WorldWideScience

Sample records for rapid dna extraction

  1. A rapid DNA extraction method suitable for human papillomavirus detection.

    Science.gov (United States)

    Brestovac, Brian; Wong, Michelle E; Costantino, Paul S; Groth, David

    2014-04-01

    Infection with oncogenic human papillomavirus (HPV) genotypes is necessary for the development of cervical cancer. Testing for HPV DNA from liquid based cervical samples can be used as an adjunct to traditional cytological screening. In addition there are ongoing viral load, genotyping, and prevalence studies. Therefore, a sensitive DNA extraction method is needed to maximize the efficiency of HPV DNA detection. The XytXtract Tissue kit is a DNA extraction kit that is rapid and so could be useful for HPV testing, particularly in screening protocols. This study was undertaken to determine the suitability of this method for HPV detection. DNA extraction from HeLa and Caski cell lines containing HPV 18 and 16 respectively together with DNA from five liquid based cervical samples were used in a HPV PCR assay. DNA was also extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) as a comparison. DNA extracts were serially diluted and assayed. HPV DNA was successfully detected in cell lines and cervical samples using the XytXtract Tissue kit. In addition, the XytXtract method was found to be more sensitive than the QIAmp method as determined by a dilution series of the extracted DNA. While the XytXtract method is a closed, the QIAamp method uses a spin column with possible loss of DNA through DNA binding competition of the matrix, which could impact on the final extraction efficiency. The XytXtract is a cheap, rapid and efficient method for extracting HPV DNA from both cell lines and liquid based cervical samples. © 2014 Wiley Periodicals, Inc.

  2. Rapid extraction and preservation of genomic DNA from human samples.

    Science.gov (United States)

    Kalyanasundaram, D; Kim, J-H; Yeo, W-H; Oh, K; Lee, K-H; Kim, M-H; Ryew, S-M; Ahn, S-G; Gao, D; Cangelosi, G A; Chung, J-H

    2013-02-01

    Simple and rapid extraction of human genomic DNA remains a bottleneck for genome analysis and disease diagnosis. Current methods using microfilters require cumbersome, multiple handling steps in part because salt conditions must be controlled for attraction and elution of DNA in porous silica. We report a novel extraction method of human genomic DNA from buccal swab and saliva samples. DNA is attracted onto a gold-coated microchip by an electric field and capillary action while the captured DNA is eluted by thermal heating at 70 °C. A prototype device was designed to handle four microchips, and a compatible protocol was developed. The extracted DNA using microchips was characterized by qPCR for different sample volumes, using different lengths of PCR amplicon, and nuclear and mitochondrial genes. In comparison with a commercial kit, an equivalent yield of DNA extraction was achieved with fewer steps. Room-temperature preservation for 1 month was demonstrated for captured DNA, facilitating straightforward collection, delivery, and handling of genomic DNA in an environment-friendly protocol.

  3. Extraction of DNA by magnetic ionic liquids: tunable solvents for rapid and selective DNA analysis.

    Science.gov (United States)

    Clark, Kevin D; Nacham, Omprakash; Yu, Honglian; Li, Tianhao; Yamsek, Melissa M; Ronning, Donald R; Anderson, Jared L

    2015-02-03

    DNA extraction represents a significant bottleneck in nucleic acid analysis. In this study, hydrophobic magnetic ionic liquids (MILs) were synthesized and employed as solvents for the rapid and efficient extraction of DNA from aqueous solution. The DNA-enriched microdroplets were manipulated by application of a magnetic field. The three MILs examined in this study exhibited unique DNA extraction capabilities when applied toward a variety of DNA samples and matrices. High extraction efficiencies were obtained for smaller single-stranded and double-stranded DNA using the benzyltrioctylammonium bromotrichloroferrate(III) ([(C8)3BnN(+)][FeCl3Br(-)]) MIL, while the dicationic 1,12-di(3-hexadecylbenzimidazolium)dodecane bis[(trifluoromethyl)sulfonyl]imide bromotrichloroferrate(III) ([(C16BnIM)2C12(2+)][NTf2(-), FeCl3Br(-)]) MIL produced higher extraction efficiencies for larger DNA molecules. The MIL-based method was also employed for the extraction of DNA from a complex matrix containing albumin, revealing a competitive extraction behavior for the trihexyl(tetradecyl)phosphonium tetrachloroferrate(III) ([P6,6,6,14(+)][FeCl4(-)]) MIL in contrast to the [(C8)3BnN(+)][FeCl3Br(-)] MIL, which resulted in significantly less coextraction of albumin. The MIL-DNA method was employed for the extraction of plasmid DNA from bacterial cell lysate. DNA of sufficient quality and quantity for polymerase chain reaction (PCR) amplification was recovered from the MIL extraction phase, demonstrating the feasibility of MIL-based DNA sample preparation prior to downstream analysis.

  4. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  5. Rapid and effective DNA extraction method with bead grinding for a large amount of fungal DNA.

    Science.gov (United States)

    Watanabe, M; Lee, K; Goto, K; Kumagai, S; Sugita-Konishi, Y; Hara-Kudo, Y

    2010-06-01

    To identify a rapid method for extracting a large amount of DNA from fungi associated with food hygiene, extraction methods were compared using fungal pellets formed rapidly in liquid media. Combinations of physical and chemical methods or commercial kits were evaluated with 3 species of yeast, 10 species of ascomycetous molds, and 4 species of zygomycetous molds. Bead grinding was the physical method, followed by chemical methods involving sodium dodecyl sulfate (SDS), cetyl trimethyl ammonium bromide (CTAB), and benzyl chloride and two commercial kits. Quantity was calculated by UV absorbance at 260 nm, quality was determined by the ratio of UV absorbance at 260 and 280 nm, and gene amplifications and electrophoresis profiles of whole genomes were analyzed. Bead grinding with the SDS method was the most effective for DNA extraction for yeasts and ascomycetous molds, and bead grinding with the CTAB method was most effective with zygomycetous molds. For both groups of molds, bead grinding with the CTAB method was the best approach for DNA extraction. Because this combination also is relatively effective for yeasts, it can be used to extract a large amount of DNA from a wide range of fungi. The DNA extraction methods are useful for developing gene indexes to identify fungi with molecular techniques, such as DNA fingerprinting.

  6. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  7. RAPID AND EFFICIENT METHOD FOR ENVIRONMENTAL DNA EXTRACTION AND PURIFICATION FROM SOIL

    Directory of Open Access Journals (Sweden)

    J. Hamedi

    2016-06-01

    Full Text Available Large proportion of microbial population in the world is unculturable. Extraction of total DNA from soil is usually a crucial step considering to the difficulties of study the uncultivable microorganisms. Humic acid is considered as the main inhibitory agent in the environmental DNA studies. Here, we introduced a rapid and efficient method for DNA extraction and purification from soil. Yield of DNA extraction by the presented method was 130 ng/µl. Three conventional methods of DNA extraction including liquid nitrogen incursion, bead beating and sonication were performed as control methods. Yield of DNA extraction by these methods were 110, 90 and 50 ng/µl, respectively. A rapid and efficient one step DNA purification method was introduced instead of hazardous conventional phenol-chloroform methods. Humic acid removal percentage by the introduced method was 95.8 % that is comparable with 97 % gained by the conventional gel extraction method and yield of DNA after purification was 84 % and 73 %, respectively. This study could be useful in molecular ecology and metagenomics study as a fast and reliable method.

  8. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... To evaluate the efficiency of the genomic DNA in the processes in which DNA is used as a template, the polymerase chain reaction ... purity and concentration is of common processes in molecular research and clinical ... these methods, using chemical compounds or physical methods to lysis the cell is the ...

  9. New rapid DNA extraction method with Chelex from Venturia inaequalis spores.

    Science.gov (United States)

    Turan, Ceren; Nanni, Irene Maja; Brunelli, Agostino; Collina, Marina

    2015-08-01

    The objective of this study was to develop a rapid method to isolate DNA from Venturia inaequalis spores for use in diagnostic DNA mutation analysis. Chelex-100 resin was evaluated and compared with a well established DNA exctraction method, utilizing CTAB in order to have a robust comparison. In this research we demonstrated that Chelex-100 efficiently makes extraction of the DNA from V. inaequalis spores available for direct use in molecular analyses. Also, the quantity and quality of extracted DNA were shown to be adequate for PCR analysis. Comparatively, the quality of DNA samples isolated using Chelex method was better than those extracted using CTAB. In conclusion, the Chelex method is recommended for PCR experiments considering its simplicity and cost-effectiveness. Copyright © 2015. Published by Elsevier B.V.

  10. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Directory of Open Access Journals (Sweden)

    Selvaraju Gayathri Devi

    Full Text Available A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil with high purity (A260/280: 1.76 ± 0.05 and reduced humic substances (A340: 0.047 ± 0.03. The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666.

  11. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666).

  12. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R.; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely “powdered glass method” from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method’s applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666). PMID:26167854

  13. Rapid DNA extraction protocol from stool, suitable for molecular genetic diagnosis of colon cancer.

    Science.gov (United States)

    Abbaszadegan, Mohammad Reza; Velayati, Arash; Tavasoli, Alireza; Dadkhah, Ezzat

    2007-07-01

    Colorectal cancer (CRC) is one of the most common forms of cancers in the world and is curable if diagnosed at the early stage. Analysis of DNA extracted from stool specimens is a recent advantage to cancer diagnostics. Many protocols have been recommended for DNA extraction from stool, and almost all of them are difficult and time consuming, dealing with high amount of toxic materials like phenol. Their results vary due to sample collection method and further purification treatment. In this study, an easy and rapid method was optimized for isolating the human DNA with reduced PCR inhibitors present in stool. Fecal samples were collected from 10 colonoscopy-negative adult volunteers and 10 patients with CRC. Stool (1 g) was extracted using phenol/chloroform based protocol. The amplification of P53 exon 9 was examined to evaluate the extraction efficiency for human genomic targets and also compared its efficiency with Machiels et al. and Ito et al. protocols. The amplification of exon 9 of P53 from isolated fecal DNA was possible in most cases in 35 rounds of PCR using no additional purification procedure for elimination of the remaining inhibitors.inhibitors. A useful, rapid and easy protocol for routine extraction of DNA from stool was introduced and compared with two previous protocols.

  14. A RAPID DNA EXTRACTION METHOD IS SUCCESSFULLY APPLIED TO ITS-RFLP ANALYSIS OF MYCORRHIZAL ROOT TIPS

    Science.gov (United States)

    A rapid method for extracting DNA from intact, single root tips using a Xanthine solution was developed to handle very large numbers of analyses of ectomycorrhizas. By using an extraction without grinding we have attempted to bias the extraction towards the fungal DNA in the man...

  15. A rapid and efficient DNA extraction method suitable for marine macroalgae.

    Science.gov (United States)

    Ramakrishnan, Gautham Subramaniam; Fathima, Anwar Aliya; Ramya, Mohandass

    2017-12-01

    Macroalgae are a diverse group of organisms. Marine macroalgae, in particular, have numerous medicinal and industrial applications. Molecular studies of macroalgae require suitable concentrations of DNA free of contaminants. At present, numerous protocols exist for DNA extraction from macroalgae. However, they are either time consuming, expensive or work only with few species. The method described in this study is rapid and efficient and applicable to different types of marine macroalgae. This method yields an average of 3.85 µg of DNA per 50 mg of algal tissue, with an average purity of 1.88. The isolated DNA was suitable for PCR amplification of universal plastid region of macroalgae.

  16. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing

    National Research Council Canada - National Science Library

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR...

  17. Rapid yeast DNA extraction by boiling and freeze-thawing without using chemical reagents and DNA purification

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    2012-04-01

    Full Text Available The purpose of this work was to study a rapid yeast DNA extraction by boiling and freeze-thawing processes without using chemical reagents or any purification procedures, to obtain a high grade PCR-product. A specific DNA fragment of the 18S region of Dekkera bruxellensis and Saccharomyces cerevisiae was chosen. The described boiling and freeze-thawing protocols generated the PCR-grade product preparations and could be used to process many samples. The amplification of the fragments could be observed after 30 and 35 cycles. These processes of extraction without using any kind of chemical reagents, especial water, and purification procedures proved to be efficient, reproducible, simple, fast, and inexpensive.

  18. Rapid DNA extraction for specific detection and quantitation of Mycobacterium tuberculosis DNA in sputum specimens using taqman assays

    Science.gov (United States)

    Gomez, Diana I.; Mullin, Caroline S.; Mora-Guzmán, Francisco; Crespo-Solis, J. Gonzalo; Fisher-Hoch, Susan P.; McCormick, Joseph B.; Restrepo, Blanca I.

    2011-01-01

    SUMMARY Rapid tuberculosis (TB) detection is critical for disease control, and further quantitation of Mycobacterium tuberculosis (Mtb) in sputum is valuable for epidemiological and clinical studies. We evaluated a simple, robust and cost-efficient in-house DNA extraction and downstream taqman approach for detection and quantitation of Mtb genomes from sputum of newly-diagnosed TB patients and non-TB controls. DNA was extracted using guanidine isothiocyanate and silica-based spin columns in less than 2h, stored frozen, and taqman assays were used to detect Mtb with IS6110 and quantify it targeting RD1 and IS1081. The taqmans had a sensitivity > 95% in 108 culture-confirmed TB patients and specificity of 100% in 43 non-TB controls. Genome counts were correlated with the Mycobacterial Growth Indicator Tubes’ (MGIT) time-to-detection values (1/TTD×1000; rho=0.66; p<0.001) in 91 TB patients (33 excluded with MGIT contamination). This linear relationship was nearly identical between mycobacteria isolated from sputum and H37Rv Mtb grown in-vitro to its log phase. TB treatment between 3 and 7 days was associated with lower 1/TTD×1000 values but not with genome counts. Together, our protocol provides rapid, specific, inexpensive and quantitative detection of Mtb DNA in fresh or stored sputa making it a robust tool for prompt TB diagnosis, and with potential use for clinical and epidemiologic studies. PMID:22088321

  19. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  20. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  1. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  2. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  3. rapid mini-prep DNA extraction method in rice (Oryza sativa ...

    African Journals Online (AJOL)

    method, optimized for rice, which was achieved via some modifications in present DNA extraction methods, especially in first step of cell wall lyses and the use of cheap and frequent chemicals found in every laboratory is presented. Normal quality and quantity was obtained by the method. The PCR based assays also ...

  4. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  5. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  6. Rapid microfluidic solid-phase extraction system for hyper-methylated DNA enrichment and epigenetic analysis

    NARCIS (Netherlands)

    De, Arpita; Sparreboom, Wouter; van den Berg, Albert; Carlen, Edwin

    Genetic sequence and hyper-methylation profile information from the promoter regions of tumor suppressor genes are important for cancer disease investigation. Since hyper-methylated DNA (hm-DNA) is typically present in ultra-low concentrations in biological samples, such as stool, urine, and saliva,

  7. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing.

    Science.gov (United States)

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR), followed by a rapid PCR amplification step. All steps can be accomplished in stool samples with discordant EIA results (GDH(+)/toxin(-)) were tested by both the LMR/PCR assay and the loop-mediated isothermal amplification test (LAMP) (Illumigene C. difficile; Meridian Bioscience, Cincinnati, OH). In 64/69 EIA-discordant samples, LAMP and LMR/PCR results matched (both positive in 29 sample and both negative in 35 samples); in the remaining 5 samples, results were discrepant between the LAMP assay (all five negative) and the LMR/PCR assay (all 5 positive). Overall, LMR/PCR testing matched the current algorithm of EIA and/or LAMP reflex testing in 193/198 (97.5%) samples. The present proof-of-concept study suggests that the novel LMR/PCR technique described here may be developed as an inexpensive, rapid, and reliable point-of-care diagnostic test for C. difficile infection and other infectious diseases. Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  8. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... 1487. Figure 1. 1% Agarose gel showing typical PCR results obtained for the amplification of the Mdh gene after the DNA .... procedure based on selective binding of bovine alpha-casein to silica particles. J. Clin. Microbiol. 37: 615-619. Boom R, Sol CJA, Salimans MMM, Jansen CL, Werthiem-Van Dillen.

  9. A simple and rapid DNA extraction method for Chlamydia trachomatis detection from urogenital swabs.

    Science.gov (United States)

    Butzler, Matthew A; Reed, Jennifer L; McFall, Sally M

    2017-11-01

    A highly sensitive and specific Chlamydia trachomatis (CT) diagnostic test was developed by combining filtration isolation of nucleic acid (FINA) extraction with quantitative polymerase chain reaction including an internal control to identify test inhibition. A pilot study of 40 clinical specimens yielded 100% sensitivity and specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Room temperature DNA preservation of soft tissue for rapid DNA extraction: an addition to the disaster victim identification investigators toolkit?

    Science.gov (United States)

    Graham, E A M; Turk, E E; Rutty, G N

    2008-01-01

    In mass fatality incidents, for example following a vehicle accident or terrorist event, severe fragmentation of bodies may occur, making identification by the use of traditional techniques such as fingerprinting or odontology difficult. In such situations DNA profiling can be employed for individualization and re-association of fragmented remains. As at times disrupted soft tissue may be the predominate tissue type requiring identification and re-association. We have investigated the use of two buffer solutions for preservation of soft tissue samples that may be collected during such investigations, when buccal cells, blood samples or teeth or bone may not be available. Both buffer solutions have shown sufficient DNA preservation over a 12-month period of storage at room temperature to allow for DNA profiling to be successfully performed when 5-1000 mg muscle tissue was stored in each solution.

  11. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  12. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  13. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  14. Rapid method for DNA extraction from the honey bee Apis mellifera and the parasitic bee mite Varroa destructor using lysis buffer and proteinase K.

    Science.gov (United States)

    Issa, M R C; Figueiredo, V L C; De Jong, D; Sakamoto, C H; Simões, Z L P

    2013-10-22

    We developed a rapid method for extraction of DNA from honey bees, Apis mellifera, and from the parasitic bee mite, Varroa destructor. The advantages include fast processing and low toxicity of the substances that are utilized. We used lysis buffer with nonionic detergents to lyse cell walls and proteinase K to digest proteins. We tested whole thorax, thoracic muscle mass, legs, and antennae from individual bees; the mites were processed whole (1 mite/sample). Each thorax was incubated whole, without cutting, because exocuticle color pigment darkened the extraction solution, interfering with PCR results. The procedure was performed with autoclaved equipment and laboratory gloves. For each sample, we used 100 µL lysis buffer (2 mL stock solution of 0.5 M Tris/HCl, pH 8.5, 10 mL stock solution of 2 M KCl, 500 µL solution of 1 M MgCl2, 2 mL NP40, and 27.6 g sucrose, completed to 200 mL with bidistilled water and autoclaved) and 2 µL proteinase K (10 mg/mL in bidistilled water previously autoclaved, as proteinase K cannot be autoclaved). Tissues were incubated in the solutions for 1-2 h in a water bath (62°-68 °C) or overnight at 37 °C. After incubation, the tissues were removed from the extraction solution (lysis buffer + proteinase K) and the solution heated to 92 °C for 10 min, for proteinase K inactivation. Then, the solution with the extracted DNA was stored in a refrigerator (4°-8 °C) or a freezer (-20 °C). This method does not require centrifugation or phenol/chloroform extraction. The reduced number of steps allowed us to sample many individuals/day. Whole mites and bee antennae were the most rapidly processed. All bee tissues gave the same quality DNA. This method, even using a single bee antenna or a single mite, was adequate for extraction and analysis of bee genomic and mitochondrial DNA and mite genomic DNA.

  15. Ancient DNA extraction from plants.

    Science.gov (United States)

    Kistler, Logan

    2012-01-01

    A variety of protocols for DNA extraction from archaeological and paleobotanical plant specimens have been proposed. This is not surprising given the range of taxa and tissue types that may be preserved and the variety of conditions in which that preservation may take place. Commercially available DNA extraction kits can be used to recover ancient plant DNA, but modifications to standard approaches are often necessary to improve yield. In this chapter, I describe two protocols for extracting DNA from small amounts of ancient plant tissue. The CTAB protocol, which I recommend for use with single seeds, utilizes an incubation period in extraction buffer and subsequent chloroform extraction followed by DNA purification and suspension. The PTB protocol, which I recommend for use with gourd rind and similar tissues, utilizes an overnight incubation of pulverized tissue in extraction buffer, removal of the tissue by centrifugation, and DNA extraction from the buffer using commercial plant DNA extraction kits.

  16. Development and Evaluation of Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Tylenchulus semipenetrans Using DNA Extracted from Soil

    Directory of Open Access Journals (Sweden)

    Zhi-Qiang Song

    2017-04-01

    Full Text Available Tylenchulus semipenetrans is an important and widespread plant-parasitic nematode of citrus worldwide and can cause citrus slow decline disease leading to significant reduction in tree growth and yield. Rapid and accurate detection of T. semipenetrans in soil is important for the disease forecasting and management. In this study, a loop-mediated isothermal amplification (LAMP assay was developed to detect T. semipenetrans using DNA extracted from soil. A set of five primers was designed from the internal transcribed spacer region (ITS1 of rDNA, and was highly specific to T. semipenetrans. The LAMP reaction was performed at 63°C for 60 min. The LAMP product was visualized directly in one reaction tube by adding SYBR Green I. The detection limit of the LAMP assay was 10−2 J2/0.5 g of soil, which was 10 times more sensitive than conventional PCR (10−1 J2/0.5 g of soil. Examination of 24 field soil samples revealed that the LAMP assay was applicable to a range of soils infested naturally with T. semipenetrans, and the total assay time was less than 2.5 h. These results indicated that the developed LAMP assay is a simple, rapid, sensitive, specific and accurate technique for detection of T. semipenetrans in field soil, and contributes to the effective management of citrus slow decline disease.

  17. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  18. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    Abstract. There is no 'one' procedure for extracting DNA from the whole blood of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological ...

  19. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

    Directory of Open Access Journals (Sweden)

    Coupland George

    2005-08-01

    Full Text Available Abstract Background Many established PCR-based approaches in plant molecular biology rely on lengthy and expensive methods for isolation of nucleic acids. Although several rapid DNA isolation protocols are available, they have not been tested for simultaneous RNA isolation for RT-PCR applications. In addition, traditional map-based cloning technologies often use ill-proportioned marker regions even when working with the model plant Arabidopsis thaliana, where the availability of the full genome sequence can now be exploited for the creation of a high-density marker systems. Results We designed a high-density polymorphic marker set between two frequently used ecotypes. This new polymorphic marker set allows size separation of PCR products on agarose gels and provides an initial resolution of 10 cM in linkage mapping experiments, facilitated by a rapid plant nucleic acid extraction protocol using minimal amounts of A. thaliana tissue. Using this extraction protocol, we have also characterized segregating T-DNA insertion mutations. In addition, we have shown that our rapid nucleic acid extraction protocol can also be used for monitoring transcript levels by RT-PCR amplification. Finally we have demonstrated that our nucleic acid isolation method is also suitable for other plant species, such as tobacco and barley. Conclusion To facilitate high-throughput linkage mapping and other genomic applications, our nucleic acid isolation protocol yields sufficient quality of DNA and RNA templates for PCR and RT-PCR reactions, respectively. This new technique requires considerably less time compared to other purification methods, and in combination with a new polymorphic PCR marker set dramatically reduces the workload required for linkage mapping of mutations in A. thaliana utilizing crosses between Col-0 and Landsberg erecta (Ler ecotypes.

  20. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  1. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  2. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  3. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  4. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  5. Rapid cleanup of bacterial DNA from samples containing aerosol contaminants

    Science.gov (United States)

    Menking, Darrell E.; Kracke, Suzanne K.; Emanuel, Peter A.; Valdes, James J.

    1999-01-01

    Polymerase Chain Reaction (PCR) is an in vitro enzymatic, synthetic method used to amplify specific DNA sequences from organisms. Detection of DNA using gene probes allows for absolute identification not only of specific organisms, but also of genetic material in recombinant organisms. PCR is an exquisite biological method for detecting bacteria in aerosol samples. A major challenge facing detection of DNA from field samples is that they are almost sure to contain impurities, especially impurities that inhibit amplification through PCR. DNA is being extracted from air, sewage/stool samples, food, sputum, a water and sediment; however, multi- step, time consuming methods are required to isolate the DNA from the surrounding contamination. This research focuses on developing a method for rapid cleanup of DNA which combines extraction and purification of DNA while, at the same time, removing inhibitors from 'dirty samples' to produce purified, PCR-ready DNA. GeneReleaser produces PCR-ready DNA in a rapid five-minute protocol. GeneReleaser resin was able to clean up sample contain micrograms of typical aerosol and water contaminants. The advantages of using GR are that it is rapid, inexpensive, requires one-step, uses no hazardous material and produces PCR-ready DNA.

  6. DNA extraction from herbarium specimens.

    Science.gov (United States)

    Drábková, Lenka Záveská

    2014-01-01

    With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

  7. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  8. Automated DNA extraction from pollen in honey.

    Science.gov (United States)

    Guertler, Patrick; Eicheldinger, Adelina; Muschler, Paul; Goerlich, Ottmar; Busch, Ulrich

    2014-04-15

    In recent years, honey has become subject of DNA analysis due to potential risks evoked by microorganisms, allergens or genetically modified organisms. However, so far, only a few DNA extraction procedures are available, mostly time-consuming and laborious. Therefore, we developed an automated DNA extraction method from pollen in honey based on a CTAB buffer-based DNA extraction using the Maxwell 16 instrument and the Maxwell 16 FFS Nucleic Acid Extraction System, Custom-Kit. We altered several components and extraction parameters and compared the optimised method with a manual CTAB buffer-based DNA isolation method. The automated DNA extraction was faster and resulted in higher DNA yield and sufficient DNA purity. Real-time PCR results obtained after automated DNA extraction are comparable to results after manual DNA extraction. No PCR inhibition was observed. The applicability of this method was further successfully confirmed by analysis of different routine honey samples. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  10. DNA Extraction Techniques for Use in Education

    Science.gov (United States)

    Hearn, R. P.; Arblaster, K. E.

    2010-01-01

    DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

  11. Rapid and Simultaneous Detection of Mycobacterium tuberculosis Complex and Beijing/W Genotype in Sputum by an Optimized DNA Extraction Protocol and a Novel Multiplex Real-Time PCR ▿

    Science.gov (United States)

    Leung, Eric T. Y.; Zheng, L.; Wong, Rity Y. K.; Chan, Edward W. C.; Au, T. K.; Chan, Raphael C. Y.; Lui, Grace; Lee, Nelson; Ip, Margaret

    2011-01-01

    Rapid diagnosis and genotyping of Mycobacterium tuberculosis by molecular methods are often limited by the amount and purity of DNA extracted from body fluids. In this study, we evaluated 12 DNA extraction methods and developed a highly sensitive protocol for mycobacterial DNA extraction directly from sputa using surface-coated magnetic particles. We have also developed a novel multiplex real-time PCR for simultaneous identification of M. tuberculosis complex and the Beijing/W genotype (a hypervirulent sublineage of M. tuberculosis) by using multiple fluorogenic probes targeting both the M. tuberculosis IS6110 and the Rv0927c-pstS3 intergenic region. With reference strains and clinical isolates, our real-time PCR accurately identified 20 non-Beijing/W and 20 Beijing/W M. tuberculosis strains from 17 different species of nontuberculosis Mycobacterium (NTM). Further assessment of our DNA extraction protocol and real-time PCR with 335 nonduplicate sputum specimens correctly identified all 74 M. tuberculosis culture-positive specimens. In addition, 15 culture-negative specimens from patients with confirmed tuberculosis were also identified. No cross-reactivity was detected with NTM specimens (n = 31). The detection limit of the assay is 10 M. tuberculosis bacilli, as determined by endpoint dilution analysis. In conclusion, an optimized DNA extraction protocol coupled with a novel multiprobe multiplex real-time PCR for the direct detection of M. tuberculosis, including Beijing/W M. tuberculosis, was found to confer high sensitivity and specificity. The combined procedure has the potential to compensate for the drawbacks of conventional mycobacterial culture in routine clinical laboratory setting, such as the lengthy incubation period and the limitation to viable organisms. PMID:21593264

  12. An efficient and cost-effective method for DNA extraction from athalassohaline soil using a newly formulated cell extraction buffer

    OpenAIRE

    Narayan, Avinash; Jain, Kunal; Shah, Amita R.; Madamwar, Datta

    2016-01-01

    The present study describes the rapid and efficient indirect lysis method for environmental DNA extraction from athalassohaline soil by newly formulated cell extraction buffer. The available methods are mostly based on direct lysis which leads to DNA shearing and co-extraction of extra cellular DNA that influences the community and functional analysis. Moreover, during extraction of DNA by direct lysis from athalassohaline soil, it was observed that, upon addition of poly ethylene glycol (PEG...

  13. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Directory of Open Access Journals (Sweden)

    Stefano Minguzzi

    Full Text Available Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum' detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV in Prunus.

  14. Automated extraction of DNA from clothing

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

    2011-01-01

    Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing t...

  15. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  16. A method suitable for DNA extraction from humus-rich soil.

    Science.gov (United States)

    Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo

    2014-11-01

    A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.

  17. Rapid, Effective DNA Isolation from Osmanthus via Modified Alkaline Lysis.

    Science.gov (United States)

    Alexander, Lisa

    2016-07-01

    Variability of leaf structure and presence of secondary metabolites in mature leaf tissue present a challenge for reliable DNA extraction from Osmanthus species and cultivars. The objective of this study was to develop a universal rapid, effective, and cost-efficient method of DNA isolation for Osmanthus mature leaf tissue. Four different methods were used to isolate DNA from 8 cultivars of Osmanthus. Absorbance spectra, DNA concentration, appearance on agarose gel, and performance in PCR were used to analyze quality, quantity, and integrity of isolated DNA. Methods were ranked in order, based on total quantity, quality, and performance points as the following: 1) solid-phase extraction (SPE), 2) modified alkaline lysis (SDS), 3) cetyltrimethylammonium bromide (CTAB) with chloroform (CHL), and 4) CTAB with phenol/chloroform (PHE). Total DNA, isolated via SPE, showed the least contamination but the lowest mean quantity (9.6 ± 3.4 μg) and highest cost. The highest quantity of DNA was isolated via SDS (117 ± 54.1 μg). SPE and SDS resolved the most individuals on agarose gel, whereas the 2 CTAB methods had poorly resolved gels. All methods except PHE performed well in PCR. Additions to the modified alkaline lysis method increased A260:A230 by up to 59% without affecting yield. With the use of SDS, an average of 1000 μg/g DNA was isolated from fresh leaf tissue of 18 samples in ∼1.5 h at a cost of 0.74 U.S. dollars (USD)/sample. We recommend improved alkaline lysis as a rapid, effective, and cost-efficient method of isolating DNA from Osmanthus species.

  18. [DNA extraction from bones and teeth using AutoMate Express forensic DNA extraction system].

    Science.gov (United States)

    Gao, Lin-Lin; Xu, Nian-Lai; Xie, Wei; Ding, Shao-Cheng; Wang, Dong-Jing; Ma, Li-Qin; Li, You-Ying

    2013-04-01

    To explore a new method in order to extract DNA from bones and teeth automatically. Samples of 33 bones and 15 teeth were acquired by freeze-mill method and manual method, respectively. DNA materials were extracted and quantified from the triturated samples by AutoMate Express forensic DNA extraction system. DNA extraction from bones and teeth were completed in 3 hours using the AutoMate Express forensic DNA extraction system. There was no statistical difference between the two methods in the DNA concentration of bones. Both bones and teeth got the good STR typing by freeze-mill method, and the DNA concentration of teeth was higher than those by manual method. AutoMate Express forensic DNA extraction system is a new method to extract DNA from bones and teeth, which can be applied in forensic practice.

  19. Overcoming DNA extraction problems from carnivorous plants

    Directory of Open Access Journals (Sweden)

    Fleischmann, Andreas

    2009-12-01

    Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

    Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

  20. Comparison of Five Commercial DNA Extraction Kits for the Recovery of Francisella Tularensis DNA from Spiked Soil Samples

    Science.gov (United States)

    2007-01-01

    DNA Stool Mini kit, Epicentre SoilMasterTM DNA extraction kit, MoBio UltraCleanTM kit, or the MoBio PowerMaxTM soil DNA isolation kit according... extraction and purification of microbial DNA from sediments. J Microbiol Methods 1987;7: 57–66. [19] Smalla K, Creswell N, Mendonca-Hagler L, Wolters A, van...Herrick JB, Silva MC, Ghiorse WC, Madsen EL. Quantitative cell lysis of indigenous microorganisms and rapid extraction of microbial DNA from sediment. Appl

  1. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    The DNA extracted with three different methods cetyltrimethylammonium bromide (CTAB), sodium dodecyl sulfate (SDS), and cesium chloride (CsCl) density gradient) were comparatively studied by polymerase chain reaction (PCR) analysis in terms of quantity and quality. High quality genomic DNA was obtained from fresh ...

  2. Leaf tissue sampling and DNA extraction protocols.

    Science.gov (United States)

    Semagn, Kassa

    2014-01-01

    Taxonomists must be familiar with a number of issues in collecting and transporting samples using freezing methods (liquid nitrogen and dry ice), desiccants (silica gel and blotter paper), and preservatives (CTAB, ethanol, and isopropanol), with each method having its own merits and limitations. For most molecular studies, a reasonably good quality and quantity of DNA is required, which can only be obtained using standard DNA extraction protocols. There are many DNA extraction protocols that vary from simple and quick ones that yield low-quality DNA but good enough for routine analyses to the laborious and time-consuming standard methods that usually produce high quality and quantities of DNA. The protocol to be chosen will depend on the quality and quantity of DNA needed, the nature of samples, and the presence of natural substances that may interfere with the extraction and subsequent analysis. The protocol described in this chapter has been tested for extracting DNA from eight species and provided very good quality and quantity of DNA for different applications, including those genotyping methods that use restriction enzymes.

  3. An economical and combined method for rapid and efficient isolation of fungal DNA.

    Science.gov (United States)

    Lech, T; Syguła-Cholewinska, J; Szostak-Kot, J

    2014-12-18

    DNA isolation is a crucial step of conducting genetic studies in any organism. However, this process is quite difficult when studying fungi because of the need to damage the fungal cell walls of specific structures. In this study, we developed a method for the rapid and efficient isolation of fungal DNA based on simultaneous mechanical and enzymatic cell wall degradation. There are several typical modifications of the standard phenol-chloroform DNA extraction method. This method can be modified to degrade the fungal cell wall. The first step of the presented DNA extraction included manual homogenization in modified lysis buffer. Next, enzymatic digestion using 2 enzymes was conducted, including lyticase and proteinase K. To carefully select the most favorable conditions, we developed an economical, rapid, and reliable method for fungal DNA extraction that ensures both high efficiency and proper purity, which are essential for further analyses.

  4. Method for extraction and amplification of DNA from seeds and tubers

    African Journals Online (AJOL)

    Computer Department

    2013-04-10

    Apr 10, 2013 ... INTRODUCTION. Extraction of a suitable quantity and quality of DNA is a critical step in molecular applications, such as polymerase chain reaction (PCR), ..... Arch. Virol. 148:937-949. Zhang J, Stewart JM (2000). Economical and rapid method for extracting cotton genomic DNA. J. Cotton Sci. 4:193-201.

  5. [Extraction and characterization of total DNA from Dendrobium].

    Science.gov (United States)

    Peng, Rui; Song, Hong-yuan; Li, Quan-sen; Wang, Yu

    2003-12-01

    To explore the quality of DNA with three methods of DNA extraction and the influence on RAPD-PCR. the electrophoresis of total DNA, UV spectrophotometry and RAPD analysis were carried out on DNA extracted from three different methods. The DNA concentration and yields were different, which greatly influenced the result of RAPD-PCR. The higher quality DNA from Dendrobium can be obtained with the method of CTAB-free extraction medium before total DNA was isolated.

  6. Microbial diversity in fecal samples depends on DNA extraction method: easyMag DNA extraction compared to QIAamp DNA stool mini kit extraction.

    Science.gov (United States)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten; Andersen, Lee O B; Petersen, Andreas M; Krogfelt, Karen A

    2014-01-21

    There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France) and a manual one (QIAamp DNA Stool Mini Kit, Qiagen, Hilden, Germany) were tested on stool samples collected from 3 patients with Inflammatory Bowel disease (IBD) and 5 healthy individuals. DNA extracts obtained by the QIAamp DNA Stool Mini Kit yield a higher amount of DNA compared to DNA extracts obtained by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA was very successful. QIAamp DNA Stool Mini Kit DNA extracts are optimal for DGGE runs and this extraction method yields a higher amount of DNA compared to easyMag®.

  7. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  8. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for.

  9. A rapid method for the detection of foodborne pathogens by extraction of a trace amount of DNA from raw milk based on label-free amino-modified silica-coated magnetic nanoparticles and polymerase chain reaction

    Science.gov (United States)

    A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogen...

  10. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  11. Highly Effective DNA Extraction Method from Fresh, Frozen, Dried and Clotted Blood Samples

    Directory of Open Access Journals (Sweden)

    Jaleh Barar

    2011-09-01

    Full Text Available Introduction: Today, with the tremendous potential of genomics and other recent advances in science, the role of science to improve reliable DNA extraction methods is more relevant than ever before. The ideal process for genomic DNA extraction demands high quantities of pure, integral and intact genomic DNA (gDNA from the sample with minimal co-extraction of inhibitors of downstream processes. Here, we report the development of a very rapid, less-hazardous, and high throughput protocol for extracting of high quality DNA from blood samples. Methods: Dried, clotted and ethylene diamine tetra-acetic acid (EDTA treated fresh and frozen blood samples were extracted using this method in which the quality and integrity of the extracted DNA were corroborated by agarose gel electrophoresis, PCR reaction and DNA digestion using restricted enzyme. The UV spectrophotometric and gel electrophoresis analysis resulted in high A260/A280 ratio (>1.8 with high intactness of DNA. Results: PCR and DNA digestion experiments indicated that the final solutions of extracted DNA contained no inhibitory substances, which confirms that the isolated DNA is of good quality. Conclusion: The high quality and quantity of current method, no enzymatic processing and accordingly its low cost, make it appropriate for DNA extraction not only from human but also from animal blood samples in any molecular biology labs.

  12. An efficient and cost-effective method for DNA extraction from athalassohaline soil using a newly formulated cell extraction buffer.

    Science.gov (United States)

    Narayan, Avinash; Jain, Kunal; Shah, Amita R; Madamwar, Datta

    2016-06-01

    The present study describes the rapid and efficient indirect lysis method for environmental DNA extraction from athalassohaline soil by newly formulated cell extraction buffer. The available methods are mostly based on direct lysis which leads to DNA shearing and co-extraction of extra cellular DNA that influences the community and functional analysis. Moreover, during extraction of DNA by direct lysis from athalassohaline soil, it was observed that, upon addition of poly ethylene glycol (PEG), isopropanol or absolute ethanol for precipitation of DNA, salt precipitates out and affecting DNA yield significantly. Therefore, indirect lysis method was optimized for extraction of environmental DNA from such soil containing high salts and low microbial biomass (CFU 4.3 × 104 per gram soil) using newly formulated cell extraction buffer in combination with low and high speed centrifugation. The cell extraction buffer composition and its concentration were optimized and PEG 8000 (1 %; w/v) and 1 M NaCl gave maximum cell mass for DNA extraction. The cell extraction efficiency was assessed with acridine orange staining of soil samples before and after cell extraction. The efficiency, reproducibility and purity of extracted DNA by newly developed procedure were compared with previously recognized methods and kits having different protocols including indirect lysis. The extracted environmental DNA showed better yield (5.6 ± 0.7 μg g-1) along with high purity ratios. The purity of DNA was validated by assessing its usability in various molecular techniques like restriction enzyme digestion, amplification of 16S rRNA gene using PCR and UV-Visible spectroscopy analysis.

  13. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    reagents for 'all in one' / ready to use tool to extract genomic. DNA (gDNA) from a very wide spectrum of blood samples. To meet these criteria, a universal and versatile DNA extrac- tion procedure should be developed with minimal chemicals and equipment. On the other hand, the interesting natural relation between RBCs ...

  14. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  15. Optimized microbial DNA extraction from diarrheic stools.

    OpenAIRE

    Donatin Emilie; Drancourt Michel

    2012-01-01

    Abstract Background The detection of enteropathogens in stool specimens increasingly relies on the detection of specific nucleic acid sequences. We observed that such detection was hampered in diarrheic stool specimens and we set-up an improved protocol combining lyophilization of stools prior to a semi-automated DNA extraction. Findings A total of 41 human diarrheic stool specimens comprising of 35 specimens negative for enteropathogens and six specimens positive for Salmonella enterica in c...

  16. Extraction of DNA from Human Skeletal Material.

    Science.gov (United States)

    Pajnič, Irena Zupanič

    2016-01-01

    In recent years the recovery and analysis of DNA from skeletal remains has been applied to several contexts ranging from disaster victim identification to the identification of the victims of conflict. Here are described procedures for processing the bone and tooth samples including mechanical and chemical cleaning, cutting and powdering in the presence of liquid nitrogen, complete demineralization of bone and tooth powder, DNA extraction, DNA purification using magnetic beads, and the precautions and strategies implemented to avoid and detect contamination. It has proven highly successful in the analysis of bones and teeth from Second World War victims' skeletal remains that have been excavated from mass graves in Slovenia and is also suitable for genetic identification of relatively fresh human remains.

  17. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  18. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  19. Rapid folding of DNA into nanoscale shapes at constant temperature

    National Research Council Canada - National Science Library

    Sobczak, Jean-Philippe J; Martin, Thomas G; Gerling, Thomas; Dietz, Hendrik

    2012-01-01

    .... Unfolding occurred in apparent equilibrium at higher temperatures than those for folding. Folding at optimized constant temperatures enabled the rapid production of three-dimensional DNA objects with yields that approached 100...

  20. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    ... of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological basis is followed in this procedure, in which, when the bloodis placed in water, ...

  1. Extraction of trace amount of severely degraded DNA.

    Science.gov (United States)

    Lv, Pin; Zhou, Xiangshan; You, Jinhua; Ye, Bang-Ce; Zhang, Yuanxing

    2009-01-01

    DNA extraction from food is always problematic especially from highly processed samples which contain only trace amounts of severely degraded DNA fragments. In this work, to extract trace amounts of small DNA fragments of the traditional Chinese medicine (TCM) colla corii asini derived from highly processed Equus asinus skin, three strategies were compared for its authentication. With some optimizations, the modified QIAquick spin column method achieved higher DNA yield and purity in comparison with the "SDS/proteinase K" method and the "Wizard magnetic DNA purification system for food" method. Further studies showed that at least 0.4 g colla corii asini was needed to obtain enough DNA extracts for PCR-based detection by the method and only amplicons of less than 100 bp could be generated from the DNA extracts which confirmed the efficiency of the method in small DNA fragment extraction. The DNA obtained by this method was suitable to be used in PCR-based authentications.

  2. Optimized microbial DNA extraction from diarrheic stools

    Directory of Open Access Journals (Sweden)

    Donatin Emilie

    2012-12-01

    Full Text Available Abstract Background The detection of enteropathogens in stool specimens increasingly relies on the detection of specific nucleic acid sequences. We observed that such detection was hampered in diarrheic stool specimens and we set-up an improved protocol combining lyophilization of stools prior to a semi-automated DNA extraction. Findings A total of 41 human diarrheic stool specimens comprising of 35 specimens negative for enteropathogens and six specimens positive for Salmonella enterica in culture, were prospectively studied. One 1-mL aliquot of each specimen was lyophilised and total DNA was extracted from lyophilised and non-lyophilised aliquots by combining automatic and phenol-chloroform DNA extraction. DNA was incorporated into real-time PCRs targeting the 16S rRNA gene of Bacteria and the archaea Methanobrevibacter smithii and the chorismate synthase gene of S. enterica. Whereas negative controls consisting in DNA-free water remained negative, M. smithii was detected in 26/41 (63.4% non-lyophilised (Ct value 28.78 ± 9.1 versus 39/41 (95.1% lyophilised aliquots (Ct value 22.04 ± 5.5; bacterial 16S rRNA was detected in 33/41 (80.5% non-lyophilised (Ct value 28.11 ± 5.9 versus 40/41 (97.6% lyophilised aliquots (Ct value 24.94 ± 6.6; and S. enterica was detected in 6/6 (100% non-lyophilized and lyophilized aliquots (Ct value 26.98 ± 4.55 and 26.16 ± 4.97, respectively. S. enterica was not detected in the 35 remaining diarrheal-stool specimens. The proportion of positive specimens was significantly higher after lyophilization for the detection of M. smithii (p = 0.00043 and Bacteria (p = 0.015. Conclusion Lyophilization of diarrheic stool specimens significantly increases the PCR-based detection of microorganisms. The semi-automated protocol described here could be routinely used for the molecular diagnosis of infectious diarrhea.

  3. Optimized microbial DNA extraction from diarrheic stools.

    Science.gov (United States)

    Donatin, Emilie; Drancourt, Michel

    2012-12-28

    The detection of enteropathogens in stool specimens increasingly relies on the detection of specific nucleic acid sequences. We observed that such detection was hampered in diarrheic stool specimens and we set-up an improved protocol combining lyophilization of stools prior to a semi-automated DNA extraction. A total of 41 human diarrheic stool specimens comprising of 35 specimens negative for enteropathogens and six specimens positive for Salmonella enterica in culture, were prospectively studied. One 1-mL aliquot of each specimen was lyophilised and total DNA was extracted from lyophilised and non-lyophilised aliquots by combining automatic and phenol-chloroform DNA extraction. DNA was incorporated into real-time PCRs targeting the 16S rRNA gene of Bacteria and the archaea Methanobrevibacter smithii and the chorismate synthase gene of S. enterica. Whereas negative controls consisting in DNA-free water remained negative, M. smithii was detected in 26/41 (63.4%) non-lyophilised (Ct value 28.78 ± 9.1) versus 39/41 (95.1%) lyophilised aliquots (Ct value 22.04 ± 5.5); bacterial 16S rRNA was detected in 33/41 (80.5%) non-lyophilised (Ct value 28.11 ± 5.9) versus 40/41 (97.6%) lyophilised aliquots (Ct value 24.94 ± 6.6); and S. enterica was detected in 6/6 (100%) non-lyophilized and lyophilized aliquots (Ct value 26.98 ± 4.55 and 26.16 ± 4.97, respectively). S. enterica was not detected in the 35 remaining diarrheal-stool specimens. The proportion of positive specimens was significantly higher after lyophilization for the detection of M. smithii (p = 0.00043) and Bacteria (p = 0.015). Lyophilization of diarrheic stool specimens significantly increases the PCR-based detection of microorganisms. The semi-automated protocol described here could be routinely used for the molecular diagnosis of infectious diarrhea.

