WorldWideScience

Sample records for rapid direct methods

  1. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated...... to be especially convenient because the pre-mix containing all PCR reagents except for the bacterial cells could be kept at -20 degreesC for at least I month before its use. The optimized TaqMan((R)) real-time PCR assay is a useful, simple and rapid method for routine identification of Salmonella spp...

  2. A direct and rapid method to determine cyanide in urine by capillary electrophoresis.

    Science.gov (United States)

    Zhang, Qiyang; Maddukuri, Naveen; Gong, Maojun

    2015-10-02

    Cyanides are poisonous chemicals that widely exist in nature and industrial processes as well as accidental fires. Rapid and accurate determination of cyanide exposure would facilitate forensic investigation, medical diagnosis, and chronic cyanide monitoring. Here, a rapid and direct method was developed for the determination of cyanide ions in urinary samples. This technique was based on an integrated capillary electrophoresis system coupled with laser-induced fluorescence (LIF) detection. Cyanide ions were derivatized with naphthalene-2,3-dicarboxaldehyde (NDA) and a primary amine (glycine) for LIF detection. Three separate reagents, NDA, glycine, and cyanide sample, were mixed online, which secured uniform conditions between samples for cyanide derivatization and reduced the risk of precipitation formation of mixtures. Conditions were optimized; the derivatization was completed in 2-4min, and the separation was observed in 25s. The limit of detection (LOD) was 4.0nM at 3-fold signal-to-noise ratio for standard cyanide in buffer. The cyanide levels in urine samples from smokers and non-smokers were determined by using the method of standard addition, which demonstrated significant difference of cyanide levels in urinary samples from the two groups of people. The developed method was rapid and accurate, and is anticipated to be applicable to cyanide detection in waste water with appropriate modification. Published by Elsevier B.V.

  3. Rapid direct methods for enumeration of specific, active bacteria in water and biofilms

    Science.gov (United States)

    McFeters, G. A.; Pyle, B. H.; Lisle, J. T.; Broadaway, S. C.

    1999-01-01

    Conventional methods for detecting indicator and pathogenic bacteria in water may underestimate the actual population due to sublethal environmental injury, inability of the target bacteria to take up nutrients and other physiological factors which reduce bacterial culturability. Rapid and direct methods are needed to more accurately detect and enumerate active bacteria. Such a methodological advance would provide greater sensitivity in assessing the microbiological safety of water and food. The principle goal of this presentation is to describe novel approaches we have formulated for the rapid and simultaneous detection of bacteria plus the determination of their physiological activity in water and other environmental samples. The present version of our method involves the concentration of organisms by membrane filtration or immunomagnetic separation and combines an intracellular fluorochrome (CTC) for assessment of respiratory activity plus fluorescent-labelled antibody detection of specific bacteria. This approach has also been successfully used to demonstrate spatial and temporal heterogeneities of physiological activities in biofilms when coupled with cryosectioning. Candidate physiological stains include those capable of determining respiratory activity, membrane potential, membrane integrity, growth rate and cellular enzymatic activities. Results obtained thus far indicate that immunomagnetic separation can provide a high degree of sensitivity in the recovery of seeded target bacteria (Escherichia coli O157:H7) in water and hamburger. The captured and stained target bacteria are then enumerated by either conventional fluorescence microscopy or ChemScan(R), a new instrument that is very sensitive and rapid. The ChemScan(R) laser scanning instrument (Chemunex, Paris, France) provides the detection of individual fluorescently labelled bacterial cells using three emission channels in less than 5 min. A high degree of correlation has been demonstrated between

  4. Rapid intrinsic fluorescence method for direct identification of pathogens in blood cultures.

    Science.gov (United States)

    Walsh, John D; Hyman, Jay M; Borzhemskaya, Larisa; Bowen, Ann; McKellar, Caroline; Ullery, Michael; Mathias, Erin; Ronsick, Christopher; Link, John; Wilson, Mark; Clay, Bradford; Robinson, Ron; Thorpe, Thurman; van Belkum, Alex; Dunne, W Michael

    2013-11-19

    A positive blood culture is a critical result that requires prompt identification of the causative agent. This article describes a simple method to identify microorganisms from positive blood culture broth within the time taken to perform a Gram stain (identification of the etiologic agent may benefit the clinical management of sepsis. Further evaluation is now warranted to determine the performance of the method using clinical blood culture specimens. Physicians often require the identity of the infective agent in order to make life-saving adjustments to empirical therapy or to switch to less expensive and/or more targeted antimicrobials. However, standard identification procedures take up to 2 days after a blood culture is signaled positive, and even most rapid molecular techniques take several hours to provide a result. Other techniques are faster (e.g., matrix-assisted laser desorption ionization-time of flight [MALDI-TOF] mass spectrometry) but require time-consuming manual processing steps and expensive equipment. There remains a clear need for a simple, inexpensive method to rapidly identify microorganisms directly from positive blood cultures. The promising new method described in this research article can identify microorganisms in minutes by optical spectroscopy, thus permitting the lab to simultaneously report the presence of a positive blood culture and the organism's identity.

  5. Single-step blood direct PCR: A robust and rapid method to diagnose triplet repeat disorders.

    Science.gov (United States)

    Singh, Inder; Swarup, Vishnu; Shakya, Sunil; Goyal, Vinay; Faruq, Mohammed; Srivastava, Achal Kumar

    2017-08-15

    DNA extraction prior to polymerase chain reaction (PCR) amplification in genetic diagnoses of triplet repeat disorders (TRDs) is tedious and labour-intensive and has the limitations of sample contamination with foreign DNA, including that from preceding samples. Therefore, we aimed to develop a rapid, robust, and cost-effective method for expeditious genetic investigation of TRDs from whole blood as a DNA template. Peripheral blood samples were collected from 70 clinically suspected patients of progressive ataxia. The conventional method using genomic DNA and single-step Blood-Direct PCR (BD-PCR) method with just 2μl of whole blood sample were tested to amplify triplet repeat expansion in genes related to spinocerebellar ataxia (SCA) types 1, 2, 3, 12 and Friedreich's ataxia (FRDA). Post-PCR, the allele sizes were mapped and repeat numbers were calculated using GeneMapper and macros run in Microsoft Excel programmes. Successful amplification of target regions was achieved in all samples by both methods. The frequency of the normal and mutated allele was concordant between both methods, diagnosing 37% positive for a mutation in either of the candidate genes. The BD-PCR resulted in higher intensities of product peaks of normal and pathogenic alleles. The nearly-accurate sizing of the normal and expanded allele was achieved in a shorter time (4-5h), without DNA extraction and any risk of cross contamination, which suggests the BD-PCR to be a reliable, inexpensive, and rapid method to confirm TRDs. This technique can be introduced in routine diagnostic procedures of other tandem repeat disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. A novel method for ATLAS FSI alignment based on rapid, direct phase monitoring

    CERN Document Server

    Gibson, S M; The ATLAS collaboration; Horton, K; Lewis, A; Liang, Z; Livermore, S; Mattravers, C; Nickerson, R B

    2010-01-01

    Frequency Scanning Interferometry is a precise, multiple distance measurement technique, originally developed for ATLAS, which is suited to a variety of applications in the survey and alignment of future accelerators and particle detectors. The ATLAS inner detector is instrumented with an automated FSI alignment system, capable of simultaneously measuring hundreds of interferometers within the operational particle tracker. The alignment system began data taking in 2008 and we present the latest results from the on-detector system during LHC running. A new method has been developed based on rapid, direct monitoring of the interferometer phase, which allows the measurement of short term motions with improved precision, at a fraction of the wavelength of light (typically sensitive to < 50 nm). We outline the theory behind this novel technique and demonstrate precise measurements from ATLAS, which reveal interesting micron-level movements of the inner detector, correlated with thermal cycles and magnetic f...

  7. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples.

    Science.gov (United States)

    Antikainen, J; Tarkka, E; Haukka, K; Siitonen, A; Vaara, M; Kirveskari, J

    2009-08-01

    A rapid 16-plex polymerase chain reaction (PCR) suitable for routine diagnostics of diarrheagenic Escherichia coli (EHEC, EIEC, EAEC, ETEC, and EPEC) was developed, validated with control strains, and tested with 250 diarrhoeal stool samples. The specificity was 100% when tested with 289 control bacterial strains, and the analytical sensitivity of automated DNA extraction directly from stool samples was made by boiling the bacterial culture (10(4)-10(5) colony forming units/ml). The assay design starting directly from extraction of stool DNA allowed same day analysis without compromising sensitivity and specificity, which makes it superior compared to PCR after culturing the bacteria. The 16-plex PCR method demonstrated high prevalence of diarrheagenic E. coli in stool samples of patients returning from abroad (39.0%) in contrast to the patients with no travel history (8.7%; p < 0.001). The high prevalence of diarrheagenic E. coli suggests that their screening should be part of normal diarrhoea diagnostics, at least in the leading diagnostic laboratories.

  8. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  9. DPS – A rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold; Vogensen, Finn Kvist; Sørensen, Søren J.

    2014-01-01

    methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination...... of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three...

  10. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A rapid direct solvent extraction method for the extraction of 2-dodecylcyclobutanone from irradiated ground beef patties using acetonitrile.

    Science.gov (United States)

    Hijaz, Faraj; Kumar, Amit; Smith, J Scott

    2010-08-01

    The amount of irradiated beef in the U.S. market is growing, and a reliable, rapid method is needed to detect irradiated beef and quantify the irradiation dose. The official analytical method (BS EN 1785 2003) that has been adopted by the European Union is time consuming. The objective of this study was to develop a rapid method for the analysis of 2-dodecylcyclobutanone (2-DCB) in irradiated beef. A 5 g sample of commercially irradiated ground beef patty (90/10) was extracted with n-hexane using a Soxhlet apparatus or with acetonitrile via direct solvent extraction. The Soxhlet hexane extract was evaporated to dryness, and the sample was dissolved in a mixture of ethyl acetate and acetonitrile (1:1). The defatted extract was purified with a 1 g silica cartridge. Another 5 g aliquot of the same patty was mixed with 50 mL acetonitrile and either blended for 1 min with a hand blender or crushed for 10 min with a glass rod. The extraction procedure was repeated 3 times, and the acetonitrile was collected and evaporated to dryness. Eluants from both methods were concentrated under nitrogen and injected into a gas chromatography-mass spectrometry. The 2-DCB concentration in the commercial samples was 0.031 +/- 0.0026 ppm (n = 5) for the Soxhlet method and 0.031 +/- 0.0025 ppm (n = 10) for direct solvent extraction. Recovery of 2-DCB from spiked beef samples in the direct solvent extraction method was 93.2 +/- 9.0% (n = 7). This study showed that the direct solvent extraction method is simple and as efficient and reproducible as the Soxhlet method.

  12. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque.

    Science.gov (United States)

    Kot, Witold; Vogensen, Finn K; Sørensen, Søren J; Hansen, Lars H

    2014-02-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three Caudovirales phages; ϕ29 Podoviridae, P113g Siphoviridae and T4 Myovirdae, which are representative of >96% of all known phages, and were sequenced using the Illumina MiSeq platform. Successful de novo assembly of the viral genomes was possible. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Evaluation of X-ray fluorescence spectroscopy as a method for the rapid and direct determination of sodium in cheese.

    Science.gov (United States)

    Stankey, J A; Akbulut, C; Romero, J E; Govindasamy-Lucey, S

    2015-08-01

    Cheese manufacturers indirectly determine Na in cheese by analysis of Cl using the Volhard method, assuming that all Cl came from NaCl. This method overestimates the actual Na content in cheeses when Na replacers (e.g., KCl) are used. A direct and rapid method for Na detection is needed. X-ray fluorescence spectroscopy (XRF), a mineral analysis technique used in the mining industry, was investigated as an alternative method of Na detection in cheese. An XRF method for the detection of Na in cheese was developed and compared with inductively coupled plasma optical emission spectroscopy (ICP-OES; the reference method for Na in cheese) and Cl analyzer. Sodium quantification was performed by multi-point calibration with cheese standards spiked with NaCl ranging from 0 to 4% Na (wt/wt). The Na concentration of each of the cheese standards (discs: 30mm×7mm) was quantified by the 3 methods. A single laboratory method validation was performed; linearity, precision, limit of detection, and limit of quantification were determined. An additional calibration graph was created using cheese standards made from natural or process cheeses manufactured with different ratios of Na:K. Both Na and K calibration curves were linear for the cheese standards. Sodium was quantified in a variety of commercial cheese samples. The Na data obtained by XRF were in agreement with those from ICP-OES and Cl analyzer for most commercial natural cheeses. The XRF method did not accurately determine Na concentration for several process cheese samples, compared with ICP-OES, likely due to the use of unknown types of Na-based emulsifying salts (ES). When a calibration curve was created for process cheese with the specific types of ES used for this cheese, Na content was successfully predicted in the samples. For natural cheeses, the limit of detection and limit of quantification for Na that can be determined with an acceptable level of repeatability, precision, and trueness was 82 and 246mg/100g of

  14. Technical Note: Clinical translation of the Rapid-Steady-State-T1 MRI method for direct cerebral blood volume quantification.

