using a silica monolith in a microfluidic device.

Science.gov (United States)

Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

2009-12-07

A novel DNA loading methodology is presented for performing DNA extraction on a microfluidic system. DNA in a chaotropic salt solution was manually loaded onto a silica monolith orthogonal to the subsequent flow of wash and elution solutions. DNA was successfully extracted from buccal swabs using electro-osmotic pumping (EOP) coupled with in situ reagents contained within a 1.5% agarose gel matrix. The extracted DNA was of sufficient quantity and purity for polymerase chain reaction (PCR) amplification.

Rapid detection of cancer related DNA nanoparticulate biomarkers and nanoparticles in whole blood

Science.gov (United States)

Heller, Michael J.; Krishnan, Raj; Sonnenberg, Avery

2010-08-01

The ability to rapidly detect cell free circulating (cfc) DNA, cfc-RNA, exosomes and other nanoparticulate disease biomarkers as well as drug delivery nanoparticles directly in blood is a major challenge for nanomedicine. We now show that microarray and new high voltage dielectrophoretic (DEP) devices can be used to rapidly isolate and detect cfc-DNA nanoparticulates and nanoparticles directly from whole blood and other high conductance samples (plasma, serum, urine, etc.). At DEP frequencies of 5kHz-10kHz both fluorescent-stained high molecular weight (hmw) DNA, cfc-DNA and fluorescent nanoparticles separate from the blood and become highly concentrated at specific DEP highfield regions over the microelectrodes, while blood cells move to the DEP low field-regions. The blood cells can then be removed by a simple fluidic wash while the DNA and nanoparticles remain highly concentrated. The hmw-DNA could be detected at a level of <260ng/ml and the nanoparticles at <9.5 x 109 particles/ml, detection levels that are well within the range for viable clinical diagnostics and drug nanoparticle monitoring. Disease specific cfc-DNA materials could also be detected directly in blood from patients with Chronic Lymphocytic Leukemia (CLL) and confirmed by PCR genotyping analysis.

Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

Directory of Open Access Journals (Sweden)

Zakia Khanam

2015-10-01

Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

Science.gov (United States)

Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

2009-10-01

Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

Evaluation of five DNA extraction methods for purification of DNA from atherosclerotic tissue and estimation of prevalence of Chlamydia pneumoniae in tissue from a Danish population undergoing vascular repair

Directory of Open Access Journals (Sweden)

Lindholt Jes S

2003-09-01

Full Text Available Abstract Background To date PCR detection of Chlamydia pneumoniae DNA in atherosclerotic lesions from Danish patients has been unsuccessful. To establish whether non-detection was caused by a suboptimal DNA extraction method, we tested five different DNA extraction methods for purification of DNA from atherosclerotic tissue. Results The five different DNA extraction methods were tested on homogenate of atherosclerotic tissue spiked with C. pneumoniae DNA or EB, on pure C. pneumoniae DNA samples and on whole C. pneumoniae EB. Recovery of DNA was measured with a C. pneumoniae-specific quantitative real-time PCR. A DNA extraction method based on DNA-binding to spin columns with a silica-gel membrane (DNeasy Tissue kit showed the highest recovery rate for the tissue samples and pure DNA samples. However, an automated extraction method based on magnetic glass particles (MagNA Pure performed best on intact EB and atherosclerotic tissue spiked with EB. The DNeasy Tissue kit and MagNA Pure methods and the highly sensitive real-time PCR were subsequently used on 78 atherosclerotic tissue samples from Danish patients undergoing vascular repair. None of the samples were positive for C. pneumoniae DNA. The atherosclerotic samples were tested for inhibition by spiking with two different, known amounts of C. pneumoniae DNA and no samples showed inhibition. Conclusion As a highly sensitive PCR method and an optimised DNA extraction method were used, non-detection in atherosclerotic tissue from the Danish population was probably not caused by use of inappropriate methods. However, more samples may need to be analysed per patient to be completely certain on this. Possible methodological and epidemiological reasons for non-detection of C. pneumoniae DNA in atherosclerotic tissue from the Danish population are discussed. Further testing of DNA extraction methods is needed as this study has shown considerable intra- and inter-method variation in DNA recovery.

Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

Science.gov (United States)

Sá, Olga; Pereira, José Alberto; Baptista, Paula

2011-01-01

Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

Directory of Open Access Journals (Sweden)

Paula Baptista

2011-06-01

Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

A high throughput DNA extraction method with high yield and quality

Directory of Open Access Journals (Sweden)

Xin Zhanguo

2012-07-01

Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

DEFF Research Database (Denmark)

Lever, Mark; Torti, Andrea; Eickenbusch, Philip

2015-01-01

tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world...... DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample...

Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

Science.gov (United States)

Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

2006-12-14

DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

Science.gov (United States)

Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

2012-05-01

In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

Science.gov (United States)

Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

2012-05-01

The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

Science.gov (United States)

Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

2012-09-01

Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

Directory of Open Access Journals (Sweden)

Gemma Henderson

Full Text Available Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However

Rapid DNA multi-analyte immunoassay on a magneto-resistance biosensor

NARCIS (Netherlands)

Koets, M.; Wijk, van der T.; Eemeren, van J.T.W.M.; Amerongen, van A.; Prins, M.W.J.

2009-01-01

We present the rapid and sensitive detection of amplified DNA on a giant magneto-resistance sensor using superparamagnetic particles as a detection label. The one-step assay is performed on an integrated and miniaturized detection platform suitable for application into point-of-care devices. A

Photoelectrochemical Sensors for the Rapid Detection of DNA Damage Induced by Some Nanoparticles

Directory of Open Access Journals (Sweden)

M. Jamaluddin Ahmed

2010-06-01

Full Text Available Photoelectrochemcal sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy2 (dppz2+ [bpy=2, 2′ -bipyridine, dppz=dipyrido( 3, 2-a: 2′ 3′-c phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy2 (dppz2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time – dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polysterene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals.

Photoelectrochemical sensors for the rapid detection of DNA damage Induced by some nanoparticles

International Nuclear Information System (INIS)

Ahmed, M.J.; Zhang, B.T.; Guo, L.H.

2010-01-01

Photoelectrochemical sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy)2 (dppz)2+ [bpy=2, 2' -bipyridine, dppz=dipyrido (3, 2-a: 2' 3'-c) phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy)2 (dppz)2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine) was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time . dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polystyrene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals. (author)

Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

Directory of Open Access Journals (Sweden)

Åkerlund Monika

2010-01-01

Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

Science.gov (United States)

Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

2012-05-15

Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

Science.gov (United States)

Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

2014-11-01

The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

Directory of Open Access Journals (Sweden)

Byung-Hyuk Kim

Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

DEFF Research Database (Denmark)

Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

2015-01-01

) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

Science.gov (United States)

Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

2018-01-01

ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

Directory of Open Access Journals (Sweden)

André Moura

2016-07-01

Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

Grape (Vitis vinifera) extracts protect against radiation-induced oxidative stress and DNA damage

International Nuclear Information System (INIS)

Singha, Indrani; Das, Subir Kumar; Saxena, S.; Gautam, S.