  4. Comparison of Six DNA Extraction Methods for Recovery of Fungal DNA as Assessed by Quantitative PCR

    OpenAIRE

    Fredricks, David N.; Smith, Caitlin; Meier, Amalia

    2005-01-01

    The detection of fungal pathogens in clinical samples by PCR requires the use of extraction methods that efficiently lyse fungal cells and recover DNA suitable for amplification. We used quantitative PCR assays to measure the recovery of DNA from two important fungal pathogens subjected to six DNA extraction methods. Aspergillus fumigatus conidia or Candida albicans yeast cells were added to bronchoalveolar lavage fluid and subjected to DNA extraction in order to assess the recovery of DNA fr...

  5. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  6. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  7. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted.

  8. Microbial diversity in fecal samples depends on DNA extraction method: easyMag DNA extraction compared to QIAamp DNA stool mini kit extraction

    OpenAIRE

    Mirsepasi, Hengameh; Persson,Søren; Struve, Carsten; Andersen, Lee O B; Petersen, Andreas M.; Krogfelt, Karen A.

    2014-01-01

    Background There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). Findin...

  9. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  10. Comparative analysis of protocols for DNA extraction from soybean caterpillars.

    Science.gov (United States)

    Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

    2016-04-07

    Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

  11. Extraction of DNA from plant and fungus tissues in situ.

    Science.gov (United States)

    Abu Almakarem, Amal S; Heilman, Katie L; Conger, Heather L; Shtarkman, Yury M; Rogers, Scott O

    2012-06-06

    When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000 × g), two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 × g), and one manually-operated microcentrifuge (max rcf = 120 × g). Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. This CTAB (cetyltrimethylammonium bromide) DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt this method for genomic, metagenomic, transcriptomic and

  12. Rapid and accurate identification of microorganisms contaminating cosmetic products based on DNA sequence homology.

    Science.gov (United States)

    Fujita, Y; Shibayama, H; Suzuki, Y; Karita, S; Takamatsu, S

    2005-12-01

    The aim of this study was to develop rapid and accurate procedures to identify microorganisms contaminating cosmetic products, based on the identity of the nucleotide sequences of the internal transcribed spacer (ITS) region of the ribosomal RNA coding DNA (rDNA). Five types of microorganisms were isolated from the inner portion of lotion bottle caps, skin care lotions, and cleansing gels. The rDNA ITS region of microorganisms was amplified through the use of colony-direct PCR or ordinal PCR using DNA extracts as templates. The nucleotide sequences of the amplified DNA were determined and subjected to homology search of a publicly available DNA database. Thereby, we obtained DNA sequences possessing high similarity with the query sequences from the databases of all the five organisms analyzed. The traditional identification procedure requires expert skills, and a time period of approximately 1 month to identify the microorganisms. On the contrary, 3-7 days were sufficient to complete all the procedures employed in the current method, including isolation and cultivation of organisms, DNA sequencing, and the database homology search. Moreover, it was possible to develop the skills necessary to perform the molecular techniques required for the identification procedures within 1 week. Consequently, the current method is useful for rapid and accurate identification of microorganisms, contaminating cosmetics.

  13. Preliminary assessment for DNA extraction on microfluidic channel

    Science.gov (United States)

    Gopinath, Subash C. B.; Hashim, Uda; Uda, M. N. A.

    2017-03-01

    The aim of this research is to extract, purify and yield DNA in mushroom from solid state mushroom sample by using fabricated continuous high-capacity sample delivery microfluidic through integrated solid state extraction based amino-coated silica bead. This device is made to specifically extract DNA in mushroom sample in continuous inflow process with energy and cost consumption. In this project, we present two methods of DNA extraction and purification which are by using centrifuge (complex and conventional method) and by using microfluidic biosensor (new and fast method). DNA extracted can be determined by using ultraviolet-visible spectroscopy (UV-VIS). The peak obtained at wavelength 260nm after measuring the absorbance of sample proves that DNA is successfully extracted from the mushroom.

  14. Collection and extraction of saliva DNA for next generation sequencing.

    Science.gov (United States)

    Goode, Michael R; Cheong, Soo Yeon; Li, Ning; Ray, William C; Bartlett, Christopher W

    2014-08-27

    The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality DNA. However, DNA extraction from saliva can yield high quality DNA with little to no degradation/fragmentation that is suitable for a variety of DNA assays without the expense of a phlebotomist and can even be acquired through the mail. However, at present, no saliva DNA collection/extraction protocols for next generation sequencing have been presented in the literature. This protocol optimizes parameters of saliva collection/storage and DNA extraction to be of sufficient quality and quantity for DNA assays with the highest standards, including microarray genotyping and next generation sequencing.

  15. A comparison of DNA extraction methods using Petunia hybrida tissues.

    Science.gov (United States)

    Tamari, Farshad; Hinkley, Craig S; Ramprashad, Naderia

    2013-09-01

    Extraction of DNA from plant tissue is often problematic, as many plants contain high levels of secondary metabolites that can interfere with downstream applications, such as the PCR. Removal of these secondary metabolites usually requires further purification of the DNA using organic solvents or other toxic substances. In this study, we have compared two methods of DNA purification: the cetyltrimethylammonium bromide (CTAB) method that uses the ionic detergent hexadecyltrimethylammonium bromide and chloroform-isoamyl alcohol and the Edwards method that uses the anionic detergent SDS and isopropyl alcohol. Our results show that the Edwards method works better than the CTAB method for extracting DNA from tissues of Petunia hybrida. For six of the eight tissues, the Edwards method yielded more DNA than the CTAB method. In four of the tissues, this difference was statistically significant, and the Edwards method yielded 27-80% more DNA than the CTAB method. Among the different tissues tested, we found that buds, 4 days before anthesis, had the highest DNA concentrations and that buds and reproductive tissue, in general, yielded higher DNA concentrations than other tissues. In addition, DNA extracted using the Edwards method was more consistently PCR-amplified than that of CTAB-extracted DNA. Based on these results, we recommend using the Edwards method to extract DNA from plant tissues and to use buds and reproductive structures for highest DNA yields.

  16. [DNA extraction methods of compost for molecular ecology analysis].

    Science.gov (United States)

    Yang, Zhao-Hui; Xiao, Yong; Zeng, Guang-Ming; Liu, Yun-Guo; Deng, Jiu-Hua

    2006-08-01

    Molecular ecology provides new techniques for studying compost microbes, and the DNA extraction is the basis of molecular techniques. Because of the contamination of humic acids, it turns to be more difficult for compost microbial DNA extraction. Three different approaches, named as lysozyme lysis, ultrasonic lysis and proteinase K lysis with CTAB, were used to extract the total DNA from compost. The detection performed on a nucleic acids and protein analyzer showed that all the three approaches produced high DNA yields. The agarose gel electrophoresis showed that the DNA fragments extracted from compost had a length of about 23 kb. A eubacterial 16S rRNA gene targeted primer pair (27F and 1 495R) was used for PCR amplification, and all the samples got almost the full length 16S rDNA sequence (about 1.5 kb). After digested by restriction endonucleases (Hae Ill and Alu I), the restriction map showed relatively identical microbial diversity in the DNA, which was extracted by the three different approaches. All the compost microbial DNA extracted by the three different approaches could be used for molecular ecological study, and researchers should choose the right approach for extracting microbial DNA from compost based on the facts.

  17. An efficient method for DNA extraction from Cladosporioid fungi

    NARCIS (Netherlands)

    Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de P.J.G.M.

    2010-01-01

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on

  18. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

    African Journals Online (AJOL)

    BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

  20. Standardization of DNA extraction from invasive alien weed ...

    African Journals Online (AJOL)

    DNA isolation from the weed, Parthenium hysterophorus is complicated due to the presence of high amount of allelochemicals in the form of secondary metabolites that causes hindrance in extraction and enzymatic reactions. A modified and efficient DNA extraction from P. hysterophorus leaf has been developed.

  1. The First Attested Extraction of Ancient DNA in Legumes (Fabaceae).

    Science.gov (United States)

    Mikić, Aleksandar M

    2015-01-01

    Ancient DNA (aDNA) is any DNA extracted from ancient specimens, important for diverse evolutionary researches. The major obstacles in aDNA studies are mutations, contamination and fragmentation. Its studies may be crucial for crop history if integrated with human aDNA research and historical linguistics, both general and relating to agriculture. Legumes (Fabaceae) are one of the richest end economically most important plant families, not only from Neolithic onwards, since they were used as food by Neanderthals and Paleolithic modern man. The idea of extracting and analyzing legume aDNA was considered beneficial for both basic science and applied research, with an emphasis on genetic resources and plant breeding. The first reported successful and attested extraction of the legume aDNA was done from the sample of charred seeds of pea (Pisum sativum) and bitter vetch (Vicia ervilia) from Hissar, southeast Serbia, dated to 1,350-1,000 Before Christ. A modified version of cetyltrimethylammonium bromide (CTAB) method and the commercial kit for DNA extraction QIAGEN DNAesy yielded several ng μl(-1) of aDNA of both species and, after the whole genome amplification and with a fragment of nuclear ribosomal DNA gene 26S rDNA, resulted in the detection of the aDNA among the PCR products. A comparative analysis of four informative chloroplast DNA regions (trnSG, trnK, matK, and rbcL) among the modern wild and cultivated pea taxa demonstrated not only that the extracted aDNA was genuine, on the basis of mutation rate, but also that the ancient Hissar pea was most likely an early domesticated crop, related to the modern wild pea of a neighboring region. It is anticipated that this premier extraction of legume aDNA may provide taxonomists with the answers to diverse questions, such as leaf development in legumes, as well as with novel data on the single steps in domesticating legume crops worldwide.

  2. DNA Extraction Procedures Meaningfully Influence qPCR-Based mtDNA Copy Number Determination

    OpenAIRE

    Guo, Wen; Jiang, Lan; Bhasin, Shalender; Khan, Shaharyar M.; Swerdlow, Russell H.

    2009-01-01

    Quantitative real time PCR (qPCR) is commonly used to determine cell mitochondrial DNA (mtDNA) copy number. This technique involves obtaining the ratio of an unknown variable (number of copies of an mtDNA gene) to a known parameter (number of copies of a nuclear DNA gene) within a genomic DNA sample. We considered the possibility that mtDNA: nuclear DNA (nDNA) ratio determinations could vary depending on the method of genomic DNA extraction used, and that these differences could substantively...

  3. Giardia intestinalis: DNA extraction approaches to improve PCR results.

    Science.gov (United States)

    Babaei, Zahra; Oormazdi, Hormozd; Rezaie, Sasan; Rezaeian, Mostafa; Razmjou, Elham

    2011-06-01

    Difficulty in disrupting cysts of Giardia intestinalis, a cosmopolitan protozoan parasite, decreases the yield of DNA extracted and reduces the effectiveness of the polymerase chain reaction (PCR). To improve the detection of the Giardia Glutamate Dehydrogenase (gdh) gene, we re-evaluated the effects of deoxyribonucleic acid (DNA) extraction methods. Purified and concentrated cysts from 33 fecal samples were disrupted using conventional methods, and DNA extraction was conducted using two protocols: the QIAamp Stool Mini Kit and phenol/chloroform/isoamyl alcohol (PCI). PCR amplification was successful for 12 extracted DNA samples (36%) using PCI following a glass bead and freeze/thaw pretreatment and for all 33 samples (100%) using the QIAamp Stool Mini Kit following the aforementioned pretreatment. Consequently, the pretreatment of cysts with glass beads and freeze/thaw cycles followed by extraction of DNA with the QIAamp Stool Mini kit was the more effective protocol. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    Administrator

    2007-02-19

    Feb 19, 2007 ... niques such as sequencing, cDNA synthesis and cloning,. RNA transcription, nucleic acid labeling (random primer labeling) etc. Hence, extraction of high quality DNA with minimum time and cost is always of interest in molecular genetic studies. To meet these criteria many DNA isola- tion procedures have ...

  5. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  6. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  7. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  8. Rapid Column Extraction method for SoilRapid Column Extraction method for Soil

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod, L. III; Culligan, Brian K.

    2005-11-07

    The analysis of actinides in environmental soil and sediment samples is very important for environmental monitoring as well as for emergency preparedness. A new, rapid actinide separation method has been developed and implemented that provides total dissolution of large soil samples, high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and DGA-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu) neptunium (Np), uranium (U), americium (Am), and curium (Cm) using a single multi-stage column combined with alpha spectrometry. The method combines a rapid fusion step for total dissolution to dissolve refractory analytes and matrix removal using cerium fluoride precipitation to remove the difficult soil matrix. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  9. Rapid Statistical Learning Supporting Word Extraction From Continuous Speech.

    Science.gov (United States)

    Batterink, Laura J

    2017-07-01

    The identification of words in continuous speech, known as speech segmentation, is a critical early step in language acquisition. This process is partially supported by statistical learning, the ability to extract patterns from the environment. Given that speech segmentation represents a potential bottleneck for language acquisition, patterns in speech may be extracted very rapidly, without extensive exposure. This hypothesis was examined by exposing participants to continuous speech streams composed of novel repeating nonsense words. Learning was measured on-line using a reaction time task. After merely one exposure to an embedded novel word, learners demonstrated significant learning effects, as revealed by faster responses to predictable than to unpredictable syllables. These results demonstrate that learners gained sensitivity to the statistical structure of unfamiliar speech on a very rapid timescale. This ability may play an essential role in early stages of language acquisition, allowing learners to rapidly identify word candidates and "break in" to an unfamiliar language.

  10. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  11. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  12. Genomic DNA extraction from cells by electroporation on an integrated microfluidic platform.

    Science.gov (United States)

    Geng, Tao; Bao, Ning; Sriranganathanw, Nammalwar; Li, Liwu; Lu, Chang

    2012-11-06

    The vast majority of genetic analysis of cells involves chemical lysis for release of DNA molecules. However, chemical reagents required in the lysis interfere with downstream molecular biology and often require removal after the step. Electrical lysis based on irreversible electroporation is a promising technique to prepare samples for genetic analysis due to its purely physical nature, fast speed, and simple operation. However, there has been no experimental confirmation on whether electrical lysis extracts genomic DNA from cells in a reproducible and efficient fashion in comparison to chemical lysis, especially for eukaryotic cells that have most of the DNA enclosed in the nucleus. In this work, we construct an integrated microfluidic chip that physically traps a low number of cells, lyses the cells using electrical pulses rapidly, then purifies and concentrates genomic DNA. We demonstrate that electrical lysis offers high efficiency for DNA extraction from both eukaryotic cells (up to ∼36% for Chinese hamster ovary cells) and bacterial cells (up to ∼45% for Salmonella typhimurium) that is comparable to the widely used chemical lysis. The DNA extraction efficiency has dependence on both the electric parameters and relative amount of beads used for DNA adsorption. We envision that electroporation-based DNA extraction will find use in ultrasensitive assays that benefit from minimal dilution and simple procedures.

  13. Rapid extraction of aflatoxin from creamy and crunchy peanut butter.

    Science.gov (United States)

    Vega, Victor A

    2005-01-01

    A rapid extraction technique was developed for the isolation and subsequent liquid chromatographic determination of aflatoxins B1, B2, G1, and G2 in creamy and crunchy peanut butter. Peanut buftter samples were extracted with a methanol 15% sodium chloride (7 + 3) solution followed by a second extraction with methanol. The extract was subjected to a cleanup using a Vicam Aflatest immunoaffinity column. Control samples for both smooth and crunchy peanut butter were fortified at 4 different levels for aflatoxin B1, B2, G1, and G2. The average aflatoxin B1, B2, G1, and G2 recoveries from smooth peanut buffer were 95.2, 89.9, 94.1, and 62.4%, respectively, and 92.4, 84.3, 85.5, and 53.7%, respectively, from crunchy peanut butter. This extraction method and the official AOAC Method 991.31 produced comparable results for peanut butter samples. This method provides a rapid, specific, and easily controlled assay for the analysis of aflatoxins in peanut butter with minimal solvent usage. Organic solvent consumption was decreased by 85% and hazardous waste production was decreased by 80% in comparison with the AOAC method. Along with the decreased solvent consumption, significant savings in time were observed.

  14. Extracting DNA of nematodes communities from Argentine Pampas agricultural soils

    Directory of Open Access Journals (Sweden)

    Eduardo A. Mondino

    2015-06-01

    Full Text Available We examined four strategies (Tris/EDTA, sodium dodecyl sulfate, Chelex 100 resin and cetyltrimethylammonium bromide -CTAB- for extracting nucleic acid (DNA from communities of nematodes. Nematodes were isolated from an agricultural area under different management of long-term crop rotation experiment from Argentina during three seasons. After DNA extraction, Polymerase Chain Reaction-amplifications were performed and considered as indicators of successful DNA extraction. The CTAB combined with proteinase K and phenol-chloroform-isoamyl alcohol was the unique successful method because positive amplifications were obtained by using both eukaryotic and nematode specific primers. This work could contribute to biodiversity studies of nematodes on agroecosystems.

  15. Rapid automatic keyword extraction for information retrieval and analysis

    Science.gov (United States)

    Rose, Stuart J [Richland, WA; Cowley,; E, Wendy [Richland, WA; Crow, Vernon L [Richland, WA; Cramer, Nicholas O [Richland, WA

    2012-03-06

    Methods and systems for rapid automatic keyword extraction for information retrieval and analysis. Embodiments can include parsing words in an individual document by delimiters, stop words, or both in order to identify candidate keywords. Word scores for each word within the candidate keywords are then calculated based on a function of co-occurrence degree, co-occurrence frequency, or both. Based on a function of the word scores for words within the candidate keyword, a keyword score is calculated for each of the candidate keywords. A portion of the candidate keywords are then extracted as keywords based, at least in part, on the candidate keywords having the highest keyword scores.

  16. Necessity of purification during bacterial DNA extraction with environmental soils

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Lim

    2017-08-01

    Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

  17. Evaluation of growth conditions and DNA extraction techniques used in the molecular analysis of dermatophytes.

    Science.gov (United States)

    Gnat, S; Nowakiewicz, A; Ziółkowska, G; Trościańczyk, A; Majer-Dziedzic, B; Zięba, P

    2017-05-01

    Recent molecular methods for diagnosis of superficial mycoses have determined the need for a rapid and easy method of extracting DNA. The aim of study was to determine growth conditions and techniques of DNA extraction for Microsporum canis, Trichophyton mentagrophytes and T. verrucosum. Samples were prepared of each of the DNA extraction methods (phenol-chloroform, CTAB and four different kits) for all of the incubation periods (4, 7 and 10 days) of the cultures on the solid and in the liquid medium. The highest DNA concentrations were obtained using the phenol-chloroform method. The concentration of DNA extracted with the CTAB method accounted for 62·21%, for kits it corresponded from 35·53 to 15·41%. The analysis of the DNA weight yield revealed the highest isolation efficiency of the phenol-chloroform method, 1 mg of mycelium yielded 223·8 μg DNA. Lower DNA yield (by 39·32%) was obtained with the CTAB method; in the case of kits by 68·46-85·32%. In most of the techniques, the DNA yield on the solid medium was higher. In summary, the highest DNA yield was noted in the 7-day cultures and extraction with the phenol-chloroform method. Importantly, the type of culture was not relevant for the diagnostic result. Most mycoses are caused by fungi that reside in nature. The severity of the infection depends on the pathogenic attributes, socioeconomic factors and local environmental conditions. Recent diagnosis increasingly relies on not only the clinical features. Molecular identifications have determined the need for a rapid and easy method of extracting DNA. Usually two factors have to be considered: maximize the DNA yield and ensure that the extracted DNA is susceptible to enzymatic reactions. These data suggest that phenol-chloroform methods and a 7-day culture period may be useful for validation and constitute the first step of molecular diagnosis of dermatophytes. © 2017 The Society for Applied Microbiology.

  18. Extraction of DNA from plant and fungus tissues in situ

    Directory of Open Access Journals (Sweden)

    Abu Almakarem Amal S

    2012-06-01

    Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

  19. A comparison of the efficiency of five different commercial DNA extraction kits for extraction of DNA from faecal samples.

    Science.gov (United States)

    Claassen, Shantelle; du Toit, Elloise; Kaba, Mamadou; Moodley, Clinton; Zar, Heather J; Nicol, Mark P

    2013-08-01

    Differences in the composition of the gut microbiota have been associated with a range of diseases using culture-independent methods. Reliable extraction of nucleic acid is a key step in identifying the composition of the faecal microbiota. Five widely used commercial deoxyribonucleic acid (DNA) extraction kits (QIAsymphony® Virus/Bacteria Midi Kit (kit QS), ZR Fecal DNA MiniPrep™ (kit Z), QIAamp® DNA Stool Mini Kit (kit QA), Ultraclean® Fecal DNA Isolation Kit (kit U) and PowerSoil® DNA Isolation Kit (kit P)) were evaluated, using human faecal samples. Yield, purity and integrity of total genomic DNA were compared spectrophotometrically and using gel electrophoresis. Three bacteria, commonly found in human faeces were quantified using real time polymerase chain reaction (qPCR) and total bacterial diversity was studied using denaturing gradient gel electrophoresis (DGGE) as well as terminal restriction fragment length polymorphism (T-RFLP). The measurements of DNA yield and purity exhibited variations between the five kits tested in this study. Automated kit QS exhibited the best quality and highest quantity of DNA. All kits were shown to be reproducible with CV values≤0.46 for DNA extraction. qPCR results showed that all kits were uniformly efficient for extracting DNA from the selected target bacteria. DGGE and T-RFLP produced the highest diversity scores for DNA extracted using kit Z (H'=2.30 and 1.27) and kit QS (H'=2.16 and 0.94), which also extracted the highest DNA yields compared to the other kits assessed. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Preparing Silica Aerogel Monoliths via a Rapid Supercritical Extraction Method

    Science.gov (United States)

    Gorka, Caroline A.

    2014-01-01

    A procedure for the fabrication of monolithic silica aerogels in eight hours or less via a rapid supercritical extraction process is described. The procedure requires 15-20 min of preparation time, during which a liquid precursor mixture is prepared and poured into wells of a metal mold that is placed between the platens of a hydraulic hot press, followed by several hours of processing within the hot press. The precursor solution consists of a 1.0:12.0:3.6:3.5 x 10-3 molar ratio of tetramethylorthosilicate (TMOS):methanol:water:ammonia. In each well of the mold, a porous silica sol-gel matrix forms. As the temperature of the mold and its contents is increased, the pressure within the mold rises. After the temperature/pressure conditions surpass the supercritical point for the solvent within the pores of the matrix (in this case, a methanol/water mixture), the supercritical fluid is released, and monolithic aerogel remains within the wells of the mold. With the mold used in this procedure, cylindrical monoliths of 2.2 cm diameter and 1.9 cm height are produced. Aerogels formed by this rapid method have comparable properties (low bulk and skeletal density, high surface area, mesoporous morphology) to those prepared by other methods that involve either additional reaction steps or solvent extractions (lengthier processes that generate more chemical waste).The rapid supercritical extraction method can also be applied to the fabrication of aerogels based on other precursor recipes. PMID:24637334

  1. A Novel Method of Genomic DNA Extraction for Cactaceae

    Directory of Open Access Journals (Sweden)

    Shannon D. Fehlberg

    2013-03-01

    Full Text Available Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies.

  2. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  3. Rapid extraction and assay of uranium from environmental surface samples

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Christopher A.; Chouyyok, Wilaiwan; Speakman, Robert J.; Olsen, Khris B.; Addleman, Raymond Shane

    2017-10-01

    Extraction methods enabling faster removal and concentration of uranium compounds for improved trace and low-level assay are demonstrated for standard surface sampling material in support of nuclear safeguards efforts, health monitoring, and other nuclear analysis applications. A key problem with the existing surface sampling swipes is the requirement for complete digestion of sample and sampling matrix. This is a time-consuming and labour-intensive process that limits laboratory throughput, elevates costs, and increases background levels. Various extraction methods are explored for their potential to quickly and efficiently remove different chemical forms of uranium from standard surface sampling material. A combination of carbonate and peroxide solutions is shown to give the most rapid and complete form of uranyl compound extraction and dissolution. This rapid extraction process is demonstrated to be compatible with standard inductive coupled plasma mass spectrometry methods for uranium isotopic assay as well as screening techniques such as x-ray fluorescence. The general approach described has application beyond uranium to other analytes of nuclear forensic interest (e.g., rare earth elements and plutonium) as well as heavy metals for environmental and industrial hygiene monitoring.

  4. Extraction of human nuclear DNA from feces samples using the QIAamp DNA Stool Mini Kit.

    Science.gov (United States)

    Vandenberg, Nicholas; van Oorschot, Roland A H

    2002-09-01

    The use of a QIAamp DNA Stool Mini Kit (QIAGEN) for extracting human nuclear DNA from feces samples is reported. This method employs a stool lysis buffer and a unique matrix (InhibitEX tablet) to remove PCR inhibitory substances specific to feces samples. DNA extracted from various amounts of stool and from stool samples exposed to different environmental impacts was successfully amplified and typed using the Profiler Plus Amplification Kit and ABI PRISM 310 Genetic Analyser.

  5. New and rapid procedure for the isolation of ultra-high molecular weight eukaryotic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Longmire, J.L.; Lewis, A.; Meincke, L.J.; Hildebrand, C.E.

    1986-05-01

    The authors have developed a novel procedure that permits the rapid extraction and isolation of ultra-high molecular weight DNA from avian or mammalian cells using dialysis against a solution of polyethylene glycol (PEG). Cells harvested by centrifugation and washed twice in ice-cold Ca/sup + +/- and Mg/sup + +/-free phosphate buffered saline were resuspended in 5 ml 0.01 M Tris-Cl (pH 8.0); 0.001 M EDTA (TE); sodium dodecyl sulfate and proteinase K were added to final concentrations of 0.1% and 0.1 mg/ml, respectively. After incubation at 37/sup 0/C overnight, the viscous solution was transferred to a mini-collodian bag and concentrated by dialysis against 4-5 changes of 20% PEG in TE over a period of 5 hours at RT. Concentrated samples were desalted by dialysis against fresh TE for two 15 minute intervals. DNA obtained using this procedure gives A/sub 260//A/sub 280/ consistently >1.8. Analysis of DNA size using pulsed field gel electrophoresis revealed a distribution of fragments >500 Kb in length. Further measurements examined were (1) restriction enzyme digestibility, (2) ligation efficiency of restricted DNA, and (3) cloning efficiency using the lambda vector Ch21A. This novel methodology offers a valuable alternative protocol for rapid purification of ultrahigh molecular weight DNA for various applications in molecular biology.

  6. DNA extraction protocols for Citrullus lanatus and Capsicum ...

    African Journals Online (AJOL)

    Molecular breeding is a tested technique for developing disease-resistant varieties of species. A fundamental step to any molecular biology study is the capability to isolate pure genomic DNA. Many of the published plant DNA extraction protocols are not suitable for all plants due to the presence of secondary metabolites.

  7. Standardization of DNA extraction from invasive alien weed ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    and purification of DNA which include degradation of. DNA, contamination with highly viscous ... (5) For further purification, mixture was extracted with an equal volume of phenol: chloroform: isoamyl alcohol. .... disulphide bonds between cysteine residues (Nalini et al.,. 2004). Elimination of protein was carried out by phenol ...

  8. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study w...

  9. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  10. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  11. A Comparison of DNA Extraction Methods using Petunia hybrida Tissues

    OpenAIRE

    Tamari, Farshad; Hinkley, Craig S.; Ramprashad, Naderia

    2013-01-01

    Extraction of DNA from plant tissue is often problematic, as many plants contain high levels of secondary metabolites that can interfere with downstream applications, such as the PCR. Removal of these secondary metabolites usually requires further purification of the DNA using organic solvents or other toxic substances. In this study, we have compared two methods of DNA purification: the cetyltrimethylammonium bromide (CTAB) method that uses the ionic detergent hexadecyltrimethylammonium brom...

  12. Highly Rapid Amplification-Free and Quantitative DNA Imaging Assay

    Science.gov (United States)

    Klamp, Tobias; Camps, Marta; Nieto, Benjamin; Guasch, Francesc; Ranasinghe, Rohan T.; Wiedemann, Jens; Petrášek, Zdeněk; Schwille, Petra; Klenerman, David; Sauer, Markus

    2013-01-01

    There is an urgent need for rapid and highly sensitive detection of pathogen-derived DNA in a point-of-care (POC) device for diagnostics in hospitals and clinics. This device needs to work in a ‘sample-in-result-out’ mode with minimum number of steps so that it can be completely integrated into a cheap and simple instrument. We have developed a method that directly detects unamplified DNA, and demonstrate its sensitivity on realistically sized 5 kbp target DNA fragments of Micrococcus luteus in small sample volumes of 20 μL. The assay consists of capturing and accumulating of target DNA on magnetic beads with specific capture oligonucleotides, hybridization of complementary fluorescently labeled detection oligonucleotides, and fluorescence imaging on a miniaturized wide-field fluorescence microscope. Our simple method delivers results in less than 20 minutes with a limit of detection (LOD) of ~5 pM and a linear detection range spanning three orders of magnitude. PMID:23677392

  13. A Modified SDS-Based DNA Extraction Method for High Quality Environmental DNA from Seafloor Environments.

    Science.gov (United States)

    Natarajan, Vengadesh Perumal; Zhang, Xinxu; Morono, Yuki; Inagaki, Fumio; Wang, Fengping

    2016-01-01

    Recovering high quality genomic DNA from environmental samples is a crucial primary step to understand the genetic, metabolic, and evolutionary characteristics of microbial communities through molecular ecological approaches. However, it is often challenging because of the difficulty of effective cell lysis without fragmenting the genomic DNA. This work aims to improve the previous SDS-based DNA extraction methods for high-biomass seafloor samples, such as pelagic sediments and metal sulfide chimney, to obtain high quality and high molecular weight of the genomic DNA applicable for the subsequent molecular ecological analyses. In this regard, we standardized a modified SDS-based DNA extraction method (M-SDS), and its performance was then compared to those extracted by a recently developed hot-alkaline DNA extraction method (HA) and a commercial DNA extraction kit. Consequently, the M-SDS method resulted in higher DNA yield and cell lysis efficiency, lower DNA shearing, and higher diversity scores than other two methods, providing a comprehensive DNA assemblage of the microbial community on the seafloor depositional environment.

  14. Optimization of DNA extraction for advancing coral microbiota investigations.

    Science.gov (United States)

    Weber, Laura; DeForce, Emelia; Apprill, Amy

    2017-02-08

    DNA-based sequencing approaches are commonly used to identify microorganisms and their genes and document trends in microbial community diversity in environmental samples. However, extraction of microbial DNA from complex environmental samples like corals can be technically challenging, and extraction methods may impart biases on microbial community structure. We designed a two-phase study in order to propose a comprehensive and efficient method for DNA extraction from microbial cells present in corals and investigate if extraction method influences microbial community composition. During phase I, total DNA was extracted from seven coral species in a replicated experimental design using four different MO BIO Laboratories, Inc., DNA Isolation kits: PowerSoil®, PowerPlant® Pro, PowerBiofilm®, and UltraClean® Tissue & Cells (with three homogenization permutations). Technical performance of the treatments was evaluated using DNA yield and amplification efficiency of small subunit ribosomal RNA (SSU ribosomal RNA (rRNA)) genes. During phase II, potential extraction biases were examined via microbial community analysis of SSU rRNA gene sequences amplified from the most successful DNA extraction treatments. In phase I of the study, the PowerSoil® and PowerPlant® Pro extracts contained low DNA concentrations, amplified poorly, and were not investigated further. Extracts from PowerBiofilm® and UltraClean® Tissue and Cells permutations were further investigated in phase II, and analysis of sequences demonstrated that overall microbial community composition was dictated by coral species and not extraction treatment. Finer pairwise comparisons of sequences obtained from Orbicella faveolata, Orbicella annularis, and Acropora humilis corals revealed subtle differences in community composition between the treatments; PowerBiofilm®-associated sequences generally had higher microbial richness and the highest coverage of dominant microbial groups in comparison to the Ultra

  15. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  16. The first attested extraction of ancient DNA in legumes (Fabaceae

    Directory of Open Access Journals (Sweden)

    Aleksandar M. Mikić

    2015-11-01

    Full Text Available Ancient DNA (aDNA is any DNA extracted from ancient specimens, important for diverse evolutionary researches. The major obstacles in aDNA studies are mutations, contamination and fragmentation. Its studies may be crucial for crop history if integrated with human aDNA research and historical linguistics, both general and relating to agriculture. Legumes (Fabaceae are one of the richest end economically most important plant families, not only from Neolithic onwards, since they were used as food by Neanderthals and Paleolithic modern man. The idea of extracting and analysing legume aDNA was considered beneficial for both basic science and applied research, with an emphasis on genetic resources and plant breeding. The first reported successful and attested extraction of the legume aDNA was done from the sample of charred seeds of pea (Pisum sativum and bitter vetch (Vicia ervilia from Hissar, southeast Serbia, dated to 1,350 - 1,000 Before Christ. A modified version of cetyltrimethylammonium bromide (CTAB method and the commercial kit for DNA extraction QIAGEN DNAesy yielded several ng μl-1 of aDNA of both species and, after the whole genome amplification and with a fragment of nuclear ribosomal DNA gene 26S rDNA, resulted in the detection of the aDNA among the PCR products. A comparative analysis of four informative chloroplast DNA regions (trnSG, trnK, matK and rbcL among the modern wild and cultivated pea taxa demonstrated not only that the extracted aDNA was genuine, on the basis of mutation rate, but also that the ancient Hissar pea was most likely an early domesticated crop, related to the modern wild pea of a neighbouring region. It is anticipated that this premier extraction of legume aDNA may provide taxonomists with the answers to diverse questions, such as leaf development in legumes, as well as with novel data on the single steps in domesticating legume crops worldwide.

  17. DNA extraction from benthic Cyanobacteria: comparative assessment and optimization.

    Science.gov (United States)

    Gaget, V; Keulen, A; Lau, M; Monis, P; Brookes, J D

    2017-01-01

    Benthic Cyanobacteria produce toxic and odorous compounds similar to their planktonic counterparts, challenging the quality of drinking water supplies. The biofilm that benthic algae and other micro-organisms produce is a complex and protective matrix. Monitoring to determine the abundance and identification of Cyanobacteria, therefore, relies on molecular techniques, with the choice of DNA isolation technique critical. This study investigated which DNA extraction method is optimal for DNA recovery in order to guarantee the best DNA yield for PCR-based analysis of benthic Cyanobacteria. The conventional phenol-chloroform extraction method was compared with five commercial kits, with the addition of chemical and physical cell-lysis steps also trialled. The efficacy of the various methods was evaluated by measuring the quantity and quality of DNA by UV spectrophotometry and by quantitative PCR (qPCR) using Cyanobacteria-specific primers. The yield and quality of DNA retrieved with the commercial kits was significantly higher than that of DNA obtained with the phenol-chloroform protocol. Kits including a physical cell-lysis step, such as the MO BIO Power Soil and Biofilm kits, were the most efficient for DNA isolation from benthic Cyanobacteria. These commercial kits allow greater recovery and the elimination of dangerous chemicals for DNA extraction, making them the method of choice for the isolation of DNA from benthic mats. They also facilitate the extraction of DNA from benthic Cyanobacteria, which can help to improve the characterization of Cyanobacteria in environmental studies using qPCRs or population composition analysis using next-generation sequencing. © 2016 The Society for Applied Microbiology.

  18. Evaluation of MolYsis™ Complete5 DNA extraction method for detecting Staphylococcus aureus DNA from whole blood in a sepsis model using PCR/pyrosequencing.

    Science.gov (United States)

    McCann, Chase D; Jordan, Jeanne A

    2014-04-01

    Bacterial bloodstream infections (BSI) and ensuing sepsis are important causes of morbidity and mortality. Early diagnosis and rapid treatment with appropriate antibiotics are vital for improving outcome. Nucleic acid amplification of bacteria directly from whole blood has the potential of providing a faster means of diagnosing BSI than automated blood culture. However, effective DNA extraction of commonly low levels of bacterial target from whole blood is critical for this approach to be successful. This study compared the Molzyme MolYsis™ Complete5 DNA extraction method to a previously described organic bead-based method for use with whole blood. A well-characterized Staphylococcus aureus-induced pneumonia model of sepsis in canines was used to provide clinically relevant whole blood samples. DNA extracts were assessed for purity and concentration and analyzed for bacterial rRNA gene targets using PCR and sequence-based identification. Both extraction methods yielded relatively pure DNA with median A260/280 absorbance ratios of 1.71 (MolYsis™) and 1.97 (bead-based). The organic bead-based extraction method yielded significantly higher average DNA concentrations (Pcell (WBC) concentrations during this same time period, while DNA concentrations of the MolYsis™ extracts closely mirrored quantitative blood culture results. Overall, S. aureus DNA was detected from whole blood samples in 70.7% (58/82) of MolYsis™ DNA extracts, and in 59.8% (49/82) of organic bead-based extracts, with peak detection rates seen at 48h for both MolYsis™ (87.0%) and organic bead-based (82.6%) methods. In summary, the MolYsis™ Complete5 DNA extraction kit proved to be the more effective method for isolating bacterial DNA directly from extracts made from whole blood. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Nondestructive DNA extraction from blackflies (Diptera: Simuliidae): retaining voucher specimens for DNA barcoding projects.

    Science.gov (United States)

    Hunter, Stephanie J; Goodall, Tim I; Walsh, Kerry A; Owen, Richard; Day, John C

    2008-01-01

    A nondestructive, chemical-free method is presented for the extraction of DNA from small insects. Blackflies were submerged in sterile, distilled water and sonicated for varying lengths of time to provide DNA which was assessed in terms of quantity, purity and amplification efficiency. A verified DNA barcode was produced from DNA extracted from blackfly larvae, pupae and adult specimens. A 60-second sonication period was found to release the highest quality and quantity of DNA although the amplification efficiency was found to be similar regardless of sonication time. Overall, a 66% amplification efficiency was observed. Examination of post-sonicated material confirmed retention of morphological characters. Sonication was found to be a reliable DNA extraction approach for barcoding, providing sufficient quality template for polymerase chain reaction amplification as well as retaining the voucher specimen for post-barcoding morphological evaluation. © 2007 The Authors.

  20. High-throughput DNA extraction of forensic adhesive tapes.

    Science.gov (United States)

    Forsberg, Christina; Jansson, Linda; Ansell, Ricky; Hedman, Johannes

    2016-09-01

    Tape-lifting has since its introduction in the early 2000's become a well-established sampling method in forensic DNA analysis. Sampling is quick and straightforward while the following DNA extraction is more challenging due to the "stickiness", rigidity and size of the tape. We have developed, validated and implemented a simple and efficient direct lysis DNA extraction protocol for adhesive tapes that requires limited manual labour. The method uses Chelex beads and is applied with SceneSafe FAST tape. This direct lysis protocol provided higher mean DNA yields than PrepFiler Express BTA on Automate Express, although the differences were not significant when using clothes worn in a controlled fashion as reference material (p=0.13 and p=0.34 for T-shirts and button-down shirts, respectively). Through in-house validation we show that the method is fit-for-purpose for application in casework, as it provides high DNA yields and amplifiability, as well as good reproducibility and DNA extract stability. After implementation in casework, the proportion of extracts with DNA concentrations above 0.01ng/μL increased from 71% to 76%. Apart from providing higher DNA yields compared with the previous method, the introduction of the developed direct lysis protocol also reduced the amount of manual labour by half and doubled the potential throughput for tapes at the laboratory. Generally, simplified manual protocols can serve as a cost-effective alternative to sophisticated automation solutions when the aim is to enable high-throughput DNA extraction of complex crime scene samples. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  1. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  2. Multilocus DNA Sequence Comparisons Rapidly Identify Pathogenic Molds

    Science.gov (United States)

    Rakeman, Jennifer L.; Bui, Uyen; LaFe, Karen; Chen, Yi-Ching; Honeycutt, Rhonda J.; Cookson, Brad T.

    2005-01-01

    The increasing incidence of opportunistic fungal infections necessitates rapid and accurate identification of the associated fungi to facilitate optimal patient treatment. Traditional phenotype-based identification methods utilized in clinical laboratories rely on the production and recognition of reproductive structures, making identification difficult or impossible when these structures are not observed. We hypothesized that DNA sequence analysis of multiple loci is useful for rapidly identifying medically important molds. Our study included the analysis of the D1/D2 hypervariable region of the 28S ribosomal gene and the internal transcribed spacer (ITS) regions 1 and 2 of the rRNA operon. Two hundred one strains, including 143 clinical isolates and 58 reference and type strains, representing 43 recognized species and one possible new species, were examined. We generated a phenotypically validated database of 118 diagnostic alleles. DNA length polymorphisms detected among ITS1 and ITS2 PCR products can differentiate 20 of 33 species of molds tested, and ITS DNA sequence analysis permits identification of all species tested. For 42 of 44 species tested, conspecific strains displayed >99% sequence identity at ITS1 and ITS2; sequevars were detected in two species. For all 44 species, identifications by genotypic and traditional phenotypic methods were 100% concordant. Because dendrograms based on ITS sequence analysis are similar in topology to 28S-based trees, we conclude that ITS sequences provide phylogenetically valid information and can be utilized to identify clinically important molds. Additionally, this phenotypically validated database of ITS sequences will be useful for identifying new species of pathogenic molds. PMID:16000456

  3. Rapid genomic DNA changes in allotetraploid fish hybrids.

    Science.gov (United States)

    Wang, J; Ye, L H; Liu, Q Z; Peng, L Y; Liu, W; Yi, X G; Wang, Y D; Xiao, J; Xu, K; Hu, F Z; Ren, L; Tao, M; Zhang, C; Liu, Y; Hong, Y H; Liu, S J

    2015-06-01

    Rapid genomic change has been demonstrated in several allopolyploid plant systems; however, few studies focused on animals. We addressed this issue using an allotetraploid lineage (4nAT) of freshwater fish originally derived from the interspecific hybridization of red crucian carp (Carassius auratus red var., ♀, 2n=100) × common carp (Cyprinus carpio L., ♂, 2n=100). We constructed a bacterial artificial chromosome (BAC) library from allotetraploid hybrids in the 20th generation (F20) and sequenced 14 BAC clones representing a total of 592.126 kb, identified 11 functional genes and estimated the guanine-cytosine content (37.10%) and the proportion of repetitive elements (17.46%). The analysis of intron evolution using nine orthologous genes across a number of selected fish species detected a gain of 39 introns and a loss of 30 introns in the 4nAT lineage. A comparative study based on seven functional genes among 4nAT, diploid F1 hybrids (2nF1) (first generation of hybrids) and their original parents revealed that both hybrid types (2nF1 and 4nAT) not only inherited genomic DNA from their parents, but also demonstrated rapid genomic DNA changes (homoeologous recombination, parental DNA fragments loss and formation of novel genes). However, 4nAT presented more genomic variations compared with their parents than 2nF1. Interestingly, novel gene fragments were found for the iqca1 gene in both hybrid types. This study provided a preliminary genomic characterization of allotetraploid F20 hybrids and revealed evolutionary and functional genomic significance of allopolyploid animals.

  4. Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology

    Directory of Open Access Journals (Sweden)

    Li Li

    2010-01-01

    Full Text Available Abstract Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1 DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2 Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3 Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4 High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research.

  5. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  6. Method optimization for fecal sample collection and fecal DNA extraction.

    Science.gov (United States)

    Mathay, Conny; Hamot, Gael; Henry, Estelle; Georges, Laura; Bellora, Camille; Lebrun, Laura; de Witt, Brian; Ammerlaan, Wim; Buschart, Anna; Wilmes, Paul; Betsou, Fay

    2015-04-01

    This is the third in a series of publications presenting formal method validation for biospecimen processing in the context of accreditation in laboratories and biobanks. We report here optimization of a stool processing protocol validated for fitness-for-purpose in terms of downstream DNA-based analyses. Stool collection was initially optimized in terms of sample input quantity and supernatant volume using canine stool. Three DNA extraction methods (PerkinElmer MSM I®, Norgen Biotek All-In-One®, MoBio PowerMag®) and six collection container types were evaluated with human stool in terms of DNA quantity and quality, DNA yield, and its reproducibility by spectrophotometry, spectrofluorometry, and quantitative PCR, DNA purity, SPUD assay, and 16S rRNA gene sequence-based taxonomic signatures. The optimal MSM I protocol involves a 0.2 g stool sample and 1000 μL supernatant. The MSM I extraction was superior in terms of DNA quantity and quality when compared to the other two methods tested. Optimal results were obtained with plain Sarstedt tubes (without stabilizer, requiring immediate freezing and storage at -20°C or -80°C) and Genotek tubes (with stabilizer and RT storage) in terms of DNA yields (total, human, bacterial, and double-stranded) according to spectrophotometry and spectrofluorometry, with low yield variability and good DNA purity. No inhibitors were identified at 25 ng/μL. The protocol was reproducible in terms of DNA yield among different stool aliquots. We validated a stool collection method suitable for downstream DNA metagenomic analysis. DNA extraction with the MSM I method using Genotek tubes was considered optimal, with simple logistics in terms of collection and shipment and offers the possibility of automation. Laboratories and biobanks should ensure protocol conditions are systematically recorded in the scope of accreditation.