    Science.gov (United States)

    Perles-Barbacaru, Teodora-Adriana; Tropres, Irene; Sarraf, Michel G; Chechin, David; Zaccaria, Affif; Grand, Sylvie; Le Bas, Jean-François; Berger, François; Lahrech, Hana

    2015-11-01

    In preclinical studies, the Rapid-Steady-State-T1 (RSST1) MRI method has advantages over conventional MRI methods for blood volume fraction (BVf) mapping, since after contrast agent administration, the BVf is directly quantifiable from the signal amplitude corresponding to the vascular equilibrium magnetization. This study focuses on its clinical implementation and feasibility. Following sequence implementation on clinical Philips Achieva scanners, the RSST1-method is assessed at 1.5 and 3 T in the follow-up examination of neurooncological patients receiving 0.1-0.2 mmol/kg Gd-DOTA to determine the threshold dose needed for cerebral BVf quantification. Confounding effects on BVf quantification such as transendothelial water exchange, transverse relaxation, and contrast agent extravasation are evaluated. For a dose≥0.13 mmol/kg at 1.5 T and ≥0.16 mmol/kg at 3 T, the RSST1-signal time course in macrovessels and brain tissue with Gd-DOTA impermeable vasculature reaches a steady state at maximum amplitude for about 8 s. In macrovessels, a BVf of 100% was obtained validating cerebral microvascular BVf quantification (3.5%-4.5% in gray matter and 1.5%-2.0% in white matter). In tumor tissue, a continuously increasing signal is detected, necessitating signal modeling for tumor BVf calculation. Using approved doses of Gd-DOTA, the steady state RSST1-signal in brain tissue is reached during the first pass and corresponds to the BVf. The first-pass duration is sufficient to allow accurate BVf quantification. The RSST1-method is appropriate for serial clinical studies since it allows fast and straightforward BVf quantification without arterial input function determination. This quantitative MRI method is particularly useful to assess the efficacy of antiangiogenic agents.

  15. FREQ-Seq: a rapid, cost-effective, sequencing-based method to determine allele frequencies directly from mixed populations.

    Directory of Open Access Journals (Sweden)

    Lon M Chubiz

    Full Text Available Understanding evolutionary dynamics within microbial populations requires the ability to accurately follow allele frequencies through time. Here we present a rapid, cost-effective method (FREQ-Seq that leverages Illumina next-generation sequencing for localized, quantitative allele frequency detection. Analogous to RNA-Seq, FREQ-Seq relies upon counts from the >10(5 reads generated per locus per time-point to determine allele frequencies. Loci of interest are directly amplified from a mixed population via two rounds of PCR using inexpensive, user-designed oligonucleotides and a bar-coded bridging primer system that can be regenerated in-house. The resulting bar-coded PCR products contain the adapters needed for Illumina sequencing, eliminating further library preparation. We demonstrate the utility of FREQ-Seq by determining the order and dynamics of beneficial alleles that arose as a microbial population, founded with an engineered strain of Methylobacterium, evolved to grow on methanol. Quantifying allele frequencies with minimal bias down to 1% abundance allowed effective analysis of SNPs, small in-dels and insertions of transposable elements. Our data reveal large-scale clonal interference during the early stages of adaptation and illustrate the utility of FREQ-Seq as a cost-effective tool for tracking allele frequencies in populations.

  16. Evaluation of a rapid method for the detection of streptococcal group A antigen directly from throat swabs.

    Science.gov (United States)

    Venezia, R A; Ryan, A; Alward, S; Kostun, W A

    1985-01-01

    Throat swabs from 196 pediatric patients were processed by a direct extraction-latex agglutination method (Group A Strep Direct Antigen Identification Test [DAI]) that detects group A streptococci in the specimen. The method requires a 45-min enzymatic extraction period at 37 degrees C and a 4-min reaction period with antibody-linked latex particles. The results were compared with those of the culture and fluorescent antibody methods and the clinical presentation of the patient for pharyngitis. Ninety-three percent of the specimens resulted in agreement by all tests, and 28% were culture positive for group A streptococci. Compared with the culture method, the DAI had a sensitivity and a specificity of 83% and 99%, respectively. The positive predictive values were 98% versus the culture method and 93% versus the fluorescent antibody method, whereas the negative predictive values were 94% versus both other methods. Of the 14 discrepant results when both clinical presentation of an acute pharyngitis and the test results were compared, the culture method provided the best correlation. An additional 64 specimens were processed by the DAI and another direct extraction-latex agglutination method (Culturette Ten-Minute Group A Strep ID Test), and the results were compared with those of the culture method. This group had a 40.6% culture isolation rate for group A streptococci. The sensitivity and specificity of the DAI and Strep ID methods versus the culture method were 81 and 100%, and 77 and 97%, respectively. These results indicate that the DAI is accurate for diagnosing group A streptococcal pharyngitis directly from throat swabs. However, negative results in the presence of a symptomatic patient must be confirmed by standard culture techniques. PMID:3884656

  17. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry........ The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result...

  18. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  19. Rapid and direct spectrophotometric method for kinetics studies and routine assay of peroxidase based on aniline diazo substrates.

    Science.gov (United States)

    Mirazizi, Fatemeh; Bahrami, Azita; Haghbeen, Kamahldin; Shahbani Zahiri, Hossein; Bakavoli, Mehdi; Legge, Raymond L

    2016-12-01

    Peroxidases are ubiquitous enzymes that play an important role in living organisms. Current spectrophotometrically based peroxidase assay methods are based on the production of chromophoric substances at the end of the enzymatic reaction. The ambiguity regarding the formation and identity of the final chromophoric product and its possible reactions with other molecules have raised concerns about the accuracy of these methods. This can be of serious concern in inhibition studies. A novel spectrophotometric assay for peroxidase, based on direct measurement of a soluble aniline diazo substrate, is introduced. In addition to the routine assays, this method can be used in comprehensive kinetics studies. 4-[(4-Sulfophenyl)azo]aniline (λmax = 390 nm, ɛ = 32 880 M(-1) cm(-1) at pH 4.5 to 9) was introduced for routine assay of peroxidase. This compound is commercially available and is indexed as a food dye. Using this method, a detection limit of 0.05 nmol mL(-1) was achieved for peroxidase.

  20. Direct observation of f-pair magnetic field effects and time-dependence of radical pair composition using rapidly switched magnetic fields and time-resolved infrared methods.

    Science.gov (United States)

    Woodward, Jonathan R; Foster, Timothy J; Salaoru, Adrian T; Vink, Claire B

    2008-07-21

    A rapidly switched (magnetic field was employed to directly observe magnetic fields from f-pair reactions of radical pairs in homogeneous solution. Geminate radical pairs from the photoabstraction reaction of benzophenone from cyclohexanol were observed directly using a pump-probe pulsed magnetic field method to determine their existence time. No magnetic field effects from geminate pairs were observed at times greater than 100 ns after initial photoexcitation. By measuring magnetic field effects for fields applied continuously only after this initial geminate period, f-pair effects could be directly observed. Measurement of the time-dependence of the field effect for the photolysis of 2-hydroxy-4-(2-hydroxyethoxy)-2-methylpropiophenone in cyclohexanol using time-resolved infrared spectroscopy revealed not only the presence of f-pair magnetic field effects but also the ability of the time dependence of the MARY spectra to observe the changing composition of the randomly encountering pairs throughout the second order reaction period.

  1. Direct identification of bacteria in positive blood cultures: comparison of two rapid methods, FilmArray and mass spectrometry.

    Science.gov (United States)

    Rand, Kenneth H; Delano, John P

    2014-07-01

    We evaluated the accuracy and performance of the FilmArray Direct from Positive Blood Culture system (BCID) (BioFire Diagnostics, Salt Lake City, UT, USA) and the VITEK Mass Spectrometry System (Vitek MS; bioMerieux, Durham, NC, USA) to identify bacterial isolates from 161 positive blood culture bottles. The BCID uses multiplex PCR to identify 90-95% of common isolates to the genus or species/complex level as well as mecA, Van A/B, and bla(KPC) genes in approximately 1 hour. Of 151 monomicrobic isolates, the FilmArray correctly identified 48/49 (98%) to the genus and 84/84 (100%) to the species/complex level, while 18/151 (12%) gave no identification, as expected from the database. Mass spectrometry correctly identified 142/151 (94%) monomicrobic cultures to the genus level, 137/151 (91%) to the species level, with only 8/151(5%) giving no identification. Although mass spectrometry has a much larger database, the filtration system was cumbersome in contrast to the 3-5 minutes hands-on-time for the BCID. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Staph ID/R: a rapid method for determining staphylococcus species identity and detecting the mecA gene directly from positive blood culture.

    Science.gov (United States)

    Pasko, Chris; Hicke, Brian; Dunn, John; Jaeckel, Heidi; Nieuwlandt, Dan; Weed, Diane; Woodruff, Evelyn; Zheng, Xiaotian; Jenison, Robert

    2012-03-01

    Rapid diagnosis of staphylococcal bacteremia directs appropriate antimicrobial therapy, leading to improved patient outcome. We describe herein a rapid test (Staph ID/R, combines a rapid isothermal nucleic acid amplification method, helicase-dependent amplification (HDA), with a chip-based array that produces unambiguous visible results. The analytic sensitivity was 1 CFU per reaction for the mecA gene and was 1 to 250 CFU per reaction depending on the staphylococcal species present in the positive blood culture. Staph ID/R has excellent specificity as well, with no cross-reactivity observed. We validated the performance of Staph ID/R by testing 104 frozen clinical positive blood cultures and comparing the results with rpoB gene or 16S rRNA gene sequencing for species identity determinations and mecA gene PCR to confirm mecA gene results. Staph ID/R agreed with mecA gene PCR for all samples and agreed with rpoB/16S rRNA gene sequencing in all cases except for one sample that contained a mixture of two staphylococcal species, one of which Staph ID/R correctly identified, for an overall agreement of 99.0% (P Staph ID/R could potentially be used to positively affect patient management for Staphylococcus-mediated bacteremia.

  3. Development of a rapid screening method to determine primary aromatic amines in kitchen utensils using direct analysis in real time mass spectrometry (DART-MS).

    Science.gov (United States)

    Paseiro-Cerrato, R; Noonan, G O; Begley, T H

    2014-01-01

    Primary aromatic amines (PAAs) are a group of substances with undesirable health effects, that are used in a variety of commercial products. Several recent studies, using a number of screening and confirmatory methods, have reported the migration of PAAs from some kitchen utensils into acetic acid 3% (w/v). Many of these methods require significant sample preparation, therefore the aim of this work was to determine if direct analysis in real time mass spectrometry (DART-MS) could be utilised as a rapid screening tool for the determination of PAAs in kitchen utensils. DART-MS results from direct analysis of the utensil have been compared with results of PAA migration by ultra high performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method. The UPLC-MS/MS method had excellent linearity, appropriate sensitivity (LOD ≤ 1.5 µg L(-1); LOQ ≤ 4.5 µg L(-1)), repeatability from 2.4 to 13.2% and acceptable recoveries. DART-MS results were in good agreement with UPLC-MS/MS data, with 100% of non-compliant (PAA positive) samples successfully identified by DART-MS.

  4. Bi-directional dideoxy fingerprinting (Bi-ddF): a rapid method for quantitative detection of mutations in genomic regions of 300-600 bp.

    Science.gov (United States)

    Liu, Q; Feng, J; Sommer, S S

    1996-01-01

    There is a great need for rapid screening methods that detect essentially all mutations. Dideoxy fingerprinting (ddF) is a highly sensitive screening method that is performed by electrophoresing one lane of a Sanger dideoxy termination reaction through a nondenaturing gel. Mutations may produce an extra segment or eliminate a segment from the termination products (informative dideoxy component). In addition, mutations can be detected by the altered mobility of one or more termination segments (informative SSCP component). To screen larger segments with virtually 100% sensitivity, bi-directional ddF (Bi-ddF) was developed. Bi-ddF is a 'second generation ddF' in which the dideoxy termination reaction is performed simultaneously with two opposing primers. Bi-ddF has two important advantages over ddF: (i) the dideoxy component can detect 10 of the 12 types of possible single-base substitutions; and (ii) the SSCP component is enhanced because alterations of mobility can be detected in either the downstream or upstream direction. As a result, Bi-ddF can screen larger regions of genomic DNA with virtually 100% sensitivity. Bi-ddF detected 100% of 28 single-base substitutions in a 494 bp segment containing exons B and C of the human factor IX gene and 100% of 42 single-base substitutions and one microdeletion present in a 577 bp region containing exon H. In a blinded analysis in which 39 wildtype samples were randomly mixed with 51 mutant samples, all mutations were detected with no false positives. Bi-ddF requires essentially the same effort as ddF, yet twofold more DNA sequence can be screened reliably per unit effort.

  5. Evaluation of a direct colorimetric assay for rapid detection of ...

    African Journals Online (AJOL)

    Yemane Berhane

    bromide (MTT) for a rapid detection of rifampicin resistance. Methods: Sputum was inoculated directly into 7H9 .... a loopful of the corresponding broth on nutrient agar and incubating it at 370C for 24 hours before performing the .... and Training in Tropical Diseases (TDR). This study was part of the MSc thesis of DW at Addis ...