2016-01-01

Ionizing radiation (IR) causes oxidative stress through the overwhelming generation of reactive oxygen species (ROS) in the living cells leading further to the oxidative damage to biomolecules. Grapes (Vitis vinifera) contain several bioactive phytochemicals and are the richest source of antioxidant. In this study, we investigated and compared in vitro antioxidant activity and DNA damage protective property of the grape extracts of four different cultivars, including the Thompson seedless, Flame seedless, Kishmish chorni and Red globe. The activities of ascorbic acid oxidase and catalase significantly (p<0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly among extracts of any cultivar. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay and ABTS. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. DNA damage was evaluated in acellular system using pBR322 plasmid relaxation. Grape extract was able to effectively scavenge free radicals in vitro. It could significantly prevent radiation-induced DNA damage. Furthermore, the protective action of grape depends on the source of extract and type of the cultivars. (author)

A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

Science.gov (United States)

Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

2016-01-01

Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

Comparison of eight methods for the extraction of Bacillus atrophaeus spore DNA from eleven common interferents and a common swab.

Directory of Open Access Journals (Sweden)

Helen L Rose

Full Text Available Eight DNA extraction products or methods (Applied Biosystems PrepFiler Forensic DNA Extraction Kit; Bio-Rad Instagene Only, Bio-Rad Instagene & Spin Column Purification; EpiCentre MasterPure DNA & RNA Kit; FujiFilm QuickGene Mini80; Idaho Technologies 1-2-3 Q-Flow Kit; MoBio UltraClean Microbial DNA Isolation Kit; Sigma Extract-N-Amp Plant and Seed Kit were adapted to facilitate extraction of DNA under BSL3 containment conditions. DNA was extracted from 12 common interferents or sample types, spiked with spores of Bacillus atropheaus. Resulting extracts were tested by real-time PCR. No one method was the best, in terms of DNA extraction, across all sample types. Statistical analysis indicated that the PrepFiler method was the best method from six dry powders (baking, biological washing, milk, plain flour, filler and talcum and one solid (Underarm deodorant, the UltraClean method was the best from four liquids (aftershave, cola, nutrient broth, vinegar, and the MasterPure method was the best from the swab sample type. The best overall method, in terms of DNA extraction, across all sample types evaluated was the UltraClean method.

High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

DEFF Research Database (Denmark)

Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke

2013-01-01

the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

Energy Technology Data Exchange (ETDEWEB)

Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

2012-11-15

The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

Science.gov (United States)

Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

2017-01-01

Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

Science.gov (United States)

Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

2015-05-01

DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

Directory of Open Access Journals (Sweden)

L. S. Dyshlyuk

2014-01-01

Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

A simple Chelex protocol for DNA extraction from Anopheles spp.

Science.gov (United States)

Musapa, Mulenga; Kumwenda, Taida; Mkulama, Mtawa; Chishimba, Sandra; Norris, Douglas E; Thuma, Philip E; Mharakurwa, Sungano

2013-01-09

Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens. We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km(2) vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol(9,10). The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction(9). Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality, a PCR for identification of Anopheles gambiae sibling species(10) and a nested PCR for typing of Plasmodium falciparum infection

Toxic reagents and expensive equipment: are they really necessary for the extraction of good quality fungal DNA?

Science.gov (United States)

Rodrigues, P; Venâncio, A; Lima, N

2018-01-01

The aim of this work was to evaluate a fungal DNA extraction procedure with the lowest inputs in terms of time as well as of expensive and toxic chemicals, but able to consistently produce genomic DNA of good quality for PCR purposes. Two types of fungal biological material were tested - mycelium and conidia - combined with two protocols for DNA extraction using Sodium Dodecyl Sulphate (SDS) and Cetyl Trimethyl Ammonium Bromide as extraction buffers and glass beads for mechanical disruption of cell walls. Our results showed that conidia and SDS buffer was the combination that lead to the best DNA quality and yield, with the lowest variation between samples. This study clearly demonstrates that it is possible to obtain high yield and pure DNA from pigmented conidia without the use of strong cell disrupting procedures and of toxic reagents. There are numerous methods for DNA extraction from fungi. Some rely on expensive commercial kits and/or equipments, unavailable for many laboratories, or make use of toxic chemicals such as chloroform, phenol and mercaptoethanol. This study clearly demonstrates that it is possible to obtain high yields of pure DNA from pigmented conidia without the use of strong and expensive cell disrupting procedures and of toxic reagents. The method herein described is simultaneously inexpensive and adequate to DNA extraction from several different types of fungi. © 2017 The Society for Applied Microbiology.

Rapid extraction and assay of uranium from environmental surface samples

Energy Technology Data Exchange (ETDEWEB)

Barrett, Christopher A.; Chouyyok, Wilaiwan; Speakman, Robert J.; Olsen, Khris B.; Addleman, Raymond Shane

2017-10-01

Extraction methods enabling faster removal and concentration of uranium compounds for improved trace and low-level assay are demonstrated for standard surface sampling material in support of nuclear safeguards efforts, health monitoring, and other nuclear analysis applications. A key problem with the existing surface sampling swipes is the requirement for complete digestion of sample and sampling matrix. This is a time-consuming and labour-intensive process that limits laboratory throughput, elevates costs, and increases background levels. Various extraction methods are explored for their potential to quickly and efficiently remove different chemical forms of uranium from standard surface sampling material. A combination of carbonate and peroxide solutions is shown to give the most rapid and complete form of uranyl compound extraction and dissolution. This rapid extraction process is demonstrated to be compatible with standard inductive coupled plasma mass spectrometry methods for uranium isotopic assay as well as screening techniques such as x-ray fluorescence. The general approach described has application beyond uranium to other analytes of nuclear forensic interest (e.g., rare earth elements and plutonium) as well as heavy metals for environmental and industrial hygiene monitoring.

Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

Directory of Open Access Journals (Sweden)

Khandaker Shadia

2012-01-01

Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers

Science.gov (United States)

Harika, Katakam; Mahla, Ranjeet Singh; Shivaji, Sisinthy

2012-01-01

Background Non-invasively collected samples allow a variety of genetic studies on endangered and elusive species. However due to low amplification success and high genotyping error rates fewer samples can be identified up to the individual level. Number of PCRs needed to obtain reliable genotypes also noticeably increase. Methods We developed a quantitative PCR assay to measure and grade amplifiable nuclear DNA in feline faecal extracts. We determined DNA degradation in experimentally aged faecal samples and tested a suite of pre-PCR protocols to considerably improve DNA retrieval. Results Average DNA concentrations of Grade I, II and III extracts were 982pg/µl, 9.5pg/µl and 0.4pg/µl respectively. Nearly 10% of extracts had no amplifiable DNA. Microsatellite PCR success and allelic dropout rates were 92% and 1.5% in Grade I, 79% and 5% in Grade II, and 54% and 16% in Grade III respectively. Our results on experimentally aged faecal samples showed that ageing has a significant effect on quantity and quality of amplifiable DNA (pDNA degradation occurs within 3 days of exposure to direct sunlight. DNA concentrations of Day 1 samples stored by ethanol and silica methods for a month varied significantly from fresh Day 1 extracts (p0.05). DNA concentrations of fresh tiger and leopard faecal extracts without addition of carrier RNA were 816.5pg/µl (±115.5) and 690.1pg/µl (±207.1), while concentrations with addition of carrier RNA were 49414.5pg/µl (±9370.6) and 20982.7pg/µl (±6835.8) respectively. Conclusions Our results indicate that carnivore faecal samples should be collected as freshly as possible, are better preserved by two-step method and should be extracted with addition of carrier RNA. We recommend quantification of template DNA as this facilitates several downstream protocols. PMID:23071624

Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

Science.gov (United States)

Lech, T

2016-05-06

Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

An optimized protocol for DNA extraction from wheat seeds and Loop-Mediated Isothermal Amplification (LAMP) to detect Fusarium graminearum contamination of wheat grain.

Science.gov (United States)

Abd-Elsalam, Kamel; Bahkali, Ali; Moslem, Mohamed; Amin, Osama E; Niessen, Ludwig

2011-01-01

A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs) were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP) procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

International Nuclear Information System (INIS)

Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

2012-01-01

The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials. �

DNA preservation in silk.

Science.gov (United States)

Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

2017-06-27

The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

Science.gov (United States)

Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

2013-07-01

Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods.

Science.gov (United States)

Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N; Hoflund, Anders; Mogensen, Helle S; Hansen, Anders J; Morling, Niels

2013-05-01

The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were processed. The highest DNA recovery was obtained with the PrepFiler Express kit on an AutoMate Express while the lowest DNA recovery was obtained using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen. Extraction using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen resulted in the lowest percentage of PCR inhibition (0%) while extraction using manual Chelex resulted in the highest percentage of PCR inhibition (51%). The largest number of reportable STR-profiles was obtained with DNA from samples extracted with the PrepFiler Express kit (75%) while the lowest number was obtained with DNA from samples extracted using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen (41%). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

Science.gov (United States)

Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

2013-01-01

Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

DNA is a co-factor for its own replication in Xenopus egg extracts

NARCIS (Netherlands)

Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

Quantification of DNA in Neonatal Dried Blood Spots by Adenine Tandem Mass Spectrometry.

Science.gov (United States)

Durie, Danielle; Yeh, Ed; McIntosh, Nathan; Fisher, Lawrence; Bulman, Dennis E; Birnboim, H Chaim; Chakraborty, Pranesh; Al-Dirbashi, Osama Y

2018-01-02

Newborn screening programs have expanded to include molecular-based assays as first-tier tests and the success of these assays depends on the quality and yield of DNA extracted from neonatal dried blood spots (DBS). To meet high throughput and rapid turnaround time requirements, newborn screening laboratories adopted rapid DNA extraction methods that produce crude extracts. Quantification of DNA in neonatal DBS is not routinely performed due to technical challenges; however, this may enhance the performance of assays that are sensitive to amounts of input DNA. In this study, we developed a novel high throughput method to quantify total DNA in DBS. It is based on specific acid-catalyzed depurination of DNA followed by mass spectrometric quantification of adenine. The amount of adenine was used to calculate DNA quantity per 3.2 mm DBS. Reference intervals were established using archived, neonatal DBS (n = 501) and a median of 130.6 ng of DNA per DBS was obtained, which is in agreement with literature values. The intra- and interday variations were quantification were 12.5 and 37.8 nmol/L adenine, respectively. We demonstrated that DNA from neonatal DBS can be successfully quantified in high throughput settings using instruments currently deployed in NBS laboratories.

CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

Directory of Open Access Journals (Sweden)

MacKinnon Ruth N

2012-02-01

Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

Optimizing factors influencing DNA extraction from fresh whole avian ...

African Journals Online (AJOL)

A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

Science.gov (United States)

Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

2009-05-01

Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (pextract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (pextract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs

Directory of Open Access Journals (Sweden)

Ana Cristina dos Reis Ferreira

2015-06-01

Full Text Available ABSTRACT. Ferreira A.C.dosR. & dos Santos B.M. [Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs.] Avaliação de três métodos de extração de DNA de Salmonella sp. em ovos de galinhas contaminados artificialmente. Revista Brasileira de Medicina Veterinária, 37(2:115-119, 2015. Departamento de Veterinária, Universidade Federal de Viçosa, Campus Universitário, Av. Peter Henry Rolfs, s/n, Viçosa, MG 36571-000, Brasil. E-mail: bmsantos@ufv.br The present study evaluated the efficiency of different protocols for the genomic DNA extraction of Salmonella bacteria in chicken eggs free of specific pathogens – SPF. Seventy-five eggs were used and divided into five groups with fifteen eggs each. Three of the five groups of eggs were inoculated with enteric Salmonella cultures. One of the five groups was inoculated with Escherichia coli bacterium culture. And another group of eggs was the negative control that received saline solution 0.85% infertile. The eggs were incubated on a temperature that varied from 20 to 25°C during 24, 48 and 72 hours. Five yolks of each group were collected every 24 hours. These yolks were homogenized and centrifuged during 10 minutes. The supernatant was rejected. After the discard, PBS ph 7.2 was added and centrifuged again. The sediment obtained of each group was used for the extraction of bacterial genomic DNA. Silica particles and a commercial kit were utilized as the extraction methods. The extracted DNA was kept on a temperature of 20°C until the evaluation through PCR. The primers utilized were related with the invA gene and they were the following: 5’ GTA AAA TTA TCG CCA CGT TCG GGC AA 3’ and 5’ TCA TCG CAC CGT CAA AGG AAC C 3’. The amplification products were visualized in transilluminator with ultraviolet light. The obtained results through the bacterial DNA extractions demonstrated that the extraction method utilizing silica particles was

Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

Directory of Open Access Journals (Sweden)

Wajhul Qamar

2017-11-01

Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

Evaluation of the ISO standard 11063 DNA extraction procedure for assessing soil microbial abundance and community structure.