  7. Comparison of three genomic DNA extraction methods to obtain high DNA quality from maize.

    Science.gov (United States)

    Abdel-Latif, Amani; Osman, Gamal

    2017-01-01

    The world's top three cereals, based on their monetary value, are rice, wheat, and corn. In cereal crops, DNA extraction is difficult owing to rigid non-cellulose components in the cell wall of leaves and high starch and protein content in grains. The advanced techniques in molecular biology require pure and quick extraction of DNA. The majority of existing DNA extraction methods rely on long incubation and multiple precipitations or commercially available kits to produce contaminant-free high molecular weight DNA. In this study, we compared three different methods used for the isolation of high-quality genomic DNA from the grains of cereal crop, Zea mays, with minor modifications. The DNA from the grains of two maize hybrids, M10 and M321, was extracted using extraction methods DNeasy Qiagen Plant Mini Kit, CTAB-method (with/without 1% PVP) and modified Mericon extraction. Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain codes for 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS regions show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this study, the genomic DNA was then amplified with PCR using primers specific for ITS gene. PCR products were then visualized on agarose gel. The modified Mericon extraction method was found to be the most efficient DNA extraction method, capable to provide high DNA yields with better quality, affordable cost and less time.

  8. DNA extractions from deep subseafloor sediments: novel cryogenic-mill-based procedure and comparison to existing protocols.

    Science.gov (United States)

    Alain, Karine; Callac, Nolwenn; Ciobanu, Maria-Cristina; Reynaud, Yann; Duthoit, Frédérique; Jebbar, Mohamed

    2011-12-01

    Extracting DNA from deep subsurface sediments is challenging given the complexity of sediments types, low biomasses, resting structures (spores, cysts) frequently encountered in deep sediments, and the potential presence of enzymatic inhibitors. Promising results for cell lysis efficiency were recently obtained by use of a cryogenic mill (Lipp et al., 2008). These findings encouraged us to devise a DNA extraction protocol using this tool. Thirteen procedures involving a combination of grinding in liquid nitrogen (for various durations and beating rates) with different chemical solutions (phenol, chloroform, SDS, sarkosyl, proteinase, GTC), or with use of DNA recovery kits (MagExtractor®) were compared. Effective DNA extraction was evaluated in terms of cell lysis efficiency, DNA extraction efficiency, DNA yield and determination of prokaryotic diversity. Results were compared to those obtained by standard protocols: the FastDNA®SPIN kit for soil and the Zhou protocol. For most sediment types grinding in a cryogenic mill at a low beating rate in combination with direct phenol-chloroform extraction resulted in much higher DNA yields than those obtained using classical procedures. In general (except for clay-rich sediments), this procedure provided high-quality crude extracts for direct downstream nested-PCR, from cell numbers as low as 1.1×10(6) cells/cm(3). This procedure is simple, rapid, low-cost, and could be used with minor modifications for large-scale DNA extractions for a variety of experimental goals. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Evaluation of Filtration and DNA Extraction Methods for Environmental DNA Biodiversity Assessments across Multiple Trophic Levels

    Directory of Open Access Journals (Sweden)

    Anni Djurhuus

    2017-10-01

    Full Text Available Metabarcoding of marine environmental DNA (eDNA, originating from tissue, cells, or extracellular DNA, offers the opportunity to survey the biological composition of communities across multiple trophic levels from a non-invasive seawater sample. Here we compare results of eDNA metabarcoding of multiple trophic levels from individual seawater samples collected from a kelp forest in Monterey Bay, California in order to establish methods for future cross-trophic level eDNA analysis. Triplicate 1 L water samples were filtered using five different 47 mm diameter membrane filters (PVDF, PES, GFF, PCTE, and NC and DNA was extracted from triplicates of each filter-type using three widely-used extraction methods (the DNeasy Blood and Tissue kit, the MoBio PowerWater DNA Isolation kit, and standard phenol/chloroform methods resulting in 45 individual eDNA samples prepared with 15 workflow combinations. Each DNA extract was amplified using PCR primers for the 16S rRNA gene (microorganisms; Bacteria and Archaea, 18S rRNA gene (phytoplankton, and the 12S rRNA gene (vertebrates, and PCR products were sequenced on an Illumina MiSeq platform. The richness and community composition of microbial, phytoplankton, and vertebrate OTUs were not significantly different between any of the 0.2 μm pore-size filter types extracted with the DNeasy or MoBio kits. However, phenol/chloroform extraction resulted in significantly different community structures. This study provides insight into multiple choices for extraction and filtration methods to use eDNA metabarcoding for biodiversity assessment of multiple trophic levels from a single sample. We recommend any combination of either DNeasy or MoBio with PES, PCTE, PVDF, or NC filters for a cross trophic level comparison.

  10. A Modified SDS-Based DNA Extraction Method for High Quality Environmental DNA from Seafloor Environments

    OpenAIRE

    Natarajan, Vengadesh Perumal; Zhang, Xinxu; Morono, Yuki; Inagaki, Fumio; Wang, Fengping

    2016-01-01

    Recovering high quality genomic DNA from environmental samples is a crucial primary step to understand the genetic, metabolic, and evolutionary characteristics of microbial communities through molecular ecological approaches. However, it is often challenging because of the difficulty of effective cell lysis without fragmenting the genomic DNA. This work aims to improve the previous SDS-based DNA extraction methods for high-biomass seafloor samples, such as pelagic sediments and metal sulfide ...

  11. Rapid Purification of Salmonella DNA in Minced Meat and Detection by Real-time PCR

    DEFF Research Database (Denmark)

    Jenikova, G.; Jensen, Annette Nygaard; Demnerova, K.

    2001-01-01

    of DNeasy was found to be 6-8 CFU in just 19 end-point fluorescence (C-t) values, while this was 22 C-t for a combination of DNeasy and BactXtractor. Extraction by DNeasy resulted in C-t cells per 25 g, when the samples were inoculated with Salmonella......Four rapid and simple DNA purification and sample treatment protocols were evaluated for detection of Salmonella enterica in spiked minced meat, using a fluorogenic 5' nuclease (TaqMan) PCR assay in an ABI-Prism 7700 Sequence Detector. The detection limit with the single separation treatment...... before the overnight preenrichment. The method is currently being adapted to a BioRobot 3000 platform. However, the use of paramagnetic beads (DNA Direct) resulted in poor and variable detection limit....

  12. Suitability of various DNA extraction methods for a traditional Chinese paocai system.

    Science.gov (United States)

    Zhao, Nan; Cai, Jialiang; Zhang, Chuchu; Guo, Zhuang; Lu, Wenwei; Yang, Bo; Tian, Feng-Wei; Liu, Xiao-Ming; Zhang, Hao; Chen, Wei

    2017-09-03

    Traditional paocai brine (PB), which is continuously propagated by back-slopping and contains various species of lactic acid bacteria (LAB), is critical for the flavor of paocai. Culture-independent approaches are commonly used to investigate the microbial communities of fermented food. To evaluate the influence of different DNA (DNA) extraction methods on estimates of bacterial community profiles from 4 PBs, the lysis efficiency, DNA yield, purity and denaturing gradient gel electrophoresis (DGGE) profiles of V3 region of a 16S ribosomal ribonucleic acid gene were acquired. The cell lysis pattern of SDS + beads and Lysing matrix E+ beads (methods 3 and 4) showed higher cell lysis efficiency than SDS and SDS + Lysozyme (methods 1 and 2) in all PBs. SDS + beads obtained the largest DNA yield of the 4 methods. Moreover, methods 3 and 4 resulted in higher H' values and generated more global bacteria profiles than other methods. Overall, our results demonstrate that the properties of PB significantly affect the efficiency of DNA extraction methods. Methods 3 and 4 were both suitable for DNA extraction from PB. Method 3 is more economic, simple and rapid than method 4 for large-scale studies of the bacterial profiles of PB.

  13. A semi-automated protocol for Archaea DNA extraction from stools.

    Science.gov (United States)

    Khelaifia, Saber; Ramonet, Pierre-Yves; Bedotto Buffet, Marielle; Drancourt, Michel

    2013-05-07

    The PCR-based detection of archaea DNA in human specimens relies on efficient DNA extraction. We previously designed one such protocol involving only manual steps. In an effort to reduce the workload involved, we compared this manual protocol to semi-automated and automated protocols for archaea DNA extraction from human specimens. We tested 110 human stool specimens using each protocol. An automated protocol using the EZ1 Advanced XL extractor with the V 1.066069118 Qiagen DNA bacteria card and the EZ1® DNA Tissue Kit (Qiagen, Courtaboeuf, France) yielded 35/110 (32%) positives for the real-time PCR detection of the Methanobrevibacter smithii 16S rRNA gene, with average Ct values of 36.1. A semi-automated protocol combining glass-powder crushing, overnight proteinase K digestion and lysis in the buffer from the EZ1 kit yielded 90/110 (82%) positive specimens (P = 0.001) with an average Ct value of 27.4 (P = 0.001). The manual protocol yielded 100/110 (91%) positive specimens (P = 0.001) with an average Ct value of 30.33 (P = 0.001). However, neither the number of positive specimens nor the Ct values were significantly different between the manual protocol and the semi-automated protocol (P > 0.1 and P > 0.1). Proteinase K digestion and glass powder crushing dramatically increase the extraction yield of archaea DNA from human stools. The semi-automated protocol described here was more rapid than the manual protocol and yielded significantly more archaeal DNA. It could be applied for extracting total stool DNA for further PCR amplification.

  14. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

    2013-01-01

    protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA......Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore...

  15. Standardization of DNA extraction from methanol acetic acid fixed cytogenetic cells of cattle and buffalo.

    Science.gov (United States)

    Kotikalapudi, Rosaiah; Patel, Rajesh K; Katragadda, Sanghamitra

    2013-12-01

    The aim of the study is to standardize the simple method for extracting DNA from cells fixed in fixative (3:1 ratio of methanol and acetic acid glacial) mostly used for chromosomal studies in cattle and buffaloes. These fixed cells were stored for more than 6 months at refrigerated temperature. The fixed cells were washed 2-3 times by the ice cold 1x Phosphate Buffer Saline (PBS) with pH 7.4, so that effect of fixative may be eliminated. The genomic DNA was extracted by adding cell lysis and nucleus lysis buffers. The quality and quantity of DNA were estimated. The readings of nano drop and agarose gel electrophoresis indicate good quality DNA isolated with a rapid and simple protocol routinely using in our laboratory. The method enables us to study the DNA of a cattle and buffaloes after completing cytogenetic investigation or in cases where DNA samples are otherwise not available. This protocol may be useful for molecular analysis of DNA from fixed cells palettes.

  16. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  17. A comparison of DNA extraction methods for high-throughput DNA analyses.

    Science.gov (United States)

    Schiebelhut, Lauren M; Abboud, Sarah S; Gómez Daglio, Liza E; Swift, Holly F; Dawson, Michael N

    2017-07-01

    The inclusion of next-generation sequencing technologies in population genetic and phylogenetic studies has elevated the need to balance time and cost of DNA extraction without compromising DNA quality. We tested eight extraction methods - ranging from low- to high-throughput techniques - and eight phyla: Annelida, Arthropoda, Cnidaria, Chordata, Echinodermata, Mollusca, Ochrophyta and Porifera. We assessed DNA yield, purity, efficacy and cost of each method. Extraction efficacy was quantified using the proportion of successful polymerase chain reaction (PCR) amplification of two molecular markers for metazoans (mitochondrial COI and nuclear histone 3) and one for Ochrophyta (mitochondrial nad6) at four time points - 0.5, 1, 2 and 3 years following extraction. DNA yield and purity were quantified using NanoDrop absorbance ratios. Cost was estimated in terms of time and material expense. Results show differences in DNA yield, purity and PCR success between extraction methods and that performance also varied by taxon. The traditional time-intensive, low-throughput CTAB phenol-chloroform extraction performed well across taxa, but other methods also performed well and provide the opportunity to reduce time spent at the bench and increase throughput. © 2016 John Wiley & Sons Ltd.

  18. Comparison of different methodologies for DNA extraction from Aegla longirostri

    Directory of Open Access Journals (Sweden)

    João Vitor Trindade Bitencourt

    2007-11-01

    Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

  19. Impact of the DNA extraction method on 2-LTR DNA circle recovery from HIV-1 infected cells.

    Science.gov (United States)

    Badralmaa, Yunden; Natarajan, Ven

    2013-10-01

    Detection of episomal 2-LTR DNA circles is used as a marker for the ongoing virus replication in patients infected with HIV-1, and efficient extraction of episomal DNA is critical for accurate estimation of the 2-LTR circles. The impact of different methods of DNA extraction on the recovery of 2-LTR circles was compared using mitochondrial DNA extracted as an internal control. The bacterial plasmid DNA isolation method extracted less than 10% of cellular DNA, 40% of mitochondrial DNA and 12-20% of the input 2-LTR DNA. The total DNA isolation method recovered about 70% of mitochondrial DNA and 45% of the input 2-LTR DNA. The total nucleic acid isolation method recovered 90% of mitochondrial DNA and 60% of the input 2-LTR DNA. Similar results were obtained when the DNA was extracted from HIV-1 infected cells. Plasmid DNA isolation could not distinguish between 12 and 25 copies of 2-LTR DNA per million cells, whereas the total nucleic acid isolation showed a consistent and statistically significant difference between 12 and 25 copies. In conclusion, the total nucleic acid isolation method is more efficient than the plasmid DNA isolation method in recovering mitochondrial DNA and 2-LTR DNA circles from HIV-1 infected cells. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. A facile one-step method for cell lysis and DNA extraction of waterborne pathogens using a microchip.

    Science.gov (United States)

    Kamat, Vivek; Pandey, Sulaxna; Paknikar, Kishore; Bodas, Dhananjay

    2018-01-15

    Globally, waterborne organisms are the primary causative agents for the transmission of various forms of diarrheal diseases. For accurate diagnosis, molecular tools have gained considerable attention in the recent past. Molecular tools require DNA as the starting material for diagnosis, and hence, a prerequisite is the quality and integrity of DNA. To obtain high quality DNA rapidly, we have fabricated a microchip in poly(dimethyl siloxane) (PDMS) by soft lithography process. The microchip facilitated in-flow coating of chitosan on the magnetic nanoparticles, which under external mechanical vibration caused cell lysis and released DNA in the supernatant. The released DNA was captured by the nanoparticles owing to its positive charge (chitosan coating). The magnetic nanoparticle-DNA complex was then isolated from the in-flow matrix using permanent magnet, Further, removal of the cell debris, proteins, and carbohydrates was done using wash buffer. DNA extracted using the microchip was pure with absorbance (260/280) ratio of 1.77±0.04, as compared to 1.79±0.03 obtained by TRIzol method. The complete isolation of the DNA using the microchip took ~ 15min as against>2h with a TRIzol method. Six gram-negative waterborne pathogens were used to demonstrate the efficacy of the microchip based DNA extraction process. The integrity of the isolated DNA was assessed by amplifying the 16S rRNA gene using Com1 and Com2 universal primers. The presence of a band at 407bp on gel electrophoresis confirmed the amplified product. Further, the gel image was used for quantification of the amplified product using ImageJ software. Higher regression values obtained using microchip confirmed better quality and integrity of the extracted DNA as opposed to the conventional method. The lower (integrity of the obtained DNA proved the simplicity, rapidity, and sensitivity of the microchip-assisted DNA extraction process. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  2. Comparison of DNA extraction methods for meat analysis.

    Science.gov (United States)

    Yalçınkaya, Burhanettin; Yumbul, Eylem; Mozioğlu, Erkan; Akgoz, Muslum

    2017-04-15

    Preventing adulteration of meat and meat products with less desirable or objectionable meat species is important not only for economical, religious and health reasons, but also, it is important for fair trade practices, therefore, several methods for identification of meat and meat products have been developed. In the present study, ten different DNA extraction methods, including Tris-EDTA Method, a modified Cetyltrimethylammonium Bromide (CTAB) Method, Alkaline Method, Urea Method, Salt Method, Guanidinium Isothiocyanate (GuSCN) Method, Wizard Method, Qiagen Method, Zymogen Method and Genespin Method were examined to determine their relative effectiveness for extracting DNA from meat samples. The results show that the salt method is easy to perform, inexpensive and environmentally friendly. Additionally, it has the highest yield among all the isolation methods tested. We suggest this method as an alternative method for DNA isolation from meat and meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  4. Evaluation of DNA extraction methods of rumen microbial populations.

    Science.gov (United States)

    Villegas-Rivera, Gabriela; Vargas-Cabrera, Yevani; González-Silva, Napoleón; Aguilera-García, Florentino; Gutiérrez-Vázquez, Ernestina; Bravo-Patiño, Alejandro; Cajero-Juárez, Marcos; Baizabal-Aguirre, Víctor Manuel; Valdez-Alarcón, Juan José

    2013-02-01

    The dynamism of microbial populations in the rumen has been studied with molecular methods that analyze single nucleotide polymorphisms of ribosomal RNA gene fragments (rDNA). Therefore DNA of good quality is needed for this kind of analysis. In this work we report the evaluation of four DNA extraction protocols (mechanical lysis or chemical lysis with CTAB, ethylxanthogenate or DNAzol(®)) from ruminal fluid. The suitability of two of these protocols (mechanical lysis and DNAzol(®)) was tested on single-strand conformation polymorphism (SSCP) of rDNA of rumen microbial populations. DNAzol(®) was a simple method that rendered good integrity, yield and purity. With this method, subtle changes in protozoan populations were detected in young bulls fed with slightly different formulations of a supplement of multinutritional blocks of molasses and urea. Sequences related to Eudiplodinium maggi and a non-cultured Entodiniomorphid similar to Entodinium caudatum, were related to major fluctuating populations in an SSCP assay.

  5. Rapid quantification of DNA libraries for next-generation sequencing.

    Science.gov (United States)

    Buehler, Bernd; Hogrefe, Holly H; Scott, Graham; Ravi, Harini; Pabón-Peña, Carlos; O'Brien, Scott; Formosa, Rachel; Happe, Scott

    2010-04-01

    The next-generation DNA sequencing workflows require an accurate quantification of the DNA molecules to be sequenced which assures optimal performance of the instrument. Here, we demonstrate the use of qPCR for quantification of DNA libraries used in next-generation sequencing. In addition, we find that qPCR quantification may allow improvements to current NGS workflows, including reducing the amount of library DNA required, increasing the accuracy in quantifying amplifiable DNA, and avoiding amplification bias by reducing or eliminating the need to amplify DNA before sequencing. Copyright 2010. Published by Elsevier Inc.

  6. Comparative evaluation of DNA extraction methods for amplification by qPCR of superficial vs intracellular DNA from Bacillus spores.

    Science.gov (United States)

    Brauge, Thomas; Faille, Christine; Inglebert, Gaëlle; Dubois, Thomas; Morieux, Paul; Slomianny, Christian; Midelet-Bourdin, Graziella

    2018-02-02

    This study was designed to assess the efficiency of eight extraction methods regarding their ability to release superficial (exogenous) and intracellular (endogenous) DNA from B. cereus spores for subsequent analysis by quantitative PCR (qPCR). B. cereus spore suspensions were subjected to both commercial DNA extraction kits and mechanical DNA extraction methods. The spores were observed by transmission electron microscopy to evaluate any damage caused during extraction. The efficiency of both extraction and purification were assessed using a qPCR assay targeting the bclA gene. Most of the extraction methods assessed, except the passage through the French press or the use of the QIAamp DNA Blood Mini kit without 95°C treatment, allowed the amplification of significant amounts of DNA. By using propidium monoazide, which is a photoreactive DNA-binding dye, the presence of non-negligible amounts of amplifiable DNA at the spore surface was highlighted. A further set of extraction assays was then performed on spores previously treated with PMA. The results of this study show that both superficial and intracellular spore DNA can be released by extraction methods to a greater or lesser extent and then further amplified by qPCR. The Precellys extraction allowed the detection of both intracellular and superficial DNA, the DNeasy Blood & Tissue kit the specific detection of intracellular DNA, while the Instagene kit detected only superficial DNA. Of the methods tested in this study, the Precellys extraction was the most efficient in terms of further DNA detection. In order to verify the presence or absence of B. cereus spores in food or on surfaces in the food environment, the use of an efficient extraction method is required, followed by a qPCR analysis on the DNA released. Conversely, in order to quantify the population of Bacillus spores, any superficial DNA must be blocked, e.g. with PMA, prior to intracellular DNA extraction and further amplification. Copyright © 2018

  7. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    Directory of Open Access Journals (Sweden)

    Shirleny Monserrat Sandoval-Arias

    2014-11-01

    Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

  8. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    Energy Technology Data Exchange (ETDEWEB)

    Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

  9. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  10. Interlaboratory evaluation of different extraction and real-time PCR methods for detection of Coxiella burnetii DNA in serum

    NARCIS (Netherlands)

    Tilburg, Jeroen J. H. C.; Melchers, Willem J. G.; Pettersson, Annika M.; Rossen, John W. A.; Hermans, Mirjam H. A.; van Hannen, Erik J.; Nabuurs-Franssen, Marrigje H.; de Vries, Maaike C.; Horrevorts, Alphons M.; Klaassen, Corne H. W.

    2010-01-01

    In the Netherlands, there is an ongoing and unparalleled outbreak of Q fever. Rapid and reliable methods to identify patients infected with Coxiella burnetii, the causative agent of Q fever, are urgently needed. We evaluated the performance of different DNA extraction methods and real-time PCR

  11. Interlaboratory evaluation of different extraction and real-time PCR methods for detection of Coxiella burnetii DNA in serum.

    NARCIS (Netherlands)

    Tilburg, J.J.; Melchers, W.J.G.; Pettersson, A.M.; Rossen, J.W.; Hermans, M.H.; Hannen, E.J.M.; Nabuurs-Franssen, M.H.; Vries, M.C. de; Horrevorts, A.M.; Klaassen, C.H.

    2010-01-01

    In the Netherlands, there is an ongoing and unparalleled outbreak of Q fever. Rapid and reliable methods to identify patients infected with Coxiella burnetii, the causative agent of Q fever, are urgently needed. We evaluated the performance of different DNA extraction methods and real-time PCR

  12. Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood

    Science.gov (United States)

    Vieira, Alexandre R.; Deeley, Kathleen B.; Callahan, Nicholas F.; Noel, Jacqueline B.; Anjomshoaa, Ida; Carricato, Wendy M.; Schulhof, Louise P.; DeSensi, Rebecca S.; Gandhi, Pooja; Resick, Judith M.; Brandon, Carla A.; Rozhon, Christopher; Patir, Asli; Yildirim, Mine; Poletta, Fernando A.; Mereb, Juan C.; Letra, Ariadne; Menezes, Renato; Wendell, Steven; Lopez-Camelo, Jorge S.; Castilla, Eduardo E.; Orioli, Iêda M.; Seymen, Figen; Weyant, Robert J.; Crout, Richard; McNeil, Daniel W.; Modesto, Adriana; Marazita, Mary L.

    2011-01-01

    Caries is a multifactorial disease, and studies aiming to unravel the factors modulating its etiology must consider all known predisposing factors. One major factor is bacterial colonization, and Streptococcus mutans is the main microorganism associated with the initiation of the disease. In our studies, we have access to DNA samples extracted from human saliva and blood. In this report, we tested a real-time PCR assay developed to detect copies of genomic DNA from Streptococcus mutans in 1,424 DNA samples from humans. Our results suggest that we can determine the presence of genomic DNA copies of Streptococcus mutans in both DNA samples from caries-free and caries-affected individuals. However, we were not able to detect the presence of genomic DNA copies of Streptococcus mutans in any DNA samples extracted from peripheral blood, which suggests the assay may not be sensitive enough for this goal. Values of the threshold cycle of the real-time PCR reaction correlate with higher levels of caries experience in children, but this correlation could not be detected for adults. PMID:21731912

  13. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Nucleotide sequence (5′ to 3′). Length product Restriction enzyme Restriction fragment. Las/I-F. ATGATCGTACAAATTGGTCGG. 600 bp. EcoRI. 400 - 200 bp. Las/I-R. GTCATGAAACCGCCATG proper results in the next molecular processes such as. PCR (Neumann et al., 1992; Bahl and Pfenninger,.

  14. Extraction and quantification of phosphorus derived from DNA and lipids in environmental samples.

    Science.gov (United States)

    Paraskova, Julia V; Rydin, Emil; Sjöberg, Per J R

    2013-10-15

    Understanding the flux and turnover of phosphorus (P) in the environment is important due to the key role P plays in eutrophication and in the ambition to find cost-effective measures to mitigate it. Orthophosphate diesters, including DNA and phospholipids (PLs), represent a potentially degradable P pool that could support future primary production and eutrophication. In this study, extraction techniques were optimized and combined with colorimetric determination of extracted P to provide a selective quantification method for DNA-P and PL-P in agricultural soil, sediment and composted manure. The proposed method is rapid and reproducible with an RSD of DNA and PL standards, was over 95% for both DNA and PLs. The method can be used for the determination of the pool size of the two organic P fractions. Results show that DNA-P comprises 3.0% by weight of the total P (TP) content in the studied soil, 10.4% in the sediment and 8.4% in the compost samples. The values for PL-P are 0.5%, 6.0% and 1.7% for soil, sediment and compost, respectively. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  16. Optimization of DNA Extractions from Iron-rich Microbial Mats

    Science.gov (United States)

    Fullerton, H.; Hilton, T. S.; Moyer, C. L.

    2013-12-01

    Iron is the fourth most abundant element in the Earth's crust and is potentially one of the most abundant energy sources on the earth as an electron donor for chemolithoautotrophicgrowth coupled to Fe(II) oxidation. Many microbes have adapted to this energy source. One such bacterial class are the Zetaproteobacteria, which dominate Iron-rich microbial mats at Loihi seamount. Although cell counts are very high (up to 5.3x108 cells/ml), efficient DNA yields are low in comparison. In this study we compared extraction efficiency across different methods and with the addition of various buffers. Regardless of protocol (i.e., kit), the addition of sodium citrate drastically increased the DNA yield. The addition of sodium citrate did not alter community structure as determined by T-RFLP and qPCR. Citrate is a well-known ferric iron chelator and will bind ferrous as well. The chelated iron is then unable to participate in the Fenton reaction and this stops the generation of hydroxyl radicals which in turn can react and degrade the extracted DNA. We have utilized this relationship to allow us to obtain nearly an order of magnitude more microbial community DNA per sample, which should also have implications when processing low biomass samples, e.g., from the deep subsurface.

  17. Comparison of different protocols for the extraction of microbial DNA from reef corals

    NARCIS (Netherlands)

    Santos, H. F.; Carmo, F. L.; Leite, D. C. A.; Jesus, H. E.; De Carvalho Maalouf, P.; Almeida, C.; Soriano, A. U.; Altomari, D.; Suhett, L.; Volaro, V.; Valoni, E.; Francisco, M.; Vieira, J.; Rocha, R.; Sardinha, B. L.; Mendes, L. B.; Joao, R. R.; Lacava, B.; Jesus, R. F.; Sebastian, G.; Pessoa, A.; van Elsas, J. D.; Rezende, R. P.; Pires, D. O.; Duarte, G.; Castro, C. B.; Rosado, A. S.; Peixoto, R. S.

    2012-01-01

    This study aimed to test different protocols for the extraction of microbial DNA from the coral Mussismilia harttii. Four different commercial kits were tested, three of them based on methods for DNA extraction from soil (FastDNA SPIN Kit for soil, MP Bio, PowerSoil DNA Isolation Kit, MoBio, and ZR

  18. Modifying and adapting a plant-based DNA extraction protocol for ...

    African Journals Online (AJOL)

    Modifying and adapting a plant-based DNA extraction protocol for human genomic DNA extraction: a cost effective approach. ... The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method ...

  19. Evaluation of four automated protocols for extraction of DNA from FTA cards.

    Science.gov (United States)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-10-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

  20. Comparisons of direct extraction methods of microbial DNA from different paddy soils

    OpenAIRE

    Islam, Md. Rashedul; Sultana, Tahera; Melvin Joe, M.; Cho, Jang-Cheon; Sa, Tongmin

    2012-01-01

    Molecular analyses for the study of soil microbial communities often depend on the direct extraction of DNA from soils. The present work compares the effectiveness of three different methods of extracting microbial DNA from seven different paddy soils. Comparison among different DNA extraction methods against different paddy soil samples revealed a marked variation in DNA yields from 3.18–20.17 μg DNA/g of dry soil. However, irrespective of the soil samples and extraction methods the DNA frag...

  1. Quality of DNA extracted from saliva samples collected with the Oragene™ DNA self-collection kit

    Directory of Open Access Journals (Sweden)

    Nunes Ana P

    2012-05-01

    Full Text Available Abstract Background Large epidemiological studies in DNA biobanks have increasingly used less invasive methods for obtaining DNA samples, such as saliva collection. Although lower amounts of DNA are obtained as compared with blood collection, this method has been widely used because of its more simple logistics and increased response rate. The present study aimed to verify whether a storage time of 8 months decreases the quality of DNA from collected samples. Methods Saliva samples were collected with an OrageneTM DNA Self-Collection Kit from 4,110 subjects aged 14–15 years. The samples were processed in two aliquots with an 8-month interval between them. Quantitative and qualitative evaluations were carried out in 20% of the samples by spectrophotometry and genotyping. Descriptive analyses and paired t-tests were performed. Results The mean volume of saliva collected was 2.2 mL per subject, yielding on average 184.8 μg DNA per kit. Most samples showed a Ratio of OD differences (RAT between 1.6 and 1.8 in the qualitative evaluation. The evaluation of DNA quality by TaqMan®, High Resolution Melting (HRM, and restriction fragment length polymorphism-PCR (RFLP-PCR showed a rate of success of up to 98% of the samples. The sample store time did not reduce either the quantity or quality of DNA extracted with the Oragene kit. Conclusion The study results showed that a storage period of 8 months at room temperature did not reduce the quality of the DNA obtained. In addition, the use of the Oragene kit during fieldwork in large population-based studies allows for DNA of high quantity and high quality.

  2. Designing easy DNA extraction: Teaching creativity through laboratory practice.

    Science.gov (United States)

    Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

    2017-05-01

    Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  3. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  4. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  5. A comparative study of extraction and purification methods for environmental DNA from soil and sludge samples

    OpenAIRE

    Roh, Changhyun; Villatte, Francois; Kim, Byung-Gee; Schmid, Rolf D.

    2006-01-01

    An important prerequisite for a successful metagenome library construction is an efficient extraction procedure for DNA out of environmental samples. In this study we compared three indirect and four direct extraction methods, including a commercial kit, in terms of DNA yield, purity and time requirement. A special focus was set on methods which are appropriate for the extraction of environmental DNA (eDNA) from very limited sample sizes (0.1 g) to enable a highly parallel approach. Direct ex...

  6. Glycans affect DNA extraction and induce substantial differences in gut metagenomic studies

    OpenAIRE

    Emmanouil Angelakis; Dipankar Bachar; Bernard Henrissat; Fabrice Armougom; Gilles Audoly; Jean-Christophe Lagier; Catherine Robert; Didier Raoult

    2016-01-01

    Exopolysaccharides produced by bacterial species and present in feces are extremely inhibitory to DNA restriction and can cause discrepancies in metagenomic studies. We determined the effects of different DNA extraction methods on the apparent composition of the gut microbiota using Illumina MiSeq deep sequencing technology. DNA was extracted from the stool from an obese female using 10 different methods and the choice of DNA extraction method affected the proportional abundance at the phylum...

  7. Lyophyllization improves the extraction of PCR-quality community DNA from pig faecal samples

    OpenAIRE

    Ruiz, Raquel; Rubio, Luis A.

    2012-01-01

    BACKGROUND. Faeces are increasingly used as sources of DNA for genetic and ecological studies. Although multiple methods to preserve faecal samples prior to DNA extraction have been used (e.g. 70 % or absolute ethanol, freezing at -20ºC or in liquid nitrogen) no information is at present available in the literature on the use of lyophilized faeces. Accordingly, the yield and quality of the community DNA obtained by using four different commercial DNA extraction kits (QIAamp DNA Stool Mini Kit...

  8. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Science.gov (United States)

    Chen, Hong; Rangasamy, Murugesan; Tan, Sek Yee; Wang, Haichuan; Siegfried, Blair D

    2010-08-13

    DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue) at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  9. Sample Preservation, DNA or RNA Extraction and Data Analysis for High-Throughput Phytoplankton Community Sequencing

    Directory of Open Access Journals (Sweden)

    Anita Mäki

    2017-09-01

    Full Text Available Phytoplankton is the basis for aquatic food webs and mirrors the water quality. Conventionally, phytoplankton analysis has been done using time consuming and partly subjective microscopic observations, but next generation sequencing (NGS technologies provide promising potential for rapid automated examination of environmental samples. Because many phytoplankton species have tough cell walls, methods for cell lysis and DNA or RNA isolation need to be efficient to allow unbiased nucleic acid retrieval. Here, we analyzed how two phytoplankton preservation methods, three commercial DNA extraction kits and their improvements, three RNA extraction methods, and two data analysis procedures affected the results of the NGS analysis. A mock community was pooled from phytoplankton species with variation in nucleus size and cell wall hardness. Although the study showed potential for studying Lugol-preserved sample collections, it demonstrated critical challenges in the DNA-based phytoplankton analysis in overall. The 18S rRNA gene sequencing output was highly affected by the variation in the rRNA gene copy numbers per cell, while sample preservation and nucleic acid extraction methods formed another source of variation. At the top, sequence-specific variation in the data quality introduced unexpected bioinformatics bias when the sliding-window method was used for the quality trimming of the Ion Torrent data. While DNA-based analyses did not correlate with biomasses or cell numbers of the mock community, rRNA-based analyses were less affected by different RNA extraction procedures and had better match with the biomasses, dry weight and carbon contents, and are therefore recommended for quantitative phytoplankton analyses.

  10. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Nicole L Podnecky

    Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

  11. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  12. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Science.gov (United States)

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  13. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  14. Rapid response to changing environments during biological invasions: DNA methylation perspectives.

    Science.gov (United States)

    Huang, Xuena; Li, Shiguo; Ni, Ping; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin

    2017-12-01

    Dissecting complex interactions between species and their environments has long been a research hot spot in the fields of ecology and evolutionary biology. The well-recognized Darwinian evolution has well-explained long-term adaptation scenarios; however, "rapid" processes of biological responses to environmental changes remain largely unexplored, particularly molecular mechanisms such as DNA methylation that have recently been proposed to play crucial roles in rapid environmental adaptation. Invasive species, which have capacities to successfully survive rapidly changing environments during biological invasions, provide great opportunities to study molecular mechanisms of rapid environmental adaptation. Here, we used the methylation-sensitive amplified polymorphism (MSAP) technique in an invasive model ascidian, Ciona savignyi, to investigate how species interact with rapidly changing environments at the whole-genome level. We detected quite rapid DNA methylation response: significant changes of DNA methylation frequency and epigenetic differentiation between treatment and control groups occurred only after 1 hr of high-temperature exposure or after 3 hr of low-salinity challenge. In addition, we detected time-dependent hemimethylation changes and increased intragroup epigenetic divergence induced by environmental stresses. Interestingly, we found evidence of DNA methylation resilience, as most stress-induced DNA methylation variation maintained shortly (~48 hr) and quickly returned back to the control levels. Our findings clearly showed that invasive species could rapidly respond to acute environmental changes through DNA methylation modifications, and rapid environmental changes left significant epigenetic signatures at the whole-genome level. All these results provide fundamental background to deeply investigate the contribution of DNA methylation mechanisms to rapid contemporary environmental adaptation. © 2017 John Wiley & Sons Ltd.

  15. Wine yeast molecular typing using a simplified method for simultaneously extracting mtDNA, nuclear DNA and virus dsRNA.

    Science.gov (United States)

    Maqueda, Matilde; Zamora, Emiliano; Rodríguez-Cousiño, Nieves; Ramírez, Manuel

    2010-04-01

    Quick and accurate methods are required for the identification of industrial, environmental, and clinical yeast strains. We propose a rapid method for the simultaneous extraction of yeast mtDNA, nuclear DNA, and virus dsRNA. It is simpler, cheaper, and faster than the previously reported methods. It allows one to choose among a broad range of molecular analysis approaches for yeast typing, avoiding the need to use of several different methods for the separate extraction of each nucleic acid type. The application of this method followed by the combined analysis of mtDNA and dsRNA (ScV-M and W) is a highly attractive option for fast and efficient wine yeast typing.

  16. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Directory of Open Access Journals (Sweden)

    Junya Yamagishi

    Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  17. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Science.gov (United States)

    Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

    2016-01-01

    The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  18. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... Crop improvement facilitated by modern biotechnology has largely been acknowledged as a ... ligases and restriction endonucleases (Sharma et al.,. 2002). The aim of this study is to focus on ... Chokanan mango leaf of different growth stages used in the isolation of DNA. (a) Dark purplish, soft and partially.

  19. Rapid isolation of high molecular weight DNA from single dry ...

    African Journals Online (AJOL)

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  20. Rapid purification of high activity Taq DNA polymerase expressed in ...

    African Journals Online (AJOL)

    A simplified method is described here for the preparation of a thermostable Taq DNA polymerase enzyme from Escherichia coli (E. coli) strain DH5a carrying the pTTQ18 expression vector transformed with the Taq polymerase gene. Standard purifications were done with 1 litre batch cultures of E. coli cells and produced ...

  1. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  2. [Study of DNA extraction methods for testing for genetically modified organisms in soyproducts].

    Science.gov (United States)

    Moriuchi, Rie; Monma, Kimio; Kamata, Kunihiro; Ibe, Akihiro

    2008-01-01

    In order to evaluate three different methods for DNA extraction (CTAB, DNeasy Plant Mini Kit and Wizard DNA Clean-up Resin system), the yields of DNA extracted from soyproducts and the copy numbers of lectin genes amplified by quantitative PCR were compared. Fermented foods, such as miso and nattou, gave poor yields of DNA and low copy numbers with any method. However atsu-age and kinugoshi-tofu gave high-quality results with all methods. Kinako gave a high yield of DNA, but poor amplification. Boiled soybeans and soymilk showed in poor amplification. It is important to choose the appropriate DNA extraction method for each product.

  3. Rapid metal extractability tests from polluted mining soils by ultrasound probe sonication and microwave-assisted extraction systems.

    Science.gov (United States)

    García-Salgado, Sara; Quijano, M Ángeles

    2016-12-01

    Ultrasonic probe sonication (UPS) and microwave-assisted extraction (MAE) were used for rapid single extraction of Cd, Cr, Cu, Ni, Pb, and Zn from soils polluted by former mining activities (Mónica Mine, Bustarviejo, NW Madrid, Spain), using 0.01 mol L-1 calcium chloride (CaCl2), 0.43 mol L-1 acetic acid (CH3COOH), and 0.05 mol L-1 ethylenediaminetetraacetic acid (EDTA) at pH 7 as extracting agents. The optimum extraction conditions by UPS consisted of an extraction time of 2 min for both CaCl2 and EDTA extractions and 15 min for CH3COOH extraction, at 30% ultrasound (US) amplitude, whereas in the case of MAE, they consisted of 5 min at 50 °C for both CaCl2 and EDTA extractions and 15 min at 120 °C for CH3COOH extraction. Extractable concentrations were determined by inductively coupled plasma atomic emission spectrometry (ICP-AES). The proposed methods were compared with a reduced version of the corresponding single extraction procedures proposed by the Standards, Measurements and Testing Programme (SM&T). The results obtained showed a great variability on extraction percentages, depending on the metal, the total concentration level and the soil sample, reaching high values in some areas. However, the correlation analysis showed that total concentration is the most relevant factor for element extractability in these soil samples. From the results obtained, the application of the accelerated extraction procedures, such as MAE and UPS, could be considered a useful approach to evaluate rapidly the extractability of the metals studied.

  4. Microbial DNA extraction from intestinal biopsies is improved by avoiding mechanical cell disruption

    OpenAIRE

    Carbonero, Franck; Nava, Gerardo M.; Benefiel, Ann C.; Greenberg, Eugene; Gaskins, H. Rex

    2011-01-01

    Currently, standard protocols for microbial DNA extraction from intestinal tissues do not exist. We assessed the efficiency of a commercial kit with and without mechanical disruption. Better quality DNA was obtained without mechanical disruption. Thus, it appears that bead-beating is not required for efficient microbial DNA extraction from intestinal biopsies.

  5. Workshop report on the extraction of foetal DNA from maternal plasma

    NARCIS (Netherlands)

    Legler, Tobias J.; Liu, Zhong; Mavrou, Ariadni; Finning, Kirstin; Hromadnikova, Ilona; Galbiati, Silvia; Meaney, Cathy; Hultén, Maj A.; Crea, Francesco; Olsson, Martin L.; Maddocks, Deborah G.; Huang, Dorothy; Fisher, Sylvia Armstrong; Sprenger-Haussels, Markus; Soussan, Aicha Ait; van der Schoot, C. Ellen

    2007-01-01

    OBJECTIVE: Cell free foetal DNA (cff DNA) extracted from maternal plasma is now recognized as a potential source for prenatal diagnosis but the methodology is currently not well standardized. To evaluate different manual and automated DNA extraction methods with a view to developing standards, an

  6. modifying and adapting a plant-based dna extraction protocol for ...

    African Journals Online (AJOL)

    good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell. KEYWORDS: Genomic DNA, Human red blood cells, amplicons. INTRODUCTION. The extraction ...

  7. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    Feb 5, 2014 ... DNA fruit. 4 μl DNA was loaded per lane. (b) Restriction enzymes digestion of Annona senegalensis genomic. DNA. Lanes 1-3: DNA digested with Sau3A. Figure 2. Amplification of purified DNA with SSR-PCR. DNA was purified using the method described. The purified DNA was amplified using SSR-.

  8. A simple, rapid and efficient method for the extraction of genomic ...

    African Journals Online (AJOL)

    The isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including long range PCR, endonuclease restriction digestion, southern blot analysis, and genomic library construction. Many protocols are available for the extraction of DNA from plant material, but obtain it is ...

  9. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Evelio Ángel

    2014-04-01

    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  10. Potential application of superparamagnetic nanoparticles for extraction of bacterial genomic DNA from contaminated food and environmental samples.

    Science.gov (United States)

    Basu, Semanti; Chatterjee, Saptarshi; Bandyopadhyay, Arghya; Sarkar, Keka

    2013-03-15

    Isolation of high-molecular-weight DNA is essential for many molecular biology applications. Owing to the presence of polymerase chain reaction (PCR) inhibitors, there is a scarcity of suitable protocols for PCR-ready DNA extraction from food and natural environments. The conventional chemical methods of DNA extraction are time consuming and laborious and the yield is very low. Thus the aim of this research was to develop a simple, rapid, cost-effective method of genomic DNA extraction from food (milk and fruit juice) and environmental (pond water) samples and to detect bacterial contaminants present in those samples. This approach is efficient for both Gram-positive and Gram-negative bacteria from all the studied samples. Herein super paramagnetic bare iron oxide nanoparticles were implemented for bacterial genomic DNA isolation. The method was also compared to the conventional phenol-chloroform method in the context of quality, quantity and timing process. This method took only half an hour or less to obtain high-molecular-weight purified DNA from minimum bacterial contamination. Additionally, the method was directly compatible to PCR amplification. The problem of availability of suitable generalized methods for DNA isolation from various samples including food and environmental has been solved by a nanobiotechnological approach that may prove to be extremely useful in biotechnological applications. © 2012 Society of Chemical Industry.

  11. Differential conductance as a promising approach for rapid DNA sequencing with nanopore-embedded electrodes

    Science.gov (United States)

    He, Yuhui; Shao, Lubing; Scheicher, Ralph H.; Grigoriev, Anton; Ahuja, Rajeev; Long, Shibing; Ji, Zhuoyu; Yu, Zhaoan; Liu, Ming

    2010-07-01

    We propose an approach for nanopore-based DNA sequencing using characteristic transverse differential conductance. Molecular dynamics and electron transport simulations show that the transverse differential conductance during the translocation of DNA through the nanopore is distinguishable enough for the detection of the base sequence and can withstand electrical noise caused by DNA structure fluctuation. Our findings demonstrate several advantages of the transverse conductance approach, which may lead to important applications in rapid genome sequencing.

  12. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  13. Rapid development of a DNA vaccine for Zika virus.

    Science.gov (United States)

    Dowd, Kimberly A; Ko, Sung-Youl; Morabito, Kaitlyn M; Yang, Eun Sung; Pelc, Rebecca S; DeMaso, Christina R; Castilho, Leda R; Abbink, Peter; Boyd, Michael; Nityanandam, Ramya; Gordon, David N; Gallagher, John Robert; Chen, Xuejun; Todd, John-Paul; Tsybovsky, Yaroslav; Harris, Audray; Huang, Yan-Jang S; Higgs, Stephen; Vanlandingham, Dana L; Andersen, Hanne; Lewis, Mark G; De La Barrera, Rafael; Eckels, Kenneth H; Jarman, Richard G; Nason, Martha C; Barouch, Dan H; Roederer, Mario; Kong, Wing-Pui; Mascola, John R; Pierson, Theodore C; Graham, Barney S

    2016-10-14

    Zika virus (ZIKV) was identified as a cause of congenital disease during the explosive outbreak in the Americas and Caribbean that began in 2015. Because of the ongoing fetal risk from endemic disease and travel-related exposures, a vaccine to prevent viremia in women of childbearing age and their partners is imperative. We found that vaccination with DNA expressing the premembrane and envelope proteins of ZIKV was immunogenic in mice and nonhuman primates, and protection against viremia after ZIKV challenge correlated with serum neutralizing activity. These data not only indicate that DNA vaccination could be a successful approach to protect against ZIKV infection, but also suggest a protective threshold of vaccine-induced neutralizing activity that prevents viremia after acute infection. Copyright © 2016, American Association for the Advancement of Science.