  6. A Rapid and Direct Sensitive Spectrophotometric Method for the Determination of Molybdenum(VI using Gallacetophenone Phenylhydrazone with Application to Alloy Steel Samples

    Directory of Open Access Journals (Sweden)

    D. Venkataramana Reddy

    2011-01-01

    Full Text Available A rapid, sensitive and fairly selective spectrophotometric method has been developed for the determination of molybdenum(VI using gallacetophenone phenylhydrazone (GPPH as an analytical reagent. The GPPH forms an orange red species of molybdenum(VI at a pH range of 3.0-4.0 and the complex is soluble in 20% ethanol. The Mo(VI-GPPH complex shows maximum absorbance at 375 nm with molar absorptivity and Sandellʼs sensitivity being 1.539x104 L/mol cm and 1.5x10-3 μg cm-2 respectively. The system obeys Beerʼs law in the range of 1.0-6.0 μg/mL. The repeatability of the method was checked by finding the relative standard deviation. The composition of the Mo(VI-GPPH complex is established as 1:2 by slope analysis method. The instability constant of the complex calculated from Edmond and Birnbaumʼs method is 6.785x10-8 at room temperature. The interfering effect of various cations and anions has also been studied. The method has been applied for the determination of Mo(VI in alloy steel samples.

  7. Rapid identification of pathogens directly from blood culture bottles by Bruker matrix-assisted laser desorption laser ionization-time of flight mass spectrometry versus routine methods.

    Science.gov (United States)

    Jamal, Wafaa; Saleem, Rola; Rotimi, Vincent O

    2013-08-01

    The use of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) for identification of microorganisms directly from blood culture is an exciting dimension to the microbiologists. We evaluated the performance of Bruker SepsiTyper kit™ (STK) for direct identification of bacteria from positive blood culture. This was done in parallel with conventional methods. Nonrepetitive positive blood cultures from 160 consecutive patients were prospectively evaluated by both methods. Of 160 positive blood cultures, the STK identified 114 (75.6%) isolates and routine conventional method 150 (93%). Thirty-six isolates were misidentified or not identified by the kit. Of these, 5 had score of >2.000 and 31 had an unreliable low score of time using the STK was 35 min, including extraction steps and 30:12 to 36:12 h with routine method. The STK holds promise for timely management of bacteremic patients. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Rapid methods for detection of bacteria

    DEFF Research Database (Denmark)

    Corfitzen, Charlotte B.; Andersen, B.Ø.; Miller, M.

    2006-01-01

    Traditional methods for detection of bacteria in drinking water e.g. Heterotrophic Plate Counts (HPC) or Most Probable Number (MNP) take 48-72 hours to give the result. New rapid methods for detection of bacteria are needed to protect the consumers against contaminations. Two rapid methods...

  9. The Directed Case Method.

    Science.gov (United States)

    Cliff, William H.; Curtin, Leslie Nesbitt

    2000-01-01

    Provides an example of a directed case on human anatomy and physiology. Uses brief real life newspaper articles and clinical descriptions of medical reference texts to describe an actual, fictitious, or composite event. Includes interrelated human anatomy and physiology topics in the scenario. (YDS)

  10. Innovative rapid construction/reconstruction methods.

    Science.gov (United States)

    2005-07-01

    Innovative construction and reconstruction methods provide the opportunity to significantly reduce the time of roadway projects while maintaining the necessary quality of workmanship. The need for these rapid methods stems from the increase in ...

  11. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  12. Effect of phenolic compounds on the rapid direct enzymatic ...

    African Journals Online (AJOL)

    2009-05-15

    May 15, 2009 ... β-D-Galactosidase and β-D-glucuronidase are 2 marker enzymes used in the rapid detection of total coliforms and E. coli, respectively. A range of bioprobes and biosensors have recently been developed for the rapid, direct and in situ detection of these enzymes. Chromogenic substrates are often used to ...

  13. A scoping review of rapid review methods.

    Science.gov (United States)

    Tricco, Andrea C; Antony, Jesmin; Zarin, Wasifa; Strifler, Lisa; Ghassemi, Marco; Ivory, John; Perrier, Laure; Hutton, Brian; Moher, David; Straus, Sharon E

    2015-09-16

    Rapid reviews are a form of knowledge synthesis in which components of the systematic review process are simplified or omitted to produce information in a timely manner. Although numerous centers are conducting rapid reviews internationally, few studies have examined the methodological characteristics of rapid reviews. We aimed to examine articles, books, and reports that evaluated, compared, used or described rapid reviews or methods through a scoping review. MEDLINE, EMBASE, the Cochrane Library, internet websites of rapid review producers, and reference lists were searched to identify articles for inclusion. Two reviewers independently screened literature search results and abstracted data from included studies. Descriptive analysis was conducted. We included 100 articles plus one companion report that were published between 1997 and 2013. The studies were categorized as 84 application papers, seven development papers, six impact papers, and four comparison papers (one was included in two categories). The rapid reviews were conducted between 1 and 12 months, predominantly in Europe (58 %) and North America (20 %). The included studies failed to report 6 % to 73 % of the specific systematic review steps examined. Fifty unique rapid review methods were identified; 16 methods occurred more than once. Streamlined methods that were used in the 82 rapid reviews included limiting the literature search to published literature (24 %) or one database (2 %), limiting inclusion criteria by date (68 %) or language (49 %), having one person screen and another verify or screen excluded studies (6 %), having one person abstract data and another verify (23 %), not conducting risk of bias/quality appraisal (7 %) or having only one reviewer conduct the quality appraisal (7 %), and presenting results as a narrative summary (78 %). Four case studies were identified that compared the results of rapid reviews to systematic reviews. Three studies found that the conclusions between

  14. Detection of Magnaporthe oryzae chrysovirus 1 in Japan and establishment of a rapid, sensitive and direct diagnostic method based on reverse transcription loop-mediated isothermal amplification.

    Science.gov (United States)

    Komatsu, Ken; Urayama, Syun-Ichi; Katoh, Yu; Fuji, Shin-Ichi; Hase, Shu; Fukuhara, Toshiyuki; Arie, Tsutomu; Teraoka, Tohru; Moriyama, Hiromitsu

    2016-02-01

    Magnaporthe oryzae chrysovirus 1 (MoCV1) is a mycovirus with a dsRNA genome that infects the rice blast fungus Magnaporthe oryzae and impairs its growth. To date, MoCV1 has only been found in Vietnamese isolates of M. oryzae, and the distribution of this virus in M. oryzae isolates from other parts of the world remains unknown. In this study, using a one-step reverse transcription PCR (RT-PCR) assay, we detected a MoCV1-related virus in M. oryzae in Japan (named MoCV1-AK) whose sequence shares considerable similarity with that of the MoCV1 Vietnamese isolate. To establish a system for a comprehensive survey of MoCV1 infection in the field, we developed a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for direct detection of the virus. The sensitivity of the RT-LAMP assay was at least as high as that of the one-step RT-PCR assay. In addition, we detected MoCV1-AK in M. oryzae-infected oatmeal agar plates and lesions on rice leaves using the RT-LAMP assay without dsRNA extraction, by simple sampling with a toothpick. Preliminary screening of MoCV1 in Japanese M. oryzae isolates indicated that MoCV1 is currently distributed in rice fields in Japan. Our results provide a first example of the application of RT-LAMP for the detection of mycoviruses, which will accelerate surveys for mycovirus infection.

  15. Rapid determination of capsaicinoids by colorimetric method

    OpenAIRE

    Ryu, Wang-Kyun; Kim, Hee-Woong; Kim, Geun-Dong; Rhee, Hae-Ik

    2016-01-01

    Capsaicinoids, the pungent component of chili peppers, are generally analyzed by precise analytical techniques, such as gas chromatography and high-performance liquid chromatography (HPLC), but these are not practical for the mass analyses of samples. To analyze mass samples rapidly, a colorimetric method was suggested. In this work, pigments and capsaicinoids were efficiently separated from chili pepper extract by sequential solid–liquid extraction and liquid–liquid extraction in test tubes ...

  16. Methods and systems for rapid prototyping of high density circuits

    Science.gov (United States)

    Palmer, Jeremy A [Albuquerque, NM; Davis, Donald W [Albuquerque, NM; Chavez, Bart D [Albuquerque, NM; Gallegos, Phillip L [Albuquerque, NM; Wicker, Ryan B [El Paso, TX; Medina, Francisco R [El Paso, TX

    2008-09-02

    A preferred embodiment provides, for example, a system and method of integrating fluid media dispensing technology such as direct-write (DW) technologies with rapid prototyping (RP) technologies such as stereolithography (SL) to provide increased micro-fabrication and micro-stereolithography. A preferred embodiment of the present invention also provides, for example, a system and method for Rapid Prototyping High Density Circuit (RPHDC) manufacturing of solderless connectors and pilot devices with terminal geometries that are compatible with DW mechanisms and reduce contact resistance where the electrical system is encapsulated within structural members and manual electrical connections are eliminated in favor of automated DW traces. A preferred embodiment further provides, for example, a method of rapid prototyping comprising: fabricating a part layer using stereolithography and depositing thermally curable media onto the part layer using a fluid dispensing apparatus.

  17. Rapid Column Extraction method for SoilRapid Column Extraction method for Soil

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod, L. III; Culligan, Brian K.

    2005-11-07

    The analysis of actinides in environmental soil and sediment samples is very important for environmental monitoring as well as for emergency preparedness. A new, rapid actinide separation method has been developed and implemented that provides total dissolution of large soil samples, high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and DGA-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu) neptunium (Np), uranium (U), americium (Am), and curium (Cm) using a single multi-stage column combined with alpha spectrometry. The method combines a rapid fusion step for total dissolution to dissolve refractory analytes and matrix removal using cerium fluoride precipitation to remove the difficult soil matrix. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  18. Methods and compositions for rapid thermal cycling

    Science.gov (United States)

    Beer, Neil Reginald; Benett, William J.; Frank, James M.; Deotte, Joshua R.; Spadaccini, Christopher

    2015-10-27

    The rapid thermal cycling of a material is targeted. A microfluidic heat exchanger with an internal porous medium is coupled to tanks containing cold fluid and hot fluid. Fluid flows alternately from the cold tank and the hot tank into the porous medium, cooling and heating samples contained in the microfluidic heat exchanger's sample wells. A valve may be coupled to the tanks and a pump, and switching the position of the valve may switch the source and direction of fluid flowing through the porous medium. A controller may control the switching of valve positions based on the temperature of the samples and determined temperature thresholds. A sample tray for containing samples to be thermally cycled may be used in conjunction with the thermal cycling system. A surface or internal electrical heater may aid in heating the samples, or may replace the necessity for the hot tank.

  19. Rapid determination of capsaicinoids by colorimetric method.

    Science.gov (United States)

    Ryu, Wang-Kyun; Kim, Hee-Woong; Kim, Geun-Dong; Rhee, Hae-Ik

    2017-10-01

    Capsaicinoids, the pungent component of chili peppers, are generally analyzed by precise analytical techniques, such as gas chromatography and high-performance liquid chromatography (HPLC), but these are not practical for the mass analyses of samples. To analyze mass samples rapidly, a colorimetric method was suggested. In this work, pigments and capsaicinoids were efficiently separated from chili pepper extract by sequential solid-liquid extraction and liquid-liquid extraction in test tubes followed by a colorimetric analysis on the capsaicinoids by a selective chromogenic reaction with Gibbs reagent (2,6-dichloroquinone-4-chloroimide). In the comparison of the capsaicinoid content by the colorimetric method and HPLC using acetone extracts of fresh pepper and dry red pepper as samples, R2 was 0.9973 and 0.9816, respectively, which shows a high linear correlation. In addition, a minimum of 1 μg/mL capsaicinoids can be detected and it was therefore determined that the method can efficiently analyze a great quantity of samples in a short time. Copyright © 2016. Published by Elsevier B.V.

  20. Rapid determination of capsaicinoids by colorimetric method

    Directory of Open Access Journals (Sweden)

    Wang-Kyun Ryu

    2017-10-01

    Full Text Available Capsaicinoids, the pungent component of chili peppers, are generally analyzed by precise analytical techniques, such as gas chromatography and high-performance liquid chromatography (HPLC, but these are not practical for the mass analyses of samples. To analyze mass samples rapidly, a colorimetric method was suggested. In this work, pigments and capsaicinoids were efficiently separated from chili pepper extract by sequential solid–liquid extraction and liquid–liquid extraction in test tubes followed by a colorimetric analysis on the capsaicinoids by a selective chromogenic reaction with Gibbs reagent (2,6-dichloroquinone-4-chloroimide. In the comparison of the capsaicinoid content by the colorimetric method and HPLC using acetone extracts of fresh pepper and dry red pepper as samples, R2 was 0.9973 and 0.9816, respectively, which shows a high linear correlation. In addition, a minimum of 1 μg/mL capsaicinoids can be detected and it was therefore determined that the method can efficiently analyze a great quantity of samples in a short time.