Directory of Open Access Journals (Sweden)

Pierre Plassart

Full Text Available Soil DNA extraction has become a critical step in describing microbial biodiversity. Historically, ascertaining overarching microbial ecological theories has been hindered as independent studies have used numerous custom and commercial DNA extraction procedures. For that reason, a standardized soil DNA extraction method (ISO-11063 was previously published. However, although this ISO method is suited for molecular tools such as quantitative PCR and community fingerprinting techniques, it has only been optimized for examining soil bacteria. Therefore, the aim of this study was to assess an appropriate soil DNA extraction procedure for examining bacterial, archaeal and fungal diversity in soils of contrasting land-use and physico-chemical properties. Three different procedures were tested: the ISO-11063 standard; a custom procedure (GnS-GII; and a modified ISO procedure (ISOm which includes a different mechanical lysis step (a FastPrep ®-24 lysis step instead of the recommended bead-beating. The efficacy of each method was first assessed by estimating microbial biomass through total DNA quantification. Then, the abundances and community structure of bacteria, archaea and fungi were determined using real-time PCR and terminal restriction fragment length polymorphism approaches. Results showed that DNA yield was improved with the GnS-GII and ISOm procedures, and fungal community patterns were found to be strongly dependent on the extraction method. The main methodological factor responsible for differences between extraction procedure efficiencies was found to be the soil homogenization step. For integrative studies which aim to examine bacteria, archaea and fungi simultaneously, the ISOm procedure results in higher DNA recovery and better represents microbial communities.

A simple and cost-effective method of DNA extraction from small formalin-fixed paraffin-embedded tissue for molecular oncologic testing.

Science.gov (United States)

Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin

2014-01-01

Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.

Development of a Competent and Trouble Free DNA Isolation Protocol for Downstream Genetic Analyses in Glycine Species

Directory of Open Access Journals (Sweden)

Muhammad Amjad Nawaz

2016-08-01

Full Text Available Extraction of deoxyribose nucleic acid (DNA from plants is preliminary step in molecular biology. Fast and cost effective genomic DNA isolation from Glycine species for downstream application is a major bottleneck. Here we report a high throughput and trouble free method for genomic DNA extraction from leaf and seeds of Glycine species with high quality and quantity. Protocol reports the optimization by employing different concentrations of CTAB and PVP in extraction buffer. Efficiency of optimized protocol was compared with frequently used DNA extraction methods. Wide adoptability and utility of this protocol was confirmed by DNA extraction from leaves as well as seeds of G. max, G. soja, G. tomentella and G. latifolia. Extracted DNA was successfully subjected to PCR amplification of five microsatellite markers and four putative glycosyltransferase genes. DNA extraction protocol is reproducible, trouble free, rapid and can be adopted for plant molecular biology applications.

Rapid extraction and x-ray fluorescence determination of gold in rock

International Nuclear Information System (INIS)

Lobanov, F.I.; Logunova, S.A.; Popov, A.M.; Krasnopevtseva, E.V.

1994-01-01

The optimal conditions for gold extractional recovery by melts of aliphatic monocarboxylic acids mixtures (C ≥ 16) with additions of di-2-ethylhexyldithiophosphoric acid, di-n-oxtylsulfide and alkylaniline were determined. A rapid method of extraction and X-ray fluorescence detection of gold in the presence of considerable amounts of Fe, Cu, Pb, Cd, Zn and Bi was developed

Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

Science.gov (United States)

Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

2006-03-15

Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

DNA isolation by Chelex-100: an efficient approach to consider in leptospirosis early stages

Directory of Open Access Journals (Sweden)

Angel Alberto Noda

2014-06-01

Full Text Available Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures were applied for microbiological analysis, results of QIAmp DNA mini kit (QIAGEN, Germany, CLART HPV kit (GENOMICA, Spain and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific polymerase chain reaction for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.

UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract

International Nuclear Information System (INIS)

Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh

2016-01-01

UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)

All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

KAUST Repository

So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

2014-01-01

This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

KAUST Repository

So, Hongyun

2014-11-24

This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

Efficient method for the extraction of genomic DNA from wormwood ...

African Journals Online (AJOL)

STORAGESEVER

2008-09-17

Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

N-nitrosodimethylamine in drinking water using a rapid, solid-phase extraction method

Energy Technology Data Exchange (ETDEWEB)

Jenkins, S W.D. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Koester, C J [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Taguchi, V Y [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Wang, D T [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Palmentier, J P.F.P. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Hong, K P [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch

1995-12-01

A simple, rapid method for the extraction of N-nitrosodimethylamine (NDMA) from drinking and surface waters was developed using Ambersorb 572. Development of an alternative method to classical liquid-liquid extraction techniques was necessary to handle the workload presented by implementation of a provincial guideline of 9 ppt for drinking water and a regulatory level of 200 ppt for effluents. A granular absorbent, Ambersorb 572, was used to extract the NDMA from the water in the sample bottle. The NDMA was extracted from the Ambersorb 572 with dichloromethane in the autosampler vial. Method characteristics include a precision of 4% for replicate analyses, and accuracy of 6% at 10 ppt and a detection limit of 1.0 ppt NDMA in water. Comparative data between the Ambersorb 572 method and liquid-liquid extraction showed excellent agreement (average difference of 12%). With the Ambersorb 572 method, dichloromethane use has been reduced by a factor of 1,000 and productivity has been increased by a factor of 3-4. Monitoring of a drinking water supply showed rapidly changing concentrations of NDMA from day to day. (orig.)

PROTOCOL FOR EXTRACTION OF BACTERIAL METAGENOME DNA TO PRAWN Macrobrachium carcinus L

Directory of Open Access Journals (Sweden)

J U González de la Cruz

2011-07-01

Full Text Available In this work we adapted a protocol for the extraction of metagenomic DNA (ADNmg bacteria in the digestive system (intestines, stomach and hepatopancreas of Macrobrachium carcinus L., with reference to the method of extracting bacterial DNA from soils and sediments (Rojas-Herrera et al., 2008. This methodology consisted of enzymatic, physics, mechanics and chemistry after a series of tests was abolished enzymatic lysis. However, the success ADNmg extraction was influenced mainly by the preparation of the samples, in particular the hepatopancreas, where it was necessary to remove the fat by thermal shock temperature and phase separation by centrifugation with the sample frozen.The effectiveness of isolated DNA fragmentation was verified by gel electrophoresis in denaturing gradient (DGGE after amplification with universal primers. In general, it had a low diversity (19 phylotypes between the different organs analyzed of 13.5 ± 1 (intestines to 11.7 ± 0.96 (stomach. The Shannon-Weaver index (2.45, Simpsons (10.88 and equity (0972 obtained from the digitization of the image of the gel, suggested that the phylotypes that form the gut microflora M. carcinus, is distributed unevenly between the different organs analyzed.

The currently used commercial DNA-extraction methods give different results of clostridial and actinobacterial populations derived from human fecal samples.