  14. DNA, RNA, and Protein Extraction: The Past and The Present

    Directory of Open Access Journals (Sweden)

    Siun Chee Tan

    2009-01-01

    Full Text Available Extraction of DNA, RNA, and protein is the basic method used in molecular biology. These biomolecules can be isolated from any biological material for subsequent downstream processes, analytical, or preparative purposes. In the past, the process of extraction and purification of nucleic acids used to be complicated, time-consuming, labor-intensive, and limited in terms of overall throughput. Currently, there are many specialized methods that can be used to extract pure biomolecules, such as solution-based and column-based protocols. Manual method has certainly come a long way over time with various commercial offerings which included complete kits containing most of the components needed to isolate nucleic acid, but most of them require repeated centrifugation steps, followed by removal of supernatants depending on the type of specimen and additional mechanical treatment. Automated systems designed for medium-to-large laboratories have grown in demand over recent years. It is an alternative to labor-intensive manual methods. The technology should allow a high throughput of samples; the yield, purity, reproducibility, and scalability of the biomolecules as well as the speed, accuracy, and reliability of the assay should be maximal, while minimizing the risk of cross-contamination.

  15. Extraction Strategy for DNA Recovery from Putrefied Teeth and Skull Bone

    Directory of Open Access Journals (Sweden)

    Arwa Kamoun

    2016-12-01

    Full Text Available Forensic samples are commonly exposed to harsh environmental conditions which affect the degree of sample (DNA preservation and subsequent genetic profiling. The aim of this study was to develop a better strategy for DNA extraction from hard putrefied tissues (Teeth and Skull bone. Jaw (teeth and the skull samples were collected from the putrefied corpses and the authors were asked to determine if the two specimens belonged to the same body. The DNA was extracted by phenol-chloroform and DNA IQ™ System Kit. The PowerPlex®  16 and the PowerPlex® Y System Kits were used for autosomal STR and Y-STR genotyping, respectively. DNA profiling found evidence in favor of DNA degradation. Phenol-Chloroform extracted-DNA was re-extracted by using DNA IQ ™ System kit and managed to identify 13 autosomal STR loci and 13 Y-STR markers from doubly extracted DNA. In conclusion, the combination of two DNA extraction methods (phenol-chloroform + DNA IQ™ improved the quality of DNA extracted from putrefied teeth and skull bone.

  16. A simple and efficient method for extraction of genomic DNA from ...

    African Journals Online (AJOL)

    SERVER

    2008-04-17

    Apr 17, 2008 ... DNA extraction in many plants is difficult because of metabolites that interfere with DNA isolation procedures and subsequent applications, such as DNA restriction, amplification and cloning. We have developed a reliable and efficient method for isolating genomic DNA free from polysaccharide,.

  17. A simple and efficient method for extraction of genomic DNA from ...

    African Journals Online (AJOL)

    DNA extraction in many plants is difficult because of metabolites that interfere with DNA isolation procedures and subsequent applications, such as DNA restriction, amplification and cloning. We have developed a reliable and efficient method for isolating genomic DNA free from polysaccharide, polyphenols and protein ...

  18. Comparison of different protocols for the extraction of microbial DNA from reef corals

    Science.gov (United States)

    Santos, H.F.; Carmo, F.L.; Leite, D.C.A.; Jesus, H.E.; Maalouf, P. De Carvalho; Almeida, C.; Soriano, A.U.; Altomari, D.; Suhett, L.; Vólaro, V.; Valoni, E.; Francisco, M.; Vieira, J.; Rocha, R.; Sardinha, B.L.; Mendes, L.B.; João, R.R.; Lacava, B.; Jesus, R.F.; Sebastian, G.V.; Pessoa, A.; van Elsas, J.D.; Rezende, R.P.; Pires, D.O.; Duarte, G.; Castro, C.B.; Rosado, A.S.; Peixoto, R.S.

    2012-01-01

    This study aimed to test different protocols for the extraction of microbial DNA from the coral Mussismilia harttii. Four different commercial kits were tested, three of them based on methods for DNA extraction from soil (FastDNA SPIN Kit for soil, MP Bio, PowerSoil DNA Isolation Kit, MoBio, and ZR Soil Microbe DNA Kit, Zymo Research) and one kit for DNA extraction from plants (UltraClean Plant DNA Isolation Kit, MoBio). Five polyps of the same colony of M. harttii were macerated and aliquots were submitted to DNA extraction by the different kits. After extraction, the DNA was quantified and PCR-DGGE was used to study the molecular fingerprint of Bacteria and Eukarya. Among the four kits tested, the ZR Soil Microbe DNA Kit was the most efficient with respect to the amount of DNA extracted, yielding about three times more DNA than the other kits. Also, we observed a higher number and intensities of DGGE bands for both Bacteria and Eukarya with the same kit. Considering these results, we suggested that the ZR Soil Microbe DNA Kit is the best adapted for the study of the microbial communities of corals. PMID:24031859

  19. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...... in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......-Cloroform-Isoamyl alcohol, NucliSENS® magnetic extraction kit, and DNeasy® Blood & Tissue kit. Integrity, purity, and amount of amplifiable DNA were evaluated. The results show that the DNeasy® Blood & Tissue kit is the best extraction method evaluated because it provided the most pure, intact, and amplifiable DNA. However...

  20. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  1. Rapid new methods for paint collection and lead extraction.

    Science.gov (United States)

    Gutknecht, William F; Harper, Sharon L; Winstead, Wayne; Sorrell, Kristen; Binstock, David A; Salmons, Cynthia A; Haas, Curtis; McCombs, Michelle; Studabaker, William; Wall, Constance V; Moore, Curtis

    2009-01-01

    Chronic exposure of children to lead can result in permanent physiological impairment. In adults, it can cause irritability, poor muscle coordination, and nerve damage to the sense organs and nerves controlling the body. Surfaces coated with lead-containing paints are potential sources of exposure to lead. In April 2008, the U.S. Environmental Protection Agency (EPA) finalized new requirements that would reduce exposure to lead hazards created by renovation, repair, and painting activities, which disturb lead-based paint. On-site, inexpensive identification of lead-based paint is required. Two steps have been taken to meet this challenge. First, this paper presents a new, highly efficient method for paint collection that is based on the use of a modified wood drill bit. Second, this paper presents a novel, one-step approach for quantitatively grinding and extracting lead from paint samples for subsequent lead determination. This latter method is based on the use of a high-revolutions per minute rotor with stator to break up the paint into approximately 50 micron-size particles. Nitric acid (25%, v/v) is used to extract the lead in 95% for real-world paints, National Institute of Standards and Technology's standard reference materials, and audit samples from the American Industrial Hygiene Association's Environmental Lead Proficiency Analytical Testing Program. This quantitative extraction procedure, when paired with quantitative paint sample collection and lead determination, may enable the development of a lead paint test kit that will meet the specifications of the final EPA rule.

  2. Rapid Electrokinetic Isolation of Cancer-Related Circulating Cell-Free DNA Directly from Blood

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y.; Rassenti, Laura; Ghia, Emanuela M.; Skowronski, Elaine A.; Manouchehri, Sareh; McCanna, James; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

    2014-01-01

    BACKGROUND Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a “liquid biopsy” may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. METHODS We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification,PCR,and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. RESULTS PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15–20 mL blood. CONCLUSIONS Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring. PMID:24270796

  3. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  4. Evaluation of DNA extraction methods for the analysis of microbial community in biological activated carbon.

    Science.gov (United States)

    Zheng, Lu; Gao, Naiyun; Deng, Yang

    2012-01-01

    It is difficult to isolate DNA from biological activated carbon (BAC) samples used in water treatment plants, owing to the scarcity of microorganisms in BAC samples. The aim of this study was to identify DNA extraction methods suitable for a long-term, comprehensive ecological analysis of BAC microbial communities. To identify a procedure that can produce high molecular weight DNA, maximizes detectable diversity and is relatively free from contaminants, the microwave extraction method, the cetyltrimethylammonium bromide (CTAB) extraction method, a commercial DNA extraction kit, and the ultrasonic extraction method were used for the extraction of DNA from BAC samples. Spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR)-restriction fragment length polymorphisms (RFLP) analysis were conducted to compare the yield and quality of DNA obtained using these methods. The results showed that the CTAB method produce the highest yield and genetic diversity of DNA from BAC samples, but DNA purity was slightly less than that obtained with the DNA extraction-kit method. This study provides a theoretical basis for establishing and selecting DNA extraction methods for BAC samples.

  5. Rapid electrokinetic isolation of cancer-related circulating cell-free DNA directly from blood.

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y; Rassenti, Laura; Ghia, Emanuela M; Skowronski, Elaine A; Manouchehri, Sareh; McCanna, James; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

    2014-03-01

    Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a "liquid biopsy" may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification, PCR, and DNA sequencing. The complete process, blood to PCR, required B-cell clone, and then sequenced. PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15-20 mL blood. Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring.

  6. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  7. Electromembrane extraction as a rapid and selective miniaturized sample preparation technique for biological fluids

    DEFF Research Database (Denmark)

    Gjelstad, Astrid; Pedersen-Bjergaard, Stig; Seip, Knut Fredrik

    2015-01-01

    of organic solvent, and into an aqueous receiver solution. The extraction is promoted by application of an electrical field, causing electrokinetic migration of the charged analytes. The method has shown to perform excellent clean-up and selectivity from complicated aqueous matrices like biological fluids......This special report discusses the sample preparation method electromembrane extraction, which was introduced in 2006 as a rapid and selective miniaturized extraction method. The extraction principle is based on isolation of charged analytes extracted from an aqueous sample, across a thin film...

  8. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

    2015-01-01

    ) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

  9. DNA Extraction and Amplification from Contemporary Polynesian Bark-Cloth

    Science.gov (United States)

    Moncada, Ximena; Payacán, Claudia; Arriaza, Francisco; Lobos, Sergio; Seelenfreund, Daniela; Seelenfreund, Andrea

    2013-01-01

    Background Paper mulberry has been used for thousands of years in Asia and Oceania for making paper and bark-cloth, respectively. Museums around the world hold valuable collections of Polynesian bark-cloth. Genetic analysis of the plant fibers from which the textiles were made may answer a number of questions of interest related to provenance, authenticity or species used in the manufacture of these textiles. Recovery of nucleic acids from paper mulberry bark-cloth has not been reported before. Methodology We describe a simple method for the extraction of PCR-amplifiable DNA from small samples of contemporary Polynesian bark-cloth (tapa) using two types of nuclear markers. We report the amplification of about 300 bp sequences of the ITS1 region and of a microsatellite marker. Conclusions Sufficient DNA was retrieved from all bark-cloth samples to permit successful PCR amplification. This method shows a means of obtaining useful genetic information from modern bark-cloth samples and opens perspectives for the analyses of small fragments derived from ethnographic materials. PMID:23437166

  10. Furuncular myiasis: a simple and rapid method for extraction of intact Dermatobia hominis larvae.

    Science.gov (United States)

    Boggild, Andrea K; Keystone, Jay S; Kain, Kevin C

    2002-08-01

    We report a case of furuncular myiasis complicated by Staphylococcus aureus infection and beta-hemolytic streptococcal cellulitis. The Dermatobia hominis larva that caused this lesion could not be extracted using standard methods, including suffocation and application of lateral pressure, and surgery was contraindicated because of cellulitis. The botfly maggot was completely and rapidly extracted with an inexpensive, disposable, commercial venom extractor.

  11. Rapid turnover of DnaA at replication origin regions contributes to initiation control of DNA replication.

    Science.gov (United States)

    Schenk, Katrin; Hervás, Ana B; Rösch, Thomas C; Eisemann, Marc; Schmitt, Bernhard A; Dahlke, Stephan; Kleine-Borgmann, Luise; Murray, Seán M; Graumann, Peter L

    2017-02-01

    DnaA is a conserved key regulator of replication initiation in bacteria, and is homologous to ORC proteins in archaea and in eukaryotic cells. The ATPase binds to several high affinity binding sites at the origin region and upon an unknown molecular trigger, spreads to several adjacent sites, inducing the formation of a helical super structure leading to initiation of replication. Using FRAP analysis of a functional YFP-DnaA allele in Bacillus subtilis, we show that DnaA is bound to oriC with a half-time of 2.5 seconds. DnaA shows similarly high turnover at the replication machinery, where DnaA is bound to DNA polymerase via YabA. The absence of YabA increases the half time binding of DnaA at oriC, showing that YabA plays a dual role in the regulation of DnaA, as a tether at the replication forks, and as a chaser at origin regions. Likewise, a deletion of soj (encoding a ParA protein) leads to an increase in residence time and to overinitiation, while a mutation in DnaA that leads to lowered initiation frequency, due to a reduced ATPase activity, shows a decreased residence time on binding sites. Finally, our single molecule tracking experiments show that DnaA rapidly moves between chromosomal binding sites, and does not arrest for more than few hundreds of milliseconds. In Escherichia coli, DnaA also shows low residence times in the range of 200 ms and oscillates between spatially opposite chromosome regions in a time frame of one to two seconds, independently of ongoing transcription. Thus, DnaA shows extremely rapid binding turnover on the chromosome including oriC regions in two bacterial species, which is influenced by Soj and YabA proteins in B. subtilis, and is crucial for balanced initiation control, likely preventing fatal premature multimerization and strand opening of DnaA at oriC.

  12. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  13. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  14. [Research advances on DNA extraction methods from peripheral blood mononuclear cells].

    Science.gov (United States)

    Wang, Xiao-Ying; Yu, Chen-Xi

    2014-10-01

    DNA extraction is a basic technology of molecular biology. The purity and the integrality of DNA structure are necessary for different experiments of gene engineering. As commonly used materials in the clinical detection, the fast, efficient isolation and extraction of genomic DNA from peripheral blood mononuclear cells is very important for the inspection and analysis of clinical blood. At present, there are many methods for extracting DNA, such as phenol-chloroform method, salting out method, centrifugal adsorption column chromatography method (artificial methods), magnetic beads (semi-automatic method) and DNA extraction kit. In this article, a brief review of the principle for existing DNA blood extraction method, the specific steps and the assessment of the specific methods briefly are summarized.

  15. Sequential injection analysis with chemiluminescence detection for rapid monitoring of commercial Calendula officinalis extractions.

    Science.gov (United States)

    Hughes, Rachel R; Scown, David; Lenehan, Claire E

    2015-01-01

    Plant extracts containing high levels of antioxidants are desirable due to their reported health benefits. Most techniques capable of determining the antioxidant activity of plant extracts are unsuitable for rapid at-line analysis as they require extensive sample preparation and/or long analysis times. Therefore, analytical techniques capable of real-time or pseudo real-time at-line monitoring of plant extractions, and determination of extraction endpoints, would be useful to manufacturers of antioxidant-rich plant extracts. To develop a reliable method for the rapid at-line extraction monitoring of antioxidants in plant extracts. Calendula officinalis extracts were prepared from dried flowers and analysed for antioxidant activity using sequential injection analysis (SIA) with chemiluminescence (CL) detection. The intensity of CL emission from the reaction of acidic potassium permanganate with antioxidants within the extract was used as the analytical signal. The SIA-CL method was applied to monitor the extraction of C. officinalis over the course of a batch extraction to determine the extraction endpoint. Results were compared with those from ultra high performance liquid chromatography (UHPLC). Pseudo real-time, at-line monitoring showed the level of antioxidants in a batch extract of Calendula officinalis plateaued after 100 min of extraction. These results correlated well with those of an offline UHPLC study. SIA-CL was found to be a suitable method for pseudo real-time monitoring of plant extractions and determination of extraction endpoints with respect to antioxidant concentrations. The method was applied at-line in the manufacturing industry. Copyright © 2015 John Wiley & Sons, Ltd.

  16. Comparison of different methods for extraction and purification of human Papillomavirus (HPV) DNA from serum samples

    Science.gov (United States)

    Azizah, N.; Hashim, U.; Nadzirah, Sh.; Arshad, M. K. Md; Ruslinda, A. R.; Gopinath, Subash C. B.

    2017-03-01

    The affectability and unwavering quality of PCR for indicative and research purposes require effective fair systems of extraction and sanitization of nucleic acids. One of the real impediments of PCR-based tests is the hindrance of the enhancement procedure by substances exhibit in clinical examples. This examination considers distinctive techniques for extraction and cleaning of viral DNA from serum tests in view of recuperation productivity as far as yield of DNA and rate recouped immaculateness of removed DNA, and rate of restraint. The best extraction strategies were the phenol/chloroform strategy and the silica gel extraction methodology for serum tests, individually. Considering DNA immaculateness, extraction technique by utilizing the phenol/chloroform strategy delivered the most tasteful results in serum tests contrasted with the silica gel, separately. The nearness of inhibitors was overcome by all DNA extraction strategies in serum tests, as confirm by semiquantitative PCR enhancement.

  17. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Directory of Open Access Journals (Sweden)

    D.C.A. Leite

    2014-01-01

    Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

  18. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Science.gov (United States)

    Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

    2014-01-01

    Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

  19. [Evaluation outcome of actinobacteria diversity in saline environment influenced by different DNA extraction methods].

    Science.gov (United States)

    Zhang, Jiao; Xia, Zhanfeng; He, Jiangzhou; Sun, Hongzhuan; Zhang, Lili

    2013-07-04

    To evaluate the influence of DNA extraction methods on the actinobacteria diversity analysis in saline environment via 16S rDNA Restriction Fragment Length Polymorphism. CTAB-SDS method, glass bead beating method and repeated freezing and thawing method were used to extract total DNA in soil samples from the Yanqi Salten. The 16S rDNA clone libraries were constructed by using the purified 16S rDNA PCR amplicons to transform the E. coli DH5alpha. The transformants in the library were further analyzed by RFLP. The unique 16S rDNA clones were sequenced and further used for phylogenetic analysis. Different Operational Taxonomic Units (OTU) were obtained from DNA extracts and total 35 OTUs were obtained from CTAB-SDS method, 19 OTUs from galss bead beating method and 14 OTUs from repeated freezing and thawing methods. Up to 52% OTUs in the three libraries constructed displayed lower similarity with the published sequence, perhaps representing novel taxons. The total OTUs belong to Actinobacteridae, Acidimicrobidae and Rubrobacteridae subclasses. DNA extraction methods influence the actinobacterial diversity. Each of the DNA extraction method in our study has some drawbacks and biases, so it is better to use combined DNA extracts from different DNA methods to evaluate the microbial diversity in salty environments.

  20. Carrier molecules and extraction of circulating tumor DNA for next generation sequencing in colorectal cancer.

    Science.gov (United States)

    Beránek, Martin; Sirák, Igor; Vošmik, Milan; Petera, Jiří; Drastíková, Monika; Palička, Vladimír

    The aims of the study were: i) to compare circulating tumor DNA (ctDNA) yields obtained by different manual extraction procedures, ii) to evaluate the addition of various carrier molecules into the plasma to improve ctDNA extraction recovery, and iii) to use next generation sequencing (NGS) technology to analyze KRAS, BRAF, and NRAS somatic mutations in ctDNA from patients with metastatic colorectal cancer. Venous blood was obtained from patients who suffered from metastatic colorectal carcinoma. For plasma ctDNA extraction, the following carriers were tested: carrier RNA, polyadenylic acid, glycogen, linear acrylamide, yeast tRNA, salmon sperm DNA, and herring sperm DNA. Each extract was characterized by quantitative real-time PCR and next generation sequencing. The addition of polyadenylic acid had a significant positive effect on the amount of ctDNA eluted. The sequencing data revealed five cases of ctDNA mutated in KRAS and one patient with a BRAF mutation. An agreement of 86% was found between tumor tissues and ctDNA. Testing somatic mutations in ctDNA seems to be a promising tool to monitor dynamically changing genotypes of tumor cells circulating in the body. The optimized process of ctDNA extraction should help to obtain more reliable sequencing data in patients with metastatic colorectal cancer.

  1. The critical role of DNA extraction for detection of mycobacteria in tissues.

    Directory of Open Access Journals (Sweden)

    Nicolas Radomski

    Full Text Available Nucleic acid-based methods offer promise for both targeted and exploratory investigations of microbes in tissue samples. As the starting material for such studies is a mixture of host and microbial DNA, we have critically evaluated the DNA extraction step to determine the quantitative and qualitative parameters that permit faithful molecular detection of mycobacteria in infected tissue. Specifically, we assessed: 1 tissue disruption procedures; 2 DNA extraction protocols; and 3 inhibition of bacterial PCR by host DNA.Regarding DNA extraction, we found that 1 grinding was not necessary if bead-beating is done, 2 the reference mycobacterial DNA extraction method recovered more pure DNA than commercial spin column kits, 3 lysozyme digestion of 1 hour was sufficient, and 4 repeated steps of phenol:chloroform:isoamyl alcohol offered minimal gain in DNA quality. By artificially mixing mycobacterial DNA with DNA extracted from uninfected mice, we found that bacterial real-time quantitative PCR was only reliable when the quantity of host DNA was < 3 µg in a final volume of 25 µl and the quality was high (260/280 nm ratio = 1.89 ± 0.08. Findings from spiked DNA studies were confirmed using DNA extracted from mice infected with different intracellular pathogens (M. tuberculosis, M. avium subsp. paratuberculosis.Our findings point to the most appropriate methods for extracting DNA from tissue samples for the purpose of detecting and quantifying mycobacteria. These data also inform on the limits of detection for two mycobacterial species and indicate that increasing the sample mass to improve analytic sensitivity comes at the cost of inhibition of PCR by host DNA.

  2. An efficient and rapid DNA minipreparation procedure suitable for PCR/SSR and RAPD analyses in tropical forest tree species

    Directory of Open Access Journals (Sweden)

    Ana Lilia Alzate-Marin

    2009-10-01

    Full Text Available An efficient and rapid DNA minipreparation modified method for frozen samples was developed for five tropical tree species: Copaifera langsdorffii, Hymenaea courbaril, Eugenia uniflora, Tabebuia roseo alba and Cariniana estrellensis. This procedure that dispenses the use of liquid nitrogen, phenol and the addition of proteinase K, is an adaptation of the CTAB-based DNA extraction method. The modifications included the use of PVP to eliminate the polyphenols, only one chloroform-isoamyl alcohol step and the addition of RNase immediately after extraction with chloroform. The yields of the DNA samples ranged from 25.7 to 42.1 µg from 100 mg leaf tissue. The DNA samples extracted by this method were successfully used for PCR (SSR and RAPD analyses in these five and other twelve tropical tree species.Este trabalho teve como objetivo otimizar um protocolo econômico, rápido e eficaz de minipreparação de DNA genômico, para as espécies florestais Copaifera langsdorffii (Óleo de Copaíba, Hymenaea courbaril (Jatobá, Eugenia uniflora (Pitanga, Tabebuia roseo alba (Ipê Branco e Cariniana estrellensis (Jequitibá Branco. Este método é uma adaptação da técnica de extração CTAB de Doyle e Doyle (1990, o qual consiste principalmente na adição de PVP para eliminar polifenoles, somente uma etapa de extração com clorofórmio-álcool isoamílico e a adição da RNase A imediatamente após a extração com clorofórmio. O método também dispensa o uso de nitrogênio líquido, o uso do fenol e a adição de proteinase K. Os DNAs das espécies florestais extraídos apresentaram alto rendimento e boa qualidade, com rendimento de 25.7 a 42.1 µg de DNA a partir de 100 mg de tecido foliar congelado. Com este protocolo, em apenas 1 dia de trabalho, uma pessoa pode completar o isolamento do DNA de aproximadamente 50 amostras de folhas (dependendo da capacidade da centrífuga. O DNA obtido pode ser usado para métodos de análise baseados em PCR (SSR e

  3. Rapid transport of plasmid DNA into the nucleolus via actin depolymerization using the HVJ envelope vector.

    Science.gov (United States)

    Suvanasuthi, Saroj; Tamai, Katsuto; Kaneda, Yasufumi

    2007-01-01

    Although nuclear transport of therapeutic genes is an essential requirement of human gene therapy, factors required for nuclear entry of DNA remain to be elucidated. Non-viral vector systems have led to numerous improvements in the efficiency of delivery of exogenous DNA into cells. However, nuclear transport of plasmid is difficult to achieve. We examined nuclear translocation efficiency of Cy3-labeled plasmid DNA (Cy3-pDNA) delivered by the hemagglutinating virus of Japan envelope (HVJ-E) vector, Lipofectamine or microinjection. We also examined the effect of actin depolymerization on nuclear transport of Cy3-pDNA. Cy3-pDNA reached the nucleus, particularly in the nucleolus, in 30 min after fusion-mediated delivery using the HVJ-E vector, while the DNA was retained in the cytoplasm during the observed period after the delivery by cationic liposomes. HVJ-E treatment transiently depolymerized actin filaments, and acceleration of nucleolar entry of microinjected DNA was achieved when treated with either empty HVJ-E or cytochalasin D, an inhibitor of actin depolymerization, prior to microinjection. These results suggest that plasmid DNA can be transported rapidly from the cytoplasm to the nucleolus when actin filaments are depolymerized. Thus, the HVJ-E vector can accelerate the transport of DNA to the nucleolus by actin depolymerization. Copyright 2006 John Wiley & Sons, Ltd.

  4. Evaluation of rapid protocols for DNA isolation from Cercospora beticola Sacc.

    Directory of Open Access Journals (Sweden)

    Budakov Dragana

    2012-01-01

    Full Text Available The most fungal DNA isolation protocols are designed to obtain high amounts of very pure DNA, requiring large fungal cultures and extraction procedures with many purification steps. Since the PCR does not require high purity DNA, the aim of this investigation was to evaluate three fast and simple fungal DNA isolation protocols for further use in Cercospora PCR based research. The purity and quantity of isolated DNAs were determined spectrophotometrically, electrophoretically and by PCR reaction with universal primers. The amounts of DNA evaluated on agarose gels, isolated by protocols A and C, did not correspond to the spectrophotometrical values, probably due to RNA impurities. In samples isolated by protocol B these impurities were not detected and the DNA concentrations were more similar. Neither protocol eliminated impurities such as carbohydrates and phenol. The average DNA yield of protocol A was 1.04 μg/μl, protocol B 0.88 μg/μl, and protocol C 0.55 μg/μl. The DNA quality most suitable for PCR analysis was obtained by protocol A, where amplification product with universal primers was detected in all DNA samples. The amplification product was detected in 87% of samples isolated by protocol C and in only 60% of samples isolated by protocol B. Although DNA obtained by protocol A had the highest yield and best quality, the isolation protocol C should be also recommended, for it does not require phenol, chlorophorm or liquid nitrogen.

  5. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    Energy Technology Data Exchange (ETDEWEB)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D. (Imperial Cancer Research Fund, South Mimms, (United Kingdom))

    1991-07-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.

  6. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    OpenAIRE

    Bi Yanzhen; Qiao Xianfeng; Hua Zaidong; Zhang Liping; Liu Ximei; Li Li; Hua Wenjun; Xiao Hongwei; Zhou Jingrong; Wei Qingxin; Zheng Xinmin

    2012-01-01

    Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to pr...

  7. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Directory of Open Access Journals (Sweden)

    Hong Chen

    Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  8. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  9. Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus-1 dsDNA in serum.

    Science.gov (United States)

    Cheng, Cheng; Oueslati, Rania; Wu, Jayne; Chen, Jiangang; Eda, Shigetoshi

    2017-06-01

    This work presents a rapid, highly sensitive, low-cost, and specific capacitive DNA sensor for detection of whole genome human herpesvirus-1 DNA. This sensor is capable of direct DNA detection with a response time of 30 s, and it can be used to test standard buffer or serum samples. The sensing approach for DNA detection is based on alternating current (AC) electrokinetics. By applying an inhomogeneous AC electric field on sensor electrodes, positive dielectrophoresis is induced to accelerate DNA hybridization. The same applied AC signal also directly measures the hybridization of target with the probe on the sensor surface. Experiments are conducted to optimize the AC signal, as well as the buffers for probe immobilization and target DNA hybridization. The assay is highly sensitive and specific, with no response to human herpesvirus-2 DNA at 5 ng/mL and a LOD of 1.0 pg/mL (6.5 copies/μL or 10.7 aM) in standard buffer. When testing the double stranded (ds) DNA spiked in human serum samples, the sensor yields a LOD of 20.0 pg/mL (129.5 copies/μL or 0.21 femtomolar (fM)) in neat serum. In this work, the target is whole genome dsDNA, consequently the test can be performed without the use of enzyme or amplification, which considerably simplifies the sensor operation and is highly suitable for point of care disease diagnosis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  11. Two mini-preparation protocols to DNA extraction from plants with ...

    African Journals Online (AJOL)

    Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

  12. Removal of contaminating DNA from commercial nucleic acid extraction kit reagents

    NARCIS (Netherlands)

    Mohammadi, Tamimount; Reesink, Henk W.; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2005-01-01

    Due to contamination of DNA extraction reagents, false-positive results can occur when applying broad-range real-time PCR based on bacterial 16S rDNA. Filtration of the nucleic acid extraction kit reagents with GenElute Maxiprep binding columns was effective in removing this reagent-derived

  13. Effect of Cassia hirsuta (L) extract on DNA profile of some ...

    African Journals Online (AJOL)

    The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

  14. Comparison of DNA extraction methods for sweet corn and processed sweet corns.

    Science.gov (United States)

    Takabatake, Reona; Noritake, Hiromichi; Noguchi, Akio; Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Mano, Junichi; Kitta, Kazumi

    2013-01-01

    DNA was extracted from sweet corn and its processed products using four DNA extraction methods: the CTAB method, the DNeasy Plant Maxi kit, GM Quicker 3, and Genomic-tip 20/G. DNA was successfully extracted from raw sweet corn and baby corn samples using all four methods. Meanwhile, from frozen, canned, and dry pack products, DNA was well extracted using the DNeasy Plant Maxi kit, GM Quicker 3, and Genomic-tip 20/G, but not enough with the CTAB method. The highest yield of DNA was obtained with Genomic-tip 20/G. The degree of degradation of extracted DNA was observed to increase in the order of raw, frozen, canned, dry pack, and baby corn samples. To evaluate the quality of extracted DNA, real-time PCR analyses were conducted using three maize endogenous genes. The DNAs extracted using GM Quicker 3 had high purity, suggesting that GM Quicker 3 would be the most suitable method for DNA extraction from processed sweet corn products.

  15. Comparison of methods to preserve Rheum palmatum (Polygonaceae) for efficient DNA extraction and PCR amplification.

    Science.gov (United States)

    Huang, M; Sun, X J; Zhou, Y; Wang, X M

    2016-08-19

    In this study, we compared the quality of DNA extracted using the modified CTAB method, from Rheum palmatum leaves preserved using fourteen different methods, including ones used commonly in other species: under ultra-cold (-80°C) temperatures, after drying with an absorbent paper, desiccating using a silica gel, drying at 60°C, in 70% ethanol, absolute ethanol, 70% ethanol supplemented with 50 mM EDTA, SDS-DNA extracting solution, nuclear separation buffer, improved NaCl-CTAB solution, TE-buffer, I-solution, or II-solution. DNA extracted from fresh leaves was used as the control. The quality of extracted DNA was evaluated based on the success of PCR amplification of the ITS2 region and a microsatellite marker. DNA was not extracted from samples preserved in the nuclear separation buffer and II-solution. The purities of DNA extracted from leaves preserved in ultra-cold temperatures, 70% ethanol, and 70% ethanol with 50 mM EDTA, and after desiccating using a silica gel and drying were higher, and comparable to the purity of DNA extracted from fresh leaves, than those of leaves preserved using other methods. In the present study, combined with the PCR amplifications, the preservation using ultra-cold temperatures, silica gel desiccation, or drying, and PCR amplification of the extracted DNA can be used for further molecular studies in R. palmatum.

  16. Suitability of the boiling method of DNA extraction in mosquitoes for routine molecular analyses

    Directory of Open Access Journals (Sweden)

    D. K. Sarma

    2014-09-01

    Full Text Available This communication deals with the experience on suitability of the boiling method of DNA extraction from mosquito tissues. The DNA extracted by this method was found, by and large, stable after 30 months of storage. The method is useful for routine molecular entomological applications.

  17. Rapid Solid-Liquid Dynamic Extraction (RSLDE): a New Rapid and Greener Method for Extracting Two Steviol Glycosides (Stevioside and Rebaudioside A) from Stevia Leaves.

    Science.gov (United States)

    Gallo, Monica; Vitulano, Manuela; Andolfi, Anna; DellaGreca, Marina; Conte, Esterina; Ciaravolo, Martina; Naviglio, Daniele

    2017-06-01

    Stevioside and rebaudioside A are the main diterpene glycosides present in the leaves of the Stevia rebaudiana plant, which is used in the production of foods and low-calorie beverages. The difficulties associated with their extraction and purification are currently a problem for the food processing industries. The objective of this study was to develop an effective and economically viable method to obtain a high-quality product while trying to overcome the disadvantages derived from the conventional transformation processes. For this reason, extractions were carried out using a conventional maceration (CM) and a cyclically pressurized extraction known as rapid solid-liquid dynamic extraction (RSLDE) by the Naviglio extractor (NE). After only 20 min of extraction using the NE, a quantity of rebaudioside A and stevioside equal to 1197.8 and 413.6 mg/L was obtained, respectively, while for the CM, the optimum time was 90 min. From the results, it can be stated that the extraction process by NE and its subsequent purification developed in this study is a simple, economical, environmentally friendly method for producing steviol glycosides. Therefore, this method constitutes a valid alternative to conventional extraction by reducing the extraction time and the consumption of toxic solvents and favouring the use of the extracted metabolites as food additives and/or nutraceuticals. As an added value and of local interest, the experiment was carried out on stevia leaves from the Benevento area (Italy), where a high content of rebaudioside A was observed, which exhibits a sweet taste compared to stevioside, which has a significant bitter aftertaste.

  18. Glycans affect DNA extraction and induce substantial differences in gut metagenomic studies.

    Science.gov (United States)

    Angelakis, Emmanouil; Bachar, Dipankar; Henrissat, Bernard; Armougom, Fabrice; Audoly, Gilles; Lagier, Jean-Christophe; Robert, Catherine; Raoult, Didier

    2016-05-18

    Exopolysaccharides produced by bacterial species and present in feces are extremely inhibitory to DNA restriction and can cause discrepancies in metagenomic studies. We determined the effects of different DNA extraction methods on the apparent composition of the gut microbiota using Illumina MiSeq deep sequencing technology. DNA was extracted from the stool from an obese female using 10 different methods and the choice of DNA extraction method affected the proportional abundance at the phylum level, species richness (Chao index, 227 to 2,714) and diversity (non parametric Shannon, 1.37 to 4.4). Moreover DNA was extracted from stools obtained from 83 different individuals by the fastest extraction assay and by an extraction assay that degradated exopolysaccharides. The fastest extraction method was able to detect 68% to 100% genera and 42% to 95% species whereas the glycan degradation extraction method was able to detect 56% to 93% genera and 25% to 87% species. To allow a good liberation of DNA from exopolysaccharides commonly presented in stools, we recommend the mechanical lysis of stools plus glycan degradation, used here for the first time. Caution must be taken in the interpretation of current metagenomic studies, as the efficiency of DNA extraction varies widely among stool samples.

  19. Comparison of three DNA extraction methods for Mycobacterium bovis, Mycobacterium tuberculosis and Mycobacterium avium subsp. avium.

    Science.gov (United States)

    Amaro, A; Duarte, E; Amado, A; Ferronha, H; Botelho, A

    2008-07-01

    To compare three methods for DNA extraction from Mycobacterium bovis, Mycobacterium tuberculosis and Mycobacterium avium subsp. avium. The DNA was extracted from mycobacterial cultures using enzymatic extraction, combined bead beating and enzymatic extraction and cetyltrimethylammonium bromide (CTAB) extraction. The yield and quality of DNA were compared by spectrophotometry, agarose gel electrophoresis, restriction endonuclease analysis and PCR. The combined bead beating and enzymatic extraction method yielded more DNA. However, that method produced some sheared DNA, visible either by agarose gel electrophoresis or by restriction endonuclease analysis. All methods were appropriate for PCR amplification of a 123 bp fragment of IS6110 in M. bovis and M. tuberculosis, and of a 1700 bp fragment of FR300 region in M. avium avium. Combined bead beating and enzymatic extraction method was the most efficient and easy method for extracting DNA from bacteria of the M. tuberculosis complex. The results reveal important differences among the DNA extraction methods for mycobacteria, which are relevant for the success of further downstream molecular analysis.

  20. The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol–chloroform–isoamyl alcohol DNA extraction

    Science.gov (United States)

    Renshaw, Mark A; Olds, Brett P; Jerde, Christopher L; McVeigh, Margaret M; Lodge, David M

    2015-01-01

    Current research targeting filtered macrobial environmental DNA (eDNA) often relies upon cold ambient temperatures at various stages, including the transport of water samples from the field to the laboratory and the storage of water and/or filtered samples in the laboratory. This poses practical limitations for field collections in locations where refrigeration and frozen storage is difficult or where samples must be transported long distances for further processing and screening. This study demonstrates the successful preservation of eDNA at room temperature (20 °C) in two lysis buffers, CTAB and Longmire's, over a 2-week period of time. Moreover, the preserved eDNA samples were seamlessly integrated into a phenol–chloroform–isoamyl alcohol (PCI) DNA extraction protocol. The successful application of the eDNA extraction to multiple filter membrane types suggests the methods evaluated here may be broadly applied in future eDNA research. Our results also suggest that for many kinds of studies recently reported on macrobial eDNA, detection probabilities could have been increased, and at a lower cost, by utilizing the Longmire's preservation buffer with a PCI DNA extraction. PMID:24834966

  1. The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol-chloroform-isoamyl alcohol DNA extraction.

    Science.gov (United States)

    Renshaw, Mark A; Olds, Brett P; Jerde, Christopher L; McVeigh, Margaret M; Lodge, David M

    2015-01-01

    Current research targeting filtered macrobial environmental DNA (eDNA) often relies upon cold ambient temperatures at various stages, including the transport of water samples from the field to the laboratory and the storage of water and/or filtered samples in the laboratory. This poses practical limitations for field collections in locations where refrigeration and frozen storage is difficult or where samples must be transported long distances for further processing and screening. This study demonstrates the successful preservation of eDNA at room temperature (20 °C) in two lysis buffers, CTAB and Longmire's, over a 2-week period of time. Moreover, the preserved eDNA samples were seamlessly integrated into a phenol-chloroform-isoamyl alcohol (PCI) DNA extraction protocol. The successful application of the eDNA extraction to multiple filter membrane types suggests the methods evaluated here may be broadly applied in future eDNA research. Our results also suggest that for many kinds of studies recently reported on macrobial eDNA, detection probabilities could have been increased, and at a lower cost, by utilizing the Longmire's preservation buffer with a PCI DNA extraction. © 2014 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  2. Extraction of cell-free DNA from urine, using polylysine-coated silica particles.

    Science.gov (United States)

    Takano, Sho; Hu, Qingjiang; Amamoto, Takaki; Refinetti, Paulo; Mimori, Koshi; Funatsu, Takashi; Kato, Masaru

    2017-06-01

    DNA analysis is used for a variety of purposes, including disease diagnosis and DNA profiling; this involves extracting DNA from living organisms. In this study, we prepared polycationic silica particles to extract DNA that has the negatively charged phosphate backbone from solution. The coated particles were prepared by mixing conventional silica gel particles and poly-Lys; these particles could efficiently extract 1.3 μg of cell-free DNA from 50 mL of (male) urine. It is expected that these easily prepared particles (just a mixture of two commercially available chemicals) can be used as a noninvasive diagnostic tool for genetic disorders such as cancer, diabetes, and hypertension. Graphical abstract Effective extraction method of cfDNA from urine was developed that used commercially available silica gel particles and poly-Lys.

  3. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

  4. Enhanced method for microbial community DNA extraction and purification from agricultural yellow loess soil.

    Science.gov (United States)

    Kathiravan, Mathur Nadarajan; Gim, Geun Ho; Ryu, Jaewon; Kim, Pyung Il; Lee, Chul Won; Kim, Si Wouk

    2015-11-01

    In this study, novel DNA extraction and purification methods were developed to obtain high-quantity and reliable quality DNA from the microbial community of agricultural yellow loess soil samples. The efficiencies of five different soil DNAextraction protocols were evaluated on the basis of DNA yield, quality and DNA shearing. Our suggested extraction method, which used CTAB, EDTA and cell membrane lytic enzymes in the extraction followed by DNA precipitation using isopropanol, yielded a maximum DNA content of 42.28 ± 5.59 µg/g soil. In addition, among the five different purification protocols, the acid-treated polyvinyl polypyrrolidone (PVPP) spin column purification method yielded high-quality DNA and recovered 91% of DNA from the crude DNA. Spectrophotometry revealed that the ultraviolet A 260/A 230 and A 260/A 280 absorbance ratios of the purified DNA were 1.82 ± 0.03 and 1.94 ± 0.05, respectively. PCR-based 16S rRNA amplification showed clear bands at ~1.5 kb with acid-treated PVPP-purified DNA templates. In conclusion, our suggested extraction and purification protocols can be used to recover high concentration, high purity, and high-molecular-weight DNA from clay and silica-rich agricultural soil samples.

  5. How to Open the Treasure Chest? Optimising DNA Extraction from Herbarium Specimens

    NARCIS (Netherlands)

    Särkinen, T.; Staats, M.; Richardson, J.E.; Cowan, R.S.; Bakker, F.T.

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance

  6. Effective DNA extraction method for fragment analysis using capillary sequencer of the kelp, Saccharina

    OpenAIRE

    Maeda, Takashi; Kawai, Tadashi; NAKAOKA, MASAHIRO; Yotsukura, Norishige

    2013-01-01

    The DNA fragment analysis can become an effective tool to study genetic differences between not only species but also individuals on saccharinan kelp from which the little genetic diversity was reported. This time, extraction methods of suitable DNA for use in the analysis with a capillary sequencer was examined on Saccharina japonica var. diabolica that contains polysaccharide abundantly. When AFLP was performed using genomic DNA extracted by seven different methods: (1) commercial kit, (2) ...

  7. Genomic DNA from rat blood: A comparison of two extraction methods

    OpenAIRE

    Takić Miladinov, D.

    2016-01-01

    In this study, two methods for DNA extraction from fresh rat blood were compared. One is based on the use of cetyltrimethylammonium bromide (CTAB method), while the other one is well-known salting out method. Spectrophotometric analysis was employed to assess yield and purity of isolated DNA, while agarose gel electrophoresis was carried out to evaluate DNA integrity. The results have clearly demonstrated that the extraction method has significantly influenced the quantity and purity of isola...

  8. Optimization of a high-throughput CTAB-based protocol for the extraction of qPCR-grade DNA from rumen fluid, plant and bacterial pure cultures.

    Science.gov (United States)

    Minas, Konstantinos; McEwan, Neil R; Newbold, Charles Jamie; Scott, Karen P

    2011-12-01

    The quality and yield of extracted DNA are critical for the majority of downstream applications in molecular biology. Moreover, molecular techniques such as quantitative real-time PCR (qPCR) are becoming increasingly widespread; thus, validation and cross-laboratory comparison of data require standardization of upstream experimental procedures. DNA extraction methods depend on the type and size of starting material(s) used. As such, the extraction of template DNA is arguably the most significant variable when cross-comparing data from different laboratories. Here, we describe a reliable, inexpensive and rapid method of DNA purification that is equally applicable to small or large scale or high-throughput purification of DNA. The protocol relies on a CTAB-based buffer for cell lysis and further purification of DNA with phenol : chloroform : isoamyl alcohol. The protocol has been used successfully for DNA purification from rumen fluid and plant cells. Moreover, after slight alterations, the same protocol was used for large-scale extraction of DNA from pure cultures of Gram-positive and Gram-negative bacteria. The yield of the DNA obtained with this method exceeded that from the same samples using commercial kits, and the quality was confirmed by successful qPCR applications. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. A rapid direct solvent extraction method for the extraction of 2-dodecylcyclobutanone from irradiated ground beef patties using acetonitrile.

    Science.gov (United States)

    Hijaz, Faraj; Kumar, Amit; Smith, J Scott

    2010-08-01

    The amount of irradiated beef in the U.S. market is growing, and a reliable, rapid method is needed to detect irradiated beef and quantify the irradiation dose. The official analytical method (BS EN 1785 2003) that has been adopted by the European Union is time consuming. The objective of this study was to develop a rapid method for the analysis of 2-dodecylcyclobutanone (2-DCB) in irradiated beef. A 5 g sample of commercially irradiated ground beef patty (90/10) was extracted with n-hexane using a Soxhlet apparatus or with acetonitrile via direct solvent extraction. The Soxhlet hexane extract was evaporated to dryness, and the sample was dissolved in a mixture of ethyl acetate and acetonitrile (1:1). The defatted extract was purified with a 1 g silica cartridge. Another 5 g aliquot of the same patty was mixed with 50 mL acetonitrile and either blended for 1 min with a hand blender or crushed for 10 min with a glass rod. The extraction procedure was repeated 3 times, and the acetonitrile was collected and evaporated to dryness. Eluants from both methods were concentrated under nitrogen and injected into a gas chromatography-mass spectrometry. The 2-DCB concentration in the commercial samples was 0.031 +/- 0.0026 ppm (n = 5) for the Soxhlet method and 0.031 +/- 0.0025 ppm (n = 10) for direct solvent extraction. Recovery of 2-DCB from spiked beef samples in the direct solvent extraction method was 93.2 +/- 9.0% (n = 7). This study showed that the direct solvent extraction method is simple and as efficient and reproducible as the Soxhlet method.