  1. Rapid Identification of Ralstonia solanacearum by the Direct Colony TLC and Simple TLC

    OpenAIRE

    Rahman, Md Zahidur; Mian, Ismail Hossain; Khan, Abu Ashraf; Furuya, Naruto; Matsuyama, Nobuaki

    1998-01-01

    Rapid identification of bacterial wilt pathogen, Ralstonia solanacearum was conducted by the direct colony TLC and simple TLC methods. All fourteen isolates from different host plants in Bangladesh exhibited similar chromatograms with R. solanacearum ATCC 11696 the type strain by the direct colony TLC method. This result indicated that all the isolates were R. solanacearum. Physiological and biochemical tests on the fourteen isolates also verified that they were R. solanacearum. Seven strains...

  2. Print your own membrane: direct rapid prototyping of polydimethylsiloxane.

    Science.gov (United States)

    Femmer, Tim; Kuehne, Alexander J C; Wessling, Matthias

    2014-08-07

    Polydimethylsiloxane is a translucent and biologically inert silicone material used in sealants, biomedical implants and microscale lab-on-a-chip devices. Furthermore, in membrane technology, polydimethylsiloxane represents a material for separation barriers as it has high permeabilities for various gases. The facile handling of two component formulations with a silicone base material, a catalyst and a small molecular weight crosslinker makes it widely applicable for soft-lithographic replication of two-dimensional device geometries, such as microfluidic chips or micro-contact stamps. Here, we develop a new technique to directly print polydimethylsiloxane in a rapid prototyping device, circumventing the need for masks or sacrificial mold production. We create a three-dimensional polydimethylsiloxane membrane for gas-liquid-contacting based on a Schwarz-P triple-periodic minimal-surface, which is inaccessible with common machining techniques. Direct 3D-printing of polydimethylsiloxane enables rapid production of novel chip geometries for a manifold of lab-on-a-chip applications.

  3. Directional microwave applicator and methods

    Science.gov (United States)

    Fink, Patrick W. (Inventor); Lin, Greg Y. (Inventor); Chu, Andrew W. (Inventor); Dobbins, Justin A. (Inventor); Arndt, G. Dickey (Inventor); Ngo, Phong H. (Inventor)

    2008-01-01

    A miniature microwave antenna is disclosed which may be utilized for biomedical applications such as, for example, radiation induced hyperthermia through catheter systems. One feature of the antenna is that it possesses azimuthal directionality despite its small size. This directionality permits targeting of certain tissues while limiting thermal exposure of adjacent tissue. One embodiment has an outer diameter of about 0.095'' (2.4 mm) but the design permits for smaller diameters.

  4. Method for rapidly determining a pulp kappa number using spectrophotometry

    Science.gov (United States)

    Chai, Xin-Sheng; Zhu, Jun Yong

    2002-01-01

    A system and method for rapidly determining the pulp kappa number through direct measurement of the potassium permanganate concentration in a pulp-permanganate solution using spectrophotometry. Specifically, the present invention uses strong acidification to carry out the pulp-permanganate oxidation reaction in the pulp-permanganate solution to prevent the precipitation of manganese dioxide (MnO.sub.2). Consequently, spectral interference from the precipitated MnO.sub.2 is eliminated and the oxidation reaction becomes dominant. The spectral intensity of the oxidation reaction is then analyzed to determine the pulp kappa number.

  5. A multi-centre prospective evaluation of the Check-Direct ESBL Screen for BD MAX as a rapid molecular screening method for extended-spectrum beta-lactamase-producing Enterobacteriaceae rectal carriage

    NARCIS (Netherlands)

    Engel, T.G.; Slotboom, B.J.; Maarseveen, N. van; Zwet, A.A. van; Nabuurs-Franssen, M.H.; Hagen, F.

    2017-01-01

    OBJECTIVE: A multiplex extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBL-E) quantitative polymerase chain reaction (qPCR), performed directly on rectal swabs, was compared with a culture-based protocol to study the discrepancies between the two methods, and identify existing

  6. Rapid selective metal patterning on polydimethylsiloxane (PDMS) fabricated by capillarity-assisted laser direct write

    KAUST Repository

    Lee, Ming-Tsang

    2011-08-12

    In this study we demonstrate a novel approach for the rapid fabricating micro scale metal (silver) patterning directly on a polydimethylsiloxane (PDMS) substrate. Silver nanoparticles were sintered on PDMS to form conductive metal films using laser direct write (LDW) technology. To achieve good metal film quality, a capillarity-assisted laser direct writing (CALDW) of nanoparticle suspensions on a low surface energy material (PDMS) was utilized. Experimental results showed controllable electrical conductivities and good film properties of the sintered silver patterns. This study reveals an advanced method of metal patterning on PDMS, and proposes a new research application of LDW in a nanoparticle colloidal environment. © 2011 IOP Publishing Ltd.

  7. ARIBA: rapid antimicrobial resistance genotyping directly from sequencing reads.

    Science.gov (United States)

    Hunt, Martin; Mather, Alison E; Sánchez-Busó, Leonor; Page, Andrew J; Parkhill, Julian; Keane, Jacqueline A; Harris, Simon R

    2017-10-01

    Antimicrobial resistance (AMR) is one of the major threats to human and animal health worldwide, yet few high-throughput tools exist to analyse and predict the resistance of a bacterial isolate from sequencing data. Here we present a new tool, ARIBA, that identifies AMR-associated genes and single nucleotide polymorphisms directly from short reads, and generates detailed and customizable output. The accuracy and advantages of ARIBA over other tools are demonstrated on three datasets from Gram-positive and Gram-negative bacteria, with ARIBA outperforming existing methods.

  8. Rapid method for detection of salmonella in meat

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a rapid method for the detection of Salmonella in meat as well as to a kit for performing said method. The method provides a time-to-result of less than 8 hours.......The present invention relates to a rapid method for the detection of Salmonella in meat as well as to a kit for performing said method. The method provides a time-to-result of less than 8 hours....

  9. Direct and rapid genotyping of SLCO1B1 388A>G and 521T>C in human blood specimens using the SmartAmp-2 method.

    Science.gov (United States)

    Yoshida, Kenta; Takano, Junichi; Ishizu, Yuri; Lezhava, Alexander; Ieiri, Ichiro; Maeda, Kazuya; Hayashizaki, Yoshihide; Sugiyama, Yuichi

    2013-04-01

    Organic anion-transporting polypeptide (OATP) 1B1, encoded by the solute carrier organic anion transporter family member 1B1 (SLCO1B1) gene, mediates the active uptake of various organic anions into hepatocytes and determines their hepatic clearances as the first step in the detoxification pathway. Previous reports indicated that alterations in its function by drug-drug interactions or genetic polymorphisms affect the pharmacokinetics of the substrate drugs. In the present study, we developed a method to genotype SLCO1B1 388A>G (rs2306283) and 521>C (rs4149056), which significantly affect the clinical pharmacokinetics and subsequent side effects such as myopathy caused by statins, OATP1B1 substrates in humans. We used a small aliquot of blood and the isothermal Smart Amplification Process version 2 (SmartAmp-2), which could complete the genotyping of 388A>G and 521T>C within 60 min. The genotypes of 101 genomic DNA samples and blood samples assessed by SmartAmp-2 matched perfectly to those determined previously by the conventional PCR-SSCP method. The SmartAmp-2 method enables the rapid identification of the 388A>G and 521T>C genotypes, saving time and effort in the genomic DNA preparation in clinical practice. This method will be useful for evaluating and predicting altered pharmacological and toxicological effects of substrate drugs caused by SLCO1B1 polymorphisms.

  10. Rapid die manufacturing using direct laser metal deposition

    CSIR Research Space (South Africa)

    Pereira, MFVT

    2009-01-01

    Full Text Available This paper highlights the work undertaken at the CSIR on the issue of rapid die manufacturing through the application and evaluation of a rapid prototyping technique and coating technologies applied to die components of a high pressure casting die...

  11. Tomographic Reconstruction Methods for Decomposing Directional Components

    DEFF Research Database (Denmark)

    Kongskov, Rasmus Dalgas; Dong, Yiqiu

    X-ray computed tomography technique has many different practical applications. In this paper, we propose two new reconstruction methods that can decompose objects at the same time. By incorporating direction information, the proposed methods can decompose objects into various directional components...

  12. Rapid whole genome sequencing for the detection and characterization of microorganisms directly from clinical samples

    DEFF Research Database (Denmark)

    Hasman, Henrik; Saputra, Dhany; Sicheritz-Pontén, Thomas

    2014-01-01

    Whole genome sequencing (WGS) is becoming available as a routine tool for clinical microbiology. If applied directly on clinical samples this could further reduce diagnostic time and thereby improve control and treatment. A major bottle-neck is the availability of fast and reliable bioinformatics...... microbiology, WGS of isolated bacteria and by directly sequencing on pellets from the urine. A rapid method for analyzing the sequence data was developed. Bacteria were cultivated from 19 samples, but only in pure culture from 17. WGS improved the identification of the cultivated bacteria and almost complete...

  13. A rapid and simple pretreatment method for benzoylurea insecticides in honey samples using in-syringe dispersive liquid-liquid microextraction based on the direct solidification of ionic liquids.

    Science.gov (United States)

    Wang, Huazi; Hu, Lu; Li, Wanzhen; Lu, Runhua; Zhang, Sanbing; Zhou, Wenfeng; Gao, Haixiang

    2016-11-04

    A pretreatment method using in-syringe dispersive liquid-liquid microextraction based on the direct solidification of ionic liquids before high performance liquid chromatography analysis was developed for the determination of benzoylurea insecticides (BUs) in honey samples. The hydrophobic ionic liquid [N4444][PF6], formed in situ by the hydrophilic ionic liquid [N4444]Cl and the ion exchange reagent KPF6, was used to extract the target analytes. The entire extraction procedure was performed in a syringe. The extractant was solidified at room temperature and collected using a nylon membrane filter. This technique did not require a dispersive solvent, vortex mixer, ultrasound bath, or centrifugation. The parameters affecting the extraction efficiency were investigated through an experimental design. Under the optimal conditions, the limits of detection for the four BUs varied from 0.21 to 0.42μgL-1 in solution (2.1-4.2μgkg-1 in honey). Good linearities were obtained in the range of 2-300μgL-1, with coefficients of determination greater than 0.999. The recoveries of the four BUs ranged from 80.94% to 84.59%. The intra-day (n=3) and inter-day (n=3) relative standard deviations were less than 5.08%. Finally, the proposed method was applied to the determination of BUs in commercial honey samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A multi-directional rapidly exploring random graph (mRRG) for protein folding

    KAUST Repository

    Nath, Shuvra Kanti

    2012-01-01

    Modeling large-scale protein motions, such as those involved in folding and binding interactions, is crucial to better understanding not only how proteins move and interact with other molecules but also how proteins misfold, thus causing many devastating diseases. Robotic motion planning algorithms, such as Rapidly Exploring Random Trees (RRTs), have been successful in simulating protein folding pathways. Here, we propose a new multi-directional Rapidly Exploring Random Graph (mRRG) specifically tailored for proteins. Unlike traditional RRGs which only expand a parent conformation in a single direction, our strategy expands the parent conformation in multiple directions to generate new samples. Resulting samples are connected to the parent conformation and its nearest neighbors. By leveraging multiple directions, mRRG can model the protein motion landscape with reduced computational time compared to several other robotics-based methods for small to moderate-sized proteins. Our results on several proteins agree with experimental hydrogen out-exchange, pulse-labeling, and F-value analysis. We also show that mRRG covers the conformation space better as compared to the other computation methods. Copyright © 2012 ACM.

  15. A multi-centre prospective evaluation of the Check-Direct ESBL Screen for BD MAX as a rapid molecular screening method for extended-spectrum beta-lactamase-producing Enterobacteriaceae rectal carriage.

    Science.gov (United States)

    Engel, T; Slotboom, B J; van Maarseveen, N; van Zwet, A A; Nabuurs-Franssen, M H; Hagen, F

    2017-11-01

    A multiplex extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBL-E) quantitative polymerase chain reaction (qPCR), performed directly on rectal swabs, was compared with a culture-based protocol to study the discrepancies between the two methods, and identify existing challenges to apply this assay in routine clinical practice. The secondary objective was to assess the performance of the qPCR. In two Dutch teaching hospitals, 573 rectal swabs were collected prospectively. Culture with additional testing with the Check-MDR CT103XL (Check-Points) was compared with the Check-Direct ESBL Screen for BD MAX (Check-Points), which detects the presence of the ESBL gene families CTX-M1, CTX-M2, CTX-M9 and SHV2/5-ESBL. The culture-based protocol (with Brilliance agar) was considered as the gold standard to assess the performance of the qPCR. Of the 573 rectal swabs, 74 (12.9%) were culture-positive. Eighty-four (14.7%) were qPCR-positive. There were eight culture-positive/qPCR-negative discrepancies and 18 culture-negative/qPCR-positive discrepancies. Sensitivity and specificity of qPCR vs culture were 87.7% [95% confidence interval (CI) 79.7-95.7] and 96.3% (95% CI 94.6-98.0), respectively. The Check-Direct ESBL Screen for the BD MAX is an easy-to-perform, quick molecular diagnostic test with the potential to significantly speed up screening for rectal ESBL-E carriage. Discrepancies were observed between the culture-based protocol and the qPCR in 4.5% of tested samples. Existing challenges for implementing qPCR are its limited sensitivity, the need for thorough knowledge of the local ESBL-E genes, and interpretation of culture-negative but qPCR-positive samples. It is believed that the limited sensitivity of qPCR could be optimized by including blaTEM as a molecular target, and improving the limit of detection. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  16. Methods of conditioning direct methanol fuel cells

    Science.gov (United States)

    Rice, Cynthia; Ren, Xiaoming; Gottesfeld, Shimshon

    2005-11-08

    Methods for conditioning the membrane electrode assembly of a direct methanol fuel cell ("DMFC") are disclosed. In a first method, an electrical current of polarity opposite to that used in a functioning direct methanol fuel cell is passed through the anode surface of the membrane electrode assembly. In a second method, methanol is supplied to an anode surface of the membrane electrode assembly, allowed to cross over the polymer electrolyte membrane of the membrane electrode assembly to a cathode surface of the membrane electrode assembly, and an electrical current of polarity opposite to that in a functioning direct methanol fuel cell is drawn through the membrane electrode assembly, wherein methanol is oxidized at the cathode surface of the membrane electrode assembly while the catalyst on the anode surface is reduced. Surface oxides on the direct methanol fuel cell anode catalyst of the membrane electrode assembly are thereby reduced.