Science.gov (United States)

Maukonen, Johanna; Simões, Catarina; Saarela, Maria

2012-03-01

Recently several human health-related microbiota studies have had partly contradictory results. As some differences may be explained by methodologies applied, we evaluated how different storage conditions and commonly used DNA-extraction kits affect bacterial composition, diversity, and numbers of human fecal microbiota. According to our results, the DNA-extraction did not affect the diversity, composition, or quantity of Bacteroides spp., whereas after a week's storage at -20 °C, the numbers of Bacteroides spp. were 1.6-2.5 log units lower (P Eubacterium rectale (Erec)-group, Clostridium leptum group, bifidobacteria, and Atopobium group were 0.5-4 log units higher (P < 0.05) after mechanical DNA-extraction as detected with qPCR, regardless of storage. Furthermore, the bacterial composition of Erec-group differed significantly after different DNA-extractions; after enzymatic DNA-extraction, the most prevalent genera detected were Roseburia (39% of clones) and Coprococcus (10%), whereas after mechanical DNA-extraction, the most prevalent genera were Blautia (30%), Coprococcus (13%), and Dorea (10%). According to our results, rigorous mechanical lysis enables detection of higher bacterial numbers and diversity from human fecal samples. As it was shown that the results of clostridial and actinobacterial populations are highly dependent on the DNA-extraction methods applied, the use of different DNA-extraction protocols may explain the contradictory results previously obtained. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Isothermal amplification of environmental DNA (eDNA for direct field-based monitoring and laboratory confirmation of Dreissena sp.

Directory of Open Access Journals (Sweden)

Maggie R Williams

Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a

Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

Science.gov (United States)

Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

2015-01-01

The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences

Directory of Open Access Journals (Sweden)

Brett eWagner Mackenzie

2015-02-01

Full Text Available The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation, with a smaller proportion of variation associated with DNA extraction method (technical variation and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

Science.gov (United States)

The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

Directory of Open Access Journals (Sweden)

Shin-Yi Shyu

2013-12-01

Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

Science.gov (United States)

Desai, Chirayu; Madamwar, Datta

2007-03-01

PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

Use of real-time PCR to evaluate two DNA extraction methods from food

Directory of Open Access Journals (Sweden)

Maria Regina Branquinho

2012-03-01

Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

Directory of Open Access Journals (Sweden)

Vijay Swahari

2016-01-01

Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

NARCIS (Netherlands)

Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

2015-01-01

Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

Science.gov (United States)

Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

2015-01-01

Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

Science.gov (United States)

Adamowicz, Michael S; Stasulli, Dominique M; Sobestanovich, Emily M; Bille, Todd W

2014-01-01

Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

Science.gov (United States)

Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

2017-03-01

In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

Directory of Open Access Journals (Sweden)

TIJANA SAVIC

2006-02-01

Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

Electromembrane extraction as a rapid and selective miniaturized sample preparation technique for biological fluids

DEFF Research Database (Denmark)

Gjelstad, Astrid; Pedersen-Bjergaard, Stig; Seip, Knut Fredrik

2015-01-01

This special report discusses the sample preparation method electromembrane extraction, which was introduced in 2006 as a rapid and selective miniaturized extraction method. The extraction principle is based on isolation of charged analytes extracted from an aqueous sample, across a thin film....... Technical aspects of electromembrane extraction, important extraction parameters as well as a handful of examples of applications from different biological samples and bioanalytical areas are discussed in the paper....

Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

Science.gov (United States)

Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

2013-06-01

Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

DNA extraction in Echinococcus granulosus and Taenia spp. eggs in dogs stool samples applying thermal shock.

Science.gov (United States)

Hidalgo, Alejandro; Melo, Angélica; Romero, Fernando; Hidalgo, Víctor; Villanueva, José; Fonseca-Salamanca, Flery

2018-03-01

The extraction of DNA in taeniid eggs shows complications attached to the composition of stool samples and the high resistance of eggs to degradation. The objective of this study was to test a method of DNA extraction in taeniid eggs by applying a thermal shock to facilitate the chemical-enzymatic degradation of these elements. A group of six tubes containing 1 ml of dog stool sample was spiked with eggs of Echinococcus granulosus and another group of six with Taenia pisiformis. Samples were floated with supersaturated sugar solution and centrifuged. The upper portion of each tube (500 μl) was aspirated and deposited in 1.5 ml tubes. Three tubes from each group were incubated at -20 °C and then at 90 °C, the remaining three from each group, incubated at room temperature. Proteinase K and lysis buffer were added to each tube and incubated for 12 h at 58 °C. The lysis effect was evaluated by microscopy at 3, 6 and 12 h and integrity by electrophoresis in 1% agarose gels. With the same experimental scheme, the thermal shock effect was evaluated in extractions of 1, 2, 3 and 4 eggs of each species and the DNA was quantified. Additionally, the protocol was applied in samples of 4 dogs diagnosed with natural infection by Taeniidae worms. Finally, all the extractions were tested by PCR amplification. Both E. granulosus and T. pisiformis eggs showed a similar response in the tests. In samples without treatment, the lysis effect was poor and showed no differences over time, but in those subjected to thermal shock, eggs degradation increased with time. In both treatments, there was no DNA loss integrity. The protocol applied to limited amounts of eggs yielded PCR products in 100% of the samples exposed to thermal shock, allowing PCR amplifications up to 1 egg. In non-exposed samples, the results were not replicable. However, DNA quantification showed low values in both treatments. In turn, DNA extractions with thermal shock in infected dog samples

Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

Science.gov (United States)

Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

2011-02-07

Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

DEFF Research Database (Denmark)

Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

2010-01-01

Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

An Optimized Protocol for DNA Extraction from Wheat Seeds and Loop-Mediated Isothermal Amplification (LAMP to Detect Fusarium graminearum Contamination of Wheat Grain

Directory of Open Access Journals (Sweden)

Mohamed Moslem

2011-06-01

Full Text Available A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

Science.gov (United States)

Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

2006-08-14

Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

Directory of Open Access Journals (Sweden)

Georg Walch

2016-04-01

Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

Science.gov (United States)

Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

2017-10-11

To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

Science.gov (United States)

Yang, Qi; Franco, Christopher M M; Zhang, Wei

2015-10-01

Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows

Directory of Open Access Journals (Sweden)

Jueeli D. Vaidya

2018-01-01

Full Text Available DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF and fibrous content (FC fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100, 67% GS and 33% maize silage (GS67MS33, 33% GS and 67% MS (GS33MS67, or 100% MS (MS100. An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method (p < 0.001 and fraction (p < 0.001. The 260/280 ratio was not affected by extraction (p = 0.08 but was affected by fraction (p = 0.03. On the other hand, the 260/230 ratio was affected by extraction method (p < 0.001 but not affected by fraction (p = 0.8. However, all four extraction procedures yielded DNA suitable for further analysis of bacterial, archaeal and anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction (p = 0.012, and that PBB (p = 0.012 and FDSS (p = 0.024 also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In

Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

Science.gov (United States)

Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

2006-02-09

Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

Towards rapid prototyped convective microfluidic DNA amplification platform

Science.gov (United States)

Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

2017-02-01

Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

Rapid automatic keyword extraction for information retrieval and analysis

Science.gov (United States)

Rose, Stuart J [Richland, WA; Cowley,; E, Wendy [Richland, WA; Crow, Vernon L [Richland, WA; Cramer, Nicholas O [Richland, WA

2012-03-06

Methods and systems for rapid automatic keyword extraction for information retrieval and analysis. Embodiments can include parsing words in an individual document by delimiters, stop words, or both in order to identify candidate keywords. Word scores for each word within the candidate keywords are then calculated based on a function of co-occurrence degree, co-occurrence frequency, or both. Based on a function of the word scores for words within the candidate keyword, a keyword score is calculated for each of the candidate keywords. A portion of the candidate keywords are then extracted as keywords based, at least in part, on the candidate keywords having the highest keyword scores.

DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by 32P-postlabeling

International Nuclear Information System (INIS)

Randerath, E.; Zhou, G.D.; Donnelly, K.C.; Safe, S.H.; Randerath, K.

1996-01-01

In the present study, a mouse bioassay was used in combination with 32 P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10 6 DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10 7 or 1.2 x 10 7 DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the 32 P-labeled derivative of the reaction product of 7β, 8α-dihydroxy-9α, 10α-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N 2 of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs

Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

DEFF Research Database (Denmark)

Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

2015-01-01

Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

DEFF Research Database (Denmark)

Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

2013-01-01

Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......-time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

Global chromatin fibre compaction in response to DNA damage

International Nuclear Information System (INIS)

Hamilton, Charlotte; Hayward, Richard L.; Gilbert, Nick

2011-01-01

Highlights: ► Robust KAP1 phosphorylation in response to DNA damage in HCT116 cells. ► DNA repair foci are found in soluble chromatin. ► Biophysical analysis reveals global chromatin fibre compaction after DNA damage. ► DNA damage is accompanied by rapid linker histone dephosphorylation. -- Abstract: DNA is protected by packaging it into higher order chromatin fibres, but this can impede nuclear processes like DNA repair. Despite considerable research into the factors required for signalling and repairing DNA damage, it is unclear if there are concomitant changes in global chromatin fibre structure. In human cells DNA double strand break (DSB) formation triggers a signalling cascade resulting in H2AX phosphorylation (γH2AX), the rapid recruitment of chromatin associated proteins and the subsequent repair of damaged sites. KAP1 is a transcriptional corepressor and in HCT116 cells we found that after DSB formation by chemicals or ionising radiation there was a wave of, predominantly ATM dependent, KAP1 phosphorylation. Both KAP1 and phosphorylated KAP1 were readily extracted from cells indicating they do not have a structural role and γH2AX was extracted in soluble chromatin indicating that sites of damage are not attached to an underlying structural matrix. After DSB formation we did not find a concomitant change in the sensitivity of chromatin fibres to micrococcal nuclease digestion. Therefore to directly investigate higher order chromatin fibre structures we used a biophysical sedimentation technique based on sucrose gradient centrifugation to compare the conformation of chromatin fibres isolated from cells before and after DNA DSB formation. After damage we found global chromatin fibre compaction, accompanied by rapid linker histone dephosphorylation, consistent with fibres being more regularly folded or fibre deformation being stabilized by linker histones. We suggest that following DSB formation, although there is localised chromatin unfolding to

The DNA 'comet assay' as a rapid screening technique to control irradiated food

International Nuclear Information System (INIS)

Cerda, H.; Delincee, H.; Haine, H.; Rupp, H.

1997-01-01

The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded

Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

DEFF Research Database (Denmark)

Torti, Andrea

indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

Science.gov (United States)

Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

2015-08-01

Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

Science.gov (United States)

Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

2016-01-01

FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

The fruit extract of Berberis crataegina DC: exerts potent antioxidant activity and protects DNA integrity.

Science.gov (United States)

Charehsaz, Mohammad; Sipahi, Hande; Celep, Engin; Üstündağ, Aylin; Cemiloğlu Ülker, Özge; Duydu, Yalçın; Aydın, Ahmet; Yesilada, Erdem

2015-04-17

Dried fruits of Berberis crataegina (Berberidaceae) have been frequently consumed as food garniture in Turkish cuisine, while its fruit paste has been used to increase stamina and in particular to prevent from cardiovascular dysfunctions in Northeastern Black Sea region of Turkey. This study investigated this folkloric information in order to explain the claimed healing effects as well as to evaluate possible risks. Total phenolic, flavonoid and proanthocyanidin contents and antioxidant capacity of the methanolic fruit extract were evaluated through several in vitro assays. The cytotoxic and genotoxic effects of B. crataegina fruit extract were also assessed in both cervical cancer cell line (HeLa) and human peripheral blood lymphocytes. The extract showed protective effects against ferric-induced oxidative stress and had a relatively good antioxidant activity. It also ameliorated the H2O2 mediated DNA damage in lymphocytes, suggesting the protective effect against oxidative DNA damage. The methanolic extract of B. crataegina fruits may be a potential antioxidant nutrient and also may exert a protective role against lipid peroxidation as well as oxidative DNA damage.

Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

Science.gov (United States)

Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

2018-04-01

ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

Directory of Open Access Journals (Sweden)

Michael S Adamowicz

Full Text Available Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

Science.gov (United States)

Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

2007-05-02

An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

Comparative analysis of environmental DNA extraction and purification methods from different humic acid rich soils

CSIR Research Space (South Africa)

Lakay, FM

2007-01-01

Full Text Available Three different soil DNA isolation and four purification strategies were compared on different soil samples with variable rates of success. Bead beating extraction gave significantly higher DNA yields than microwave-based and liquid nitrogen...

PMA-Linked Fluorescence for Rapid Detection of Viable Bacterial Endospores

Science.gov (United States)

LaDuc, Myron T.; Venkateswaran, Kasthuri; Mohapatra, Bidyut

2012-01-01

The most common approach for assessing the abundance of viable bacterial endospores is the culture-based plating method. However, culture-based approaches are heavily biased and oftentimes incompatible with upstream sample processing strategies, which make viable cells/spores uncultivable. This shortcoming highlights the need for rapid molecular diagnostic tools to assess more accurately the abundance of viable spacecraft-associated microbiota, perhaps most importantly bacterial endospores. Propidium monoazide (PMA) has received a great deal of attention due to its ability to differentiate live, viable bacterial cells from dead ones. PMA gains access to the DNA of dead cells through compromised membranes. Once inside the cell, it intercalates and eventually covalently bonds with the double-helix structures upon photoactivation with visible light. The covalently bound DNA is significantly altered, and unavailable to downstream molecular-based manipulations and analyses. Microbiological samples can be treated with appropriate concentrations of PMA and exposed to visible light prior to undergoing total genomic DNA extraction, resulting in an extract comprised solely of DNA arising from viable cells. This ability to extract DNA selectively from living cells is extremely powerful, and bears great relevance to many microbiological arenas.

Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

Science.gov (United States)

Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

2011-11-01

An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effects of an extract from the sea squirt Ecteinascidia turbinata on DNA synthesis and excision repair in human fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Dunn, W.C.; Carrier, W.L.; Regan, J.D.

1982-01-01

An aqueous ethanol extract from the marine tunicate species Ecteinascidia turbinata was studied to determine its effect on semiconservative DNA synthesis in human skin fibroblast cultures as measured by (/sup 3/H) thymidine uptake in acid-insoluble cell fractions. In addition, the effect of this extract on DNA excision repair in ultraviolet light (254 nm) irradiated fibroblasts was measured by the bromodeoxyuridine photolysis assay, thymine dimer chromatography, and DNA single-strand break analysis on alkaline sucrose gradients. Repair inhibition was accompanied by an accumulation of single-strand DNA breaks which was enhanced by the addtion of 2 mM hydroxyurea. These results are discussed with respect to a mechanism of action of the marine tunicate extract at the level of DNA polymerases and are contrasted with previously studied inhibitory mechanisms of arabinofuranosyl nucleosides.

The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows.

Science.gov (United States)

Vaidya, Jueeli D; van den Bogert, Bartholomeus; Edwards, Joan E; Boekhorst, Jos; van Gastelen, Sanne; Saccenti, Edoardo; Plugge, Caroline M; Smidt, Hauke

2018-01-01

DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini) differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100), 67% GS and 33% maize silage (GS67MS33), 33% GS and 67% MS (GS33MS67), or 100% MS (MS100). An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method ( p anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA) of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction ( p = 0.012), and that PBB ( p = 0.012) and FDSS ( p = 0.024) also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In summary, the comprehensive assessment of observed communities of bacteria, archaea and anaerobic fungi described here provides insight into a rational basis for selecting an optimal methodology to obtain a representative picture of the rumen microbiota.

[Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].

Science.gov (United States)

Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi

2009-11-01

We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.

Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

Science.gov (United States)

Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

2001-10-01

Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

Science.gov (United States)

Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

2017-11-17

Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

Science.gov (United States)

Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

2014-02-27

Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue.

Science.gov (United States)

Miles, Timothy D; Martin, Frank N; Coffey, Michael D

2015-02-01

Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing

Automated extraction of genomic DNA from medically important yeast species and filamentous fungi by using the MagNA Pure LC system.

Science.gov (United States)

Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

2002-06-01

A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (10(5) to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sensitivity when DNA was extracted manually; in 9 of 28 runs, we could achieve a higher sensitivity of 1 CFU/ml blood, which was found to be significant (p DNA from all fungal species analyzed could be extracted and amplified by real-time PCR. Negative controls from all MagNA Pure isolations remained negative. Sixty-three clinical samples showed identical results by both methods, whereas in 4 of 67 samples, discordant results were obtained. Thus, the MagNA Pure LC technique offers a fast protocol for automated DNA isolation from numerous fungi, revealing high sensitivity and purity.

DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by {sup 32}P-postlabeling

Energy Technology Data Exchange (ETDEWEB)

Randerath, E. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Zhou, G.D. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Donnelly, K.C. [Department of Veterinary Anatomy and Public Health, Texas A and M University, College Station, TX (United States); Safe, S.H. [Department of Veterinary Physiology/Pharmacology, Texas A and M University, College Station, TX (United States); Randerath, K. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States)

1996-09-01

In the present study, a mouse bioassay was used in combination with {sup 32}P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10{sup 6} DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10{sup 7} or 1.2 x 10{sup 7} DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the {sup 32}P-labeled derivative of the reaction product of 7{beta}, 8{alpha}-dihydroxy-9{alpha}, 10{alpha}-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N{sup 2} of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs.

Rapid analytical extraction of volatile fermentation products

Energy Technology Data Exchange (ETDEWEB)

Jansen, N B; Flickinger, M C; Tsao, G T

1979-10-01

With renewed interest in production of liquid fuels and chemical feedstocks from carbohydrates, numerous authors have utilized gas-liquid chromatography (GC) for quantification of volatile products. Poor separation and short column life will result if residual sugars present in the medium are not separated from the volatile compounds before injection. In our current investigation of 2,3-butanediol production from xylose, we have developed a rapid GC assay for 2,3-butanediol, acetyl methyl carbinol (acetoin), 2,3-butanedione (diacetyl), and ethanol. This method extracts the fermentation products at high pH from residual xylose before injection into the GC. This routine is a modification of the method of Kolfenbach et al. and is more rapid than the method of separation of diacetyl and acetoin from carbohydrates by distillation reported by Gupta et al. Their erroneous reports of yields of 640 mg diacetyl + acetoin/g sugar are 30% higher than the theoretical maximum for Enterobacter cloacae (ATCC 27613) and points out the need for a reliable, accurate assay for these products.

Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

Science.gov (United States)

Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao

2018-05-25

Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Wang, Z.; Wu, X.; Friedberg, E.C.

1993-01-01

A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

Rapid and annealing-free self-assembly of DNA building blocks for 3D hydrogel chaperoned by cationic comb-type copolymers.

Science.gov (United States)

Zhang, Zheng; Wu, Yuyang; Yu, Feng; Niu, Chaoqun; Du, Zhi; Chen, Yong; Du, Jie

2017-10-01

The construction and self-assembly of DNA building blocks are the foundation of bottom-up development of three-dimensional DNA nanostructures or hydrogels. However, most self-assembly from DNA components is impeded by the mishybridized intermediates or the thermodynamic instability. To enable rapid production of complicated DNA objects with high yields no need for annealing process, herein different DNA building blocks (Y-shaped, L- and L'-shaped units) were assembled in presence of a cationic comb-type copolymer, poly (L-lysine)-graft-dextran (PLL-g-Dex), under physiological conditions. The results demonstrated that PLL-g-Dex not only significantly promoted the self-assembly of DNA blocks with high efficiency, but also stabilized the assembled multi-level structures especially for promoting the complicated 3D DNA hydrogel formation. This study develops a novel strategy for rapid and high-yield production of DNA hydrogel even derived from instable building blocks at relatively low DNA concentrations, which would endow DNA nanotechnology for more practical applications.

Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

DEFF Research Database (Denmark)

Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

2013-01-01

The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...