  10. Optimized DNA extraction from neonatal dried blood spots: application in methylome profiling.

    Science.gov (United States)

    Ghantous, Akram; Saffery, Richard; Cros, Marie-Pierre; Ponsonby, Anne-Louise; Hirschfeld, Steven; Kasten, Carol; Dwyer, Terence; Herceg, Zdenko; Hernandez-Vargas, Hector

    2014-07-01

    Neonatal dried blood spots (DBS) represent an inexpensive method for long-term biobanking worldwide and are considered gold mines for research for several human diseases, including those of metabolic, infectious, genetic and epigenetic origin. However, the utility of DBS is restricted by the limited amount and quality of extractable biomolecules (including DNA), especially for genome wide profiling. Degradation of DNA in DBS often occurs during storage and extraction. Moreover, amplifying small quantities of DNA often leads to a bias in subsequent data, particularly in methylome profiles. Thus it is important to develop methodologies that maximize both the yield and quality of DNA from DBS for downstream analyses. Using combinations of in-house-derived and modified commercial extraction kits, we developed a robust and efficient protocol, compatible with methylome studies, many of which require stringent bisulfite conversion steps. Several parameters were tested in a step-wise manner, including blood extraction, cell lysis, protein digestion, and DNA precipitation, purification and elution. DNA quality was assessed based on spectrophotometric measurements, DNA detectability by PCR, and DNA integrity by gel electrophoresis and bioanalyzer analyses. Genome scale Infinium HumanMethylation450 and locus-specific pyrosequencing data generated using the refined DBS extraction protocol were of high quality, reproducible and consistent. This study may prove useful to meet the increased demand for research on prenatal, particularly epigenetic, origins of human diseases and for newborn screening programs, all of which are often based on DNA extracted from DBS.

  11. Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

    Science.gov (United States)

    Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

    2015-12-28

    Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

  12. Microchip-based cell lysis and DNA extraction from sperm cells for application to forensic analysis.

    Science.gov (United States)

    Bienvenue, Joan M; Duncalf, Natalie; Marchiarullo, Daniel; Ferrance, Jerome P; Landers, James P

    2006-03-01

    The current backlog of casework is among the most significant challenges facing crime laboratories at this time. While the development of next-generation microchip-based technology for expedited forensic casework analysis offers one solution to this problem, this will require the adaptation of manual, large-volume, benchtop chemistry to small volume microfluidic devices. Analysis of evidentiary materials from rape kits where semen or sperm cells are commonly found represents a unique set of challenges for on-chip cell lysis and DNA extraction that must be addressed for successful application. The work presented here details the development of a microdevice capable of DNA extraction directly from sperm cells for application to the analysis of sexual assault evidence. A variety of chemical lysing agents are assessed for inclusion in the extraction protocol and a method for DNA purification from sperm cells is described. Suitability of the extracted DNA for short tandem repeat (STR) analysis is assessed and genetic profiles shown. Finally, on-chip cell lysis methods are evaluated, with results from fluorescence visualization of cell rupture and DNA extraction from an integrated cell lysis and purification with subsequent STR amplification presented. A method for on-chip cell lysis and DNA purification is described, with considerations toward inclusion in an integrated microdevice capable of both differential cell sorting and DNA extraction. The results of this work demonstrate the feasibility of incorporating microchip-based cell lysis and DNA extraction into forensic casework analysis.

  13. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  14. Extraction of high-quality DNA from ethanol-preserved tropical plant tissues.

    Science.gov (United States)

    Bressan, Eduardo A; Rossi, Mônica L; Gerald, Lee T S; Figueira, Antonio

    2014-04-24

    Proper conservation of plant samples, especially during remote field collection, is essential to assure quality of extracted DNA. Tropical plant species contain considerable amounts of secondary compounds, such as polysaccharides, phenols, and latex, which affect DNA quality during extraction. The suitability of ethanol (96% v/v) as a preservative solution prior to DNA extraction was evaluated using leaves of Jatropha curcas and other tropical species. Total DNA extracted from leaf samples stored in liquid nitrogen or ethanol from J. curcas and other tropical species (Theobroma cacao, Coffea arabica, Ricinus communis, Saccharum spp., and Solanum lycopersicon) was similar in quality, with high-molecular-weight DNA visualized by gel electrophoresis. DNA quality was confirmed by digestion with EcoRI or HindIII and by amplification of the ribosomal gene internal transcribed spacer region. Leaf tissue of J. curcas was analyzed by light and transmission electron microscopy before and after exposure to ethanol. Our results indicate that leaf samples can be successfully preserved in ethanol for long periods (30 days) as a viable method for fixation and conservation of DNA from leaves. The success of this technique is likely due to reduction or inactivation of secondary metabolites that could contaminate or degrade genomic DNA. Tissue conservation in 96% ethanol represents an attractive low-cost alternative to commonly used methods for preservation of samples for DNA extraction. This technique yields DNA of equivalent quality to that obtained from fresh or frozen tissue.

  15. Development of an efficient protocol for genomic DNA extraction from mango (Mangifera indica

    Directory of Open Access Journals (Sweden)

    MOHAMMAD AHSANUL KABIR

    2011-11-01

    Full Text Available Majumder DAN, Hassan L, Rahim MA, Kabir MA. 2011. Development of an efficient protocol for genomic DNA extraction from mango (Mangifera indica. Nusantara Bioscience 3: 105-111. A simple and efficient method for genomic DNA extraction from woody fruit crops containing high polysaccharide levels has been described here. In the present study, three kinds of plant DNA extraction protocols were studied and the target was to establish the water-saturated ether (WSE with 1.25 M NaCl method as the most efficient protocol for removing the highly concentrated polysaccharides from genomic DNA of woody fruit crops. This method involves the modified CTAB or SDS procedure employing a purification step to remove polysaccharides using the WSE method. Precipitation with an equal volume of isopropanol caused a DNA pellet to form. After being washed with 70% ethyl alcohol, the pellet became easily dissolved in TE buffer. Using these three methods, DNA was extracted from samples of 60 mango genotypes, including young, mature, old, frosted old and withered old leaves. Compared with the three studied DNA extraction protocols of mango, it was found that the WSE method with NaCl had the highest value of average percentage (85.44% in DNA content of the mango genotypes. The average yield of DNA ranged from 5.05 µg/µL to11.28 µg/µL. DNA was suitable for PCR and RAPD analyses and long-term storage for further use.

  16. Engineering split intein DnaE from Nostoc punctiforme for rapid protein purification.

    Science.gov (United States)

    Ramirez, Miguel; Valdes, Najla; Guan, Dongli; Chen, Zhilei

    2013-03-01

    We report the engineering of a DnaE intein able to catalyze rapid C-terminal cleavage in the absence of N-terminal cleavage. A single mutation in DnaE intein from Nostoc punctiforme PCC73102 (NpuDnaE), Asp118Gly, was introduced based on sequence alignment with a previously engineered C-terminal cleaving intein mini-MtuRecA. This mutation was able to both suppress N-terminal cleavage and significantly elevate C-terminal cleavage efficiency. Molecular modeling suggests that in NpuDnaE Asp118 forms a hydrogen bond with the penultimate Asn, preventing its spontaneous cyclization prior to N-terminal cleavage. Mutation of Asp118 to Gly essentially abolishes this restriction leading to subsequent C-terminal cleavage in the absence of N-terminal cleavage. The Gly118 NpuDnaE mutant exhibits rapid thio-dependent C-terminal cleavage kinetics with 80% completion within 3 h at room temperature. We used this newly engineered intein to develop both column-free and chromatography-based protein purification methods utilizing the elastin-like-polypeptide and chitin-binding protein as removable purification tags, respectively. We demonstrate rapid target protein purification to electrophoretic purity at yields up to 84 mg per liter of Escherichia coli culture.

  17. Rapid DNA technologies at the crime scene : ‘CSI’ fiction matching reality

    NARCIS (Netherlands)

    Mapes, A.A.

    2017-01-01

    This thesis describes how mobile Rapid DNA analysis may be implemented as a potential effective tool in modern day law enforcement. It is expected that this technology will affect the role of the forensic institutes and the tasks of professionals in the Criminal Justice System (CJS). The research in

  18. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    , it undermines the assumption of a direct link between the total extracted DNA and the local, currently living microbial assemblages in sediments, in terms of both microbial cell abundance and diversity. Hindered by technical challenges associated with separating eDNA from DNA enclosed in living cells......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  19. Evaluation of antimicrobial activity of selected plant extracts by rapid XTT colorimetry and bacterial enumeration.

    Science.gov (United States)

    Al-Bakri, Amal G; Afifi, Fatma U

    2007-01-01

    The aim of this study was to screen and evaluate the antimicrobial activity of indigenous Jordanian plant extracts, dissolved in dimethylsulfoxide, using the rapid XTT assay and viable count methods. XTT rapid assay was used for the initial screening of antimicrobial activity for the plant extracts. Antimicrobial activity of potentially active plant extracts was further assessed using the "viable plate count" method. Four degrees of antimicrobial activity (high, moderate, weak and inactive) against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa, respectively, were recorded. The plant extracts of Hypericum triquetrifolium, Ballota undulata, Ruta chalepensis, Ononis natrix, Paronychia argentea and Marrubium vulgare had shown promising antimicrobial activity. This study showed that while both XTT and viable count methods are comparable when estimating the overall antimicrobial activity of experimental substances, there is no strong linear correlation between the two methods.

  20. Comparison of ten different DNA extraction procedures with respect to their suitability for environmental samples.

    Science.gov (United States)

    Kuhn, Ramona; Böllmann, Jörg; Krahl, Kathrin; Bryant, Isaac Mbir; Martienssen, Marion

    2017-12-01

    DNA extraction for molecular biological applications usually requires target optimized extraction procedures depending on the origin of the samples. For environmental samples, a range of different procedures has been developed. We compared the applicability and efficiency of ten selected DNA extraction methods published in recent literature using four different environmental samples namely: activated sludge from a domestic wastewater treatment plant, river sediment, anaerobic digestion sludge and nitrifying enrichment culture. We assessed the suitability of the extraction procedures based on both DNA yield and quality. DNA quantification was performed by both ultra violet (UV) spectrophotometry and fluorescence spectrophotometry after staining with PicoGreen. In our study, DNA yields based on UV measurement were overestimated in most cases while DNA yields from fluorescence measurements correlated well with the sample load on agarose gels of crude DNA. The quality of the DNA extracts was determined by gel electrophoresis of crude DNA and PCR products from 16S rDNA with the universal primer set 27f/1525r. It was observed that gel electrophoresis of crude DNA was not always suitable to evaluate DNA integrity and purity since interfering background substances (e.g. humic substances) were not visible. Therefore, we strongly recommend examining the DNA quality of both crude DNA and 16S rDNA PCR products by gel electrophoresis when a new extraction method is established. Summarizing, we found four out of ten extraction procedures being applicable to all tested samples without noticeable restrictions. The procedure G (according to the standard method 432_10401 of the Lower Saxony State Office for Consumer Protection and Food Safety) had the broadest application range over procedure J (published by Wilson, 2001). These were followed by procedures F (Singka et al., 2012) and A (Bourrain et al., 1999). All four extraction procedures delivered reliable and reproducible crude

  1. Evaluation of an automated protocol for efficient and reliable DNA extraction of dietary samples.

    Science.gov (United States)

    Wallinger, Corinna; Staudacher, Karin; Sint, Daniela; Thalinger, Bettina; Oehm, Johannes; Juen, Anita; Traugott, Michael

    2017-08-01

    Molecular techniques have become an important tool to empirically assess feeding interactions. The increased usage of next-generation sequencing approaches has stressed the need of fast DNA extraction that does not compromise DNA quality. Dietary samples here pose a particular challenge, as these demand high-quality DNA extraction procedures for obtaining the minute quantities of short-fragmented food DNA. Automatic high-throughput procedures significantly decrease time and costs and allow for standardization of extracting total DNA. However, these approaches have not yet been evaluated for dietary samples. We tested the efficiency of an automatic DNA extraction platform and a traditional CTAB protocol, employing a variety of dietary samples including invertebrate whole-body extracts as well as invertebrate and vertebrate gut content samples and feces. Extraction efficacy was quantified using the proportions of successful PCR amplifications of both total and prey DNA, and cost was estimated in terms of time and material expense. For extraction of total DNA, the automated platform performed better for both invertebrate and vertebrate samples. This was also true for prey detection in vertebrate samples. For the dietary analysis in invertebrates, there is still room for improvement when using the high-throughput system for optimal DNA yields. Overall, the automated DNA extraction system turned out as a promising alternative to labor-intensive, low-throughput manual extraction methods such as CTAB. It is opening up the opportunity for an extensive use of this cost-efficient and innovative methodology at low contamination risk also in trophic ecology.

  2. Bioaerosol DNA Extraction Technique from Air Filters Collected from Marine and Freshwater Locations

    Science.gov (United States)

    Beckwith, M.; Crandall, S. G.; Barnes, A.; Paytan, A.

    2015-12-01

    Bioaerosols are composed of microorganisms suspended in air. Among these organisms include bacteria, fungi, virus, and protists. Microbes introduced into the atmosphere can drift, primarily by wind, into natural environments different from their point of origin. Although bioaerosols can impact atmospheric dynamics as well as the ecology and biogeochemistry of terrestrial systems, very little is known about the composition of bioaerosols collected from marine and freshwater environments. The first step to determine composition of airborne microbes is to successfully extract environmental DNA from air filters. We asked 1) can DNA be extracted from quartz (SiO2) air filters? and 2) how can we optimize the DNA yield for downstream metagenomic sequencing? Aerosol filters were collected and archived on a weekly basis from aquatic sites (USA, Bermuda, Israel) over the course of 10 years. We successfully extracted DNA from a subsample of ~ 20 filters. We modified a DNA extraction protocol (Qiagen) by adding a beadbeating step to mechanically shear cell walls in order to optimize our DNA product. We quantified our DNA yield using a spectrophotometer (Nanodrop 1000). Results indicate that DNA can indeed be extracted from quartz filters. The additional beadbeating step helped increase our yield - up to twice as much DNA product was obtained compared to when this step was omitted. Moreover, bioaerosol DNA content does vary across time. For instance, the DNA extracted from filters from Lake Tahoe, USA collected near the end of June decreased from 9.9 ng/μL in 2007 to 3.8 ng/μL in 2008. Further next-generation sequencing analysis of our extracted DNA will be performed to determine the composition of these microbes. We will also model the meteorological and chemical factors that are good predictors for microbial composition for our samples over time and space.

  3. Extraction of DNA suitable for PCR applications from mature leaves of Mangifera indica L.*

    OpenAIRE

    Azmat, Muhammad Abubakkar; Khan, Iqrar Ahmad; Cheema,Hafiza Masooma Naseer; Rajwana, Ishtiaq Ahmad; Khan, Ahmad Sattar; Khan, Asif Ali

    2012-01-01

    Good quality deoxyribonucleic acid (DNA) is the pre-requisite for its downstream applications. The presence of high concentrations of polysaccharides, polyphenols, proteins, and other secondary metabolites in mango leaves poses problem in getting good quality DNA fit for polymerase chain reaction (PCR) applications. The problem is exacerbated when DNA is extracted from mature mango leaves. A reliable and modified protocol based on the cetyltrimethylammonium bromide (CTAB) method for DNA extra...

  4. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. [Comparison of mtDNA extracting methods for common sarcosaphagous insects].

    Science.gov (United States)

    Chen, Yao-Qing; Guo, Ya-Dong; Li, Mao-Zhi; Xiong, Feng; Li, Jian-Bo; Cai, Ji-Feng

    2011-08-01

    To compare effects of three different methods for mtDNA extraction from common sarcosaphagous insects including cetyl trimethyl ammonium bromide (CTAB) method, sodium dodecyl sulfate-potassium acetate (SDS-KAc) method and sodium dodecyl sulfate-proteinase K (SDS-PK) method. Seventy-two insects from four species [Chrysomya megacephala (Fabricius, 1784), Eusilpha bicolor (Fairmaire, 1896), Paraeutrichopus pecoudi (Mateu, 1954), Vespa velutina (Lepeletier, 1836)] were collected from the corpses of the rabbits in Changsha district. The total DNA of above samples was extracted by CTAB, SDS-Kac and SDS-PK methods. The purity and concentration of DNA were examined by protein-nucleic acid spectrophotometry, and mtDNA were amplified by specific primers and PCR products were detected by agarose gel electrophoresis. Then PCR products were sequenced and subsequently up-loaded to GenBank. mtDNA was successfully extracted with three methods from most of the samples. The SDS-PK method was better in DNA purity compared to other methods and the CTAB method was superior in extracting DNA from old samples, while SDS-KAc method showed no significant difference for extraction effects of different samples. The most appropriate method should be chosen depending on different situations. SDS-PK method is expected to obtain high-quality DNA, while CTAB method is preferred in extracting obsolete samples. SDS-KAc method is low cost and can be used in various kinds of preliminary experiments.

  6. Comparison of several methods for the extraction of DNA from potatoes and potato-derived products.

    Science.gov (United States)

    Smith, Donna S; Maxwell, Philip W; De Boer, Solke H

    2005-12-28

    Eight methods were compared for the extraction of DNA from raw potato tubers, and nine methods were evaluated for the extraction of DNA from dehydrated potato slices, potato flakes, potato flour, potato starch, and two ready-to-eat potato snack foods. Extracts were assessed for yield using a fluorescence-based DNA quantification assay. Real-time amplification of an endogenous gene, sucrose synthase (sus), was used to assess extract and template quality. A CTAB-based method extracted the highest DNA yields from the tuber material. An in-house method, which utilized the Kingfisher magnetic particle processor, yielded the highest template quality from the tubers. For most of the tuber samples, the Kingfisher and CTAB methods recovered the highest levels of amplifiable sus. DNA yields for potato-derived foods generally decreased with the extent that the product had been processed. The methods that utilized the magnetic particle processor delivered the highest template quality from one of the snack products that was particularly high in fat. For most of the remaining processed products, the levels of amplifiable target DNA recovered were roughly correlated with total DNA recovery, indicating that overall yield had greater influence over sus amplification than template quality. The Wizard method was generally the best method for the extraction of DNA from most of the potato-derived foods.

  7. Comparison of four methods of extracting DNA from D. gallinae (Acari: Dermanyssidae).

    Science.gov (United States)

    Desloire, Sophie; Valiente Moro, Claire; Chauve, Claude; Zenner, Lionel

    2006-01-01

    Dermanyssus gallinae is one of the most serious ectoparasites of poultry and it has been implicated as a vector of several major pathogenic diseases. Molecular detection of such pathogens in mites is crucial and therefore, an important step is the extraction of their DNA from mites. So, we compared four DNA extraction protocols from engorged and unfed individual mites: a conventional method using a Cethyl Trimethyl Ammonium Bromide buffer (CTAB), a Chelex resin, a Qiamp DNA extraction kit and a more recent one filter-based technology (FTA). The DNA samples have been tested for their ability to be amplified by an amplification of a D. gallinae 16S rRNA gene region. The best results were obtained using CTAB and Qiagen methods at the same time with unfed and engorged mites (96% and 100% of amplified samples). FTA produced similar results when using unfed mites but not when processing engorged ones (96% and 70%). Finally, the Chelex method was the least efficient in terms of DNA amplification, especially when applied on engorged individuals (50%). The possible inhibitor role of these Chelex extracted DNA was demonstrated by the means of a PCR control on PUC plasmid. No difference was observed with CTAB, Qiamp DNA extraction kit or FTA methods using DNA extracted one year before.

  8. Genomic DNA from rat blood: A comparison of two extraction methods

    Directory of Open Access Journals (Sweden)

    Takić Miladinov, D.

    2016-09-01

    Full Text Available In this study, two methods for DNA extraction from fresh rat blood were compared. One is based on the use of cetyltrimethylammonium bromide (CTAB method, while the other one is well-known salting out method. Spectrophotometric analysis was employed to assess yield and purity of isolated DNA, while agarose gel electrophoresis was carried out to evaluate DNA integrity. The results have clearly demonstrated that the extraction method has significantly influenced the quantity and purity of isolated DNA. By using the CTAB method, a larger quantity of high-molecular weight DNA with good purity is obtained which, along with timeand cost-efficiency of the procedure, makes this method more suitable for the extraction of DNA from rat whole blood.

  9. Parasitic slow extraction of extremely weak beam from a high-intensity proton rapid cycling synchrotron

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Ye [University of Science and Technology of China, Hefei, Anhui 230029 (China); Institute of High Energy Physics, CAS, Yuquan Road 19B, Beijing 100049 (China); Tang, Jingyu, E-mail: tangjy@ihep.ac.cn [University of Science and Technology of China, Hefei, Anhui 230029 (China); Institute of High Energy Physics, CAS, Yuquan Road 19B, Beijing 100049 (China); Yang, Zheng; Jing, Hantao [Institute of High Energy Physics, CAS, Yuquan Road 19B, Beijing 100049 (China)

    2014-02-11

    This paper proposes a novel method to extract extremely weak beam from a high-intensity proton rapid cycling synchrotron (RCS) in the parasitic mode, while maintaining the normal fast extraction. The usual slow extraction method from a synchrotron by employing third-order resonance cannot be applied in a high-intensity RCS due to a very short flat-top at the extraction energy and the strict control on beam loss. The proposed parasitic slow extraction method moves the beam to scrape a scattering foil prior to the fast beam extraction by employing either a local orbit bump or momentum deviation or their combination, so that the halo part of the beam will be scattered. A part of the scattered particles will be extracted from the RCS and guided to the experimental area. The slow extraction process can last about a few milliseconds before the beam is extracted by the fast extraction system. The method has been applied to the RCS of China Spallation Neutron Source. With 1.6 GeV in the extraction energy, 62.5 μA in the average current and 25 Hz in the repetition rate for the RCS, the proton intensity by the slow extraction method can be up to 2×10{sup 4} protons per cycle or 5×10{sup 5} protons per second. The extracted beam has also a good time structure of approximately uniform in a spill which is required for many applications such as detector tests. Detailed studies including the scattering effect in the foil, the local orbit bump by the bump magnets and dispersive orbit bump by modifying the RF pattern, the multi-particle simulations by ORBIT and TURTLE codes, and some technical features for the extraction magnets are presented.

  10. How Severely Is DNA Quantification Hampered by RNA Co-extraction?

    Science.gov (United States)

    Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

    2015-10-01

    The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

  11. Selective precipitation of DNA by spermine during the chemical extraction of insoluble cytoplasmic protein.

    Science.gov (United States)

    Choe, W S; Middelberg, A P

    2001-01-01

    The direct chemical extraction of recombinant L1 protein (the major capsid protein of human papillomavirus type 16) from the cytoplasm of E. coli HMS174(DE3) has recently been demonstrated at high cell density (to OD(600) = 160) without the use of reducing agent (1). Coextraction of DNA at high concentration prevents direct coupling to postextraction recovery operations including expanded bed adsorption. In this study, spermine is used to selectively precipitate DNA during chemical extraction. Highly efficient and selective DNA precipitation was achieved. An approximate 10-fold increase in the specific spermine concentration (mg of spermine/mg of DNA) was required to precipitate DNA when 8 M urea was added to the extraction buffer. EDTA (3 mM), required for effective chemical extraction, does not significantly inhibit DNA precipitation. Precipitation selectivity was demonstrated in a bovine serum albumin spiking test, with almost complete recovery of the spiked protein. During studies on the direct extraction of L1 protein from cells at OD(600) = 80, high DNA removal efficiency (>85%) and negligible L1 protein coprecipitation were achieved. This selective precipitation technique simply requires the addition of spermine to the chemical extraction buffer and therefore does not increase technique complexity. This modification enhances the method's general applicability and enables direct coupling to downstream recovery units following chemical extraction at high cell and product concentrations.

  12. Extensive human DNA contamination in extracts from ancient dog bones and teeth.

    Science.gov (United States)

    Malmström, Helena; Storå, Jan; Dalén, Love; Holmlund, Gunilla; Götherström, Anders

    2005-10-01

    Ancient DNA (aDNA) sequences, especially those of human origin, are notoriously difficult to analyze due to molecular damage and exogenous DNA contamination. Relatively few systematic studies have focused on this problem. Here we investigate the extent and origin of human DNA contamination in the most frequently used sources for aDNA studies, that is, bones and teeth from museum collections. To distinguish contaminant DNA from authentic DNA we extracted DNA from dog (Canis familiaris) specimens. We monitored the presence of a 148-bp human-specific and a 152-bp dog-specific mitochondrial DNA (mtDNA) fragment in DNA extracts as well as in negative controls. The total number of human and dog template molecules were quantified using real-time polymerase chain reaction (PCR), and the sequences were characterized by amplicon cloning and sequencing. Although standard precautions to avoid contamination were taken, we found that all samples from the 29 dog specimens contained human DNA, often at levels exceeding the amount of authentic ancient dog DNA. The level of contaminating human DNA was also significantly higher in the dog extracts than in the negative controls, and an experimental setup indicated that this was not caused by the carrier effect. This suggests that the contaminating human DNA mainly originated from the dog bones rather than from laboratory procedures. When cloned, fragments within a contaminated PCR product generally displayed several different sequences, although one haplotype was often found in majority. This leads us to believe that recognized criteria for authenticating aDNA cannot separate contamination from ancient human DNA the way they are presently used.

  13. Effect of DNA extraction procedure, repeated extraction and ethidium monoazide (EMA)/propidium monoazide (PMA) treatment on overall DNA yield and impact on microbial fingerprints for bacteria, fungi and archaea in a reference soil.

    Science.gov (United States)

    Wagner, Andreas O; Praeg, Nadine; Reitschuler, Christoph; Illmer, Paul

    2015-09-01

    Different DNA extraction protocols were evaluated on a reference soil. A wide difference was found in the total extractable DNA as derived from different extraction protocols. Concerning the DNA yield phenol-chloroform-isomyl alcohol extraction resulted in high DNA yield but also in a remarkable co-extraction of contaminants making PCR from undiluted DNA extracts impossible. By comparison of two different extraction kits, the Macherey&Nagel SoilExtract II kit resulted in the highest DNA yields when buffer SL1 and the enhancer solution were applied. The enhancer solution not only significantly increased the DNA yield but also the amount of co-extracted contaminates, whereas additional disintegration strategies did not. Although a three times repeated DNA extraction increased the total amount of extracted DNA, microbial fingerprints were merely affected. However, with the 5th extraction this changed. A reduction of total DGGE band numbers was observed for archaea and fungi, whereas for bacteria the diversity increased. The application of ethidium monoazide (EMA) or propidium monoazide (PMA) treatment aiming on the selective removal of soil DNA derived from cells lacking cell wall integrity resulted in a significant reduction of total extracted DNA, however, the hypothesized effect on microbial fingerprints failed to appear indicating the need for further investigations.

  14. Assessment of DNA extraction methods for detection of arbuscular mycorrhizal fungi in plant roots by nested-PCR

    OpenAIRE

    Abdala Gamby Diédhiou; Wardsson Lustrino Borges; Oumar Sadio; Sergio Miana de Faria

    2014-01-01

    DNA extraction methods were evaluated for the yield and purity of DNA recovered from mycorrhized roots and whether the recovered DNA is suitable for amplification of arbuscular mycorrhizal (AM) fungal SSU rDNA. The DNeasy Plant Mini Kit and three extraction buffers were used alone or in combination with either polyvinylpyrrolidone (PVP), polyvinylpolypyrrolidone (PVPP) and/or activated charcoal (AC). Among the extraction methods tested, those based on the CTAB buffers yielded more DNA than th...

  15. Seed oil polyphenols: rapid and sensitive extraction method and high resolution-mass spectrometry identification.

    Science.gov (United States)

    Koubaa, Mohamed; Mhemdi, Houcine; Vorobiev, Eugène

    2015-05-01

    Phenolic content is a primary parameter for vegetables oil quality evaluation, and directly involved in the prevention of oxidation and oil preservation. Several methods have been reported in the literature for polyphenols extraction from seed oil but the approaches commonly used remain manually handled. In this work, we propose a rapid and sensitive method for seed oil polyphenols extraction and identification. For this purpose, polyphenols were extracted from Opuntia stricta Haw seed oil, using high frequency agitation, separated, and then identified using a liquid chromatography-high resolution mass spectrometry method. Our results showed good sensitivity and reproducibility of the developed methods. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Biases during DNA extraction affect bacterial and archaeal community profile of anaerobic digestion samples.

    Science.gov (United States)

    Roopnarain, Ashira; Mukhuba, Mashudu; Adeleke, Rasheed; Moeletsi, Mokhele

    2017-12-01

    The anaerobic digestion (AD) of organic waste for biogas production has received much attention in recent years due to the increasing need for renewable energy and environmentally friendly waste management systems. Identification of the microbial community involved in AD aids in better understanding and optimising of the process. The choice of DNA extraction method is an integral step in any molecular biodiversity study. In the present study, potential biases introduced by DNA extraction methods were examined by comparing quality, quantity and representability of DNA extracted from AD samples using various extraction methods. In spite of the non-kit based method (cetyltrimethylammonium bromide) yielding the largest quantity of DNA (approximately 44 µg DNA per gram dry weight), the extracted DNA contained PCR inhibitors. Furthermore, the quantity of extracted DNA was not proportional to species diversity. Diversity, determined using denaturing gradient gel electrophoresis (DGGE), was strongly linked to the type of extraction method used. The spin-column filter-based kit that incorporated mechanical and chemical lysis (Macherey-Nagel kit) gave the best results in terms of bacterial and archaeal diversity (Shannon-Wiener indices: average 2.5 and 2.6, respectively). Furthermore, this kit was the most effective at lysing hard-to-lyse bacterial and archaeal cells. The choice of DNA extraction method significantly influences the reliability and comparability of results obtained during AD microbial ecology investigations. Moreover, the careful selection of the DNA extraction method is of particular importance when analysing AD samples since these samples are rich in PCR inhibitors and hard-to-lyse cells such as archaea and gram-positive bacteria.

  17. Comparison of Five Simple Methods for DNA Extraction from Echinococcus granulosus Protoscoleces for PCR-Amplification of Ribosomal DNA

    Directory of Open Access Journals (Sweden)

    F Zahabiun

    2009-05-01

    Full Text Available "nBackground: Cystic hydatid disease is an important zoonosis, affecting humans and animals and is a significant public health and economic problem throughout the world and Iran. Since extraction of DNA from the parasite is a primary and crucial step which has a principal effect on PCR results, in the current study five simple methods for DNA extraction from protoscoleces of Echinococcus granulosus were ap­plied and compared with each other. "nMethods: After collecting hydatid cysts from an abattoir, DNA samples were extracted from two cyst isolates from sheep, two from goats and two from camels using five different methods involving the use of glass beads, mechanical grinder, freeze-thaw, boiling and crushing. For all DNA samples ex­tracted, one PCR assay based on amplifying rDNA-ITS1 region was performed and amplicons re­solved on 1.5% agarose gels. "nResults: The methods were compared regarding to DNA and PCR bands, time and cost effectiveness and laborious amount. The target DNA was successfully amplified from all samples using all methods produced an expected band size. All methods showed some advantages and disadvantages in PCR gels. The boiling method, which was the most time and cost effectiveness method, achieved the thick­est bands in the PCR following grinder, crushing, freeze-thaw and glass beads."nConclusion: Boiling and crushing methods were the most suitable methods regarding their amplicon quality, easiness, quickness and cost effectiveness.

  18. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  19. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...... yielded DNA of comparable quality, and none of the methods caused major damage to the otoliths. Of the element concentrations measured, only Mg and Rb showed considerable changes resulting from DNA extraction. The physical properties of the otolith (morphology and clarity of annual growth increments) were...

  20. Extraction of total DNA and optimization of the RAPD reaction system in Dioscorea opposita Thunb.

    Science.gov (United States)

    Wen, G Q; Li, J; Liu, X H; Zhang, Y S; Wen, S S

    2014-02-28

    Dioscorea opposita Thunb. has been used as health food and herbal medicinal ingredients in traditional Chinese medicine. In this study, the total DNA of D. opposita Thunb. was extracted using an improved cetyltrimethylammonium bromide (CTAB) method, and the extracted DNA was further used for random amplified polymorphic DNA (RAPD) reaction system by design of the L16 (4(4)) orthogonal diagram. The results showed that the improved CTAB method can be used to isolate high-quality and high-concentration DNA, and the optimized protocol can overcome the instability of RAPD reaction system. The knowledge stated here can be used to study the genetic diversity of D. opposita Thunb.

  1. Managing the social impacts of the rapidly-expanding extractive industries in Greenland

    NARCIS (Netherlands)

    Hansen, Anne Merrild; Vanclay, Frank; Croal, Peter; Skjervedal, Anna Sofie Hurup

    2016-01-01

    The recent rapid expansion of extractive industries in Greenland is both causing high hopes for the future and anxieties among the local population. In the Arctic context, even small projects carry risks of major social impacts at local and national scales, and have the potential to severely affect

  2. Managing the social impacts of the rapidly expanding extractive industries in Greenland

    DEFF Research Database (Denmark)

    Hansen, Anne Merrild; Vanclay, Frank; Croal, Peter

    2016-01-01

    The recent rapid expansion of extractive industries in Greenland is both causing high hopes for the future and anxieties among the local population. In the Arctic context, even small projects carry risks of major social impacts at local and national scales, and have the potential to severely affect...

  3. The DNA 'comet assay' as a rapid screening technique to control irradiated food.

    Science.gov (United States)

    Cerda, H; Delincée, H; Haine, H; Rupp, H

    1997-04-29

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded.

  4. The DNA `comet assay` as a rapid screening technique to control irradiated food

    Energy Technology Data Exchange (ETDEWEB)

    Cerda, H. [Department of Radioecology, The Swedish University of Agricultural Sciences, Uppsala (Sweden); Delincee, H. [Institute of Nutritional Physiology, Federal Research Centre for Nutrition, Karlsruhe (Germany); Haine, H. [Campden and Chorleywood Food Research Association, Chipping Campden, Gloucestershire (United Kingdom); Rupp, H. [Swiss Federal Office of Public Health, Section of Food Chemistry, Berne (Switzerland)

    1997-04-29

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded.

  5. Comparison of two methods of bacterial DNA extraction from human fecal samples contaminated with Clostridium perfringens, Staphylococcus aureus, Salmonella Typhimurium, and Campylobacter jejuni.

    Science.gov (United States)

    Kawase, Jun; Kurosaki, Morito; Kawakami, Yuta; Kashimoto, Takashi; Tsunomori, Yoshie; Sato, Koji; Ikeda, Tetsuya; Yamaguchi, Keiji; Watahiki, Masanori; Shima, Tomoko; Kameyama, Mitsuhiro; Etoh, Yoshiki; Horikawa, Kazumi; Fukushima, Hiroshi; Goto, Ryoichi; Shirabe, Komei

    2014-01-01

    In this study, 2 methods of DNA extraction were evaluated for use in conjunction with the screening system Rapid Foodborne Bacterial Screening 24 (RFBS24), which employs multiplex real-time SYBR Green polymerase chain reaction (SG-PCR) and can simultaneously detect 24 target genes of foodborne pathogens in fecal DNA samples. The QIAamp DNA Stool mini kit (Qkit) and Ultra Clean Fecal DNA Isolation Kit (Ukit) were used for bacterial DNA extraction from fecal samples artificially inoculated with Clostridium perfringens, Staphylococcus aureus, Salmonella Typhimurium, and Campylobacter jejuni. SG-PCR and simplex real-time quantitative PCR (S-qPCR) analyses revealed higher copy numbers (8-234 times) of DNA in samples obtained using Ukit compared with those obtained using Qkit, resulting in lower cycle threshold values for the Ukit samples of the 4 bacteria on SG-PCR analysis. Fecal DNA samples from patients infected during foodborne outbreaks of Salmonella and Campylobacter were also prepared by Qkit and Ukit methods and subjected to RFBS24 analyses. Higher numbers of RFBS24 bacterial target genes were detected in DNA samples obtained using Ukit compared with those obtained using Qkit. Thus, the higher DNA extraction efficiency of the Ukit method compared with Qkit renders the former more useful in achieving improved detection rates of these 4 bacteria in fecal samples using SG-PCR.

  6. DNA Extraction Protocol for Biological Ingredient Analysis of Liuwei Dihuang Wan

    Directory of Open Access Journals (Sweden)

    Xinwei Cheng

    2014-06-01

    Full Text Available Traditional Chinese medicine (TCM preparations are widely used for healthcare and clinical practice. So far, the methods commonly used for quality evaluation of TCM preparations mainly focused on chemical ingredients. The biological ingredient analysis of TCM preparations is also important because TCM preparations usually contain both plant and animal ingredients, which often include some mis-identified herbal materials, adulterants or even some biological contaminants. For biological ingredient analysis, the efficiency of DNA extraction is an important factor which might affect the accuracy and reliability of identification. The component complexity in TCM preparations is high, and DNA might be destroyed or degraded in different degrees after a series of processing procedures. Therefore, it is necessary to establish an effective protocol for DNA extraction from TCM preparations. In this study, we chose a classical TCM preparation, Liuwei Dihuang Wan (LDW, as an example to develop a TCM-specific DNA extraction method. An optimized cetyl trimethyl ammonium bromide (CTAB method (TCM-CTAB and three commonly-used extraction kits were tested for extraction of DNA from LDW samples. Experimental results indicated that DNA with the highest purity and concentration was obtained by using TCM-CTAB. To further evaluate the different extraction methods, amplification of the second internal transcribed spacer (ITS2 and the chloroplast genome trnL intron was carried out. The results have shown that PCR amplification was successful only with template of DNA extracted by using TCM-CTAB. Moreover, we performed high-throughput 454 sequencing using DNA extracted by TCM-CTAB. Data analysis showed that 3–4 out of 6 prescribed species were detected from LDW samples, while up to 5 contaminating species were detected, suggesting TCM-CTAB method could facilitate follow-up DNA-based examination of TCM preparations.

  7. DNA extraction protocol for biological ingredient analysis of Liuwei Dihuang Wan.

    Science.gov (United States)

    Cheng, Xinwei; Chen, Xiaohua; Su, Xiaoquan; Zhao, Huanxin; Han, Maozhen; Bo, Cunpei; Xu, Jian; Bai, Hong; Ning, Kang

    2014-06-01

    Traditional Chinese medicine (TCM) preparations are widely used for healthcare and clinical practice. So far, the methods commonly used for quality evaluation of TCM preparations mainly focused on chemical ingredients. The biological ingredient analysis of TCM preparations is also important because TCM preparations usually contain both plant and animal ingredients, which often include some mis-identified herbal materials, adulterants or even some biological contaminants. For biological ingredient analysis, the efficiency of DNA extraction is an important factor which might affect the accuracy and reliability of identification. The component complexity in TCM preparations is high, and DNA might be destroyed or degraded in different degrees after a series of processing procedures. Therefore, it is necessary to establish an effective protocol for DNA extraction from TCM preparations. In this study, we chose a classical TCM preparation, Liuwei Dihuang Wan (LDW), as an example to develop a TCM-specific DNA extraction method. An optimized cetyl trimethyl ammonium bromide (CTAB) method (TCM-CTAB) and three commonly-used extraction kits were tested for extraction of DNA from LDW samples. Experimental results indicated that DNA with the highest purity and concentration was obtained by using TCM-CTAB. To further evaluate the different extraction methods, amplification of the second internal transcribed spacer (ITS2) and the chloroplast genome trnL intron was carried out. The results have shown that PCR amplification was successful only with template of DNA extracted by using TCM-CTAB. Moreover, we performed high-throughput 454 sequencing using DNA extracted by TCM-CTAB. Data analysis showed that 3-4 out of 6 prescribed species were detected from LDW samples, while up to 5 contaminating species were detected, suggesting TCM-CTAB method could facilitate follow-up DNA-based examination of TCM preparations. Copyright © 2014. Production and hosting by Elsevier Ltd.

  8. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples

    OpenAIRE

    Deb, R.; Sengar, G. S.; Singh, U.; Kumar, S.; Raja, T. V.; Alex, R.; Alyethodi, R. R.; Prakash, B.

    2017-01-01

    Animal species detection is one of the crucial steps for consumer’s food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up ...

  9. A modified method of DNA extraction from peripheral blood and bone marrow specimens.

    Science.gov (United States)

    Hanson, C A; Kersey, J H

    1988-07-01

    We have outlined a modified method of DNA extraction from blood and bone marrow that can be used for gene rearrangement studies of leukemia and lymphoma and can consistently give excellent yields of DNA from as little as 1 x 10(6) cells. The method is based on the use of small sample vessels, a marked reduction in solution volume and minimal handling of the specimen. By using known cell numbers from eight leukemic bone marrow samples and four leukemic cell lines, the modified extraction procedure consistently had better yields of DNA, compared with a standard procedure. These findings were confirmed by further comparisons of DNA yields from 14 hypocellular clinical specimens that had been divided into two equal parts for side-by-side DNA extraction with both methods. The quality of the DNA from the modified extraction method was similar to standard methods on subsequent Southern blot analysis and hybridization with immunoglobulin and/or T-cell receptor gene probes. This modified DNA extraction method is a procedure that complements standard extraction methods and expands the number and type of specimens that can be evaluated by the clinical molecular genetics laboratory.

  10. Comparison of DNA extraction methods for human gut microbial community profiling.

    Science.gov (United States)

    Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

    2017-12-21

    The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  11. DNA extraction methods and multiple sampling to improve molecular diagnosis of Sarcocystis spp. in cattle hearts.

    Science.gov (United States)

    Bräunig, Patrícia; Portella, Luiza Pires; Cezar, Alfredo Skrebsky; Libardoni, Felipe; Sangioni, Luis Antonio; Vogel, Fernanda Silveira Flores; Gonçalves, Paulo Bayard Dias

    2016-10-01

    Molecular detection of Sarcocystis spp. in tissue samples can be useful for experimental and diagnostic purposes. However, the parasite spreads unevenly through tissues, forming tissue cysts, and the cystic wall is an obstacle in DNA extraction protocols. Therefore, adequate sampling and effective disruption of the cysts are essential to improve the accuracy of DNA detection by PCR. The aims of this study were to evaluate the suitability of four protocols for DNA extraction from cysts of Sarcocystis spp. present in bovine myocardium samples or after their harvest in phosphate-buffered saline (PBS) solution as well as determine the effects of single or multiple sampling on the accuracy of molecular diagnosis of sarcocystosis in cattle hearts. Cysts and myocardium samples from nine bovine hearts were randomly distributed to four DNA extraction protocols: kit, kit with modification, DNAzol, and cetyl-trimethyl ammonium bromide (CTAB). Samples were submitted to DNA extraction and PCR as replicates of each heart (simplicate, duplicate, and triplicate), and the probability of a true positive diagnostic was calculated. Among the protocols tested, the kit with modification was determined to be the most suitable for DNA extraction from cysts in PBS solution (92.6 % of DNA detection by PCR); DNAzol resulted in higher DNA detection frequency from bovine myocardium samples (48.1 %). Multiple sampling improved the molecular diagnosis of Sarcocystis spp. infection in cattle hearts, increasing at 22.2 % the rate of true positive diagnostic.

  12. Standardization of DNA extraction from sand flies: Application to genotyping by next generation sequencing.

    Science.gov (United States)

    Casaril, Aline Etelvina; de Oliveira, Liliane Prado; Alonso, Diego Peres; de Oliveira, Everton Falcão; Gomes Barrios, Suellem Petilim; de Oliveira Moura Infran, Jucelei; Fernandes, Wagner de Souza; Oshiro, Elisa Teruya; Ferreira, Alda Maria Teixeira; Ribolla, Paulo Eduardo Martins; de Oliveira, Alessandra Gutierrez

    2017-06-01

    Standardization of the methods for extraction of DNA from sand flies is essential for obtaining high efficiency during subsequent molecular analyses, such as the new sequencing methods. Information obtained using these methods may contribute substantially to taxonomic, evolutionary, and eco-epidemiological studies. The aim of the present study was to standardize and compare two methods for the extraction of genomic DNA from sand flies for obtaining DNA in sufficient quantities for next-generation sequencing. Sand flies were collected from the municipalities of Campo Grande, Camapuã, Corumbá and Miranda, state of Mato Grosso do Sul, Brazil. Three protocols using a silica column-based commercial kit (ReliaPrep™ Blood gDNA Miniprep System kit, Promega(®)), and three protocols based on the classical phenol-chloroform extraction method (Uliana et al., 1991), were compared with respect to the yield and quality of the extracted DNA. DNA was quantified using a Qubit 2.0 fluorometer. The presence of sand fly DNA was confirmed by PCR amplification of the IVS6 region (constitutive gene), followed by electrophoresis on a 1.5% agarose gel. A total of 144 male specimens were analyzed, 72 per method. Significant differences were observed between the two methods tested. Protocols 2 and 3 of phenol-chloroform extraction presented significantly better performance than all commercial kit extraction protocols tested. For phenol-chloroform extraction, protocol 3 presented significantly better performance than protocols 1 and 2. The IVS6 region was detected in 70 of 72 (97.22%) samples extracted with phenol, including all samples for protocols 2 and 3. This is the first study on the standardization of methods for the extraction of DNA from sand flies for application to next-generation sequencing, which is a promising tool for entomological and molecular studies of sand flies. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Field preservation and DNA extraction methods for intestinal microbial diversity analysis in earthworms.