  17. RAPID METHOD FOR DETERMINATION OF RADIOSTRONTIUM IN EMERGENCY MILK SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, S.; Culligan, B.

    2008-07-17

    A new rapid separation method for radiostrontium in emergency milk samples was developed at the Savannah River Site (SRS) Environmental Bioassay Laboratory (Aiken, SC, USA) that will allow rapid separation and measurement of Sr-90 within 8 hours. The new method uses calcium phosphate precipitation, nitric acid dissolution of the precipitate to coagulate residual fat/proteins and a rapid strontium separation using Sr Resin (Eichrom Technologies, Darien, IL, USA) with vacuum-assisted flow rates. The method is much faster than previous method that use calcination or cation exchange pretreatment, has excellent chemical recovery, and effectively removes beta interferences. When a 100 ml sample aliquot is used, the method has a detection limit of 0.5 Bq/L, well below generic emergency action levels.

  18. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    Abstract. There is no 'one' procedure for extracting DNA from the whole blood of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological ...

  19. Rapid, cost-effective liquid chromatograghic method for the ...

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... 1Department of Medicinal Chemistry and Quality Control, National Institute for Pharmaceutical Research and Development, Abuja,. Nigeria. ... A rapid and cost effective method for the analysis of metronidazole in biological samples was ... effective HPLC method of assaying metronidazole both in.

  20. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    ... of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological basis is followed in this procedure, in which, when the bloodis placed in water, ...

  1. Rapid whole-genome sequencing for detection and characterization of microorganisms directly from clinical samples.

    Science.gov (United States)

    Hasman, Henrik; Saputra, Dhany; Sicheritz-Ponten, Thomas; Lund, Ole; Svendsen, Christina Aaby; Frimodt-Møller, Niels; Aarestrup, Frank M

    2014-01-01

    Whole-genome sequencing (WGS) is becoming available as a routine tool for clinical microbiology. If applied directly on clinical samples, this could further reduce diagnostic times and thereby improve control and treatment. A major bottleneck is the availability of fast and reliable bioinformatic tools. This study was conducted to evaluate the applicability of WGS directly on clinical samples and to develop easy-to-use bioinformatic tools for the analysis of sequencing data. Thirty-five random urine samples from patients with suspected urinary tract infections were examined using conventional microbiology, WGS of isolated bacteria, and direct sequencing on pellets from the urine samples. A rapid method for analyzing the sequence data was developed. Bacteria were cultivated from 19 samples but in pure cultures from only 17 samples. WGS improved the identification of the cultivated bacteria, and almost complete agreement was observed between phenotypic and predicted antimicrobial susceptibilities. Complete agreement was observed between species identification, multilocus sequence typing, and phylogenetic relationships for Escherichia coli and Enterococcus faecalis isolates when the results of WGS of cultured isolates and urine samples were directly compared. Sequencing directly from the urine enabled bacterial identification in polymicrobial samples. Additional putative pathogenic strains were observed in some culture-negative samples. WGS directly on clinical samples can provide clinically relevant information and drastically reduce diagnostic times. This may prove very useful, but the need for data analysis is still a hurdle to clinical implementation. To overcome this problem, a publicly available bioinformatic tool was developed in this study.

  2. Distributed Reconstruction via Alternating Direction Method

    Directory of Open Access Journals (Sweden)

    Linyuan Wang

    2013-01-01

    Full Text Available With the development of compressive sensing theory, image reconstruction from few-view projections has received considerable research attentions in the field of computed tomography (CT. Total-variation- (TV- based CT image reconstruction has been shown to be experimentally capable of producing accurate reconstructions from sparse-view data. In this study, a distributed reconstruction algorithm based on TV minimization has been developed. This algorithm is very simple as it uses the alternating direction method. The proposed method can accelerate the alternating direction total variation minimization (ADTVM algorithm without losing accuracy.

  3. Comparison of rapid colorimetric method with conventional method in the isolation of mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Oberoi A

    2004-01-01

    Full Text Available The aim of the study was to evaluate two methods (colorimetric and conventional for isolation of Mycobacterium tuberculosis. A total of 500 clinical specimens were processed by modified Petroff′s method and then inoculated into MB/BacT-240 system bottles and on LJ medium slopes. The specimens included 242 sputum, 95 gastric aspirates, 47 pleural fluids, 45 CSF, 32 urine, 18 pus, 11 bronchoalveolar lavage, 3 tissue, 2 stool, 2 lymphnode specimens, 2 synovial fluid and 1 bronchial wash specimens. The isolation rate was 16.4% by the colorimetric method and 2.2% by the conventional method. The mean detection time was 16 days and 26 days respectively. Among 36 direct smear positive samples, 63.9%(23/36 and 30%(11/36 were positive by colorimetric and conventional methods respectively. Out of 464 direct smear negative samples 12.9%(60/464 and 0.6%(3/464 were positive by colorimetric and conventional methods respectively. Therefore, colorimetric method enables rapid detection leading to early diagnosis and drug susceptibility testing.

  4. Motion Planning for a Direct Metal Deposition Rapid Prototyping System

    Energy Technology Data Exchange (ETDEWEB)

    AMES,ARLO L.; HENSINGER,DAVID M.; KUHLMANN,JOEL L.

    1999-10-18

    A motion planning strategy was developed and implemented to generate motion control instructions from solid model data for controlling a robotically driven solid free-form fabrication process. The planning strategy was tested using a PUMA type robot arm integrated into a LENS{trademark} (Laser Engineered Net Shape) system. Previous systems relied on a series of x, y, and z stages, to provide a minimal coordinated motion control capability. This limited the complexity of geometries that could be constructed. With the coordinated motion provided by a robotic arm, the system can produce three dimensional parts by ''writing'' material onto any face of existing material. The motion planning strategy relied on solid model geometry evaluation and exploited robotic positioning flexibility to allow the construction of geometrically complex parts. The integration of the robotic manipulator into the LENS{trademark} system was tested by producing metal parts directly from CAD models.

  5. Rapid Detection and Identification of Candidemia by Direct Blood Culturing on Solid Medium by Use of Lysis-Centrifugation Method Combined with Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS).

    Science.gov (United States)

    Idelevich, Evgeny A; Grünastel, Barbara; Becker, Karsten

    2017-01-01

    Candida sepsis is a life-threatening condition with increasing prevalence. In this study, direct blood culturing on solid medium using a lysis-centrifugation procedure enabled successful Candida species identification by matrix-assisted laser desorption-ionization time of flight mass spectrometry on average 3.8 h (Sabouraud agar) or 7.4 h (chocolate agar) before the positivity signal for control samples in Bactec mycosis-IC/F or Bactec Plus aerobic/F bottles, respectively. Direct culturing on solid medium accelerated candidemia diagnostics compared to that with automated broth-based systems. Copyright © 2016 American Society for Microbiology.

  6. Methods for Rapid Screening in Woody Plant Herbicide Development

    Directory of Open Access Journals (Sweden)

    William Stanley

    2014-07-01

    Full Text Available Methods for woody plant herbicide screening were assayed with the goal of reducing resources and time required to conduct preliminary screenings for new products. Rapid screening methods tested included greenhouse seedling screening, germinal screening, and seed screening. Triclopyr and eight experimental herbicides from Dow AgroSciences (DAS 313, 402, 534, 548, 602, 729, 779, and 896 were tested on black locust, loblolly pine, red maple, sweetgum, and water oak. Screening results detected differences in herbicide and species in all experiments in much less time (days to weeks than traditional field screenings and consumed significantly less resources (<500 mg acid equivalent per herbicide per screening. Using regression analysis, various rapid screening methods were linked into a system capable of rapidly and inexpensively assessing herbicide efficacy and spectrum of activity. Implementation of such a system could streamline early-stage herbicide development leading to field trials, potentially freeing resources for use in development of beneficial new herbicide products.

  7. A rapid ultrasound particle agglutination method for HIV antibody detection: Comparison with conventional rapid HIV tests.

    Science.gov (United States)

    Bystryak, Simon; Ossina, Natalya

    2017-11-01

    We present the results of the feasibility and preliminary studies on analytical performance of a rapid test for detection of human immunodeficiency virus (HIV) antibodies in human serum or plasma that is an important advance in detecting HIV infection. Current methods for rapid testing of antibodies against HIV are qualitative and exhibit poor sensitivity (limit of detection). In this paper, we describe an ultrasound particle agglutination (UPA) method that leads to a significant increase of the sensitivity of conventional latex agglutination tests for HIV antibody detection in human serum or plasma. The UPA method is based on the use of: 1) a dual mode ultrasound, wherein a first single-frequency mode is used to accelerate the latex agglutination process, and then a second swept-frequency mode of sonication is used to disintegrate non-specifically bound aggregates; and 2) a numerical assessment of results of the agglutination process. The numerical assessment is carried out by optical detection and analysis of moving patterns in the resonator cell during the swept-frequency mode. The single-step UPA method is rapid and more sensitive than the three commercial rapid HIV test kits analyzed in the study: analytical sensitivity of the new UPA method was found to be 510-, 115-, and 80-fold higher than that for Capillus™, Multispot™ and Uni-Gold™ Recombigen HIV antibody rapid test kits, respectively. The newly developed UPA method opens up additional possibilities for detection of a number of clinically significant markers in point-of-care settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Rapid Methods for detection of Veterinary Drug residues in Meat

    Directory of Open Access Journals (Sweden)

    Chandan

    2010-10-01

    Full Text Available The use of substances having hormonal or thyreostatic action as well as b-agonists is banned in many countries. However, sometimes forbidden drugs may be added to feeds for illegal administration to farm animals for promoting increased muscle development or increased water retention and thus obtain an economical benefit. The result is a fraudulent overweight of meat but, what is worse, residues of these substances may remain in meat and may pose a real threat to the consumer either through exposure to the residues, transfer of antibiotic resistance or allergy risk. This has exerted a great concern among the meat consumers. The control of the absence of these forbidden substances in animal foods and feeds is regulated in the European Union by Directive 96/23/EC on measures to monitor certain substances and residues in live animals and animal products. Analytical methodology, including criteria for identification and confirmation, for the monitoring of compliance was also given in Decisions 93/256/EEC and 93/257/EEC. More recently, Decision 2002/657/EC provided rules for the analytical methods to be used in testing of official samples. New substances with anabolic properties are being detected year by year increasing the list of forbidden compounds to be tested. Furthermore, the extended practice consisting in the use of “cocktails” (mixtures of low amounts of several substances that exert a synergistic effect to have a similar growth promotion, reduces the margin for an effective analytical detection. Thus, the evolution of the “black market” is making really difficult to have an effective analytical control of the residues of these substances in foods of animal origin. Control laboratories must face an increasing demand of analysis like the growing number of residues to be analysed in different types of samples, the strict guidelines for analytical methodologies according to the latest Directives, the increased costs of such new

  9. RAPID SEPARATION METHOD FOR ACTINIDES IN EMERGENCY SOIL SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, S.; Culligan, B.; Noyes, G.

    2009-11-09

    A new rapid method for the determination of actinides in soil and sediment samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for samples up to 2 grams in emergency response situations. The actinides in soil method utilizes a rapid sodium hydroxide fusion method, a lanthanum fluoride soil matrix removal step, and a streamlined column separation process with stacked TEVA, TRU and DGA Resin cartridges. Lanthanum was separated rapidly and effectively from Am and Cm on DGA Resin. Vacuum box technology and rapid flow rates are used to reduce analytical time. Alpha sources are prepared using cerium fluoride microprecipitation for counting by alpha spectrometry. The method showed high chemical recoveries and effective removal of interferences. This new procedure was applied to emergency soil samples received in the NRIP Emergency Response exercise administered by the National Institute for Standards and Technology (NIST) in April, 2009. The actinides in soil results were reported within 4-5 hours with excellent quality.