Evaluation of simplified dna extraction methods for EMM typing of group a streptococci

Directory of Open Access Journals (Sweden)

Jose JJM

2006-01-01

Full Text Available Simplified methods of DNA extraction for amplification and sequencing for emm typing of group A streptococci (GAS can save valuable time and cost in resource crunch situations. To evaluate this, we compared two methods of DNA extraction directly from colonies with the standard CDC cell lysate method for emm typing of 50 GAS strains isolated from children with pharyngitis and impetigo. For this, GAS colonies were transferred into two sets of PCR tubes. One set was preheated at 94oC for two minutes in the thermal cycler and cooled while the other set was frozen overnight at -20oC and then thawed before adding the PCR mix. For the cell lysate method, cells were treated with mutanolysin and hyaluronidase before heating at 100oC for 10 minutes and cooling immediately as recommended in the CDC method. All 50 strains could be typed by sequencing the hyper variable region of the emm gene after amplification. The quality of sequences and the emm types identified were also identical. Our study shows that the two simplified DNA extraction methods directly from colonies can conveniently be used for typing a large number of GAS strains easily in relatively short time.

Comparison of seven DNA extraction and ampliffication protocols in historical herbarium specimens of Juncaceae

Czech Academy of Sciences Publication Activity Database

Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír

2002-01-01

Roč. 20, - (2002), s. 161-175 ISSN 0735-9640 R&D Projects: GA MŠk LN00A079; GA ČR GA206/02/0355 Institutional research plan: CEZ:AV0Z6005908 Keywords : cpDNA * DNA extraction * herbarium specimens Subject RIV: EF - Botanics Impact factor: 0.803, year: 2002

High-capacity conductive nanocellulose paper sheets for electrochemically controlled extraction of DNA oligomers.

Directory of Open Access Journals (Sweden)

Aamir Razaq

Full Text Available Highly porous polypyrrole (PPy-nanocellulose paper sheets have been evaluated as inexpensive and disposable electrochemically controlled three-dimensional solid phase extraction materials. The composites, which had a total anion exchange capacity of about 1.1 mol kg(-1, were used for extraction and subsequent release of negatively charged fluorophore tagged DNA oligomers via galvanostatic oxidation and reduction of a 30-50 nm conformal PPy layer on the cellulose substrate. The ion exchange capacity, which was, at least, two orders of magnitude higher than those previously reached in electrochemically controlled extraction, originated from the high surface area (i.e. 80 m(2 g(-1 of the porous composites and the thin PPy layer which ensured excellent access to the ion exchange material. This enabled the extractions to be carried out faster and with better control of the PPy charge than with previously employed approaches. Experiments in equimolar mixtures of (dT(6, (dT(20, and (dT(40 DNA oligomers showed that all oligomers could be extracted, and that the smallest oligomer was preferentially released with an efficiency of up to 40% during the reduction of the PPy layer. These results indicate that the present material is very promising for the development of inexpensive and efficient electrochemically controlled ion-exchange membranes for batch-wise extraction of biomolecules.

Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

Science.gov (United States)

Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

2011-06-01

This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

Rapid Solid-Liquid Dynamic Extraction (RSLDE): a New Rapid and Greener Method for Extracting Two Steviol Glycosides (Stevioside and Rebaudioside A) from Stevia Leaves.

Science.gov (United States)

Gallo, Monica; Vitulano, Manuela; Andolfi, Anna; DellaGreca, Marina; Conte, Esterina; Ciaravolo, Martina; Naviglio, Daniele

2017-06-01

Stevioside and rebaudioside A are the main diterpene glycosides present in the leaves of the Stevia rebaudiana plant, which is used in the production of foods and low-calorie beverages. The difficulties associated with their extraction and purification are currently a problem for the food processing industries. The objective of this study was to develop an effective and economically viable method to obtain a high-quality product while trying to overcome the disadvantages derived from the conventional transformation processes. For this reason, extractions were carried out using a conventional maceration (CM) and a cyclically pressurized extraction known as rapid solid-liquid dynamic extraction (RSLDE) by the Naviglio extractor (NE). After only 20 min of extraction using the NE, a quantity of rebaudioside A and stevioside equal to 1197.8 and 413.6 mg/L was obtained, respectively, while for the CM, the optimum time was 90 min. From the results, it can be stated that the extraction process by NE and its subsequent purification developed in this study is a simple, economical, environmentally friendly method for producing steviol glycosides. Therefore, this method constitutes a valid alternative to conventional extraction by reducing the extraction time and the consumption of toxic solvents and favouring the use of the extracted metabolites as food additives and/or nutraceuticals. As an added value and of local interest, the experiment was carried out on stevia leaves from the Benevento area (Italy), where a high content of rebaudioside A was observed, which exhibits a sweet taste compared to stevioside, which has a significant bitter aftertaste.

Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

Directory of Open Access Journals (Sweden)

MESQUITA Ricardo Alves

2001-01-01

Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

DEFF Research Database (Denmark)

Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

2012-01-01

Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...

Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

DEFF Research Database (Denmark)

Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...

The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

Science.gov (United States)

Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

2014-01-01

Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

Replication of UV-irradiated DNA in human cell extracts: Evidence for mutagenic bypass of pyrimidine dimers

International Nuclear Information System (INIS)

Thomas, D.C.; Kunkel, T.A.

1993-01-01

The authors have examined the efficiency and fidelity of simian virus 40-origin-dependent replication of UV-irradiated double-stranded DNA in extracts of human cells. Using as a mutational target the α-complementation domain of the Escherichia coli lacZ gene in bacteriophage M13mp2DNA, replication of undamaged DNA in HeLa cell extracts was highly accurate, whereas replication of DNA irradiated with UV light (280-320 nm) was both less efficient and less accurate. Replication was inhibited by irradiation in a dose-dependent manner. Nonetheless, covalently closed, monomer-length circular products were generated that were resistant to digestion by Dpn I, showing that they resulted from semiconservative replication. These products were incised by T4 endonuclease V, whereas the undamaged replication products were not, suggesting that pyrimidine dimers were bypassed during replication. When replicated, UV-irradiated DNA was used to transfect an E. coli α-complementation host strain to score mutant M13mp2 plaques, the mutant plaque frequency was substantially higher than that obtained with either unirradiated, replicated DNA, or unreplicated, UV-irradiated DNA. Both the increased mutagenicity and the inhibition of replication associated with UV irradiation were reversed by treatment of the irradiated DNA with photolyase before replication. Sequence analysis of mutants resulting from replication of UV-irradiated DNA demonstrated that most mutants contained C → T transition errors at dipyrimidine sites. A few mutants contained 1-nt frameshift errors or tandem double CC → TT substitutions. The data are consistent with the interpretation that pyrimidine dimers are bypassed during replication by the multiprotein replication apparatus in human cell extracts and that this bypass is mutagenic primarily via misincorporation of dAMP opposite a cytosine (or uracil) in the dimer. 56 refs., 2 figs., 3 tabs

Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

Directory of Open Access Journals (Sweden)

Žel Jana

2006-08-01

Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

Science.gov (United States)

Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

2006-01-01

Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

Energy Technology Data Exchange (ETDEWEB)

Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

2016-07-01

Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)