    Science.gov (United States)

    Thakuria, Dwipendra; Schmidt, Olaf; Liliensiek, Ann-Kathrin; Egan, Damian; Doohan, Fiona M

    2009-03-01

    We assessed the effect of DNA extraction and sample preservation methods on the DNA yield and quality obtained from earthworm (Aporrectodea caliginosa Savigny) gut samples and on the results obtained by bacterial and fungal automated ribosomal intergenic spacer analysis (ARISA) of DNA extracts. Methods based on a hexadecyltrimethylammonium bromide dithiotreitol (CTAB-DTT) extraction buffer yielded more favourable results than those based on a sodium dodecyl sulphate (SDS) buffer. For both of these buffers, incorporation of a bead-beating during the lysis step increased the ARISA-derived bacterial ribotype numbers and diversity estimates, as determined for gut wall samples (PDNA extracted by the CTAB-DTT and SDS-based methods were of comparable quality (P> or =0.05), the former method yielded >1.5 times more DNA from both gut contents and gut walls of earthworms than the latter method (both incorporating the bead beating step) (PDNA extracted by the CTAB-DTT- as compared to the SDS-based method (PDNA extracted by the CTAB-DTT (but not by the SDS-based) method (Global R=0.76, PCTAB-DTT-based method, we showed that earthworm preservation in ethanol yielded higher quality DNA from gut contents than preservation in either chloroform or liquid N, as determined by spectrophotometry, PCR inhibition analysis and bacterial and fungal ARISA (PCTAB-DTT-based DNA extraction method described herein are also suitable for the analysis of gut-associated microbiota in other soil and sediment feeding invertebrates.

  14. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    Science.gov (United States)

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  15. An Efficient DNA Extraction Method for Lactobacillus casei, a Difficult-to-Lyse Bacterium

    Directory of Open Access Journals (Sweden)

    Mojtaba Alimolaei

    2016-02-01

    Full Text Available Background: There are several protocols to extract DNA from Lactobacillus spp. In the case of L. casei it is harder because of its especial and thick cell wall. Objectives: In this study, nine DNA extraction protocols (by lysozyme treatment were evaluated and compared in two categories (traditional and kit-based protocols and an improved method was presented. Materials and Methods: DNA quantity and quality was determined by spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR. Results: The results revealed that the yield of extracted DNA differed by each protocol (5.8 - 17.1 μg/100 μL, but provided appropriate DNA for PCR amplification. The modified protocol offered the best total DNA extraction method when both quality (DNA purity; 1.54 μg and quantity (DNA yield; 17.1 μg were considered. Conclusions: We suggest this protocol for effective and inexpensive DNA isolation from L. casei for downstream biological processes such as PCR.

  16. Protocol: A high-throughput DNA extraction system suitable for conifers.

    Science.gov (United States)

    Bashalkhanov, Stanislav; Rajora, Om P

    2008-08-01

    High throughput DNA isolation from plants is a major bottleneck for most studies requiring large sample sizes. A variety of protocols have been developed for DNA isolation from plants. However, many species, including conifers, have high contents of secondary metabolites that interfere with the extraction process or the subsequent analysis steps. Here, we describe a procedure for high-throughput DNA isolation from conifers. We have developed a high-throughput DNA extraction protocol for conifers using an automated liquid handler and modifying the Qiagen MagAttract Plant Kit protocol. The modifications involve change to the buffer system and improving the protocol so that it almost doubles the number of samples processed per kit, which significantly reduces the overall costs. We describe two versions of the protocol: one for medium-throughput (MTP) and another for high-throughput (HTP) DNA isolation. The HTP version works from start to end in the industry-standard 96-well format, while the MTP version provides higher DNA yields per sample processed. We have successfully used the protocol for DNA extraction and genotyping of thousands of individuals of several spruce and a pine species. A high-throughput system for DNA extraction from conifer needles and seeds has been developed and validated. The quality of the isolated DNA was comparable with that obtained from two commonly used methods: the silica-spin column and the classic CTAB protocol. Our protocol provides a fully automatable and cost effective solution for processing large numbers of conifer samples.

  17. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  18. Microwave assisted extraction-solid phase extraction for high-efficient and rapid analysis of monosaccharides in plants.

    Science.gov (United States)

    Zhang, Ying; Li, Hai-Fang; Ma, Yuan; Jin, Yan; Kong, Guanghui; Lin, Jin-Ming

    2014-11-01

    Monosaccharides are the fundamental composition units of saccharides which are a common source of energy for metabolism. An effective and simple method consisting of microwave assisted extraction (MAE), solid phase extraction (SPE) and high performance liquid chromatography-refractive index detector (HPLC-RID) was developed for rapid detection of monosaccharides in plants. The MAE was applied to break down the structure of the plant cells and release the monosaccharides, while the SPE procedure was adopted to purify the extract before analysis. Finally, the HPLC-RID was employed to separate and analyze the monosaccharides with amino column. As a result, the extraction time was reduced to 17 min, which was nearly 85 times faster than soxhlet extraction. The recoveries of arabinose, xylose, fructose and glucose were 85.01%, 87.79%, 103.17%, and 101.24%, with excellent relative standard deviations (RSDs) of 1.94%, 1.13%, 0.60% and 1.67%, respectively. The proposed method was demonstrated to be efficient and time-saving, and had been applied to analyze monosaccharides in tobacco and tea successfully. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. An optmized protocol for simultaneous extraction of DNA and RNA from soils Protocolo otimizado para extração simultanea de DNA e RNA de solo

    Directory of Open Access Journals (Sweden)

    Rodrigo Costa

    2004-09-01

    Full Text Available In this work we report an optimized protocol for simultaneous extraction of DNA and RNA from soil matrices. Treatment of soil matrices with ethanol followed by bead-beating worked as a successful strategy to lyse the cells without considerable degradation of nucleic acids, resulting in DNA and RNA of good yield and integrity. The reverse transcribed RNA could be amplified with primers targeting a glutamine synthetase (glnA gene fragment. From both DNA and cDNA, 16S rDNA fragments were amplified and analyzed by Denaturing Gradient Gel Electrophoresis (DGGE. The method was applied to soil and rhizosphere (strawberry and oilseed rape samples. Two other protocols for the extraction of nucleic acids from soil were applied to the same set of samples in order to compare the methods in terms of efficiency and reproducibility. The DGGE profiles indicated no relevant differences between the patterns obtained. The method described here is suitable for rapid processing of many samples and therefore appropriate for ecological studies.Nesse trabalho descrevemos um protocolo otimizado para extração simultânea de DNA e RNA de solo. O tratamento das amostras de solo com etanol e posterior agitação com partículas foi uma estratégia bem sucedida para lise das células sem degradação significativa dos ácidos nucléicos, resultando em bom rendimento de DNA e RNA íntegros. O RNA transcrito pode ser amplificado com iniciadores com alvo no fragmento do gene da glutamina sintetase (glnA. Os fragmentos 16S rDNA, tanto do DNA como do cDNA, foram amplificados e analisados por DGGE. O método foi aplicado para amostras de solo e rizosfera (morango e canola. Dois outros protocolos para extração de ácidos nucléicos de solo foram aplicados para o mesmo lote de amostras, de forma a comparar os métodos quanto à eficiência e reprodutibilidade. Os perfis de DGGE mostraram não haver diferença relevante nos padrões obtidos. O método descrito é apropriado para

  20. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    Suitable method for isolation of genomic DNA is really important. The best method can make the best result for genetic study. About five differences methods were used amongst which were Sarkosyl Method, CTAB method, Kit Method, SDS Method and Phenol-Chloroform Method. Isolated genomic DNA showed high purity ...

  1. Comparison of DNA extraction kits for PCR-DGGE analysis of human intestinal microbial communities from fecal specimens.

    Science.gov (United States)

    Ariefdjohan, Merlin W; Savaiano, Dennis A; Nakatsu, Cindy H

    2010-05-22

    The influence of diet on intestinal microflora has been investigated mainly using conventional microbiological approaches. Although these studies have advanced knowledge on human intestinal microflora, it is imperative that new methods are applied to facilitate scientific progress. Culture-independent molecular fingerprinting method of Polymerase Chain Reaction and Denaturing Gradient Gel Electrophoresis (PCR-DGGE) has been used to study microbial communities in a variety of environmental samples. However, these protocols must be optimized prior to their application in order to enhance the quality and accuracy of downstream analyses. In this study, the relative efficacy of four commercial DNA extraction kits (Mobio Ultra Clean(R) Fecal DNA Isolation Kit, M; QIAamp DNA Stool Mini Kit, Q; FastDNA SPIN Kit, FSp; FastDNA SPIN Kit for Soil, FSo) were evaluated. Further, PCR-DGGE technique was also assessed for its feasibility in detecting differences in human intestinal bacterial fingerprint profiles. Total DNA was extracted from varying weights of human fecal specimens using four different kits, followed by PCR amplification of bacterial 16S rRNA genes, and DGGE separation of the amplicons. Regardless of kit, maximum DNA yield was obtained using 10 to 50 mg (wet wt) of fecal specimens and similar DGGE profiles were obtained. However, kits FSp and FSo extracted significantly larger amounts of DNA per g dry fecal specimens and produced more bands on their DGGE profiles than kits M and Q due to their use of bead-containing lysing matrix and vigorous shaking step. DGGE of 16S rRNA gene PCR products was suitable for capturing the profiles of human intestinal microbial community and enabled rapid comparative assessment of inter- and intra-subject differences. We conclude that extraction kits that incorporated bead-containing lysing matrix and vigorous shaking produced high quality DNA from human fecal specimens (10 to 50 mg, wet wt) that can be resolved as bacterial

  2. Comparing the performance of three ancient DNA extraction methods for high-throughput sequencing

    DEFF Research Database (Denmark)

    Gamba, Cristina; Hanghøj, Kristian Ebbesen; Gaunitz, Charleen

    2016-01-01

    The DNA molecules that can be extracted from archaeological and palaeontological remains are often degraded and massively contaminated with environmental microbial material. This reduces the efficacy of shotgun approaches for sequencing ancient genomes, despite the decreasing sequencing costs...... of high-throughput sequencing (HTS). Improving the recovery of endogenous molecules from the DNA extraction and purification steps could, thus, help advance the characterization of ancient genomes. Here, we apply the three most commonly used DNA extraction methods to five ancient bone samples spanning...... a ~30 thousand year temporal range and originating from a diversity of environments, from South America to Alaska. We show that methods based on the purification of DNA fragments using silica columns are more advantageous than in solution methods and increase not only the total amount of DNA molecules...

  3. Comparison of DNA extraction methods for polymerase chain reaction amplification of guanaco (Lama guanicoe) fecal DNA samples.

    Science.gov (United States)

    Espinosa, M I; Bertin, A; Squeo, F A; Cortés, A; Gouin, N

    2015-01-23

    Feces-based population genetic studies have become increasingly popular. However, polymerase chain reaction (PCR) amplification rates from fecal material vary depending on the species, populations, loci, and extraction protocols. Here, we assessed the PCR amplification success of three microsatellite markers and a segment of the mitochondrial control region of DNA extracted from field-collected feces of guanaco (Lama guanicoe) using two protocols - Qiagen DNA Stool Kit and 2 cetyltrimethylammonium bromide/phenol:chloroform:isoamyl alcohol (2CTAB/PCI) method. Chelex resin treatment to remove inhibitors was also tested. Our results show that the mitochondrial locus was the most difficult to amplify. PCR success rates improved for all markers after Chelex treatment of extracted DNA, and 2CTAB/PCI method (95.83%) appeared to perform slightly better than stool kit (91.67%) for the nuclear markers. Amplification success was significantly influenced by the extraction method, Chelex treatment, and locus (P 0.89), but they decreased slightly after treatment for amplification of nuclear markers and markedly after treatment for amplification of the mitochondrial control region. Thus, we showed that Chelex treatment gives high PCR success, especially for nuclear markers, and adequate DNA extraction rates can be achieved from L. guanicoe feces even from non-fresh fecal material. Although not significant, 2CTAB/PCI method tended to provide higher successful amplification rates on a whole set of samples, suggesting that the method could be particularly useful when using small sample sizes.

  4. DNA extraction from plant food supplements: Influence of different pharmaceutical excipients.

    Science.gov (United States)

    Costa, Joana; Amaral, Joana S; Fernandes, Telmo J R; Batista, Andreia; Oliveira, M Beatriz P P; Mafra, Isabel

    2015-12-01

    The consumption of plant food supplements (PFS) has been growing globally, with an increase of misleading labeling and fraudulent practices also being reported. Recently, the use of molecular biology techniques has been proposed to detect botanical adulterations, one of the possible frauds in PFS. However, difficulties in recovering DNA from some PFS samples have been described. Aiming at using DNA-based methods for the unequivocal identification of plant species in PFS, adequate DNA isolation is required. However, PFS often contain pharmaceutical excipients known to have adsorbent properties that might interfere with DNA extraction. Thus, the aim of this work was to assess the effect of different excipients (talc, silica, iron oxide and titanium dioxide) on the recovery/amplification of DNA. For that purpose, known amounts of template maize DNA were spiked either to PFS or to model mixtures of excipients and quantified by real-time PCR. The tested excipients evidenced clear adsorption phenomena that justify the hampering effect on DNA extraction from PFS. The use of either 10% talc or 0.5% dyes completely adsorbed DNA, resulting in negative PCR amplifications. For the first time, pharmaceutical excipients were shown to affect DNA extraction explaining the inability of recovering DNA from some PFS samples in previous studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

    Directory of Open Access Journals (Sweden)

    Imelda Kristina Sutrisno

    2013-06-01

    Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

  6. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively (P Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS6110 per ml of pleural effusion and showed good accordance of the results between repeated tests (r = 0.978, P = 2.84 × 10-10). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  7. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  9. Commercial DNA extraction kits impact observed microbial community composition in permafrost samples.

    Science.gov (United States)

    Vishnivetskaya, Tatiana A; Layton, Alice C; Lau, Maggie C Y; Chauhan, Archana; Cheng, Karen R; Meyers, Arthur J; Murphy, Jasity R; Rogers, Alexandra W; Saarunya, Geetha S; Williams, Daniel E; Pfiffner, Susan M; Biggerstaff, John P; Stackhouse, Brandon T; Phelps, Tommy J; Whyte, Lyle; Sayler, Gary S; Onstott, Tullis C

    2014-01-01

    The total community genomic DNA (gDNA) from permafrost was extracted using four commercial DNA extraction kits. The gDNAs were compared using quantitative real-time PCR (qPCR) targeting 16S rRNA genes and bacterial diversity analyses obtained via 454 pyrosequencing of the 16S rRNA (V3 region) amplified in single or nested PCR. The FastDNA(®) SPIN (FDS) Kit provided the highest gDNA yields and 16S rRNA gene concentrations, followed by MoBio PowerSoil(®) (PS) and MoBio PowerLyzer™ (PL) kits. The lowest gDNA yields and 16S rRNA gene concentrations were from the Meta-G-Nome™ (MGN) DNA Isolation Kit. Bacterial phyla identified in all DNA extracts were similar to that found in other soils and were dominated by Actinobacteria, Firmicutes, Gemmatimonadetes, Proteobacteria, and Acidobacteria. Weighted UniFrac and statistical analyses indicated that bacterial community compositions derived from FDS, PS, and PL extracts were similar to each other. However, the bacterial community structure from the MGN extracts differed from other kits exhibiting higher proportions of easily lysed β- and γ-Proteobacteria and lower proportions of Actinobacteria and Methylocystaceae important in carbon cycling. These results indicate that gDNA yields differ between the extraction kits, but reproducible bacterial community structure analysis may be accomplished using gDNAs from the three bead-beating lysis extraction kits. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. Limitations and recommendations for successful DNA extraction from forensic soil samples: a review.

    Science.gov (United States)

    Young, Jennifer M; Rawlence, Nicolas J; Weyrich, Laura S; Cooper, Alan

    2014-05-01

    Soil is commonly used in forensic casework to provide discriminatory power to link a suspect to a crime scene. Standard analyses examine the intrinsic properties of soils, including mineralogy, geophysics, texture and colour; however, soils can also support a vast amount of organisms, which can be examined using DNA fingerprinting techniques. Many previous genetic analyses have relied on patterns of fragment length variation produced by amplification of unidentified taxa in the soil extract. In contrast, the development of advanced DNA sequencing technologies now provides the ability to generate a detailed picture of soil microbial communities and the taxa present, allowing for improved discrimination between samples. However, DNA must be efficiently extracted from the complex soil matrix to achieve accurate and reproducible DNA sequencing results, and extraction efficacy is highly dependent on the soil type and method used. As a result, a consideration of soil properties is important when estimating the likelihood of successful DNA extraction. This would include a basic understanding of soil components, their interactions with DNA molecules and the factors that affect such interactions. This review highlights some important considerations required prior to DNA extraction and discusses the use of common chemical reagents in soil DNA extraction protocols to achieve maximum efficacy. Together, the information presented here is designed to facilitate informed decisions about the most appropriate sampling and extraction methodology, relevant both to the soil type and the details of a specific forensic case, to ensure sufficient DNA yield and enable successful analysis. Copyright © 2014 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.

  11. Genomic DNA extraction from medicinal plants available in Malaysia using a TriOmic(TM) improved extraction kit.

    Science.gov (United States)

    Mohd-Hairul, A R; Sade, A B; Yiap, B C; Raha, A R

    2011-11-08

    DNA extraction was carried out on 32 medicinal plant samples available in Malaysia using the TriOmic(TM) extraction kit. Amounts of 0.1 g flowers or young leaves were ground with liquid nitrogen, lysed at 65°C in RY1(plus) buffer and followed by RNAse treatment. Then, RY2 buffer was added to the samples and mixed completely by vortexing before removal of cell debris by centrifugation. Supernatants were transferred to fresh microcentrifuge tubes and 0.1 volume RY3 buffer was added to each of the transferred supernatant. The mixtures were applied to spin columns followed by a centrifugation step to remove buffers and other residues. Washing step was carried out twice by applying 70% ethanol to the spin columns. Genomic DNA of the samples was recovered by applying 50 μL TE buffer to the membrane of each spin column, followed by a centrifugation step at room temperature. A modification of the TriOmic(TM) extraction procedure was carried out by adding chloroform:isoamyl alcohol (24:1) steps in the extraction procedure. The genomic DNA extracted from most of the 32 samples showed an increase of total yield when chloroform:isoamyl alcohol (24:1) steps were applied in the TriOmicTM extraction procedure. This preliminary study is very important for molecular studies of medicinal plants available in Malaysia since the DNA extraction can be completed in a shorter period of time (within 1 h) compared to manual extraction, which entails applying phenol, chloroform and ethanol precipitation, and requires 1-2 days to complete.

  12. Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2017-01-01

    Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

  13. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  15. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy.

    Science.gov (United States)

    Bi, Yanzhen; Qiao, Xianfeng; Hua, Zaidong; Zhang, Liping; Liu, Ximei; Li, Li; Hua, Wenjun; Xiao, Hongwei; Zhou, Jingrong; Wei, Qingxin; Zheng, Xinmin

    2012-07-06

    Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to DNA engineering and gene functional

  16. Chemiluminescence analysis for HBV-DNA hybridization detection with magnetic nanoparticles based DNA extraction from positive whole blood samples.

    Science.gov (United States)

    He, Nongyue; Wang, Fang; Ma, Chao; Li, Chuanyan; Zeng, Xin; Deng, Yan; Zhang, Liming; Li, Zhiyang

    2013-02-01

    Molecular detection of HBV has a significant impact on prognosis and therapy of the disease. In this paper, a sensitive nucleic acid detection method of HBV was established taking advantage of magnetic nanoparticles (MNPs), chemiluminescence (CL) and polymerase chain reaction (PCR). HBV-DNA was extracted from hepatitis B positive human blood samples using MNPs adsorption method and biotin was labeled on the DNA segment after base insertion of bintin-dUTP in PCR. The biotinylated DNA segment was captured by amino probe immobilized on carboxyl MNPs and was detected by the chemiluminescence system of alkaline phosphatase catalyzing 3-(2'-spiroadamantane)-4-methoxy-4-(3"-phosphoryloxy) phenyl-1, 2-dioxetane. Different concentrations of HBV-DNA were detected under the optimized experiment conditions and the relevant CL intensity were obtained, which provided a novel research or clinic diagnosis method for the quantification detection of HBV-DNA.

  17. Hot-alkaline DNA extraction method for deep-subseafloor archaeal communities.

    Science.gov (United States)

    Morono, Yuki; Terada, Takeshi; Hoshino, Tatsuhiko; Inagaki, Fumio

    2014-03-01

    A prerequisite for DNA-based microbial community analysis is even and effective cell disruption for DNA extraction. With a commonly used DNA extraction kit, roughly two-thirds of subseafloor sediment microbial cells remain intact on average (i.e., the cells are not disrupted), indicating that microbial community analyses may be biased at the DNA extraction step, prior to subsequent molecular analyses. To address this issue, we standardized a new DNA extraction method using alkaline treatment and heating. Upon treatment with 1 M NaOH at 98°C for 20 min, over 98% of microbial cells in subseafloor sediment samples collected at different depths were disrupted. However, DNA integrity tests showed that such strong alkaline and heat treatment also cleaved DNA molecules into short fragments that could not be amplified by PCR. Subsequently, we optimized the alkaline and temperature conditions to minimize DNA fragmentation and retain high cell disruption efficiency. The best conditions produced a cell disruption rate of 50 to 80% in subseafloor sediment samples from various depths and retained sufficient DNA integrity for amplification of the complete 16S rRNA gene (i.e., ∼1,500 bp). The optimized method also yielded higher DNA concentrations in all samples tested compared with extractions using a conventional kit-based approach. Comparative molecular analysis using real-time PCR and pyrosequencing of bacterial and archaeal 16S rRNA genes showed that the new method produced an increase in archaeal DNA and its diversity, suggesting that it provides better analytical coverage of subseafloor microbial communities than conventional methods.

  18. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Science.gov (United States)

    Li, Shikuo; Shen, Yuhua; Xie, Anjian; Yu, Xuerong; Zhang, Xiuzhen; Yang, Liangbao; Li, Chuanhao

    2007-10-01

    We describe the formation of amorphous selenium (α-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO32-) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO32- ions to Se0, but also controls the nucleation and growth of Se0, and even participates in the formation of α-Se/protein composites. The size and shell thickness of the α-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO32- ions by Capsicum annuum L extract.

  19. Comparative assessment of genomic DNA extraction processes for Plasmodium: Identifying the appropriate method.

    Science.gov (United States)

    Mann, Riti; Sharma, Supriya; Mishra, Neelima; Valecha, Neena; Anvikar, Anupkumar R

    2015-12-01

    Plasmodium DNA, in addition to being used for molecular diagnosis of malaria, find utility in monitoring patient responses to antimalarial drugs, drug resistance studies, genotyping and sequencing purposes. Over the years, numerous protocols have been proposed for extracting Plasmodium DNA from a variety of sources. Given that DNA isolation is fundamental to successful molecular studies, here we review the most commonly used methods for Plasmodium genomic DNA isolation, emphasizing their pros and cons. A comparison of these existing methods has been made, to evaluate their appropriateness for use in different applications and identify the method suitable for a particular laboratory based study. Selection of a suitable and accessible DNA extraction method for Plasmodium requires consideration of many factors, the most important being sensitivity, cost-effectiveness and, purity and stability of isolated DNA. Need of the hour is to accentuate on the development of a method that upholds well on all these parameters.

  20. [Comparison of mtDNA extraction from different parts of sarcosaphagous insects].

    Science.gov (United States)

    Guo, Ya-Dong; Cai, Ji-Feng; Su, Ri-Na; Chang, Yun-Feng; Lan, Ling-Mei; Li, Xiang; Wen, Ji-Fang

    2010-10-01

    To explore mitochondrial DNA (mtDNA) extraction effects of different parts from sarcosaphagous insects using improved cetyltriethylammnonium bromide (CTAB) method. Thirteen Lucilia sericata (Meigen) and 13 Nicrophorus fossor (Erichson) were collected from the corpses of rabbits placed on the outdoor lawn in Huhehot district. Four parts (head, chest muscle, legs and wings) of insect were collected, and the mtDNA of all samples were extracted using CTAB method. The purity and concentration were tested using protein and nucleic acid spectrophotometry. The integrity of the extracted mtDNA and PCR products were checked by agarose gel electrophoresis. The PCR products were sequenced and the obtained sequences were imputed into GenBank for comparison. mtDNA were successfully extracted from 10 head samples, 6 legs samples, 4 wing samples and 13 chest muscle samples of the Lucilia sericata (Meigen). Also, mtDNA were successfully extracted from 5 head samples, 8 legs samples, 3 wing samples and 13 chest muscle samples of the Nicrophorus fossor (Erichson). mtDNA can be obtained from chest muscle and other parts of sarcosaphagous insects using the improved CTAB method.

  1. Decomposable quantum-dots/DNA nanosphere for rapid and ultrasensitive detection of extracellular respiring bacteria.

    Science.gov (United States)

    Wen, Junlin; Zhou, Shungui; Yu, Zhen; Chen, Junhua; Yang, Guiqin; Tang, Jia

    2018-02-15

    Extracellular respiring bacteria (ERB) are a group of bacteria capable of transferring electrons to extracellular acceptors and have important application in environmental remediation. In this study, a decomposable quantum-dots (QDs)/DNA nanosphere probe was developed for rapid and ultrasensitive detection of ERB. The QDs/DNA nanosphere was self-assembled from QDs-streptavidin conjugate (QDs-SA) and Y-shaped DNA nanostructure that is constructed based on toehold-mediated strand displacement. It can release numerous fluorescent QDs-SA in immunomagnetic separation (IMS)-based immunoassay via simple biotin displacement, which remarkably amplifies the signal of antigen-antibody recognizing event. This QDs/DNA-nanosphere-based IMS-fluorescent immunoassay is ultrasensitive for model ERB Shewanella oneidensis, showing a wide detection range between 1.0 cfu/mL and 1.0 × 108 cfu/mL with a low detection limit of 1.37 cfu/mL. Moreover, the proposed IMS-fluorescent immunoassay exhibits high specificity, acceptable reproducibility and stability. Furthermore, the proposed method shows acceptable recovery (92.4-101.4%) for detection of S. oneidensis spiked in river water samples. The proposed IMS-fluorescent immunoassay advances an intelligent strategy for rapid and ultrasensitive quantitation of low-abundance analyte and thus holds promising potential in food, medical and environmental applications. Copyright © 2017. Published by Elsevier B.V.

  2. Comparison of protocols for DNA extraction from long-term preserved formalin fixed tissues.

    Science.gov (United States)

    Paireder, Stefan; Werner, Bettina; Bailer, Josef; Werther, Wolfgang; Schmid, Erich; Patzak, Beatrix; Cichna-Markl, Margit

    2013-08-15

    The current study compared the applicability of protocols to extract DNA from formalin fixed heart tissues that have been preserved for more than 50 years. Ten methods were tested: a cetyltrimethylammonium bromide (CTAB) standard protocol, seven variants of this standard protocol, and two commercial kits. In the case of younger specimens (fixed in 1951, 1934, or 1914), extracts with DNA concentrations ≥ 10.0 ng/μl were obtained with the standard CTAB protocol, two variants of the standard protocol including prolonged tissue digestion (72 h instead of 1-2h), and a commercial kit particularly recommended for DNA extraction from formalin fixed paraffin embedded tissues (FFPE Kit). With the FFPE Kit, DNA could also be extracted from older tissues (fixed in 1893, 1850/1851, or before 1820). In general, the purity of the DNA extracts, assessed from the ratio of the absorbance at 260 and 280 nm, was not very high. In spite of their rather low purity, the DNA extracts could, however, be used to amplify a 122-bp sequence and, in most cases, also a 171-bp sequence of the gene coding for human albumin by the polymerase chain reaction (PCR). Copyright © 2013 Elsevier Inc. All rights reserved.

  3. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction

    DEFF Research Database (Denmark)

    Kumar, Jitendra; Kumar, Manoj; Gupta, Shashank

    2016-01-01

    454 FLX+. Moreover, 16S rRNA gene analysis indicated that compared to other DNA extraction methods tested, the fecal metagenomic DNA isolated with current methodology retains species richness and does not show microbial diversity biases, which is further confirmed by qPCR with a known quantity...

  4. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Science.gov (United States)

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  5. A new protocol for extraction of C0t-1 DNA from rice

    African Journals Online (AJOL)

    USER

    2010-07-12

    Jul 12, 2010 ... A new protocol for extraction of C0t-1 DNA from rice. Chen Yan1#, Guan Li2#, Liu Hong1, Li Gang1 ... plant species differentiation and genome evolution. A new protocol to steadily obtain the aimed ... problem, we have developed a new procedure to steadily obtain the aimed ranges of DNA fragments by ...

  6. DNA damage inhibitory effect and phytochemicals of fermented red brown rice extract

    Directory of Open Access Journals (Sweden)

    Ee-Ling Kong

    2015-09-01

    Full Text Available Objective: To determine the polyphenol compounds (phenolic and flavonoid compounds, antioxidant activity [1,1-diphenylpicryl-2-picrylhydrazyl (DPPH radical scavenging activity] and DNA damage inhibitory effect of fermented local red brown rice. Methods: DNA nicking assay was employed to determine the antioxidant activity of the fermented rice extract. Phytochemical screening was completed using standard methods and DPPH radical assays were used to confirm the antioxidant properties of the extracts. Results: After four days of fermentation, fermented red brown rice had more polyphenol compounds compared to unfermented counterpart. Fermented red brown rice showed greater antioxidant properties with EC50 value of DPPH radical scavenging of 43.00 mg extract/mL or 8 mg quercetin equivalent antioxidant activity. In addition, fermented rice extract showed DNA damage inhibitory effect to a certain extent. It protected DNA from reactive oxygen species; however, at high concentration it might induce reductive damage to DNA, whereas, unfermented red brown rice showed weak DNA damage inhibitory effect. Conclusions: Fermented red brown rice could protect DNA from oxidative damage but might induce reductive damage to DNA at high concentrations.

  7. Quantitative and qualitative assessment of DNA extracted from saliva for its use in forensic identification.

    Science.gov (United States)

    Khare, Parul; Raj, Vineet; Chandra, Shaleen; Agarwal, Suraksha

    2014-05-01

    Saliva has long been known for its diagnostic value in several diseases. It also has a potential to be used in forensic science. The objective of this study is to compare the quantity and quality of DNA samples extracted from saliva with those extracted from blood in order to assess the feasibility of extracting sufficient DNA from saliva for its possible use in forensic identification. Blood and saliva samples were collected from 20 volunteers and DNA extraction was performed through Phenol Chloroform technique. The quantity and quality of isolated DNA was analyzed by spectrophotometery and the samples were then used to amplify short tandem repeat (STR) F13 using the polymerase chain reaction. Mean quantity of DNA obtained in saliva was 48.4 ± 8.2 μg/ml and in blood was 142.5 ± 45.9 μg/ml. Purity of DNA obtained as assessed by the ratio of optical density 260/280, was found to be optimal in 45% salivary samples while remaining showed minor contamination. Despite this positive F13 STR amplification was achieved in 75% of salivary DNA samples. Results of this study showed that saliva may prove to be a useful source of DNA for forensic purpose.

  8. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Co-extraction of high-quality RNA and DNA from rubber tree (Hevea ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    2012-05-15

    May 15, 2012 ... efficient method was developed for co-extracting high-quality DNA and RNA from rubber tree (Hevea brasiliensis) in this ... ratios), agarose electrophoresis analysis and reverse transcription (RT-PCR) of isolated nucleic acids indicate that ... isolate DNA from bacterium and viruses (Lewis and. Metcalf, 1988 ...

  10. Comparison of six extraction techniques for isolation of DNA from filamentous fungi.

    Science.gov (United States)

    van Burik, J A; Schreckhise, R W; White, T C; Bowden, R A; Myerson, D

    1998-10-01

    Filamentous fungi have a sturdy cell wall which is resistant to the usual DNA extraction procedures. We determined the DNA extraction procedure with the greatest yield of high quality fungal DNA and the least predilection for cross-contamination of equipment between specimens. Each of six extraction methods was performed using Aspergillus fumigatus hyphae. The six methods were: (1) glass bead pulverization with vortexing; (2) grinding with mortar and pestle followed by glass bead pulverization; (3) glass bead pulverization using 1% hydroxyacetyl trimethyl ammonium bromide (CTAB) buffer in a water bath sonicator; (4) water bath sonication in CTAB buffer; (5) grinding followed by incubation with CTAB; and (6) lyticase enzymatic cell lysis. Genomic DNA yields were measured by spectrophotometry and by visual reading of 2% agarose gels, with shearing assessed by the migration of the DNA on the gel. Genomic fungal DNA yields were highest for Method 1, followed by Methods 5 approximately = to 2 >3 approximately = to 4 approximately = to 6. Methods 2 and 5, both of which involved grinding with mortar and pestle, led to shearing of the genomic DNA in one of two trials each. We conclude that the use of glass beads with extended vortexing is optimal for extraction of microgramme amounts of DNA from filamentous fungal cultures.

  11. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  12. An efficient DNA extraction method for desert Calligonum species.

    Science.gov (United States)

    Abdellaoui, Raoudha; Gouja, Hassen; Sayah, Amel; Neffati, Mohamed

    2011-12-01

    Genetic conservation programs in arid environments rely on molecular methods for diversity assessments. DNA-based molecular profiling will aid in conservation and protection of species from genetic erosion. Obtaining intact genomic DNA from Calligonum species, of sufficiently high-quality that is readily amplifiable using PCR, is challenging because of the presence of the exceptionally large amount of oxidized polyphenolic compounds, polysaccharides, and other secondary metabolites. The present method involves a modification of the available CTAB method employing higher concentrations of NaCl and CTAB, and incorporating PEG 6000 (1%) and glucose. The yield of DNA was 60-670 μg g(-1) of fresh tissue. The protocol has been tested with two species from the arid region. The DNA isolated was successfully amplified by two ITS primer pairs. PCR-RFLP analysis of the ITS1-5.8S-ITS2 region among and within Calligonum species followed by sequencing is under way.

  13. The rapid determination of sideroxylonals in Eucalyptus foliage by extraction with sonication followed by HPLC.

    Science.gov (United States)

    Wallis, Ian R; Foley, William J

    2005-01-01

    A rapid method is described for the quantification of sideroxylonals, a group of formylated phloroglucinol compounds found in some eucalypts. Samples of dry, ground foliage were extracted by sonication with 20% methanol in acetonitrile, 7% water in acetonitrile or 40% water in acetonitrile and the extracts analysed by reversed phase HPLC. The extracts from the two water-acetonitrile extractions were stable for at least 48 h. All three sonication methods recovered more sideroxylonals than did the Soxhlet extraction with petroleum spirit and acetone. Adding 0.1% trifluoracetic acid to the water-acetonitrile extraction solvents led to even higher recoveries of sideroxylonals. Soaking the sample in extracting solvent for 5 min recovered 70% of the sideroxylonals, whilst sonicating the suspension for 1 min recovered the remainder. The developed method involving sonication of the sample for 5 min in 7% water in acetonitrile with 0.1% trifluoroacetic acid is fast and requires minimal equipment and solvents compared with the traditional methods. With an autosampler it is possible to prepare and run 100 samples a day. More importantly, the technique is ideal for the analysis of small samples, e.g. individual leaves, which is essential when studying the evolutionary ecology of eucalypts.

  14. Extraction of DNA suitable for PCR applications from mature leaves of Mangifera indica L.*

    Science.gov (United States)

    Azmat, Muhammad Abubakkar; Khan, Iqrar Ahmad; Cheema, Hafiza Masooma Naseer; Rajwana, Ishtiaq Ahmad; Khan, Ahmad Sattar; Khan, Asif Ali

    2012-01-01

    Good quality deoxyribonucleic acid (DNA) is the pre-requisite for its downstream applications. The presence of high concentrations of polysaccharides, polyphenols, proteins, and other secondary metabolites in mango leaves poses problem in getting good quality DNA fit for polymerase chain reaction (PCR) applications. The problem is exacerbated when DNA is extracted from mature mango leaves. A reliable and modified protocol based on the cetyltrimethylammonium bromide (CTAB) method for DNA extraction from mature mango leaves is described here. High concentrations of inert salt were used to remove polysaccharides; Polyvinylpyrrolidone (PVP) and β-mercaptoethanol were employed to manage phenolic compounds. Extended chloroform-isoamyl alcohol treatment followed by RNase treatment yielded 950‒1050 µg of good quality DNA, free of protein and RNA. The problems of DNA degradation, contamination, and low yield due to irreversible binding of phenolic compounds and coprecipitation of polysaccharides with DNA were avoided by this method. The DNA isolated by the modified method showed good PCR amplification using simple sequence repeat (SSR) primers. This modified protocol can also be used to extract DNA from other woody plants having similar problems. PMID:22467363

  15. Extraction of DNA suitable for PCR applications from mature leaves of Mangifera indica L.

    Science.gov (United States)

    Azmat, Muhammad Abubakkar; Khan, Iqrar Ahmad; Cheema, Hafiza Masooma Naseer; Rajwana, Ishtiaq Ahmad; Khan, Ahmad Sattar; Khan, Asif Ali

    2012-04-01

    Good quality deoxyribonucleic acid (DNA) is the pre-requisite for its downstream applications. The presence of high concentrations of polysaccharides, polyphenols, proteins, and other secondary metabolites in mango leaves poses problem in getting good quality DNA fit for polymerase chain reaction (PCR) applications. The problem is exacerbated when DNA is extracted from mature mango leaves. A reliable and modified protocol based on the cetyltrimethylammonium bromide (CTAB) method for DNA extraction from mature mango leaves is described here. High concentrations of inert salt were used to remove polysaccharides; Polyvinylpyrrolidone (PVP) and β-mercaptoethanol were employed to manage phenolic compounds. Extended chloroform-isoamyl alcohol treatment followed by RNase treatment yielded 950-1050 µg of good quality DNA, free of protein and RNA. The problems of DNA degradation, contamination, and low yield due to irreversible binding of phenolic compounds and coprecipitation of polysaccharides with DNA were avoided by this method. The DNA isolated by the modified method showed good PCR amplification using simple sequence repeat (SSR) primers. This modified protocol can also be used to extract DNA from other woody plants having similar problems.

  16. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    Directory of Open Access Journals (Sweden)

    Paula Baptista

    2011-06-01

    Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  17. Optimization of DNA extraction from a scleractinian coral for the detection of thymine dimers by immunoassay.

    Science.gov (United States)

    Banaszak, Anastazia T

    2007-01-01

    Ultraviolet (UV)-B is known to cause DNA damage, principally by the formation of thymine dimers, but little research has been conducted in coral reef environments where UV doses are high. The majority of tropical reef-dwelling corals form a mutualistic symbiosis with the dinoflagellate Symbiodinium but few studies have been conducted on in situ DNA damage in corals and none have investigated the symbiotic components separately. The aim of this research was to quantify DNA damage in both the coral host and the dinoflagellate symbiont. The first step in this investigation was to optimize the extraction of DNA from the host, Porites astreoides, as well as the symbiont. The optimization was divided into a series of steps: the preservation of the samples, separation of the coral tissue from the skeleton, separation of the host tissue from the algal cells to prevent cross contamination as well as the extraction and purification of genomic DNA from the algae that are located intracellularly within the invertebrate animal tissue. The best preservation method was freezing at low temperatures without ethanol. After scraping with a razor blade, the coral tissue can be divided into host and algal components and the DNA extracted using modifications of published techniques yielding DNA suitable for the quantification of thymine dimer formation using antibodies. Preliminary data suggest that in P. astreoides collected from 1 m depth, thymine dimers form approximately 2.8 times more frequently in the host DNA than in the DNA of its symbionts.

  18. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  19. The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

    Science.gov (United States)

    Kasu, Mohaimin; Shires, Karen

    2015-07-01

    The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Buccal cells submitted to three different storage conditions before DNA extraction

    Directory of Open Access Journals (Sweden)

    Fernanda Nedel

    2009-04-01

    Full Text Available This study evaluated quantitatively and qualitatively the effect of the storage time of samples before the application of the cell lysis solution (CLS for extracting DNA from buccal cells (BC. BC from the upper and lower gutter region were collected from 5 volunteers using special cytobrushes (Gentra, totaling 3 collections for each individual. In the control group (n=10, CLS was applied soon after BC collection. In the other two groups, samples were stored at room temperature (n=10 or at 4°C (n=10. After CLS application, DNA was extracted according to the manufacturer's instructions (Puregene DNA Buccal Cell Kit; Gentra Systems, Inc.. The DNA obtained was evaluated by two calibrated blind examiners using spectrophotometry and analysis of DNA bands (0.8% agarose gel electrophoresis. The obtained data were submitted to one-way ANOVA. The means and standard deviations for DNA extracted under immediate, room temperature and cooling temperature conditions were 3.5 ± 0.7, 3.0 ± 0.6 and 4.1 ± 1.8 µg, respectively (p=0.385. No significant differences were found in relation to the amount of DNA for the different storage conditions. However, in the visual analysis of the DNA bands, no trace of DNA degradation was detected when CSL was applied soon after DNA collection, while DNA bands with degradation could be observed in the other groups. Within the limitations of the study, it may be concluded that CLS should be applied soon after DNA collection in order to obtain high-quality DNA from BC.

  1. Comparison of DNA extraction kits and modification of DNA elution procedure for the quantitation of subdominant bacteria from piggery effluents with real‐time PCR

    National Research Council Canada - National Science Library

    Desneux, Jérémy; Pourcher, Anne‐Marie

    2014-01-01

    Four commercial DNA extraction kits and a minor modification in the DNA elution procedure were evaluated for the quantitation of bacteria in pig manure samples. The PowerSoil ® , PowerFecal ® , NucleoSpin...

  2. A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

    Directory of Open Access Journals (Sweden)

    Aqeela S. Abuidrees

    2016-06-01

    Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

  3. Tuning Toehold Length and Temperature to Achieve Rapid, Colorimetric Detection of DNA from the Disassembly of DNA-Gold Nanoparticle Aggregates.

    Science.gov (United States)

    Lam, Michael K; Gadzikwa, Tendai; Nguyen, Trang; Kausar, Abu; Alladin-Mustan, B Safeenaz; Sikder, Md Delwar; Gibbs-Davis, Julianne M

    2016-02-16

    Gold nanoparticles have been widely utilized to achieve colorimetric detection for various diagnostic applications. One of the most frequently used methods for DNA detection involves the aggregation of DNA-modified gold nanoparticles driven by target DNA hybridization. This process, however, is intrinsically slow, limiting its use in rapid diagnostics. Here we take advantage of the reverse process: the disassembly of preformed aggregates triggered by the addition of target DNA via a strand displacement mechanism. A systematic study of the dependence of the disassembly rate on temperature, with and without toeholds, has delivered a system that produces an extremely rapid colorimetric response. Furthermore, using an optimal toehold length of 5 nucleotides, target triggered disassembly is rapid over a wide range of ambient temperatures. Using this overhang system, simple visualization of low picomole amounts of target DNA is possible within 10 min at room temperature.

  4. Antioxidant, DNA protective efficacy and HPLC analysis of Annona muricata (soursop) extracts.

    Science.gov (United States)

    George, V Cijo; Kumar, D R Naveen; Suresh, P K; Kumar, R Ashok

    2015-04-01

    Annona muricata is a naturally occurring edible plant with wide array of therapeutic potentials. In India, it has a long history of traditional use in treating various ailments. The present investigation was carried out to characterize the phytochemicals present in the methanolic and aqueous leaf extracts of A. muricata, followed by validation of its radical scavenging and DNA protection activities. The extracts were also analyzed for its total phenolic contents and subjected to HPLC analysis to determine its active metabolites. The radical scavenging activities were premeditated by various complementary assays (DRSA, FRAP and HRSA). Further, its DNA protection efficacy against H2O2 induced toxicity was evaluated using pBR322 plasmid DNA. The results revealed that the extracts were highly rich in various phytochemicals including luteolin, homoorientin, tangeretin, quercetin, daidzein, epicatechin gallate, emodin and coumaric acid. Both the extracts showed significant (p < 0.05) radical scavenging activities, while methanolic extract demonstrated improved protection against H2O2-induced DNA damage when compared to aqueous extract. A strong positive correlation was observed for the estimated total phenolic contents and radical scavenging potentials of the extracts. Further HPLC analysis of the phyto-constituents of the extracts provides a sound scientific basis for compound isolation.

  5. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  6. Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

    Science.gov (United States)

    Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

    2017-03-01

    In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

  7. Extracting DNA from 'jaws': High yield and quality from archived tiger shark (Galeocerdo cuvier) skeletal material

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Morgan, J. A T; Maher, S. L.

    2017-01-01

    Archived specimens are highly valuable sources of DNA for retrospective genetic/genomic analysis. However, often limited effort has been made to evaluate and optimize extraction methods, which may be crucial for downstream applications. Here, we assessed and optimized the usefulness of abundant...... archived skeletal material from sharks as a source of DNA for temporal genomic studies. Six different methods for DNA extraction, encompassing two different commercial kits and three different protocols, were applied to material, so-called bio-swarf, from contemporary and archived jaws and vertebrae...

  8. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

    OpenAIRE

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

  9. Effects of DNA extraction and purification methods on real-time quantitative PCR analysis of Roundup Ready soybean.

    Science.gov (United States)

    Demeke, Tigst; Ratnayaka, Indira; Phan, Anh

    2009-01-01

    The quality of DNA affects the accuracy and repeatability of quantitative PCR results. Different DNA extraction and purification methods were compared for quantification of Roundup Ready (RR) soybean (event 40-3-2) by real-time PCR. DNA was extracted using cetylmethylammonium bromide (CTAB), DNeasy Plant Mini Kit, and Wizard Magnetic DNA purification system for food. CTAB-extracted DNA was also purified using the Zymo (DNA Clean & Concentrator 25 kit), Qtip 100 (Qiagen Genomic-Tip 100/G), and QIAEX II Gel Extraction Kit. The CTAB extraction method provided the largest amount of DNA, and the Zymo purification kit resulted in the highest percentage of DNA recovery. The Abs260/280 and Abs260/230 ratios were less than the expected values for some of the DNA extraction and purification methods used, indicating the presence of substances that could inhibit PCR reactions. Real-time quantitative PCR results were affected by the DNA extraction and purification methods used. Further purification or dilution of the CTAB DNA was required for successful quantification of RR soybean. Less variability of quantitative PCR results was observed among experiments and replications for DNA extracted and/or purified by CTAB, CTAB+Zymo, CTAB+Qtip 100, and DNeasy methods. Correct and repeatable results for real-time PCR quantification of RR soybean were achieved using CTAB DNA purified with Zymo and Qtip 100 methods.