  10. Rapid method to estimate temperature changes in electronics elements

    Directory of Open Access Journals (Sweden)

    Oborskii G. A., Savel’eva O. S., Shikhireva Yu. V.

    2014-06-01

    Full Text Available Thermal behavior of electronic equipment is the determining factor for performing rapid assessment of the effectiveness of design and operation of the equipment. The assessment method proposed in this article consists in fixation of an infrared video stream from the surface of the device and converting it into a visible flow by means of a thermal imager, splitting it into component colors and their further processing using parabolic transformation. The result of the transformation is the number used as a rapid criterion for estimation of distribution stability of heat in the equipment.

  11. Direct, rapid antimicrobial susceptibility test from positive blood cultures based on microscopic imaging analysis

    OpenAIRE

    Choi, Jungil; Jeong, Hyun Yong; Lee, Gi Yoon; Han, Sangkwon; Han, Shinhun; Jin, Bonghwan; Lim, Taegeun; Kim, Shin; Kim, Dong Young; Kim, Hee Chan; Kim, Eui-Chong; Song, Sang Hoon; Kim, Taek Soo; Kwon, Sunghoon

    2017-01-01

    For the timely treatment of patients with infections in bloodstream and cerebrospinal fluid, a rapid antimicrobial susceptibility test (AST) is urgently needed. Here, we describe a direct and rapid antimicrobial susceptibility testing (dRAST) system, which can determine the antimicrobial susceptibility of bacteria from a positive blood culture bottle (PBCB) in six hours. The positive blood culture sample is directly mixed with agarose and inoculated into a micropatterned plastic microchip wit...

  12. Rapid methods for detection of bacterial resistance to antibiotics.

    Science.gov (United States)

    March-Rosselló, Gabriel Alberto

    2017-03-01

    The most widely used antibiotic susceptibility testing methods in Clinical Microbiology are based on the phenotypic detection of antibiotic resistance by measuring bacterial growth in the presence of the antibiotic being tested. These conventional methods take typically 24hours to obtain results. Here we review the main techniques for rapid determination of antibiotic susceptibility. Data obtained with different methods such as molecular techniques, microarrays, commercial methods used in work routine, immunochromatographic methods, colorimetric methods, image methods, nephelometry, MALDI-TOF mass spectrometry, flow cytometry, chemiluminescence and bioluminescence, microfluids and methods based on cell disruption are analysed in detail. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  13. Evaluation of a Rapid Method of Determination of Plasma Fibrinogen

    Science.gov (United States)

    Thomson, G. W.; McSherry, B. J.; Valli, V. E. O.

    1974-01-01

    An evaluation was made of a rapid semiautomated method of determining fibrinogen levels in bovine plasma. This method, the fibrometer method of Morse, Panek and Menga (8), is based on the principle that when thrombin is added to suitably diluted plasma the time of clotting is linearly related to the fibrinogen concentration. A standard curve prepared using bovine plasma had an r value of .9987 and analysis of variance showed there was no significant deviation from regression. A comparison of the fibrometer method and the biuret method of Ware, Guest and Seegers done on 158 bovine plasma samples showed good correlation between the two methods. It was concluded that the fibrometer method does measure bovine fibrinogen and has considerable merit for use in clinical diseases of cattle. PMID:4277474

  14. Rapid methods for determination of fluoxetine in pharmaceutical formulations.

    Science.gov (United States)

    Mandrioli, R; Pucci, V; Visini, D; Varani, G; Raggi, M A

    2002-08-01

    Two different analytical methods for the quality control of fluoxetine in commercial formulations have been developed and compared: a spectrofluorimetric method and a capillary zone electrophoretic (CZE) method. The fluorescence emission values were measured at lambda=293 nm when exciting at lambda=230 nm. The CZE method used an uncoated fused-silica capillary and pH 2.5 phosphate buffer as the background electrolyte. The extraction of fluoxetine from the capsules consisted of a simple one-step dissolution with methanol/water, filtration and dilution. Both methods gave satisfactory results in terms of precision; the best results were obtained for the electrophoretic method, with RSD% values always lower than 2.0%. The accuracy was assessed by means of recovery studies, which gave very good results, between 97.5 and 102.6%. Furthermore, both methods also have the advantage of being very rapid.

  15. Direct anharmonic correction method by molecular dynamics

    Science.gov (United States)

    Liu, Zhong-Li; Li, Rui; Zhang, Xiu-Lu; Qu, Nuo; Cai, Ling-Cang

    2017-04-01

    The quick calculation of accurate anharmonic effects of lattice vibrations is crucial to the calculations of thermodynamic properties, the construction of the multi-phase diagram and equation of states of materials, and the theoretical designs of new materials. In this paper, we proposed a direct free energy interpolation (DFEI) method based on the temperature dependent phonon density of states (TD-PDOS) reduced from molecular dynamics simulations. Using the DFEI method, after anharmonic free energy corrections we reproduced the thermal expansion coefficients, the specific heat, the thermal pressure, the isothermal bulk modulus, and the Hugoniot P- V- T relationships of Cu easily and accurately. The extensive tests on other materials including metal, alloy, semiconductor and insulator also manifest that the DFEI method can easily uncover the rest anharmonicity that the quasi-harmonic approximation (QHA) omits. It is thus evidenced that the DFEI method is indeed a very efficient method used to conduct anharmonic effect corrections beyond QHA. More importantly it is much more straightforward and easier compared to previous anharmonic methods.

  16. A simple and rapid method for determining transgenic cotton plants.

    Science.gov (United States)

    Zhang, Baohong; Wang, Hongmei; Liu, Fang; Wang, Qinglian

    2013-01-01

    Determining transgenic events is a critical step for obtaining transgenic plants as well as the later stage of application. Traditional methods, such as Northern blotting and qRT-PCR, for determining transgenic events either require radioactively labeled substrates, expensive instruments, or long-time commitments, which result in lab and time-consuming as well as expensive costs. These methods also require destroying the transgenic events. In this chapter, we present a simple and rapid method for determining transgenic cotton plants in both laboratory and field conditions. This method is based on the sensitivity of transgenic and non-transgenic plants to a specific chemical, such as antibiotics or herbicides. This method will facilitate the screening of transgenic events, save time, reduce cost, and speed up the application of transgenic technology on cotton breeding and production. More important, this is a nondestructive bioassay method; the transgenic plants can be transferred into greenhouse or field for the later study after the detection process.

  17. Rapid Diagnosis of Azole-Resistant Aspergillosis by Direct PCR Using Tissue Specimens

    NARCIS (Netherlands)

    van der Linden, Jan W. M.; Snelders, Eveline; Arends, Jan P.; Daenen, Simon M.; Melchers, Willem J. G.; Verweij, Paul E.

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  18. Rapid diagnosis of azole-resistant aspergillosis by direct PCR using tissue specimens.

    NARCIS (Netherlands)

    Linden, J.W.M. van der; Snelders, E.; Arends, J.P.; Daenen, S.M.G.J.; Melchers, W.J.G.; Verweij, P.E.

    2010-01-01

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  19. Rapid and selective method for quantitation of metronidazole in pharmaceuticals.

    Science.gov (United States)

    Sanyal, A K

    1988-01-01

    A selective and highly sensitive assay for N-1-substituted nitroimidazoles has been modified and adapted for rapid estimation of metronidazole in pharmaceuticals. The color reaction is based on diazotization of sulfanilamide with the nitrite ions liberated by alkaline hydrolysis of metronidazole and subsequent coupling of the diazonium salt with N-1-(naphthyl)-ethylenediamine dihydrochloride. This method is applicable for the assay of benzoyl metronidazole in oral suspension. Officially recommended excipients and preservatives do not interfere.

  20. Preparing Silica Aerogel Monoliths via a Rapid Supercritical Extraction Method

    Science.gov (United States)

    Gorka, Caroline A.

    2014-01-01

    A procedure for the fabrication of monolithic silica aerogels in eight hours or less via a rapid supercritical extraction process is described. The procedure requires 15-20 min of preparation time, during which a liquid precursor mixture is prepared and poured into wells of a metal mold that is placed between the platens of a hydraulic hot press, followed by several hours of processing within the hot press. The precursor solution consists of a 1.0:12.0:3.6:3.5 x 10-3 molar ratio of tetramethylorthosilicate (TMOS):methanol:water:ammonia. In each well of the mold, a porous silica sol-gel matrix forms. As the temperature of the mold and its contents is increased, the pressure within the mold rises. After the temperature/pressure conditions surpass the supercritical point for the solvent within the pores of the matrix (in this case, a methanol/water mixture), the supercritical fluid is released, and monolithic aerogel remains within the wells of the mold. With the mold used in this procedure, cylindrical monoliths of 2.2 cm diameter and 1.9 cm height are produced. Aerogels formed by this rapid method have comparable properties (low bulk and skeletal density, high surface area, mesoporous morphology) to those prepared by other methods that involve either additional reaction steps or solvent extractions (lengthier processes that generate more chemical waste).The rapid supercritical extraction method can also be applied to the fabrication of aerogels based on other precursor recipes. PMID:24637334

  1. Rapid Enzymatic Method for Pectin Methyl Esters Determination

    Directory of Open Access Journals (Sweden)

    Lucyna Łękawska-Andrinopoulou

    2013-01-01

    Full Text Available Pectin is a natural polysaccharide used in food and pharma industries. Pectin degree of methylation is an important parameter having significant influence on pectin applications. A rapid, fully automated, kinetic flow method for determination of pectin methyl esters has been developed. The method is based on a lab-made analyzer using the reverse flow-injection/stopped flow principle. Methanol is released from pectin by pectin methylesterase in the first mixing coil. Enzyme working solution is injected further downstream and it is mixed with pectin/pectin methylesterase stream in the second mixing coil. Methanol is oxidized by alcohol oxidase releasing formaldehyde and hydrogen peroxide. This reaction is coupled to horse radish peroxidase catalyzed reaction, which gives the colored product 4-N-(p-benzoquinoneimine-antipyrine. Reaction rate is proportional to methanol concentration and it is followed using Ocean Optics USB 2000+ spectrophotometer. The analyzer is fully regulated by a lab written LabVIEW program. The detection limit was 1.47 mM with an analysis rate of 7 samples h−1. A paired t-test with results from manual method showed that the automated method results are equivalent to the manual method at the 95% confidence interval. The developed method is rapid and sustainable and it is the first application of flow analysis in pectin analysis.

  2. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Hongbin; Wang Chunyan; Qi Yao [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); University of Chinese Academy of Sciences, Beijing 100039 (China); Song Fengrui, E-mail: songfr@ciac.jl.cn [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Liu Zhiqiang; Liu Shuying [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

    2012-11-08

    Highlights: Black-Right-Pointing-Pointer DART MS combined with PCA and HCA was used to rapidly identify markers of Radix Aconiti. Black-Right-Pointing-Pointer The DART MS behavior of six aconitine-type alkaloids was investigated. Black-Right-Pointing-Pointer Chemical markers were recognized between the qualified and unqualified samples. Black-Right-Pointing-Pointer DART MS was shown to be an effective tool for quality control of Radix Aconiti Preparata. - Abstract: This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in

  3. [The primary application of direct rapid immunohistochemical test to rabies diagnosis in China].

    Science.gov (United States)

    Tao, Xiao-Yan; Niezgoda, Michael; Du, Jia-Liang; Li, Hao; Wang, Xiao-Guang; Huang, Ying; Jiao, Yang; Cao, Lei; Tang, Qing; Liang, Guo-Dong

    2008-06-01

    Evaluation of the direct rapid immumohistochemical test (DRIT) for laboratory surveillance of rabies. 72 brain specimens of domestic dogs or patients collected from Guizhou, Guangxi, Hunan, Anhui, Jiangsu and Yunnan provinces were detected by conventional methods including Direct Fluorescent-antibody Assay (DFA) and Reverse Transcription Polymerase Chain Reaction (RT-PCR), and by DRIT which was newly developed in the Rabies Section of the Centers for Disease Control and Prevention in the United States. The sensitivity and specificity of DRIT were evaluated by compare of the three results. By analysis of the index including cost of experiment, technique requirement and so on, the advancement and applicability of DRIT were discussed. Compared with DFA and RT-PCR, DRIT will be more applicable for laboratories with limited funds and weak techniques because of its lower cost needed and simpler techniques required while its sensitivity and specificity are equal to the other two methods. DRIT is more valuable in rabies diagnosis and more applicable for extension and popularization in rabies laboratory surveillance in local CDC.

  4. A convenient and rapid method for genetic transformation of E. coli with plasmids.

    Science.gov (United States)

    Chen, X; Guo, P; Xie, Z; Shen, P

    2001-12-01

    A convenient and rapid method for the genetic transformation of Escherichia coli with plasmids is proposed. By mixing the recipient cells and plasmid DNA and spreading them directly on selective medium plates containing Ca2+, the so-called 'plate transformation' could achieve almost the same transformation efficiency as the classical transformation method with calcium. The whole protocol takes only about 2 min, its simplicity compared favorably, not only to the usual protocol, but also to all other documented modifications.