  10. Carbon nanotube-based lateral flow biosensor for sensitive and rapid detection of DNA sequence.

    Science.gov (United States)

    Qiu, Wanwei; Xu, Hui; Takalkar, Sunitha; Gurung, Anant S; Liu, Bin; Zheng, Yafeng; Guo, Zebin; Baloda, Meenu; Baryeh, Kwaku; Liu, Guodong

    2015-02-15

    In this article, we describe a carbon nanotube (CNT)-based lateral flow biosensor (LFB) for rapid and sensitive detection of DNA sequence. Amine-modified DNA detection probe was covalently immobilized on the shortened multi-walled carbon nanotubes (MWCNTs) via diimide-activated amidation between the carboxyl groups on the CNT surface and amine groups on the detection DNA probes. Sandwich-type DNA hybridization reactions were performed on the LFB and the captured MWCNTs on test zone and control zone of LFB produced the characteristic black bands, enabling visual detection of DNA sequences. Combining the advantages of lateral flow chromatographic separation with unique physical properties of MWCNT (large surface area), the optimized LFB was capable of detecting of 0.1 nM target DNA without instrumentation. Quantitative detection could be realized by recording the intensity of the test line with the Image J software, and the detection limit of 40 pM was obtained. This detection limit is 12.5 times lower than that of gold nanoparticle (GNP)-based LFB (0.5 nM, Mao et al. Anal. Chem. 2009, 81, 1660-1668). Another important feature is that the preparation of MWCNT-DNA conjugates was robust and the use of MWCNT labels avoided the aggregation of conjugates and tedious preparation time, which were often met in the traditional GNP-based nucleic acid LFB. The applications of MWCNT-based LFB can be extended to visually detect protein biomarkers using MWCNT-antibody conjugates. The MWCNT-based LFB thus open a new door to prepare a new generation of LFB, and shows great promise for in-field and point-of-care diagnosis of genetic diseases and for the detection of infectious agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Comparison of DNA extraction methods from small samples of newborn screening cards suitable for retrospective perinatal viral research.

    Science.gov (United States)

    McMichael, Gai L; Highet, Amanda R; Gibson, Catherine S; Goldwater, Paul N; O'Callaghan, Michael E; Alvino, Emily R; MacLennan, Alastair H

    2011-04-01

    Reliable detection of viral DNA in stored newborn screening cards (NSC) would give important insight into possible silent infection during pregnancy and around birth. We sought a DNA extraction method with sufficient sensitivity to detect low copy numbers of viral DNA from small punch samples of NSC. Blank NSC were spotted with seronegative EDTA-blood and seropositive EBV EDTA-blood. DNA was extracted with commercial and noncommercial DNA extraction methods and quantified on a spectrofluorometer using a PicoGreen dsDNA quantification kit. Serial dilutions of purified viral DNA controls determined the sensitivity of the amplification protocol, and seropositive EBV EDTA-blood amplified by nested PCR (nPCR) validated the DNA extraction methods. There were considerable differences between the commercial and noncommercial DNA extraction methods (P=0.014; P=0.016). Commercial kits compared favorably, but the QIamp DNA micro kit with an added forensic filter step was marginally more sensitive. The mean DNA yield from this method was 3 ng/μl. The limit of detection was 10 viral genome copies in a 50-μl reaction. EBV nPCR detection in neat and 1:10 diluted DNA extracts could be replicated reliably. We conclude that the QIamp Micro DNA extraction method with the added forensic spin-filter step was suitable for retrospective DNA viral assays from NSC.

  12. Assessing impacts of DNA extraction methods on next generation sequencing of water and wastewater samples.

    Science.gov (United States)

    Walden, Connie; Carbonero, Franck; Zhang, Wen

    2017-10-01

    Next Generation Sequencing (NGS) is increasingly affordable and easier to perform. However, standard protocols prior to the sequencing step are only available for few selected sample types. Here we investigated the impact of DNA extraction methods on the consistency of NGS results. Four commercial DNA extraction kits (QIAamp DNA Mini Kit, QIAamp DNA Stool Mini Kit, MO BIO Power Water Kit, and MO BIO Power Soil DNA Isolation Kit) were used on sample sources including lake water and wastewater, and sample types including planktonic and biofilm bacteria communities. Sampling locations included a lake water reservoir, a trickling filter, and a moving bed biofilm reactor (MBBR). Unique genera such as Gemmatimonadetes, Elusimicrobia, and Latescibacteria were found in multiple samples. The Stool Mini Kit was least efficient in terms of diversity in sampling results with freshwater lake samples, and surprisingly the Power Water Kit was the least efficient across all sample types examined. Detailed NGS beta diversity comparisons indicated that the Mini Kit and PowerSoil Kit are best suited for studies that extract DNA from a variety of water and wastewater samples. We ultimately recommend application of Mini Kit or PowerSoil Kit as an improvement to NGS protocols for these sampling environments. These results are a step toward achieving accurate comparability of complex samples from water and wastewater environments by applying a single DNA extraction method, further streamlining future investigations. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Automated Device for Asynchronous Extraction of RNA, DNA, or Protein Biomarkers from Surrogate Patient Samples.

    Science.gov (United States)

    Bitting, Anna L; Bordelon, Hali; Baglia, Mark L; Davis, Keersten M; Creecy, Amy E; Short, Philip A; Albert, Laura E; Karhade, Aditya V; Wright, David W; Haselton, Frederick R; Adams, Nicholas M

    2016-12-01

    Many biomarker-based diagnostic methods are inhibited by nontarget molecules in patient samples, necessitating biomarker extraction before detection. We have developed a simple device that purifies RNA, DNA, or protein biomarkers from complex biological samples without robotics or fluid pumping. The device design is based on functionalized magnetic beads, which capture biomarkers and remove background biomolecules by magnetically transferring the beads through processing solutions arrayed within small-diameter tubing. The process was automated by wrapping the tubing around a disc-like cassette and rotating it past a magnet using a programmable motor. This device recovered biomarkers at ~80% of the operator-dependent extraction method published previously. The device was validated by extracting biomarkers from a panel of surrogate patient samples containing clinically relevant concentrations of (1) influenza A RNA in nasal swabs, (2) Escherichia coli DNA in urine, (3) Mycobacterium tuberculosis DNA in sputum, and (4) Plasmodium falciparum protein and DNA in blood. The device successfully extracted each biomarker type from samples representing low levels of clinically relevant infectivity (i.e., 7.3 copies/µL of influenza A RNA, 405 copies/µL of E. coli DNA, 0.22 copies/µL of TB DNA, 167 copies/µL of malaria parasite DNA, and 2.7 pM of malaria parasite protein). © 2015 Society for Laboratory Automation and Screening.

  14. Evaluation of methods for the extraction and purification of DNA from the human microbiome.

    Directory of Open Access Journals (Sweden)

    Sanqing Yuan

    Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

  15. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  16. Safer DNA extraction from plant tissues using sucrose buffer and glass fiber filter.

    Science.gov (United States)

    Takakura, Koh-Ichi; Nishio, Takayuki

    2012-11-01

    For some plant species, DNA extraction and downstream experiments are inhibited by various chemicals such as polysaccharides and polyphenols. This short communication proposed an organic-solvent free (except for ethanol) extraction method. This method consists of an initial washing step with STE buffer (0.25 M sucrose, 0.03 M Tris, 0.05 M EDTA), followed by DNA extraction using a piece of glass fiber filter. The advantages of this method are its safety and low cost. The purity of the DNA solution obtained using this method is not necessarily as high as that obtained using the STE/CTAB method, but it is sufficient for PCR experiments. These points were demonstrated empirically with two species, Japanese speedwell and common dandelion, for which DNA has proven difficult to amplify via PCR in past studies.

  17. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  18. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Directory of Open Access Journals (Sweden)

    Paul D N Hebert

    Full Text Available DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  19. Automated serial extraction of DNA and RNA from biobanked tissue specimens

    OpenAIRE

    Mathot, Lucy; Wallin, Monica; Sjöblom, Tobias

    2013-01-01

    Background: With increasing biobanking of biological samples, methods for large scale extraction of nucleic acids are in demand. The lack of such techniques designed for extraction from tissues results in a bottleneck in downstream genetic analyses, particularly in the field of cancer research. We have developed an automated procedure for tissue homogenization and extraction of DNA and RNA into separate fractions from the same frozen tissue specimen. A purpose developed magnetic bead based te...

  20. One-stop genomic DNA extraction by salicylic acid-coated magnetic nanoparticles.

    Science.gov (United States)

    Zhou, Zhongwu; Kadam, Ulhas S; Irudayaraj, Joseph

    2013-11-15

    Salicylic acid-coated magnetic nanoparticles were prepared via a modified one-step synthesis and used for a one-stop extraction of genomic DNA from mammalian cells. The synthesized magnetic particles were used for magnetic separation of cells from the media by nonspecific binding of the particles as well as extraction of genomic DNA from the lysate. The quantity and quality were confirmed by agarose gel electrophoresis and polymerase chain reaction. The entire process of extraction and isolation can be completed within 30 min. Compared with traditional methods based on centrifugation and filtration, the established method is fast, simple, reliable, and environmentally friendly. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  2. Low concentration DNA extraction and recovery using a silica solid phase.

    Directory of Open Access Journals (Sweden)

    Constantinos Katevatis

    Full Text Available DNA extraction from clinical samples is commonly achieved with a silica solid phase extraction column in the presence of a chaotrope. Versions of these protocols have been adapted for point of care (POC diagnostic devices in miniaturized platforms, but commercial kits require a high amount of input DNA. Thus, when the input clinical sample contains less than 1 μg of total DNA, the target-specific DNA recovery from most of these protocols is low without supplementing the sample with exogenous carrier DNA. In fact, many clinical samples used in the development of POC diagnostics often exhibit target DNA concentrations as low as 3 ng/mL. With the broader goal of improving the yield and efficiency of nucleic acid-based POC devices for dilute samples, we investigated both DNA adsorption and recovery from silica particles by using 1 pg- 1 μg of DNA with a set of adsorption and elution buffers ranging in pH and chaotropic presence. In terms of adsorption, we found that low pH and the presence of chaotropic guanidinium thiocyanate (GuSCN enhanced DNA-silica adsorption. When eluting with a standard low-salt, high-pH buffer, > 70% of DNA was unrecoverable, except when DNA was initially adsorbed with 5 M GuSCN at pH 5.2. Unrecovered DNA was either not initially adsorbed or irreversibly bound on the silica surface. Recovery was improved when eluting with 95°C formamide and 1 M NaOH, which suggested that DNA-silica-chaotrope interactions are dominated by hydrophobic interactions and hydrogen bonding. While heated formamide and NaOH are non-ideal elution buffers for practical POC devices, the salient results are important for engineering a set of optimized reagents that could maximize nucleic acid recovery from a microfluidic DNA-silica-chaotrope system.

  3. On-Orbit DNA, RNA, and Protein Extraction Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Genova Engineering proposes to develop and demonstrate a toolset of discrete devices and extraction kits which will leverage existing on-orbit facilities and will...

  4. Comparison of seven methods for extraction of bacterial DNA from fecal and cecal samples of mice.

    Science.gov (United States)

    Ferrand, Janina; Patron, Kevin; Legrand-Frossi, Christine; Frippiat, Jean-Pol; Merlin, Christophe; Alauzet, Corentine; Lozniewski, Alain

    2014-10-01

    Analysis of bacterial DNA from fecal samples of mice is commonly performed in experimental studies. Although DNA extraction is a critical step in various molecular approaches, the efficiency of methods that may be used for DNA extraction from mice fecal samples has never been evaluated. We compared the efficiencies of six widely used commercial kits (MasterPure™ Gram Positive DNA Purification Kit, QIAamp® DNA Stool Mini Kit; NucliSENS® easyMAG®, ZR Fecal DNA MiniPrep™, FastDNA® SPIN Kit for Feces and FastDNA® SPIN Kit for Soil) and a non-commercial method for DNA isolation from mice feces and cecal contents. DNA quantity and quality were assessed by fluorometry, spectrophotometry, gel electrophoresis and qPCR. Cell lysis efficiencies were evaluated by qPCR targeting three relevant bacteria in spiked specimens. For both feces and intestinal contents, the most efficient extraction method was the FastDNA® SPIN Kit for Soil. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. An alternative protocol for DNA extraction from formalin fixed and paraffin wax embedded tissue.

    Science.gov (United States)

    Coura, R; Prolla, J C; Meurer, L; Ashton-Prolla, P

    2005-08-01

    DNA extraction from paraffin wax embedded tissue requires special protocols, and most described methods report an amplification success rate of 60-80%. To propose a simple and inexpensive protocol consisting of xylene/ethanol dewaxing, followed by a kit based extraction. Xylene/ethanol dewaxing was followed by a long rehydration step and a kit based DNA extraction step. This method produced a 100% amplification success rate for fragments of 121 to 227 bp for tamponated formalin fixed paraffin wax embedded tissue. This cost effective and non-laborious protocol can successfully extract DNA from tamponated formalin fixed paraffin wax embedded tissue and should facilitate the molecular analysis of a large number of archival specimens in retrospective studies.

  6. Comparison and optimization of methods for the simultaneous extraction of DNA, RNA, proteins, and metabolites.

    Science.gov (United States)

    Vorreiter, Fränze; Richter, Silke; Peter, Michel; Baumann, Sven; von Bergen, Martin; Tomm, Janina M

    2016-09-01

    The challenge of performing a time-resolved comprehensive analysis of molecular systems has led to the quest to optimize extraction methods. When the size of a biological sample is limited, there is demand for the simultaneous extraction of molecules representing the four areas of "omics": genomics, transcriptomics, proteomics, and metabolomics. Here we optimized a protocol for the simultaneous extraction of DNA, RNA, proteins, and metabolites and compared it with two existing protocols. Our optimization comprised the addition of a methanol/chloroform metabolite purification before the separation of DNA/RNA and proteins. Extracted DNA, RNA, proteins, and metabolites were quantitatively and/or qualitatively analyzed. Of the three methods, only the newly developed protocol yielded all biomolecule classes of adequate quantity and quality. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Tracing tree nut allergens in chocolate: A comparison of DNA extraction protocols.

    Science.gov (United States)

    Costa, Joana; Melo, Vítor S; Santos, Cristina G; Oliveira, M Beatriz P P; Mafra, Isabel

    2015-11-15

    The present work aimed at comparing different DNA extraction methods, from chocolate matrices, for the effective application in molecular techniques to detect tree nut allergens. For this study, DNA from almond or hazelnut model chocolates was extracted using seven selected protocols: the in-house methods of CTAB-PVP (cetyltrimethylammonium bromide-polyvinylpyrrolidone), Wizard with and without RNase, Wizard-PVP with and without RNase, and the Wizard Magnetic and Nucleospin kits. The extracts were assessed for their suitability for amplification by qualitative PCR and real-time PCR. From the evaluated protocols, Nucleospin presented the best results for almond and hazelnut amplification, achieving a limit of detection of 0.005% (w/w) with high PCR efficiency, linearity and range of amplification. These results highlight the importance of the DNA extraction protocol in the case of food allergens from complex matrices, such as chocolate, in which sensitivity is a key parameter. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and quantity from culturable and uncultured microbial species living in that environment. Proper lysis of heterogeneous community microbial cells without damaging their genomes is a major challenge. In this study, we have developed an improved method for extraction of community DNA from different environmental......To explore the natural microbial community of any ecosystems by high-resolution molecular approaches including next generation sequencing, it is extremely important to develop a sensitive and reproducible DNA extraction method that facilitate isolation of microbial DNA of sufficient purity...... and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...

  9. High-quality genomic DNA extraction from formalin-fixed and paraffin-embedded samples deparaffinized using mineral oil.

    Science.gov (United States)

    Lin, Jianghai; Kennedy, Stephen H; Svarovsky, Therese; Rogers, Jeffrey; Kemnitz, Joseph W; Xu, Anlong; Zondervan, Krina T

    2009-12-15

    Extracting DNA from formalin-fixed and paraffin-embedded (FFPE) tissue remains a challenge, despite numerous attempts to develop a more effective method. Polymerase chain reaction (PCR) success rates with DNA extracted using current methods remain low. We extracted DNA from 140 long-term archived FFPE samples using a simple but effective deparaffinization method, removing the wax with mineral oil, and a commercially available DNA extraction kit. DNA quality was subsequently tested in a genotyping experiment with 14 microsatellite markers. High-quality DNA was obtained with a mean PCR success rate of 97% (range: 88-100%) across markers. The results suggested that DNA extracted using this novel method is likely to be suitable for genetic studies involving DNA fragments <200 bp.

  10. Antigenotoxic Effect of Trametes spp. Extracts against DNA Damage on Human Peripheral White Blood Cells

    Directory of Open Access Journals (Sweden)

    Aleksandar Knežević

    2015-01-01

    Full Text Available Trametes species have been used for thousands of years in traditional and conventional medicine for the treatment of various types of diseases. The goal was to evaluate possible antigenotoxic effects of mycelium and basidiocarp extracts of selected Trametes species and to assess dependence on their antioxidant potential. Trametes versicolor, T. hirsuta, and T. gibbosa were the species studied. Antigenotoxic potentials of extracts were assessed on human peripheral white blood cells with basidiocarp and mycelium extracts of the species. The alkaline comet test was used for detection of DNA strand breaks and alkali-labile sites, as well as the extent of DNA migration. DPPH assay was used to estimate antioxidative properties of extracts. Fruiting body extracts of T. versicolor and T. gibbosa as well as T. hirsuta extracts, except that at 20.0 mg/mL, were not genotoxic agents. T. versicolor extract had at 5.0 mg/mL the greatest antigenotoxic effect in both pre- and posttreatment of leukocytes. The mycelium extracts of the three species had no genotoxic activity and significant antigenotoxic effect against H2O2-induced DNA damage, both in pre- and posttreatment. The results suggest that extracts of these three species could be considered as strong antigenotoxic agents able to stimulate genoprotective response of cells.

  11. [Influence of different DNA extractions on the identification of streptococcus sanguis group by arbitrary primed polymerase chain reaction

    Science.gov (United States)

    Zhang, Wei-Dong; Chen, Hui; Yu, Zhong-Sheng

    2002-08-01

    OBJECTIVE: To assess the influence of different DNA extractions on the identification of streptococcus sanguis group (SSG) species by arbitrary primed polymerase chain reaction (AP-PCR). METHODS: AP-PCR was used to distinguish SSG species by designing 25bp arbitrary primer 5'AAG AGA GGA GCT AGC TCT TCT TGG A 3', and the genomic DNA was extracted by 3 methods. RESULTS: There were great differences in the main band of DNA polymorphism among SSG species. The similar band could be got from the different DNA extractions in the same species. CONCLUSION: Different DNA extractions have no influence on the identification of SSG.

  12. Efficiency of EGFR mutation analysis for small microdissected cytological specimens using multitech DNA extraction solution.

    Science.gov (United States)

    Oh, Seo Young; Lee, Hoon Taek

    2015-07-01

    The microdissection method has greatly facilitated the isolation of pure cell populations for accurate analysis of mutations. However, the absence of coverslips in these preparations leads to poor resolution of cellular morphological features. In the current study, the authors developed the MultiTech DNA extraction solution to improve the visualization of cell morphology for microdissection and tested it for the preservation of morphological properties of cells, quality of DNA, and ability to detect mutations. A total of 121 cytological samples, including fine-needle aspirates, sputum, pleural fluid, and bronchial washings, were selected from hospital archives. DNA extracted from microdissected cells was evaluated by epidermal growth factor receptor (EGFR) mutation analysis using pyrosequencing, Sanger sequencing, and peptide nucleic acid (PNA)-mediated real-time polymerase chain reaction clamping. Morphological features of cells as well as DNA quality and quantity were analyzed in several cytological samples to assess the performance of the MultiTech DNA extraction solution. The results were compared with previous EGFR mutation tests. The MultiTech DNA extraction solution improved the morphology of archived stained cells before microdissection and provided a higher DNA yield than the commercial QIAamp DNA Mini Kit in samples containing a minimal number of cells (25-50 cells). The authors were able to detect identical EGFR mutations by using different analysis platforms and consistently identified these mutations in samples comprising as few as 25 microdissected cells. The MultiTech DNA extraction solution is a reliable medium that improves the resolution of cell morphology during microdissection. It was particularly useful in EGFR mutations of samples containing a small number of cells. © 2015 American Cancer Society.

  13. Fatty acids are rapidly delivered to and extracted from membranes by methyl-beta-cyclodextrin.

    Science.gov (United States)

    Brunaldi, Kellen; Huang, Nasi; Hamilton, James A

    2010-01-01

    We performed detailed biophysical studies of transfer of long-chain fatty acids (FAs) from methyl-beta-CD (MBCD) to model membranes (egg-PC vesicles) and cells and the extraction of FA from membranes by MBCD. We used i) fluorescein phosphatidylethanolamine to detect transfer of FA anions arriving in the outer membrane leaflet; ii) entrapped pH dyes to measure pH changes after FA diffusion (flip-flop) across the lipid bilayer; and iii) soluble fluorescent-labeled FA binding protein to measure the concentration of unbound FA in water. FA dissociated from MBCD, bound to the membrane, and underwent flip-flop within milliseconds. In the presence of vesicles, MBCD maintained the aqueous concentration of unbound FA at low levels comparable to those measured with albumin. In studies with cells, addition of oleic acid (OA) complexed with MBCD yielded rapid (seconds) dose-dependent OA transport into 3T3-L1 preadipocytes and HepG2 cells. MBCD extracted OA from cells and model membranes rapidly at concentrations exceeding those required for OA delivery but much lower than concentrations commonly used for extracting cholesterol. Compared with albumin, MBCD can transfer its entire FA load and is less likely to extract cell nutrients and to introduce impurities.

  14. Evaluation of wavelet techniques in rapid extraction of ABR variations from underlying EEG.

    Science.gov (United States)

    De Silva, A C; Schier, M A

    2011-11-01

    The aim of this study is to analyse an effective wavelet method for denoising and tracking temporal variations of the auditory brainstem response (ABR). The rapid and accurate extraction of ABRs in clinical practice has numerous benefits, including reductions in clinical test times and potential long-term patient monitoring applications. One method of achieving rapid extraction is through the application of wavelet filtering which, according to earlier research, has shown potential in denoising signals with low signal-to-noise ratios. The research documented in this paper evaluates the application of three such wavelet approaches on a common set of ABR data collected from eight participants. We introduced the use of the latency-intensity curve of ABR wave V for performance evaluation of tracking temporal variations. The application of these methods to the ABR required establishing threshold functions and time windows as an integral part of the research. Results revealed that the cyclic-shift-tree-denoising performed superior compared to other tested approaches. This required an ensemble of only 32 epochs to extract a fully featured ABR compared to the 1024 epochs with conventional ABR extraction based on linear moving time averaging.

  15. Invader or resident? Ancient-DNA reveals rapid species turnover in New Zealand little penguins.

    Science.gov (United States)

    Grosser, Stefanie; Rawlence, Nicolas J; Anderson, Christian N K; Smith, Ian W G; Scofield, R Paul; Waters, Jonathan M

    2016-02-10

    The expansion of humans into previously unoccupied parts of the globe is thought to have driven the decline and extinction of numerous vertebrate species. In New Zealand, human settlement in the late thirteenth century AD led to the rapid demise of a distinctive vertebrate fauna, and also a number of 'turnover' events where extinct lineages were subsequently replaced by closely related taxa. The recent genetic detection of an Australian little penguin (Eudyptula novaehollandiae) in southeastern New Zealand may potentially represent an additional 'cryptic' invasion. Here we use ancient-DNA (aDNA) analysis and radiocarbon dating of pre-human, archaeological and historical Eudyptula remains to reveal that the arrival of E. novaehollandiae in New Zealand probably occurred between AD 1500 and 1900, following the anthropogenic decline of its sister taxon, the endemic Eudyptula minor. This rapid turnover event, revealed by aDNA, suggests that native species decline can be masked by invasive taxa, and highlights the potential for human-mediated biodiversity shifts. © 2016 The Author(s).

  16. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics.

    Science.gov (United States)

    Josefsen, Mathilde H; Andersen, Sandra C; Christensen, Julia; Hoorfar, Jeffrey

    2015-07-01

    The efficiency of ten widely applied DNA extraction protocols was evaluated for suitability for diagnostic metagenomics. The protocols were selected based on a thorough literature study. Chicken fecal samples inoculated with about 1×10(3) and 1×10(6) CFU/g Campylobacter jejuni were used as a model. The evaluation was performed based on total DNA yield measured by fluorometry, and quality and quantity of C. jejuni DNA measured by real-time PCR. There was up to a 25-fold variance between the lowest (NucliSens miniMAG, BIOMÉRIEUX) and highest (PowerLyzer PowerSoil DNA Isolation Kit, MO BIO Laboratories) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold increase in total DNA was observed following the protocol for human DNA analysis and including a 5 min heating step at 70°C. For the PowerLyzer PowerSoil and the PowerFecal DNA Isolation Kit (MO BIO Laboratories) the total DNA fold increase was 1.6 to 1.8 when including an extra 10 min of bead-vortexing. There was no correlation between the yield of total DNA and the amount of PCR-amplifiable DNA from C. jejuni. The protocols resulting in the highest yield of total DNA did not show correspondingly increased levels of C. jejuni DNA as determined by PCR. In conclusion, substantial variation in the efficiency of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Comparison of DNA extraction kits for PCR-DGGE analysis of human intestinal microbial communities from fecal specimens

    Directory of Open Access Journals (Sweden)

    Nakatsu Cindy H

    2010-05-01

    Full Text Available Abstract Background The influence of diet on intestinal microflora has been investigated mainly using conventional microbiological approaches. Although these studies have advanced knowledge on human intestinal microflora, it is imperative that new methods are applied to facilitate scientific progress. Culture-independent molecular fingerprinting method of Polymerase Chain Reaction and Denaturing Gradient Gel Electrophoresis (PCR-DGGE has been used to study microbial communities in a variety of environmental samples. However, these protocols must be optimized prior to their application in order to enhance the quality and accuracy of downstream analyses. In this study, the relative efficacy of four commercial DNA extraction kits (Mobio Ultra Clean® Fecal DNA Isolation Kit, M; QIAamp® DNA Stool Mini Kit, Q; FastDNA® SPIN Kit, FSp; FastDNA® SPIN Kit for Soil, FSo were evaluated. Further, PCR-DGGE technique was also assessed for its feasibility in detecting differences in human intestinal bacterial fingerprint profiles. Method Total DNA was extracted from varying weights of human fecal specimens using four different kits, followed by PCR amplification of bacterial 16S rRNA genes, and DGGE separation of the amplicons. Results Regardless of kit, maximum DNA yield was obtained using 10 to 50 mg (wet wt of fecal specimens and similar DGGE profiles were obtained. However, kits FSp and FSo extracted significantly larger amounts of DNA per g dry fecal specimens and produced more bands on their DGGE profiles than kits M and Q due to their use of bead-containing lysing matrix and vigorous shaking step. DGGE of 16S rRNA gene PCR products was suitable for capturing the profiles of human intestinal microbial community and enabled rapid comparative assessment of inter- and intra-subject differences. Conclusion We conclude that extraction kits that incorporated bead-containing lysing matrix and vigorous shaking produced high quality DNA from human fecal

  18. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...... samples using three different extraction methods. No consistent differences were observed in DNA yields between extractions on fresh and frozen samples, however differences were observed between extraction methods. Quantitative PCR analysis was subsequently performed on all DNA samples using six different...

  19. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    2012-01-01

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...... samples using three different extraction methods. No consistent differences were observed in DNA yields between extractions on fresh and frozen samples; however, differences were observed between extraction methods. Quantitative PCR analysis was subsequently performed on all DNA samples using six...

  20. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... The mixed were transferred to a test tube. (with cap), 2 ml phenol were added again and were centrifuged for. 5 min to separate phase. The upper aqueous phase was tran- sferred into new tube. Then, two volume of ice-cool 95% ethanol were added to the aqueous phase for ethanol precipitated DNA and.

  1. Influence of EDTA and magnesium on DNA extraction from blood ...

    African Journals Online (AJOL)

    This study consisting of two trails conducted to examine the impact of initial EDTA level added to blood samples on quantity and quality of genomic DNA isolated from avian fresh blood and the influence of initial EDTA level with various levels of MgCl2 added to polymerase chain reaction (PCR) final volume on amplification ...

  2. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    ily and was well digested by restriction enzymes. All of the other methods tested resulted in the ... that was not contaminated with inhibitors of DNA modifying enzymes and poly- merases. Both pathogens secrete excessive .... De gomziekte van het suikerret. hare oorzaak in hare bestrijding. Archief voor de Suikerindustrie ...

  3. Field collection, preservation and large scale DNA extraction ...

    African Journals Online (AJOL)

    Some genetic studies using molecular methods such as diversity assessment or marker-assisted selection require collection of a large number of samples from fields located in the vicinity or in remote areas, followed by isolation of good quality DNA in a short time span. In the present study, different tissue preservation ...

  4. Pilot study of DNA extraction from archival unstained bone marrow ...

    African Journals Online (AJOL)

    coagulant whole blood, bloodstains, hairs, tissue samples and buccal epithelial cells. The purpose of this study was to compare yield and quality of DNA samples obtained with the use of three different methods. The ability of these procedures to ...

  5. Influence of EDTA and magnesium on DNA extraction from blood ...

    African Journals Online (AJOL)

    KEN

    2007-02-05

    Feb 5, 2007 ... This study consisting of two trails conducted to examine the impact of initial EDTA level added to blood samples on quantity and quality of genomic DNA isolated from avian fresh blood and the influence of initial EDTA level with various levels of MgCl2 added to polymerase chain reaction (PCR) final volume ...

  6. Field collection, preservation and large scale DNA extraction ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Some genetic studies using molecular methods such as diversity assessment or marker-assisted selection require collection of a large number of samples from fields located in the vicinity or in remote areas, followed by isolation of good quality DNA in a short time span. In the present study, different.

  7. Xenopus egg extract to study regulation of genome-wide and locus-specific DNA replication.

    Science.gov (United States)

    Raspelli, Erica; Falbo, Lucia; Costanzo, Vincenzo

    2017-01-01

    Faithful DNA replication, coupled with accurate repair of DNA damage, is essential to maintain genome stability and relies on different DNA metabolism genes. Many of these genes are involved in the assembly of replication origins, in the coordination of DNA repair to protect replication forks progression in the presence of DNA damage and in the replication of repetitive chromatin regions. Some DNA metabolism genes are essential in higher eukaryotes, suggesting the existence of specialized mechanisms of repair and replication in organisms with complex genomes. The impact on cell survival of many of these genes has so far precluded in depth molecular analysis of their function. The cell-free Xenopus laevis egg extract represents an ideal system to overcome survival issues and to facilitate the biochemical study of replication-associated functions of essential proteins in vertebrate organisms. Here, we will discuss how Xenopus egg extracts have been used to study cellular and molecular processes, such as DNA replication and DNA repair. In particular, we will focus on innovative imaging and proteomic-based experimental approaches to characterize the molecular function of a number of essential DNA metabolism factors involved in the duplication of complex vertebrate genomes. © 2017 Wiley Periodicals, Inc.

  8. Use of a Filter Cartridge for Filtration of Water Samples and Extraction of Environmental DNA.

    Science.gov (United States)

    Miya, Masaki; Minamoto, Toshifumi; Yamanaka, Hiroki; Oka, Shin-Ichiro; Sato, Keiichi; Yamamoto, Satoshi; Sado, Tetsuya; Doi, Hideyuki

    2016-11-25

    Recent studies demonstrated the use of environmental DNA (eDNA) from fishes to be appropriate as a non-invasive monitoring tool. Most of these studies employed disk fiber filters to collect eDNA from water samples, although a number of microbial studies in aquatic environments have employed filter cartridges, because the cartridge has the advantage of accommodating large water volumes and of overall ease of use. Here we provide a protocol for filtration of water samples using the filter cartridge and extraction of eDNA from the filter without having to cut open the housing. The main portions of this protocol consists of 1) filtration of water samples (water volumes ≤4 L or >4 L); (2) extraction of DNA on the filter using a roller shaker placed in a preheated incubator; and (3) purification of DNA using a commercial kit. With the use of this and previously-used protocols, we perform metabarcoding analysis of eDNA taken from a huge aquarium tank (7,500 m3) with known species composition, and show the number of detected species per library from the two protocols as the representative results. This protocol has been developed for metabarcoding eDNA from fishes, but is also applicable to eDNA from other organisms.

  9. DNA extraction from human saliva deposited on skin and its use in forensic identification procedures.

    Science.gov (United States)

    Anzai-Kanto, Evelyn; Hirata, Mário Hiroyuki; Hirata, Rosario Dominguez Crespo; Nunes, Fabio Daumas; Melani, Rodolfo Francisco Haltenhoff; Oliveira, Rogério Nogueira

    2005-01-01

    Saliva is usually deposited in bite marks found in many homicides, assault and other criminal cases. In the present study, saliva obtained from volunteers was deposited on skin and recovered for DNA extraction and typing in order to evaluate its usefulness for practical case investigation and discuss the contribution of forensic dentistry to saliva DNA typing. Twenty saliva samples were collected from different donors and used as suspects' samples. Five of these samples were randomly selected and deposited (250 microl) on arm skin. Saliva was collected from skin using the double swab technique. DNA from saliva and skin-deposited saliva samples was extracted by the phenol-chloroform method. DNA samples were amplified by PCR for DNA typing using a set of 15 STRs. The recovery of DNA from saliva deposited in the skin was 14 to 10 times lower than DNA quantity from saliva samples. DNA typing was demonstrated in 4 of 5 deposited saliva samples, the likelihood ratios estimated for these samples based on data of the Brazilian population were 1:11, 1:500, 1:159.140 and 1:153.700.123. Our results indicate that standardized procedures used for DNA collection and extraction from skin-deposited saliva can be used as a method to recover salivary DNA in criminal cases. However, it is important to observe that DNA recovery in forensic samples can be difficult. This study suggests that the analysis of saliva deposited on skin be incorporated into a criminal investigation since it may have great discriminatory power.

  10. Ultrasensitive, rapid and inexpensive detection of DNA using paper based lateral flow assay

    Science.gov (United States)

    Jauset-Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; McNeil, Calum; Keegan, Neil; Saeed, Ayman; Abbas, Mohammad Nooredeen; El-Shahawi, Mohammad S.; Bashammakh, Abdulaziz S.; Alyoubi, Abdulrahman O.; O´Sullivan, Ciara K.

    2016-01-01

    Sensitive, specific, rapid, inexpensive and easy-to-use nucleic acid tests for use at the point-of-need are critical for the emerging field of personalised medicine for which companion diagnostics are essential, as well as for application in low resource settings. Here we report on the development of a point-of-care nucleic acid lateral flow test for the direct detection of isothermally amplified DNA. The recombinase polymerase amplification method is modified slightly to use tailed primers, resulting in an amplicon with a duplex flanked by two single stranded DNA tails. This tailed amplicon facilitates detection via hybridisation to a surface immobilised oligonucleotide capture probe and a gold nanoparticle labelled reporter probe. A detection limit of 1 × 10−11 M (190 amol), equivalent to 8.67 × 105 copies of DNA was achieved, with the entire assay, both amplification and detection, being completed in less than 15 minutes at a constant temperature of 37 °C. The use of the tailed primers obviates the need for hapten labelling and consequent use of capture and reporter antibodies, whilst also avoiding the need for any post-amplification processing for the generation of single stranded DNA, thus presenting an assay that can facilely find application at the point of need. PMID:27886248

  11. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  12. Developmental validation of a forensic rapid DNA-STR kit: Expressmarker 16.

    Science.gov (United States)

    Zhou, Huaigu; Wu, Dan; Chen, Ronghua; Xu, Yan; Xia, Zifang; Guo, Yulin; Zhang, Fan; Zheng, Weiguo

    2014-07-01

    DNA-STR analysis is widely used in the forensic science field and has important requirements on the analysis time to obtain faster inspections. The developed forensic STR kit, referred to as Expressmarker 16 (EX16), could shorten the amplification time to a minimum of 35min. It enables 16 STR loci to be co-detected, including 13 CODIS loci, D2S1338, D6S1043 and Amelogenin loci. The kit is validated by a series of tests formed by DNA mixtures, stutter ratios, optimized PCR protocols based on annealing temperature research, species specificities, inhibitors, sensitivity, and parallel tests according to FBI QAS (2009/2011) (QAS, 2009; SWGDAM, 2010). The results demonstrated that EX16 was a useful tool for rapid criminal investigation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Microfluidic extraction, stretching and analysis of human chromosomal DNA from single cells.

    Science.gov (United States)

    Benítez, Jaime J; Topolancik, Juraj; Tian, Harvey C; Wallin, Christopher B; Latulippe, David R; Szeto, Kylan; Murphy, Patrick J; Cipriany, Benjamin R; Levy, Stephen L; Soloway, Paul D; Craighead, Harold G

    2012-11-21

    We describe a microfluidic device for the extraction, purification and stretching of human chromosomal DNA from single cells. A two-dimensional array of micropillars in a microfluidic polydimethylsiloxane channel was designed to capture a single human cell. Megabase-long DNA strands released from the cell upon lysis are trapped in the micropillar array and stretched under optimal hydrodynamic flow conditions. Intact chromosomal DNA is entangled in the array, while other cellular components are washed from the channel. To demonstrate the entrapment principle, a single chromosome was hybridized to whole chromosome paints, and imaged by fluorescence microscopy. DNA extracted from a single cell and small cell populations (less than 100) was released from the device by restriction endonuclease digestion under continuous flow and collected for off-chip analysis. Quantification of the extracted material reveals that the microdevice efficiently extracts essentially all chromosomal DNA. The device described represents a novel platform to perform a variety of analyses on chromosomal DNA at the single cell level.

  14. Microfluidic extraction, stretching and analysis of human chromosomal DNA from single cells†

    Science.gov (United States)

    Benítez, Jaime J.; Topolancik, Juraj; Tian, Harvey C.; Wallin, Christopher B.; Latulippe, David R.; Szeto, Kylan; Murphy, Patrick J.; Cipriany, Benjamin R.; Levy, Stephen L.; Soloway, Paul D.; Craighead, Harold G.

    2014-01-01

    We describe a microfluidic device for the extraction, purification and stretching of human chromosomal DNA from single cells. A two-dimensional array of micropillars in a microfluidic polydimethylsiloxane channel was designed to capture a single human cell. Megabase-long DNA strands released from the cell upon lysis are trapped in the micropillar array and stretched under optimal hydrodynamic flow conditions. Intact chromosomal DNA is entangled in the array, while other cellular components are washed from the channel. To demonstrate the entrapment principle, a single chromosome was hybridized to whole chromosome paints, and imaged by fluorescence microscopy. DNA extracted from a single cell and small cell populations (less than 100) was released from the device by restriction endonuclease digestion under continuous flow and collected for offchip analysis. Quantification of the extracted material reveals that the microdevice efficiently extracts essentially all chromosomal DNA. The device described represents a novel platform to perform a variety of analyses on chromosomal DNA at the single cell level. PMID:23018789

  15. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  16. Lysis efficiency of standard DNA extraction methods for Halococcus spp. in an organic rich environment.

    Science.gov (United States)

    Leuko, S; Goh, F; Ibáñez-Peral, R; Burns, B P; Walter, M R; Neilan, B A

    2008-03-01

    The extraction of nucleic acids from a given environment marks a crucial and essential starting point in any molecular investigation. Members of Halococcus spp. are known for their rigid cell walls, and are thus difficult to lyse and could potentially be overlooked in an environment. Furthermore, the lack of a suitable lysis method hinders subsequent molecular analysis. The effects of six different DNA extraction methods were tested on Halococcus hamelinensis, Halococcus saccharolyticus and Halobacterium salinarum NRC-1 as well as on an organic rich, highly carbonated sediment from stromatolites spiked with Halococcus hamelinensis. The methods tested were based on physical disruption (boiling and freeze/thawing), chemical lysis (Triton X-100, potassium ethyl xanthogenate (XS) buffer and CTAB) and on enzymatic lysis (lysozyme). Results showed that boiling and freeze/thawing had little effect on the lysis of both Halococcus strains. Methods based on chemical lysis (Triton X-100, XS-buffer, and CTAB) showed the best results, however, Triton X-100 treatment failed to produce visible DNA fragments. Using a combination of bead beating, chemical lysis with lysozyme, and thermal shock, lysis of cells was achieved however DNA was badly sheared. Lysis of cells and DNA extraction of samples from spiked sediment proved to be difficult, with the XS-buffer method indicating the best results. This study provides an evaluation of six commonly used methods of cell lysis and DNA extraction of Halococcus spp., and the suitability of the resulting DNA for molecular analysis.

  17. Extraction of High Quality DNA from Seized Moroccan Cannabis Resin (Hashish)

    Science.gov (United States)

    El Alaoui, Moulay Abdelaziz; Melloul, Marouane; Alaoui Amine, Sanaâ; Stambouli, Hamid; El Bouri, Aziz; Soulaymani, Abdelmajid; El Fahime, Elmostafa

    2013-01-01

    The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish) free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004) adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR) amplification of tetrahydrocannabinolic acid (THCA) synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish) resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances. PMID:24124454

  18. Rapid detection of Ganoderma-infected oil palms by microwave ergosterol extraction with HPLC and TLC.

    Science.gov (United States)

    Muniroh, M S; Sariah, M; Zainal Abidin, M A; Lima, N; Paterson, R R M

    2014-05-01

    Detection of basal stem rot (BSR) by Ganoderma of oil palms was based on foliar symptoms and production of basidiomata. Enzyme-Linked Immunosorbent Assays-Polyclonal Antibody (ELISA-PAB) and PCR have been proposed as early detection methods for the disease. These techniques are complex, time consuming and have accuracy limitations. An ergosterol method was developed which correlated well with the degree of infection in oil palms, including samples growing in plantations. However, the method was capable of being optimised. This current study was designed to develop a simpler, more rapid and efficient ergosterol method with utility in the field that involved the use of microwave extraction. The optimised procedure involved extracting a small amount of Ganoderma, or Ganoderma-infected oil palm suspended in low volumes of solvent followed by irradiation in a conventional microwave oven at 70°C and medium high power for 30s, resulting in simultaneous extraction and saponification. Ergosterol was detected by thin layer chromatography (TLC) and quantified using high performance liquid chromatography with diode array detection. The TLC method was novel and provided a simple, inexpensive method with utility in the field. The new method was particularly effective at extracting high yields of ergosterol from infected oil palm and enables rapid analysis of field samples on site, allowing infected oil palms to be treated or culled very rapidly. Some limitations of the method are discussed herein. The procedures lend themselves to controlling the disease more effectively and allowing more effective use of land currently employed to grow oil palms, thereby reducing pressure to develop new plantations. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.

    Science.gov (United States)

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan

    2015-09-30

    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition.

  20. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  1. Extracting DNA from 'jaws': High yield and quality from archived tiger shark (Galeocerdo cuvier) skeletal material

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Morgan, J. A T; Maher, S. L.

    2017-01-01

    archived skeletal material from sharks as a source of DNA for temporal genomic studies. Six different methods for DNA extraction, encompassing two different commercial kits and three different protocols, were applied to material, so-called bio-swarf, from contemporary and archived jaws and vertebrae...... of tiger sharks (Galeocerdo cuvier). Protocols were compared for DNA yield and quality using a qPCR approach. For jaw swarf, all methods provided relatively high DNA yield and quality, while large differences in yield between protocols were observed for vertebrae. Similar results were obtained from samples...... of white shark (Carcharodon carcharias). Application of the optimized methods to 38 museum and private angler trophy specimens dating back to 1912 yielded sufficient DNA for downstream genomic analysis for 68% of the samples. No clear relationships between age of samples, DNA quality and quantity were...

  2. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  3. Comparing the performance of three ancient DNA extraction methods for high-throughput sequencing.

    Science.gov (United States)

    Gamba, Cristina; Hanghøj, Kristian; Gaunitz, Charleen; Alfarhan, Ahmed H; Alquraishi, Saleh A; Al-Rasheid, Khaled A S; Bradley, Daniel G; Orlando, Ludovic

    2016-03-01

    The DNA molecules that can be extracted from archaeological and palaeontological remains are often degraded and massively contaminated with environmental microbial material. This reduces the efficacy of shotgun approaches for sequencing ancient genomes, despite the decreasing sequencing costs of high-throughput sequencing (HTS). Improving the recovery of endogenous molecules from the DNA extraction and purification steps could, thus, help advance the characterization of ancient genomes. Here, we apply the three most commonly used DNA extraction methods to five ancient bone samples spanning a ~30 thousand year temporal range and originating from a diversity of environments, from South America to Alaska. We show that methods based on the purification of DNA fragments using silica columns are more advantageous than in solution methods and increase not only the total amount of DNA molecules retrieved but also the relative importance of endogenous DNA fragments and their molecular diversity. Therefore, these methods provide a cost-effective solution for downstream applications, including DNA sequencing on HTS platforms. © 2015 John Wiley & Sons Ltd.