  5. SIMS: a hybrid method for rapid conformational analysis.

    Directory of Open Access Journals (Sweden)

    Bryant Gipson

    Full Text Available Proteins are at the root of many biological functions, often performing complex tasks as the result of large changes in their structure. Describing the exact details of these conformational changes, however, remains a central challenge for computational biology due the enormous computational requirements of the problem. This has engendered the development of a rich variety of useful methods designed to answer specific questions at different levels of spatial, temporal, and energetic resolution. These methods fall largely into two classes: physically accurate, but computationally demanding methods and fast, approximate methods. We introduce here a new hybrid modeling tool, the Structured Intuitive Move Selector (sims, designed to bridge the divide between these two classes, while allowing the benefits of both to be seamlessly integrated into a single framework. This is achieved by applying a modern motion planning algorithm, borrowed from the field of robotics, in tandem with a well-established protein modeling library. sims can combine precise energy calculations with approximate or specialized conformational sampling routines to produce rapid, yet accurate, analysis of the large-scale conformational variability of protein systems. Several key advancements are shown, including the abstract use of generically defined moves (conformational sampling methods and an expansive probabilistic conformational exploration. We present three example problems that sims is applied to and demonstrate a rapid solution for each. These include the automatic determination of "active" residues for the hinge-based system Cyanovirin-N, exploring conformational changes involving long-range coordinated motion between non-sequential residues in Ribose-Binding Protein, and the rapid discovery of a transient conformational state of Maltose-Binding Protein, previously only determined by Molecular Dynamics. For all cases we provide energetic validations using well

  6. A novel method for rapid in vitro radiobioassay

    Science.gov (United States)

    Crawford, Evan Bogert

    Rapid and accurate analysis of internal human exposure to radionuclides is essential to the effective triage and treatment of citizens who have possibly been exposed to radioactive materials in the environment. The two most likely scenarios in which a large number of citizens would be exposed are the detonation of a radiation dispersal device (RDD, "dirty bomb") or the accidental release of an isotope from an industrial source such as a radioisotopic thermal generator (RTG). In the event of the release and dispersion of radioactive materials into the environment in a large city, the entire population of the city -- including all commuting workers and tourists -- would have to be rapidly tested, both to satisfy the psychological needs of the citizens who were exposed to the mental trauma of a possible radiation dose, and to satisfy the immediate medical needs of those who received the highest doses and greatest levels of internal contamination -- those who would best benefit from rapid, intensive medical care. In this research a prototype rapid screening method to screen urine samples for the presence of up to five isotopes, both individually and in a mixture, has been developed. The isotopes used to develop this method are Co-60, Sr-90, Cs-137, Pu-238, and Am-241. This method avoids time-intensive chemical separations via the preparation and counting of a single sample on multiple detectors, and analyzing the spectra for isotope-specific markers. A rapid liquid-liquid separation using an organic extractive scintillator can be used to help quantify the activity of the alpha-emitting isotopes. The method provides quantifiable results in less than five minutes for the activity of beta/gamma-emitting isotopes when present in the sample at the intervention level as defined by the Centers for Disease Control and Prevention (CDC), and quantifiable results for the activity levels of alpha-emitting isotopes present at their respective intervention levels in approximately 30

  7. Rapid Electrokinetic Isolation of Cancer-Related Circulating Cell-Free DNA Directly from Blood

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y.; Rassenti, Laura; Ghia, Emanuela M.; Skowronski, Elaine A.; Manouchehri, Sareh; McCanna, James; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

    2014-01-01

    BACKGROUND Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a “liquid biopsy” may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. METHODS We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification,PCR,and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. RESULTS PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15–20 mL blood. CONCLUSIONS Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring. PMID:24270796

  8. Rapid assessment methods in eye care: An overview

    Directory of Open Access Journals (Sweden)

    Srinivas Marmamula

    2012-01-01

    Full Text Available Reliable information is required for the planning and management of eye care services. While classical research methods provide reliable estimates, they are prohibitively expensive and resource intensive. Rapid assessment (RA methods are indispensable tools in situations where data are needed quickly and where time- or cost-related factors prohibit the use of classical epidemiological surveys. These methods have been developed and field tested, and can be applied across almost the entire gamut of health care. The 1990s witnessed the emergence of RA methods in eye care for cataract, onchocerciasis, and trachoma and, more recently, the main causes of avoidable blindness and visual impairment. The important features of RA methods include the use of local resources, simplified sampling methodology, and a simple examination protocol/data collection method that can be performed by locally available personnel. The analysis is quick and easy to interpret. The entire process is inexpensive, so the survey may be repeated once every 5-10 years to assess the changing trends in disease burden. RA survey methods are typically linked with an intervention. This article provides an overview of the RA methods commonly used in eye care, and emphasizes the selection of appropriate methods based on the local need and context.

  9. A rapid DNA extraction method suitable for human papillomavirus detection.

    Science.gov (United States)

    Brestovac, Brian; Wong, Michelle E; Costantino, Paul S; Groth, David

    2014-04-01

    Infection with oncogenic human papillomavirus (HPV) genotypes is necessary for the development of cervical cancer. Testing for HPV DNA from liquid based cervical samples can be used as an adjunct to traditional cytological screening. In addition there are ongoing viral load, genotyping, and prevalence studies. Therefore, a sensitive DNA extraction method is needed to maximize the efficiency of HPV DNA detection. The XytXtract Tissue kit is a DNA extraction kit that is rapid and so could be useful for HPV testing, particularly in screening protocols. This study was undertaken to determine the suitability of this method for HPV detection. DNA extraction from HeLa and Caski cell lines containing HPV 18 and 16 respectively together with DNA from five liquid based cervical samples were used in a HPV PCR assay. DNA was also extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) as a comparison. DNA extracts were serially diluted and assayed. HPV DNA was successfully detected in cell lines and cervical samples using the XytXtract Tissue kit. In addition, the XytXtract method was found to be more sensitive than the QIAmp method as determined by a dilution series of the extracted DNA. While the XytXtract method is a closed, the QIAamp method uses a spin column with possible loss of DNA through DNA binding competition of the matrix, which could impact on the final extraction efficiency. The XytXtract is a cheap, rapid and efficient method for extracting HPV DNA from both cell lines and liquid based cervical samples. © 2014 Wiley Periodicals, Inc.

  10. Rapid detection of haloarchaeal carotenoids via liquid-liquid microextraction enabled direct TLC MALDI-MS.

    Science.gov (United States)

    Manikandan, Muthu; Hasan, Nazim; Wu, Hui-Fen

    2013-03-30

    For the first time, we demonstrate the use of TiO2 nanoparticles (NPs) for enhancing the carotenoid production by the extremophilic haloarchea, Haloferax mediterranei. TiO2 NPs at optimal concentration of 375 mg/L results in a 95% increase in the production of carotenoid pigment compared to the control (no TiO2 NPs). The carotenoid pigments extracted from TiO2 NPs treated H. mediterranei cells, were separated using thin layer chromatography (TLC). The separated carotenoid spots were subjected directly for MALDI MS detection. To limit the sample diffusion during matrix addition on TLC plates, a simple bordering mode was exercised. Using this method we were able to detect the pigments successfully using MALDI-MS, directly from TLC plates after separation. In addition, we also applied the Pt NPs capped with ODT via Liquid-liquid microextraction (LLME) for extracting the pigment molecules from the halobacteria in MALDI-MS. These novel NP approaches possess numerous advantages such as; rapidity, ease in synthesis, high sensitivity and low cost. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

    Science.gov (United States)

    V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

    2016-12-01

    Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

  12. Radiometric method for the rapid detection of Leptospira organisms

    Energy Technology Data Exchange (ETDEWEB)

    Manca, N.; Verardi, R.; Colombrita, D.; Ravizzola, G.; Savoldi, E.; Turano, A.

    1986-02-01

    A rapid and sensitive radiometric method for detection of Leptospira interrogans serovar pomona and Leptospira interrogans serovar copenhageni is described. Stuart's medium and Middlebrook TB (12A) medium supplemented with bovine serum albumin, catalase, and casein hydrolysate and labeled with /sup 14/C-fatty acids were used. The radioactivity was measured in a BACTEC 460. With this system, Leptospira organisms were detected in human blood in 2 to 5 days, a notably shorter time period than that required for the majority of detection techniques.

  13. Rapid coulometric method for the Kjeldahl determination of nitrogen.

    Science.gov (United States)

    Boström, C A; Cedergren, A; Johansson, G; Pettersson, I

    1974-11-01

    A rapid coulometric method for the Kjeldahl determination of nitrogen is described. The samples are digested by means of the Tecator AB digestion system which permits forty samples to be digested at the same time. The digestion products are diluted to 75 ml and 1 ml is coulometrically titrated in 1-2 min: 20-30 determinations can be performed per hour. For substances containing nitrogen in the per cent range the relative standard deviations for eight different substances were 0.1-1%.

  14. A Novel Rapid Method to Determine Cannabis Seed Germination Ability

    OpenAIRE

    吉澤, 政夫; 荒金, 眞佐子; 鈴木, 幸子; 北川, 重美; 中嶋, 順一; 森, 謙一郎; 荻野, 周三; Masao, Yoshizawa; Masako, Aragane; Yukiko, Suzuki; Shigemi, Kitagawa; Jun'ichi, Nakajima; Ken'ichiro, Mori; Shuzo, Ogino; 東京都健康安全研究センター薬用植物園

    2011-01-01

    A novel rapid method to determine cannabis seed germination ability was developed. Cannabis seeds were soaked in water for 15 minutes at 40℃, and germs were removed from the seeds by cracking the shell with tweezers. The germs were soaked in water for 15 minutes at 40℃, and the swollen skin was peeled off. The peeled germs were again soaked in water for 10 minutes at 40℃, and the angles between the seed leaves were measured. Cannabis seeds with angles of the seed leaves exceeding 30 degrees w...

  15. Rapid electrokinetic isolation of cancer-related circulating cell-free DNA directly from blood.

    Science.gov (United States)

    Sonnenberg, Avery; Marciniak, Jennifer Y; Rassenti, Laura; Ghia, Emanuela M; Skowronski, Elaine A; Manouchehri, Sareh; McCanna, James; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

    2014-03-01

    Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a "liquid biopsy" may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification, PCR, and DNA sequencing. The complete process, blood to PCR, required B-cell clone, and then sequenced. PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15-20 mL blood. Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring.

  16. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  17. Seed oil polyphenols: rapid and sensitive extraction method and high resolution-mass spectrometry identification.

    Science.gov (United States)

    Koubaa, Mohamed; Mhemdi, Houcine; Vorobiev, Eugène

    2015-05-01

    Phenolic content is a primary parameter for vegetables oil quality evaluation, and directly involved in the prevention of oxidation and oil preservation. Several methods have been reported in the literature for polyphenols extraction from seed oil but the approaches commonly used remain manually handled. In this work, we propose a rapid and sensitive method for seed oil polyphenols extraction and identification. For this purpose, polyphenols were extracted from Opuntia stricta Haw seed oil, using high frequency agitation, separated, and then identified using a liquid chromatography-high resolution mass spectrometry method. Our results showed good sensitivity and reproducibility of the developed methods. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Direct Parametric Image Reconstruction in Reduced Parameter Space for Rapid Multi-Tracer PET Imaging.

    Science.gov (United States)

    Cheng, Xiaoyin; Li, Zhoulei; Liu, Zhen; Navab, Nassir; Huang, Sung-Cheng; Keller, Ulrich; Ziegler, Sibylle; Shi, Kuangyu

    2015-02-12

    The separation of multiple PET tracers within an overlapping scan based on intrinsic differences of tracer pharmacokinetics is challenging, due to limited signal-to-noise ratio (SNR) of PET measurements and high complexity of fitting models. In this study, we developed a direct parametric image reconstruction (DPIR) method for estimating kinetic parameters and recovering single tracer information from rapid multi-tracer PET measurements. This is achieved by integrating a multi-tracer model in a reduced parameter space (RPS) into dynamic image reconstruction. This new RPS model is reformulated from an existing multi-tracer model and contains fewer parameters for kinetic fitting. Ordered-subsets expectation-maximization (OSEM) was employed to approximate log-likelihood function with respect to kinetic parameters. To incorporate the multi-tracer model, an iterative weighted nonlinear least square (WNLS) method was employed. The proposed multi-tracer DPIR (MTDPIR) algorithm was evaluated on dual-tracer PET simulations ([18F]FDG and [11C]MET) as well as on preclinical PET measurements ([18F]FLT and [18F]FDG). The performance of the proposed algorithm was compared to the indirect parameter estimation method with the original dual-tracer model. The respective contributions of the RPS technique and the DPIR method to the performance of the new algorithm were analyzed in detail. For the preclinical evaluation, the tracer separation results were compared with single [18F]FDG scans of the same subjects measured 2 days before the dual-tracer scan. The results of the simulation and preclinical studies demonstrate that the proposed MT-DPIR method can improve the separation of multiple tracers for PET image quantification and kinetic parameter estimations.