  4. Optimisation of DNA extraction and validation of PCR assays to detect Mycobacterium avium subsp. paratuberculosis.

    Science.gov (United States)

    Timms, Verlaine J; Mitchell, Hazel M; Neilan, Brett A

    2015-05-01

    The aim of this study was to investigate DNA extraction methods and PCR assays suitable for the detection of Mycobacterium paratuberculosis in bovine tissue. The majority of methods currently used to detect M. paratuberculosis have been developed using bovine samples, such as faeces, blood or tissue and, in many cases, have been based on detection from pooled samples from a herd. However most studies have not compared PCR results to culture results. In order to address this problem, four DNA extraction protocols and three PCR assays were employed to detect M. paratuberculosis in bovine tissue. Given that culture is reliable from cows, the results were then compared with the known M. paratuberculosis culture status. The following DNA extractions were included, two commercial kits, a boiling method, an in house extraction based on a published method and enrichment by sonication. The three PCR assays used included single round IS900 and f57 assays and a nested IS900 assay. In addition, another PCR assay was validated for the detection of any Mycobacterial species and a universal bacterial 16S rRNA gene assay was used to detect sample inhibition. The in-house DNA extraction was the most consistent in extracting good quality DNA compared to all other methods. The use of two PCR markers, IS900 and f57, and a universal PCR enabled the correct samples to be identified as M. paratuberculosis positive. In addition, when compared to the culture result, false-positives did not occur and PCR inhibition was readily identified. Using an in house DNA extraction coupled with the IS900 and f57 PCR markers, this study provides a reliable and simple method to detect M. paratuberculosis in both veterinary and spill over infections. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Dataset of plasmid DNA extraction using different magnetic nanoparticles (MNPs

    Directory of Open Access Journals (Sweden)

    H. Rahnama

    2016-12-01

    MNPs were characterized by energy dispersive spectroscopy (EDS and transmission electron microscopy (TEM. Finally, the overall efficiency of different MNPs (Fe3O4, Fe3O4/SiO2, Fe3O4/SiO2/TiO2 in plasmid DNA isolation was compared using gel electrophoresis analysis. The data supplied in this article supports the accompanying publication “Comparative study of three magnetic nano-particles (FeSO4, FeSO4/SiO2, FeSO4/SiO2/TiO2 in plasmid DNA extraction” (H. Rahnama, A. Sattarzadeh, F. Kazemi, N. Ahmadi, F. Sanjarian, Z. Zand, 2016 [1].

  6. Development of a Fieldable, Rapid, Accurate and Sensitive Bio-Electronic, DNA Biosensor

    Science.gov (United States)

    2004-12-01

    single molecule of DNA or RNA and therefore does not require the use of PCR. The sensor chip can be engineered with an array of hundreds of independent test sites, which allows for confirmatory tests leading to a high level of specificity, the ability to screen for multiple threat agents simultaneously, and the capability to detect genetically engineered organisms. Biological agents continue to pose a major threat to U.S. troops as well as U.S. civilians both domestically and overseas. Rapid, accurate and sensitive detection and identification of biological agents is

  7. Protocol: A high-throughput DNA extraction system suitable for conifers

    Directory of Open Access Journals (Sweden)

    Rajora Om P

    2008-08-01

    Full Text Available Abstract Background High throughput DNA isolation from plants is a major bottleneck for most studies requiring large sample sizes. A variety of protocols have been developed for DNA isolation from plants. However, many species, including conifers, have high contents of secondary metabolites that interfere with the extraction process or the subsequent analysis steps. Here, we describe a procedure for high-throughput DNA isolation from conifers. Results We have developed a high-throughput DNA extraction protocol for conifers using an automated liquid handler and modifying the Qiagen MagAttract Plant Kit protocol. The modifications involve change to the buffer system and improving the protocol so that it almost doubles the number of samples processed per kit, which significantly reduces the overall costs. We describe two versions of the protocol: one for medium-throughput (MTP and another for high-throughput (HTP DNA isolation. The HTP version works from start to end in the industry-standard 96-well format, while the MTP version provides higher DNA yields per sample processed. We have successfully used the protocol for DNA extraction and genotyping of thousands of individuals of several spruce and a pine species. Conclusion A high-throughput system for DNA extraction from conifer needles and seeds has been developed and validated. The quality of the isolated DNA was comparable with that obtained from two commonly used methods: the silica-spin column and the classic CTAB protocol. Our protocol provides a fully automatable and cost effective solution for processing large numbers of conifer samples.

  8. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  9. Radiocarbon-dating and ancient DNA reveal rapid replacement of extinct prehistoric penguins

    Science.gov (United States)

    Rawlence, Nicolas J.; Perry, George L. W.; Smith, Ian W. G.; Scofield, R. Paul; Tennyson, Alan J. D.; Matisoo-Smith, Elizabeth A.; Boessenkool, Sanne; Austin, Jeremy J.; Waters, Jonathan M.

    2015-03-01

    Prehistoric faunal extinctions dramatically reshaped biological assemblages around the world. However, the timing of such biotic shifts is often obscured by the fragmentary nature and limited temporal resolution of fossil records. We use radiocarbon-dating and ancient-DNA analysis of prehistoric (ca A.D. 1450-1834) Megadyptes penguin specimens to assess the time-frame of biological turnover in coastal New Zealand following human settlement. These data suggest that the final extirpation of the endemic Megadyptes waitaha, and subsequent replacement by the previously sub-Antarctic-limited Megadyptes antipodes, likely occurred within a narrow temporal window (e.g. a century or less). This transition represents one of the most rapid prehistoric faunal turnover events documented, and is likely linked to human demographic and cultural transitions during the 15th Century. Our results suggest that anthropogenic forces can trigger rapid biogeographic shifts.

  10. Chromosome-Specific DNA Repeats: Rapid Identification in Silico and Validation Using Fluorescence in Situ Hybridization

    Directory of Open Access Journals (Sweden)

    Heinz-Ulrich G. Weier

    2012-12-01

    Full Text Available Chromosome enumeration in interphase and metaphase cells using fluorescence in situ hybridization (FISH is an established procedure for the rapid and accurate cytogenetic analysis of cell nuclei and polar bodies, the unambiguous gender determination, as well as the definition of tumor-specific signatures. Present bottlenecks in the procedure are a limited number of commercial, non-isotopically labeled probes that can be combined in multiplex FISH assays and the relatively high price and effort to develop additional probes. We describe a streamlined approach for rapid probe definition, synthesis and validation, which is based on the analysis of publicly available DNA sequence information, also known as “database mining”. Examples of probe preparation for the human gonosomes and chromosome 16 as a selected autosome outline the probe selection strategy, define a timeline for expedited probe production and compare this novel selection strategy to more conventional probe cloning protocols.

  11. THE RAPID DIAGNOSTICS OF SEX OF SALMONIDS USING DNA-MARKERS

    Directory of Open Access Journals (Sweden)

    Yu. P. Rud

    2014-12-01

    Full Text Available Based on nucleotide sequences of sex-specific DNA-markers of salmonid fishes the oligonucleotide primers for polymerase chain reaction were selected with purpose on rapid diagnostic of sex in rainbow trout Onchorhynchus mykiss, brown trout Salmo trutta, huchen Hucho hucho and grayling Thymallus thymallus. The specify of amplification was determined by nucleotide sequence analysis of PCR-products. All amplified fragments were referred to sex-specific locuses of Y chromosomes in males of investigated fish species. The PCR-products were in size of 880, 607, 521 and 558 for rainbow trout, brown trout, grayling and huchen respectively. Thus the sex determination in above mentioned fish species and identification of genotypic males under process of hormonal sex reversion can be provided using conventional PCR. Present method relates to rapid diagnostics because the data analysis and return of results back to fish farm take one single day.

  12. Impact of two different commercial DNA extraction methods on BK virus viral load

    Directory of Open Access Journals (Sweden)

    Massimiliano Bergallo

    2016-03-01

    Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

  13. Evaluation of extraction methods from paraffin wax embedded tissues for PCR amplification of human and viral DNA.

    Science.gov (United States)

    Chan, P K; Chan, D P; To, K F; Yu, M Y; Cheung, J L; Cheng, A F

    2001-05-01

    To evaluate the efficiency of phenol/chloroform, microwave, and Qiagen spin column based DNA extractions from paraffin wax embedded tissue for use in the polymerase chain reaction (PCR). In addition, to assess the reliability of amplifying a housekeeping gene to indicate successful viral DNA extraction. DNA samples extracted from 20 blocks of cervical carcinoma tissues using the three methods were subjected to PCRs targeting 509 bp and 355 bp of the beta globin gene, and 450 bp and 150 bp of human papillomavirus (HPV) DNA. Microwave extraction showed the highest positive rate for beta globin PCR, whereas the spin column method was the most efficient for HPV DNA extraction. When the 509 bp beta globin and 450 bp HPV PCR results were correlated, two of 10, eight of 12, and nine of 10 beta globin positive extractions prepared by means of the phenol/chloroform, microwave, and spin column methods, respectively, yielded HPV DNA of the expected size. For the beta globin negative samples, HPV was detected in three of 10, two of eight, and four of 10 samples. HPV DNA extraction was most efficient using the Qiagen spin column and had the highest positive predictive value when a housekeeping gene was used as an indicator of successful viral DNA extraction; the phenol/chloroform method was the least efficient. The potential drawbacks of some extraction methods when using a human housekeeping gene to assess the quality of viral DNA extraction need to be considered.

  14. Comparison of three different DNA extraction methods from a highly degraded biological material.

    Science.gov (United States)

    Kuś, M; Ossowski, A; Zielińska, G

    2016-05-01

    The identification of unknown victims is one of the most challenging tasks faced by forensic medicine. This is due to the rapid decomposition of tissues, beginning at the moment of death and caused by released enzymes and microbial activity. Decay is directly associated with the decomposition of soft tissues and also the degradation of genetic material inside cells. Decomposition rates vary depending on a number of environmental factors, including temperature, humidity, season, and soil properties. Decomposition also differs between bodies left in the open air or buried. To date, forensic medicine has identified mainly people who were the victims of various types of criminal offences. However, with advances in identification methods, increasingly frequent attempts are made to identify the victims of armed conflicts, crimes of totalitarian regimes, or genocide. The aim of the study was to compare three different methods for the extraction of nuclear DNA from material considered in forensic medicine as difficult to handle, i.e. fragments of bones and teeth, and to determine the performance of these methods and their suitability for identification procedures. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  15. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    Science.gov (United States)

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  16. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Wang

    Full Text Available BACKGROUND: In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. METHODOLOGY/PRINCIPAL FINDINGS: We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. CONCLUSIONS/SIGNIFICANCE: We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN, indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  17. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Science.gov (United States)

    Wang, Xiao-Dong; Liu, A-Ping; Wu, Yin-Yuan; Wang, Peng

    2013-01-01

    In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN), indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  18. Rapid green synthesis of silver nanoparticles and nanorods using Piper nigrum extract

    Energy Technology Data Exchange (ETDEWEB)

    Mohapatra, Bandita [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Kuriakose, Sini [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Mohapatra, Satyabrata, E-mail: smiuac@gmail.com [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India)

    2015-07-15

    Highlights: • Silver nanorods were synthesized by photoreduction using Piper nigrum extract. • The morphological and structural properties were studied by XRD and AFM. • Silver nanoparticles were formed at lower AgNO{sub 3} concentration. • Increase in AgNO{sub 3} concentration resulted in formation of silver nanorods. - Abstract: We report sun light driven rapid green synthesis of stable aqueous dispersions of silver nanoparticles and nanorods at room temperature using photoreduction of silver ions with Piper nigrum extract. Silver nanoparticles were formed within 3 min of sun light irradiation following addition of Piper nigrum extract to the AgNO{sub 3} solution. The effects of AgNO{sub 3} concentration and irradiation time on the formation and plasmonic properties of biosynthesized silver nanoparticles were studied using UV–visible absorption spectroscopy. The morphology and structure of silver nanoparticles were well characterized by atomic force microscopy (AFM) and X-ray diffraction (XRD). The size of Ag nanoparticles increased with increase in irradiation time, leading to the formation of anisotropic nanostructures. Increasing the AgNO{sub 3} concentration resulted in the formation of Ag nanorods. UV–visible absorption studies revealed the presence of surface plasmon resonance (SPR) peaks which red shift and broaden with increasing AgNO{sub 3} concentration. We have demonstrated a facile, energy efficient and rapid green synthetic route to synthesize stable aqueous dispersions of silver nanoparticles and nanorods.

  19. Sequence-specific DNA solid-phase extraction in an on-chip monolith: Towards detection of antibiotic resistance genes.

    Science.gov (United States)

    Knob, Radim; Nelson, Daniel B; Robison, Richard A; Woolley, Adam T

    2017-11-10

    Antibiotic resistance of bacteria is a growing problem and presents a challenge for prompt treatment in patients with sepsis. Currently used methods rely on culturing or amplification; however, these steps are either time consuming or suffer from interference issues. A microfluidic device was made from black polypropylene, with a monolithic column modified with a capture oligonucleotide for sequence selective solid-phase extraction of a complementary target from a lysate sample. Porous properties of the monolith allow flow and hybridization of a target complementary to the probe immobilized on the column surface. Good flow-through properties enable extraction of a 100μL sample and elution of target DNA in 12min total time. Using a fluorescently labeled target oligonucleotide related to Verona Integron-Mediated Metallo-β-lactamase it was possible to extract and detect a 1pM sample with 83% recovery. Temperature-mediated elution by heating above the duplex melting point provides a clean extract without any agents that interfere with base pairing, allowing various labeling methods or further downstream processing of the eluent. Further integration of this extraction module with a system for isolation and lysis of bacteria from blood, as well as combining with single-molecule detection should allow rapid determination of antibiotic resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    Riemerella anatipestifer (RA) infection is the main disease causing severe losses in duck production. Because RA is characterized more by the absence than by the presence of specific phenotypic properties and different scholar had the different results of biochemical detection, it can't always be identified quickly and correctly only by the phenotypic properties or biochemical characteristics. The research object was to develop a species specific PCR method for RA detection. Because of the conserved structure of rRNA and appropriate size of 16S rRNA, a multiple alignment of 16S rDNA (gene coding 16S rRNA) was processed among RA, Escherichia coli, Pasteurella multocida, Salmonella enteritidis and Salmonella gallinarum, which are the main bacteria causing duck diseases. A pair of species specific primers named 190f and 843r were selected from the variable regions of 16S rDNA depending on the result of multiple alignment. Using BLAST on NCBI website for a sequence similarity search, the results showed that this pair of primers had very high specificity, except for having a lower sequence similarity with some species of Flavobacterium and Chryseobacterium. A PCR assay was performed and the template was extracted using the bacteria genomic DNA extraction kit and boiling method respectively. A chelate resin named Chelex 100 was used in the boiling method at the same time. Under the annealing temperature of 60 degrees C, all the 26 RA strains, including 19 representative strains of serotypes 1 to approximately 19 and 7 domestic isolated strains, showed the same 654bp fragment after PCR, while there was no amplification with isolates of other bacterial species. Also a series of sensitivity experiments were performed and proved that the detection limit of this method was 50pg genomic DNA, 1.5 x 10(6) CFU/mL and 15 CFU/mL, when the template was prepared with genomic DNA extraction kit, only boiling method and boiling method with Chelex 100 respectively. 12 clinical cases

  1. Combined DNA extraction and antibody elution from filter papers for the assessment of malaria transmission intensity in epidemiological studies

    National Research Council Canada - National Science Library

    Baidjoe, Amrish; Stone, Will; Ploemen, Ivo; Shagari, Shehu; Grignard, Lynn; Osoti, Victor; Makori, Euniah; Stevenson, Jennifer; Kariuki, Simon; Sutherland, Colin; Sauerwein, Robert; Cox, Jonathan; Drakeley, Chris; Bousema, Teun

    2013-01-01

    .... Filter paper blood spots are commonly used a source of both DNA and antibodies. To enhance the operational practicability of malaria surveys, a method is presented for combined DNA extraction and antibody elution...

  2. Phenological Metrics Extraction for Agricultural Land-use Types Using RapidEye and MODIS

    Science.gov (United States)

    Xu, Xingmei; Doktor, Daniel; Conrad, Christopher

    2016-04-01

    Crop phenology involves the various agricultural events, such as planting, emergence, flowering, development of fruit and harvest. These phenological stages of a crop contain essential information for practical agricultural management, crop productivity estimation, investigations of crop-weather relationships, and also play an important role in improving agricultural land-use classification. In this study, we used MODIS and RapidEye images to extract phenological metrics in central Germany between 2010 and 2014. The Best Index Slope Extraction algorithm was used to remove undesirable data noise from Normalized Difference Vegetation Index (NDVI) time series of both satellite data before fast Fourier transformation was applied. Metrics optimization for phenology of major crops in the study area (winter wheat, winter barley, winter oilseed rape and sugar beet) and validation were performed with intensive ground observations from the German Weather Service (2010-2014) and our own measurements of BBCH code (Biologische Bundesanstalt für Land- und Forstwirtschaft, Bundessortenamt und CHemische Industrie) (in 2014). We found that the dates with maximum NDVI have a close link to the heading stage of cereals (RMSE = 9.48 days for MODIS and RMSE = 13.55 days for RapidEye), and the dates of local half maximum during senescence period of winter crops was strongly related to ripeness stage (BBCH: 87) (RMSE = 8.87 days for MODIS and RMSE = 9.62 days for RapidEye). The root-mean-square errors (RMSE) of derived green up dates for both winter and summer crops were larger than 2 weeks, which was caused by limited number of good quality images during the winter season. Comparison between RapidEye and homogeneous MODIS pixels indicated that phenological metrics derived from both satellites were similar to the crop calendar in this region. We also investigated the influence of spatial aggregation of RapidEye-scale phenology to MODIS scale as well as the effect of decreasing the

  3. VIP Barcoding: composition vector-based software for rapid species identification based on DNA barcoding.

    Science.gov (United States)

    Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou

    2014-07-01

    Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.

  4. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  5. A high throughput DNA extraction method with high yield and quality.

    Science.gov (United States)

    Xin, Zhanguo; Chen, Junping

    2012-07-28

    Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome), and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L.) Moench] leaves and dry seeds with high yield, high quality, and affordable cost. We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  6. Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.

    Science.gov (United States)

    Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

    2014-11-01

    Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 μg/μL and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. DNA extract characterization process for microbial detection methods development and validation

    Science.gov (United States)

    2012-01-01

    Background Quantitative polymerase chain reaction (qPCR) assays used in pathogen detection require rigorous methods development including characterizing DNA extraction products. A DNA extract characterization process is demonstrated using DNA extracted from five different cells types (two Gram-negatives: Escherichia coli, and Burkholderia thailandensis, spores and vegetative cells from the Gram-positive Bacillus cereus, and yeast Saccharomyces cerevisiae) with six different methods. Results DNA extract quantity (concentration and extraction efficiency) and quality (purity and intactness) varied by cell type and extraction method enabling the demonstration of different DNA characterization methods. DNA purity was measured using UV spectroscopy, where the A260/A280 and A260/A230 ratios are indicators of different contaminants. Reproducibility of UV spectroscopy measurements decreased for DNA concentrations less than 17.5 ng/μL. Forty-seven extracts had concentrations greater than 17.5 ng/μL, 25 had A260/A280 above 2.0, and 28 had A260/A230 ratios below 1.8 indicating RNA and polysaccharide contamination respectively. Based on a qPCR inhibition assay the contaminants did not inhibit PCR. Extract intactness was evaluated using microfluidic gel electrophoresis. Thirty-five samples had concentrations above the limit of quantification (LOQ, roughly 11 ng/ μL), 93.5% of the DNA was larger than 1kb and 1% was smaller than 300 bp. Extract concentrations ranged from 1502.2 ng/μL to below the LOQ when UV spectroscopy, fluorometry, and qPCR were used. LOQ for UV spectroscopic and fluorometric measurements were 3.5 ng/μL and 0.25 ng/μL respectively. The qPCR LOQ varied by cell type (5.72 × 10-3 ng/μL for E. coli, 2.66 × 10-3 ng/μL, for B. cereus, 3.78 × 10-3 ng/μL for B. thailandensis, and 7.67 × 10-4 ng/μL for S. cerevisiae). A number of samples were below the UV spectroscopy (n = 27), flurometry (n = 15), and qPCR (n = 3) LOQ

  8. Design of a biological method for rapid detection of presence of PCR inhibitors in aged bone DNA.

    Science.gov (United States)

    Ghasemi, Akram; Mahdieh, Nejat; Tavallaei, Mahmood; Aslani, Mohammad Mehdi; Zafari, Zahra; Shirkavand, Atefeh; Farzad, Maryam Sharafi; Naderi, Mahdi; Azariyan, Sajjad Habibi; Zeinali, Sirous

    2012-01-01

    Molecular human identification is one of the most important tests performed in forensic laboratories. Some of these tests are applied for identification of human remains from natural disasters, wars, etc., but problems may occur as a result of DNA degradation and external DNA contamination. We investigated effects of bacterial DNA on identifying the presence or absence of PCR inhibitors in aged bone DNA. DNA samples were extracted from blood, bone remains and Escherichia coli. These DNA were amplified using human and bacterial specific primers. Using different blood, aged bone, and bacterial DNA dilutions along with PCR based methods; we checked their positive, negative effects, or detecting presence of inhibitors in aged bone DNA by PCR method. Our observation indicated that the addition of bacterial DNA could be a valid biological method for testing the quality of bone DNA to enable us to obtain a usable profile for the identification of human remains. This method will help to test the presence of inhibitors, quantity or even quality of DNA which are of importance in profiling archeological remains. Our method will help to determine if PCR failure is due to presence of inhibitors or lack of amplifiable DNA either because of degradation, minute amount or absence of human DNA.

  9. Reliability and performance of commercial RNA and DNA extraction kits for FFPE tissue cores.

    Science.gov (United States)

    Patel, Palak G; Selvarajah, Shamini; Guérard, Karl-Philippe; Bartlett, John M S; Lapointe, Jacques; Berman, David M; Okello, John B A; Park, Paul C

    2017-01-01

    Cancer biomarker studies often require nucleic acid extraction from limited amounts of formalin-fixed, paraffin-embedded (FFPE) tissues, such as histologic sections or needle cores. A major challenge is low quantity and quality of extracted nucleic acids, which can limit our ability to perform genetic analyses, and have a significant influence on overall study design. This study was aimed at identifying the most reliable and reproducible method of obtaining sufficient high-quality nucleic acids from FFPE tissues. We compared the yield and quality of nucleic acids from 0.6-mm FFPE prostate tissue cores across 16 DNA and RNA extraction protocols, using 14 commercially available kits. Nucleic acid yield was determined by fluorometry, and quality was determined by spectrophotometry. All protocols yielded nucleic acids in quantities that are compatible with downstream molecular applications. However, the protocols varied widely in the quality of the extracted RNA and DNA. Four RNA and five DNA extraction protocols, including protocols from two kits for dual-extraction of RNA and DNA from the same tissue source, were prioritized for further quality assessment based on the yield and purity of their products. Specifically, their compatibility with downstream reactions was assessed using both NanoString nCounter gene expression assays and reverse-transcriptase real-time PCR for RNA, and methylation-specific PCR assays for DNA. The kit deemed most suitable for FFPE tissue was the AllPrep kit by Qiagen because of its yield, quality, and ability to purify both RNA and DNA from the same sample, which would be advantageous in biomarker studies.

  10. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  11. Application of rapid cloud point extraction method for trace cobalt analysis coupled with spectrophotometric determination

    Science.gov (United States)

    Wen, Xiaodong; He, Lei; Shi, Chunsheng; Deng, Qingwen; Wang, Jiwei; Zhao, Xia

    2013-11-01

    In this work, the analytical performance of conventional spectrophotometer was improved through the coupling of effective preconcentration method with spectrophotometric determination. Rapidly synergistic cloud point extraction (RS-CPE) was used to pre-concentrate ultra trace cobalt and firstly coupled with spectrophotometric determination. The developed coupling was simple, rapid and efficient. The factors influencing RS-CPE and spectrophotometer were optimized. Under the optimal conditions, the limit of detection (LOD) was 0.6 μg L-1, with sensitivity enhancement factor of 23. The relative standard deviation (RSD) for seven replicate measurements of 50 μg L-1 of cobalt was 4.3%. The recoveries for the spiked samples were in the acceptable range of 93.8-105%.

  12. Application of chemometric tools for automatic classification and profile extraction of DNA samples in forensic tasks.

    Science.gov (United States)

    Talavera Bustamante, Isneri; Silva Mata, Francisco; Hernández González, Noslen; González Gazapo, Ricardo; Palau, Juan; Ferreira, Marcia M Castro

    2007-07-09

    In this paper a method for the automatic DNA spots classification and extraction of profiles associated in DNA polyacrylamide gel electrophoresis is presented and it integrates the use of image processing techniques and chemometrics tools. A software which implements this method was developed; for feature extraction a combination of a PCA analysis and a C4.5 decision tree were used. To obtain good results in the profile extraction only DNA spots are useful; therefore, it was necessary to solve a two-class classification problem among DNA spots and no-DNA spots. In order to perform the classification process with high velocity, effectiveness and robustness, comparative classification studies among support vector machine (SVM), K-NN and PLS-DA classifiers were made. The best results obtained with the SVM classifier demonstrated the advantages attributed to it in the literature as a two-class classifier. A Sequential Cluster Leader Algorithm and another one developed for the restoration of pattern missing spots were needed to conclude the profiles extraction step. The experimental results show that this method has a very effective computational behavior and effectiveness, and provide a very useful tool to decrease the time and increase the quality of the specialist responses.

  13. Less is More--Optimization of DNA Extraction from Canine Feces.

    Science.gov (United States)

    Lindquist, Christina D; Wictum, Elizabeth J

    2016-01-01

    Although most DNA crime laboratories may not encounter fecal samples often, they are a familiar sample type in non-human forensic laboratories due to their prevalence in the environment. Fecal matter can be challenging due to low numbers of nucleated cells and the presence of inhibitors that impede amplification success. Sampling location (internal vs. external), sampling quantity (10-200 mg), and various extraction protocols (silica matrix, bead beating, and clean-up column) were evaluated to maximize DNA yield. The greatest yield of intact DNA was obtained using a modified silica matrix extraction protocol (VGL-Fecal) on 30-50 mg of fecal matter collected from the external surface of a stool that had been dried for 24 h. This optimized sampling and extraction protocol was applied to a pilot study where DNA yield and genotyping success were evaluated. By optimizing our collection, sampling, and extraction procedures, a reliable method for maximizing the yield of canine fecal DNA was developed. © 2015 American Academy of Forensic Sciences.

  14. Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing.

    Science.gov (United States)

    Rittenour, William R; Park, Ju-Hyeong; Cox-Ganser, Jean M; Beezhold, Donald H; Green, Brett J

    2012-03-01

    Traditional methods of assessing fungal exposure have been confounded by a number of limiting variables. The recent utilization of molecular methods such as internal transcribed spacer (ITS) sequencing of ribosomal RNA genes has provided improved insight into the diversity of fungal bioaerosols in indoor, outdoor and occupational environments. However, ITS analyses may also be confounded by a number of methodological limitations. In this study, we have optimized this technology for use in occupational or environmental studies. Three commonly used DNA extraction methodologies (UltraClean Soil kit, High Pure PCR Template kit, and EluQuik/DNeasy kit) were compared in terms of sensitivity and susceptibility to PCR inhibitors in dust for three common fungal bioaerosols, Aspergillus versicolor, Rhizopus microsporus and Wallemia sebi. Environmental dust samples were then studied using each extraction methodology and results were compared to viable culture data. The extraction methods differed in terms of their ability to efficiently extract DNA from particular species of fungi (e.g. Aspergillus versicolor). In addition, the ability to remove PCR inhibitors from dust samples was most effective using the soil DNA extraction kit. The species composition varied greatly between ITS clone libraries generated with the different DNA extraction kits. However, compared to viable culture data, ITS clone libraries included additional fungal species that are incapable of growth on solid culture medium. Collectively, our data indicated that DNA extraction methodologies used in ITS sequencing studies of occupational or environmental dust samples can greatly influence the fungal species that are detected. This journal is © The Royal Society of Chemistry 2012

  15. Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

    2012-01-01

    Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

  16. Comparison of dry- and wet-based fine bead homogenizations to extract DNA from fungal spores.

    Science.gov (United States)

    Yamamoto, Naomichi; Matsuzaka, Yasunari; Kimura, Minoru; Matsuki, Hideaki; Yanagisawa, Yukio

    2009-04-01

    The present study explored DNA extraction kinetics from fungal spores, i.e., Aspergillus niger, Penicillium chrysogenum and Cladosporium sphaerospermum, by fine bead mill homogenization. In particular, the study aimed to investigate basic differences between the dry- and wet-based methods. The results showed higher initial rates of the DNA extractions by the dry-based method than by the wet-based method, due to higher collision efficiency among fine beads and fungal spores. Based on the experimental results, we constructed kinetic models. While the results by the wet-based method were fitted well with an existing first-order release-degradation model, the results by the dry-based method were not fitted well. Meanwhile, a newly constructed first-order release-degradation model, assuming a proportion of the DNA remained inside the disrupted spore cells and protected from further sheer stress, showed good correlations. The real-time PCR assays showed the PCR efficiencies of the DNA obtained by the dry-based method were higher than those by the wet-based method likely due to increased moderate fragmentation of the DNA by the dry-based method. Thus, although wet-based methods have been commonly used, dry-based methods might also be applicable to achieve efficient extraction and PCR amplification of fungal DNA.

  17. DNA extraction from bristles and quills of Chaetomys subspinosus (Rodentia: Erethizontidae) using a novel protocol.

    Science.gov (United States)

    Oliveira, C G; Martinez, R A; Gaiotto, F A

    2007-09-30

    DNA extraction protocols are as varied as DNA sources. When it comes to endangered species, it is especially important to pay attention to all details that ensure the completion of the study goals and effectiveness in attaining useful data for conservation. Chaetomys subspinosus (Rodentia: Erethizontidae) is a secretive arboreal porcupine endemic to certain ecosystems of the Brazilian Atlantic Forest. A multidisciplinary study (including genetic data) was performed to create a management plan for the conservation of this species. Individuals from natural populations of the states of Bahia, Espírito Santo and Sergipe were sampled. To obtain a reliable and abundant amount of starting material, non-destructive methods were tested, extracting DNA from the bristles and quills that comprise most of this animal's hide. This method has also been innovative in adapting a DNA extraction protocol traditionally used for plants. Digestion using proteinase K was followed by protein precipitation with CTAB, a chloroform-isoamyl alcohol cleaning and DNA precipitation with isopropyl alcohol. This protocol supplies good-quality DNA for genetic analysis with molecular markers based on PCR.

  18. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Energy Technology Data Exchange (ETDEWEB)

    Li Shikuo; Shen Yuhua; Xie Anjian; Yu Xuerong; Zhang Xiuzhen; Yang Liangbao; Li Chuanhao [School of Chemistry and Chemical Engineering, Anhui University, Hefei 230039 (China)

    2007-10-10

    We describe the formation of amorphous selenium ({alpha}-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO{sub 3}{sup 2-}) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO{sub 3}{sup 2-} ions to Se{sup 0}, but also controls the nucleation and growth of Se{sup 0}, and even participates in the formation of {alpha}-Se/protein composites. The size and shell thickness of the {alpha}-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO{sub 3}{sup 2-} ions by Capsicum annuum L extract.

  19. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  20. Bxb1 integrase serves as a highly efficient DNA recombinase in rapid metabolite pathway assembly.

    Science.gov (United States)

    Wang, Xianwei; Tang, Biao; Ye, Yu; Mao, Yayi; Lei, Xiaolai; Zhao, Guoping; Ding, Xiaoming

    2017-01-01

    Phage-encoded serine integrases are widely used in genetic engineering. They also have the potential to serve as efficient DNA assemblers, demonstrated by the method of site-specific recombination-based tandem assembly (SSRTA) that can combine biological parts into devices, pathways, and systems. Here, four serine integrases, ϕBT1, TG1, ϕRv1, and Bxb1, were investigated to ascertain their in vitro DNA assembly activities. Bxb1 integrase displayed the highest efficiency to obtain final products. Thus, we conclude that Bxb1 integrase is an excellent choice for DNA assembly in vitro Using this enzyme and its recognition sites, BioBrick standards were designed that are compatible with the SSRTA method for module addition. A rapid and efficient procedure was developed for the assembly of a multigene metabolic pathway in one step, directly from non-cutting plasmids containing the gene fragments. This technique is easy and convenient, and would be of interest to the synthetic biology community. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Direct loading of polymer matrices in plastic microchips for rapid DNA analysis: a comparative study.

    Science.gov (United States)

    Hurth, Cedric; Gu, Jian; Aboud, Maurice; Estes, Matthew D; Nordquist, Alan R; McCord, Bruce; Zenhausern, Frederic

    2012-08-01

    We report the design and performance validation of microfluidic separation technologies for human identification using a disposable plastic device suitable for integration into an automated rapid DNA analysis system. A fabrication process for a 15-cm long hot-embossed plastic microfluidic devices with a smooth semielliptical cross section out of cyclic olefin copolymer is presented. We propose a mixed polymer solution of 95% w/v hydroxyethylcellulose and 5% w/v polyvinylpyrrolidone for a final polymer concentration of 2.5 or 3.0% to be used as coating and sieving matrix for DNA separation. This formulation allows preparing the microchip without pretreatment in a single-loading step and provides high-resolution separation (≈1.2 bp for fragments <200 bp), which is superior to existing commercial matrices under the same conditions. The hot-embossed device performance is characterized and compared to injection-molded devices made out of cyclic olefin copolymer based on their respective injector geometry, channel shape, and surface charges. Each device design is assessed by fluorescence videomicroscopy to evaluate the formation of injection plugs, then by comparing electropherograms for the separation of a DNA size standard relevant to human identification. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  3. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Science.gov (United States)

    2011-01-01

    Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP) in the catechol-0-methyltransferase gene (COMT rs4680) and one representative variable number of tandem repeats (VNTR) in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region) were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days), repeated freeze-thaw cycles (up to 6 cycles), and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using 10 ng of DNA per

  4. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Directory of Open Access Journals (Sweden)

    Tiina Särkinen

    Full Text Available Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA, the LEAFY exon 3 (nrDNA, and the trnL((UAA P6 loop (cpDNA. Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp and the largest fragment the lowest success (10%, rbcL, 670 bp. The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (<200-300 bp in order to maximise outcomes. Development of shorter barcoding regions, or mini-barcodes within existing ones should be of high importance as only a few options are currently available; this is particularly important if we hope to incorporate the millions of herbarium samples available into barcoding initiatives and other molecular studies.

  5. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  6. Statistical assessment of DNA extraction reagent lot variability in real-time quantitative PCR

    Science.gov (United States)

    Bushon, R.N.; Kephart, C.M.; Koltun, G.F.; Francy, D.S.; Schaefer, F. W.; Lindquist, H.D. Alan

    2010-01-01

    Aims: The aim of this study was to evaluate the variability in lots of a DNA extraction kit using real-time PCR assays for Bacillus anthracis, Francisella tularensis and Vibrio cholerae. Methods and Results: Replicate aliquots of three bacteria were processed in duplicate with three different lots of a commercial DNA extraction kit. This experiment was repeated in triplicate. Results showed that cycle threshold values were statistically different among the different lots. Conclusions: Differences in DNA extraction reagent lots were found to be a significant source of variability for qPCR results. Steps should be taken to ensure the quality and consistency of reagents. Minimally, we propose that standard curves should be constructed for each new lot of extraction reagents, so that lot-to-lot variation is accounted for in data interpretation. Significance and Impact of the Study: This study highlights the importance of evaluating variability in DNA extraction procedures, especially when different reagent lots are used. Consideration of this variability in data interpretation should be an integral part of studies investigating environmental samples with unknown concentrations of organisms. ?? 2010 The Society for Applied Microbiology.

  7. A comparison of methods for total community DNA preservation and extraction from various thermal environments.

    Science.gov (United States)

    Mitchell, Kendra R; Takacs-Vesbach, Cristina D

    2008-10-01

    The widespread use of molecular techniques in studying microbial communities has greatly enhanced our understanding of microbial diversity and function in the natural environment and contributed to an explosion of novel commercially viable enzymes. One of the most promising environments for detecting novel processes, enzymes, and microbial diversity is hot springs. We examined potential biases introduced by DNA preservation and extraction methods by comparing the quality, quantity, and diversity of environmental DNA samples preserved and extracted by commonly used methods. We included samples from sites representing the spectrum of environmental conditions that are found in Yellowstone National Park thermal features. Samples preserved in a non-toxic sucrose lysis buffer (SLB), along with a variation of a standard DNA extraction method using CTAB resulted in higher quality and quantity DNA than the other preservation and extraction methods tested here. Richness determined using DGGE revealed that there was some variation within replicates of a sample, but no statistical difference among the methods. However, the sucrose lysis buffer preserved samples extracted by the CTAB method were 15-43% more diverse than the other treatments.

  8. Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

    DEFF Research Database (Denmark)

    Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

    2013-01-01

    -time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

  9. Use of molecular beacons for the rapid analysis of DNA damage induced by exposure to an atmospheric pressure plasma jet

    Energy Technology Data Exchange (ETDEWEB)

    Kurita, Hirofumi, E-mail: kurita@ens.tut.ac.jp, E-mail: mizuno@ens.tut.ac.jp; Miyachika, Saki; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira, E-mail: kurita@ens.tut.ac.jp, E-mail: mizuno@ens.tut.ac.jp [Department of Environmental and Life Sciences, Toyohashi University of Technology, Aichi 441-8580 (Japan)

    2015-12-28

    A rapid method for evaluating the damage caused to DNA molecules upon exposure to plasma is demonstrated. Here, we propose the use of a molecular beacon for rapid detection of DNA strand breaks induced by atmospheric pressure plasma jet (APPJ) irradiation. Scission of the molecular beacon by APPJ irradiation leads to separation of the fluorophore-quencher pair, resulting in an increase in fluorescence that directly correlates with the DNA strand breaks. The results show that the increase in fluorescence intensity is proportional to the exposure time and the rate of fluorescence increase is proportional to the discharge power. This simple and rapid method allows the estimation of DNA damage induced by exposure to a non-thermal plasma.

  10. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  11. [Extractable microbial DNA pool and microbial activity in paleosols of Southern Ural].

    Science.gov (United States)

    Blagodatskaia, E V; Khokhlova, O S; Anderson, T H; Blagodatskiĭ, S A

    2003-01-01

    An evaluation of microbial DNA pools was performed using direct quantitative isolation of DNA from contemporary soils of Southern Urals and paleosols sealed under burial mounds of early Bronze Age more than 5000 years B.P. Significant regression dependence was found between the biomass and DNA contents in these soils (R2 = 0.97). Activity and dominant ecological strategies of microbial communities of paleosols and contemporary southern black soil were compared from growth parameters obtained by analysis of respiratory curves. The ratio of maximum specific growth rates of soil microorganisms on glucose and on yeast extract was shown to provide an auxotrophy index for soil microbial communities.

  12. Separation of Y-chromosomal haplotypes from male DNA mixtures via multiplex haplotype-specific extraction.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2015-11-01

    In forensic analysis, the interpretation of DNA mixtures is the subject of ongoing debate and requires expertise knowledge. Haplotype-specific extraction (HSE) is an alternative method that enables the separation of large chromosome fragments or haplotypes by using magnetic beads in conjunction with allele-specific probes. HSE thus allows physical separation of the components of a DNA mixture. Here, we present the first multiplex HSE separation of a Y-chromosomal haplotype consisting of six Yfiler short tandem repeat markers from a mixture of male DNA. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  14. Protective Effect of Juglans regia L. Walnut Extract Against Oxidative DNA Damage.

    Science.gov (United States)

    Calcabrini, Cinzia; De Bellis, Roberta; Mancini, Umberto; Cucchiarini, Luigi; Stocchi, Vilberto; Potenza, Lucia

    2017-06-01

    Walnuts (Juglans regia L.) are relevant components of the Mediterranean diet providing important macronutrients, micronutrients and other bioactive constituents including unsaturated fatty acids, proteins, fiber, vitamins, minerals, phytosterols and polyphenols. Although the walnut beneficial effects in human health are widely recognized by a lot of epidemiologic studies very little is known regarding its effect on damaged DNA. The aim of the present study was to investigate the effect of Juglans regia L. ethanolic extract from kernel on the induction of DNA strand breaks by thiol/Fe3+/O2 mixed function oxidase, tert-butyl hydroperoxide or UVC radiations in acellular and cellular models. Plasmid DNA cleavage and fast Halo assay were used to monitor oxidative damage to DNA. Both approaches showed protection of oxidatively injured DNA. These results agree with a lot of scientific proofs which recommend walnut as dietary adjunct in health promotion and prevention as well as in treatment of lifestyle-related oxidative diseases.

  15. Cascade cell lyses and DNA extraction for identification of genes and microorganisms in kefir grains.

    Science.gov (United States)

    Kowalczyk, Magdalena; Kolakowski, Piotr; Radziwill-Bienkowska, Joanna M; Szmytkowska, Agnieszka; Bardowski, Jacek

    2012-02-01

    Kefir is a dairy product popular in many countries in Central Europe, especially in Poland and other countries of Eastern and Northern Europe. This type of fermented milk is produced by a complex population of symbiotic bacteria and yeasts. In this work, conditions for DNA extraction, involving disruption of kefir grains and a cascade of cell lysis treatments, were established. Extraction procedure of total microbial DNA was carried out directly from fresh kefir grains. Using different lysis stringency conditions, five DNA pools were obtained. Genetic diversity of DNA pools were validated by RAPD analysis, which showed differences in patterns of amplified DNA fragments, indicating diverse microbial composition of all the analysed samples. These DNA pools were used for construction of genomic DNA libraries for sequencing. As much as 50% of the analysed nucleotide sequences showed homology to sequences from bacteria belonging to the Lactobacillus genus. Several sequences were similar to sequences from bacteria representing Lactococcus, Oenococcus, Pediococcus, Streptococcus and Leuconostoc species. Among homologues of yeast proteins were those from Candida albicans, Candida glabrata, Kluyveromyces lactis and Saccharomyces cerevisiae. In addition, several sequences were found to be homologous to sequences from bacteriophages.

  16. Extraction and fractionation of RNA and DNA from single cells using selective lysing and isotachophoresis

    Science.gov (United States)

    Shintaku, Hirofumi; Santiago, Juan G.

    2015-03-01

    Single cell analyses of RNA and DNA are crucial to understanding the heterogeneity of cell populations. The numbers of approaches to single cells analyses are expanding, but sequence specific measurements of nucleic acids have been mostly limited to studies of either DNA or RNA, and not both. This remains a challenge as RNA and DNA have very similar physical and biochemical properties, and cross-contamination with each other can introduce false positive results. We present an electrokinetic technique which creates the opportunity to fractionate and deliver cytoplasmic RNA and genomic DNA to independent downstream analyses. Our technique uses an on-chip system that enables selective lysing of cytoplasmic membrane, extraction of RNA (away from genomic DNA and nucleus), focusing, absolute quantification of cytoplasmic RNA mass. The absolute RNA mass quantification is performed using fluorescence observation without enzymatic amplification in cell nucleus is left intact and the relative genomic DNA amount in the nucleus can be measured. We demonstrate the technique using single mouse B lymphocyte cells, for which we extracted an average of 14.1 pg total cytoplasmic RNA per cell. We also demonstrate correlation analysis between the absolute amount of cytoplasmic RNA and relative amount of genomic DNA, showing heterogeneity associated with cell cycle.

  17. Elimination of bioweapons agents from forensic samples during extraction of human DNA.

    Science.gov (United States)

    Timbers, Jason; Wilkinson, Della; Hause, Christine C; Smith, Myron L; Zaidi, Mohsin A; Laframboise, Denis; Wright, Kathryn E

    2014-11-01

    Collection of DNA for genetic profiling is a powerful means for the identification of individuals responsible for crimes and terrorist acts. Biologic hazards, such as bacteria, endospores, toxins, and viruses, could contaminate sites of terrorist activities and thus could be present in samples collected for profiling. The fate of these hazards during DNA isolation has not been thoroughly examined. Our goals were to determine whether the DNA extraction process used by the Royal Canadian Mounted Police eliminates or neutralizes these agents and if not, to establish methods that render samples safe without compromising the human DNA. Our results show that bacteria, viruses, and toxins were reduced to undetectable levels during DNA extraction, but endospores remained viable. Filtration of samples after DNA isolation eliminated viable spores from the samples but left DNA intact. We also demonstrated that contamination of samples with some bacteria, endospores, and toxins for longer than 1 h compromised the ability to complete genetic profiling. © 2014 American Academy of Forensic Sciences.

  18. Comparative Evaluation of DNA Extraction Methods from Feces of Multiple Host Species for Downstream Next-Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Marcia L Hart

    Full Text Available The gastrointestinal tract contains a vast community of microbes that to this day remain largely unculturable, making studies in this area challenging. With the newly affordable advanced sequencing technology, important breakthroughs in this exciting field are now possible. However, standardized methods of sample collection, handling, and DNA extraction have yet to be determined. To help address this, we investigated the use of 5 common DNA extraction methods on fecal samples from 5 different species. Our data show that the method of DNA extraction impacts DNA concentration and purity, successful NGS amplification, and influences microbial communities seen in NGS output dependent on the species of fecal sample and the DNA extraction method used. These data highlight the importance of careful consideration of DNA extraction method used when designing and interpreting data from cross species studies.

  19. DNA Barcoding Coupled with High Resolution Melting Analysis Enables Rapid and Accurate Distinction of Aspergillus species.

    Science.gov (United States)

    Fidler, Gabor; Kocsube, Sandor; Leiter, Eva; Biro, Sandor; Paholcsek, Melinda

    2017-08-01

    We describe a high-resolution melting (HRM) analysis method that is rapid, reproducible, and able to identify reference strains and further 40 clinical isolates of Aspergillus fumigatus (14), A. lentulus (3), A. terreus (7), A. flavus (8), A. niger (2), A. welwitschiae (4), and A. tubingensis (2). Asp1 and Asp2 primer sets were designed to amplify partial sequences of the Aspergillus benA (beta-tubulin) genes in a closed-, single-tube system. Human placenta DNA, further Aspergillus (3), Candida (9), Fusarium (6), and Scedosporium (2) nucleic acids from type strains and clinical isolates were also included in this study to evaluate cross rea