  19. Rapid Prototyping of Polymeric Nanopillars by 3D Direct Laser Writing for Controlling Cell Behavior.

    Science.gov (United States)

    Buch-Månson, Nina; Spangenberg, Arnaud; Gomez, Laura Piedad Chia; Malval, Jean-Pierre; Soppera, Olivier; Martinez, Karen L

    2017-08-23

    Mammalian cells have been widely shown to respond to nano- and microtopography that mimics the extracellular matrix. Synthetic nano- and micron-sized structures are therefore of great interest in the field of tissue engineering, where polymers are particularly attractive due to excellent biocompatibility and versatile fabrication methods. Ordered arrays of polymeric pillars provide a controlled topographical environment to study and manipulate cells, but processing methods are typically either optimized for the nano- or microscale. Here, we demonstrate polymeric nanopillar (NP) fabrication using 3D direct laser writing (3D DLW), which offers a rapid prototyping across both size regimes. The NPs are interfaced with NIH3T3 cells and the effect of tuning geometrical parameters of the NP array is investigated. Cells are found to adhere on a wide range of geometries, but the interface depends on NP density and length. The Cell Interface with Nanostructure Arrays (CINA) model is successfully extended to predict the type of interface formed on different NP geometries, which is found to correlate with the efficiency of cell alignment along the NPs. The combination of the CINA model with the highly versatile 3D DLW fabrication thus holds the promise of improved design of polymeric NP arrays for controlling cell growth.

  20. Rapid and direct synthesis of complex perovskite oxides through a highly energetic planetary milling

    Science.gov (United States)

    Lee, Gyoung-Ja; Park, Eun-Kwang; Yang, Sun-A.; Park, Jin-Ju; Bu, Sang-Don; Lee, Min-Ku

    2017-04-01

    The search for a new and facile synthetic route that is simple, economical and environmentally safe is one of the most challenging issues related to the synthesis of functional complex oxides. Herein, we report the expeditious synthesis of single-phase perovskite oxides by a high-rate mechanochemical reaction, which is generally difficult through conventional milling methods. With the help of a highly energetic planetary ball mill, lead-free piezoelectric perovskite oxides of (Bi, Na)TiO3, (K, Na)NbO3 and their modified complex compositions were directly synthesized with low contamination. The reaction time necessary to fully convert the micron-sized reactant powder mixture into a single-phase perovskite structure was markedly short at only 30-40 min regardless of the chemical composition. The cumulative kinetic energy required to overtake the activation period necessary for predominant formation of perovskite products was ca. 387 kJ/g for (Bi, Na)TiO3 and ca. 580 kJ/g for (K, Na)NbO3. The mechanochemically derived powders, when sintered, showed piezoelectric performance capabilities comparable to those of powders obtained by conventional solid-state reaction processes. The observed mechanochemical synthetic route may lead to the realization of a rapid, one-step preparation method by which to create other promising functional oxides without time-consuming homogenization and high-temperature calcination powder procedures.

  1. RAPID SEPARATION METHOD FOR EMERGENCY WATER AND URINE SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, S.; Culligan, B.

    2008-08-27

    The Savannah River Site Environmental Bioassay Lab participated in the 2008 NRIP Emergency Response program administered by the National Institute for Standards and Technology (NIST) in May, 2008. A new rapid column separation method was used for analysis of actinides and {sup 90}Sr the NRIP 2008 emergency water and urine samples. Significant method improvements were applied to reduce analytical times. As a result, much faster analysis times were achieved, less than 3 hours for determination of {sup 90}Sr and 3-4 hours for actinides. This represents a 25%-33% improvement in analysis times from NRIP 2007 and a {approx}100% improvement compared to NRIP 2006 report times. Column flow rates were increased by a factor of two, with no significant adverse impact on the method performance. Larger sample aliquots, shorter count times, faster cerium fluoride microprecipitation and streamlined calcium phosphate precipitation were also employed. Based on initial feedback from NIST, the SRS Environmental Bioassay Lab had the most rapid analysis times for actinides and {sup 90}Sr analyses for NRIP 2008 emergency urine samples. High levels of potential matrix interferences may be present in emergency samples and rugged methods are essential. Extremely high levels of {sup 210}Po were found to have an adverse effect on the uranium results for the NRIP-08 urine samples, while uranium results for NRIP-08 water samples were not affected. This problem, which was not observed for NRIP-06 or NRIP-07 urine samples, was resolved by using an enhanced {sup 210}Po removal step, which will be described.

  2. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  3. A rapid and specific colorimetric method for free tryptophan quantification.

    Science.gov (United States)

    Wu, Yinan; Wang, Tianmin; Zhang, Chong; Xing, Xin-Hui

    2018-01-01

    Tryptophan is one of the eight essential amino acids and plays an important role in many biological processes. For its interaction with human health, environment and relevant commercial interest in biotechnology-based production, rapid and specific quantification method for this molecule accessible to common laboratories is badly needed. We herein reported a simple colorimetric method for free tryptophan quantification with 96-well-plate-level throughput. Our protocol firstly converted tryptophan to indole enzymatically by purified tryptophanases and then used reactivity of indole with hydroxylamine to form pink product with absorption peak at 530nm, enabling the quantification of tryptophan with simple spectrometry in just two hours. We presented that this method exhibited a linear detection range from 100μM to 600μM (R(2) = 0.9969) with no detection towards other naturally occurring tryptophan analogs or tryptophan residues in proteins. It was very robust in complicated biological samples, as demonstrated by quantifying the titer of 36 mutated tryptophan-producing strains with Pearson correlation coefficient of 0.93 in contrast to that measured by high performance liquid chromatography (HPLC). Our method should be potent for routine free tryptophan quantification in a high-throughput manner, facilitating studies in medicine, microbiology, food chemistry, metabolic engineering, etc. Copyright © 2017. Published by Elsevier B.V.

  4. Rapid simulation of electromagnetic telemetry using an axisymmetric semianalytical finite element method

    Science.gov (United States)

    Chen, Jiefu; Zeng, Shubin; Dong, Qiuzhao; Huang, Yueqin

    2017-02-01

    An axisymmetric semianalytical finite element method is proposed and employed for rapid simulations of electromagnetic telemetry in layered underground formation. In this method, the layered media is decomposed into several subdomains and the interfaces between subdomains are discretized by conventional finite elements. Then a Riccati equation based high precision integration scheme is applied to exploit the homogeneity along the vertical direction in each layer. This semianalytical finite element scheme is very efficient in modeling electromagnetic telemetry in layered formation. Numerical examples as well as a field case with water based mud as drilling fluid are given to demonstrate the validity and effectiveness of this method.

  5. Rapid identification of cytokinins by an immunological method

    Energy Technology Data Exchange (ETDEWEB)

    Morris, R.O.; Jameson, P.E.; Morris, J.W. (Univ. of Missouri-Columbia (USA)); Laloue, M. (Centre Nationale de la Recherche Scientifique, Gif-sur-Yvette (France))

    1991-04-01

    A method for rapid identification of bacterial cytokinins has been developed in which cultures are fed ({sup 3}H)adenine, the cytokinins (including, {sup 3}H-labeled cytokinins) are isolated by immunoaffinity chromatography, and analyzed by HPLC with on-line scintillation counting. Analysis of Agrobacterium tumefaciens strains showed that some produced primarily trans-zeatin, whereas others produced primarily trans-zeatin riboside. Pseudomonas syringae pv savastanoi produced mixtures of transzeatin, dihydrozeatin, 1{double prime}-methyl-trans-zeatin riboside, and other unknown cytokinin-like substances. Corynebacterium fascians, produced cis-zeatin, isopentenyladenine and isopentenyladenosine. The technique is designed for qualitative rather than quantitative studies and allows ready identification of bacterial cytokinins. It may also have utility in the study of plant cytokinins if adequate incorporation of label into cytokinin precursor pools can be achieved.

  6. A rapid protection switching method in carrier ethernet ring networks

    Science.gov (United States)

    Yuan, Liang; Ji, Meng

    2008-11-01

    Abstract: Ethernet is the most important Local Area Network (LAN) technology since more than 90% data traffic in access layer is carried on Ethernet. From 10M to 10G, the improving Ethernet technology can be not only used in LAN, but also a good choice for MAN even WAN. MAN are always constructed in ring topology because the ring network could provide resilient path protection by using less resource (fibre or cable) than other network topologies. In layer 2 data networks, spanning tree protocol (STP) is always used to protect transmit link and preventing the formation of logic loop in networks. However, STP cannot guarantee the efficiency of service convergence when link fault happened. In fact, convergent time of networks with STP is about several minutes. Though Rapid Spanning Tree Protocol (RSTP) and Multi-Spanning Tree Protocol (MSTP) improve the STP technology, they still need a couple of seconds to achieve convergence, and can not provide sub-50ms protection switching. This paper presents a novel rapid ring protection method (RRPM) for carrier Ethernet. Unlike other link-fault detection method, it adopts distributed algorithm to detect link fault rapidly (sub-50ms). When networks restore from link fault, it can revert to the original working state. RRPM can provide single ring protection and interconnected ring protection without the formation of super loop. In normal operation, the master node blocks the secondary port for all non-RRPM Ethernet frames belonging to the given RRPM Ring, thereby avoiding a loop in the ring. When link fault happens, the node on which the failure happens moves from the "ring normal" state to the "ring fault" state. It also sends "link down" frame immediately to other nodes and blocks broken port and flushes its forwarding database. Those who receive "link down" frame will flush forwarding database and master node should unblock its secondary port. When the failure restores, the whole ring will revert to the normal state. That is

  7. Rapid in vitro derivation of endothelium directly from human cancer cells.

    Directory of Open Access Journals (Sweden)

    Jennifer D Elster

    Full Text Available The development of an independent blood supply by a tumor is essential for maintaining growth beyond a certain limited size and for providing a portal for metastatic dissemination. Host-derived endothelial cells (ECs residing in and compromising the tumor vasculature originate via distinct processes known as sprouting angiogenesis and vasculogenesis. More recently ECs originating directly from the tumor cells themselves have been described although the basis for this phenomenon remains poorly understood. Here we describe in vitro conditions that allow lung and ovarian cancer cells to undergo a rapid and efficient transition into ECs that are indistinguishable from those obtained in vivo. A variety of methods were used to establish that the acquired phenotypes and behaviors of these tumor-derived ECs (TDECs closely resemble those of authentic ECs. Xenografts arising from co-inoculated in vitro-derived TDECs and tumor cells were also more highly vascularized than control tumors; moreover, their blood vessels were on average larger and frequently contained admixtures of host-derived ECs and TDECs derived from the initial inoculum. These results demonstrate that cancer cells can be manipulated under well-defined in vitro conditions to initiate a tumor cell-to-EC transition that is largely cell-autonomous, highly efficient and closely mimics the in vivo process. These studies provide a suitable means by which to identify and perhaps modify the earliest steps in TDEC generation.

  8. Limit State of Materials and Structures Direct Methods 2

    CERN Document Server

    Oueslati, Abdelbacet; Charkaluk, Eric; Tritsch, Jean-Bernard

    2013-01-01

    To determine the carrying capacity of a structure or a structural element susceptible to operate beyond the elastic limit is an important task in many situations of both mechanical and civil engineering. The so-called “direct methods” play an increasing role due to the fact that they allow rapid access to the request information in mathematically constructive manners. They embrace Limit Analysis, the most developed approach now widely used, and Shakedown Analysis, a powerful extension to the variable repeated loads potentially more economical than step-by-step inelastic analysis. This book is the outcome of a workshop held at the University of Sciences and Technology of Lille. The individual contributions stem from the areas of new numerical developments rendering these methods more attractive for industrial design, extension of the general methodology to new horizons, probabilistic approaches and concrete technological applications.

  9. Method for Rapid Protein Identification in a Large Database

    Directory of Open Access Journals (Sweden)

    Wenli Zhang

    2013-01-01

    Full Text Available Protein identification is an integral part of proteomics research. The available tools to identify proteins in tandem mass spectrometry experiments are not optimized to face current challenges in terms of identification scale and speed owing to the exponential growth of the protein database and the accelerated generation of mass spectrometry data, as well as the demand for nonspecific digestion and post-modifications in complex-sample identification. As a result, a rapid method is required to mitigate such complexity and computation challenges. This paper thus aims to present an open method to prevent enzyme and modification specificity on a large database. This paper designed and developed a distributed program to facilitate application to computer resources. With this optimization, nearly linear speedup and real-time support are achieved on a large database with nonspecific digestion, thus enabling testing with two classical large protein databases in a 20-blade cluster. This work aids in the discovery of more significant biological results, such as modification sites, and enables the identification of more complex samples, such as metaproteomics samples.

  10. Note: Non-invasive optical method for rapid determination of alignment degree of oriented nanofibrous layers

    Energy Technology Data Exchange (ETDEWEB)

    Pokorny, M.; Rebicek, J. [R& D Department, Contipro Biotech s.r.o., 561 02 Dolni Dobrouc (Czech Republic); Klemes, J. [R& D Department, Contipro Pharma a.s., 561 02 Dolni Dobrouc (Czech Republic); Kotzianova, A. [R& D Department, Contipro Pharma a.s., 561 02 Dolni Dobrouc (Czech Republic); Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5, CZ-62500 Brno (Czech Republic); Velebny, V. [R& D Department, Contipro Biotech s.r.o., 561 02 Dolni Dobrouc (Czech Republic); R& D Department, Contipro Pharma a.s., 561 02 Dolni Dobrouc (Czech Republic)

    2015-10-15

    This paper presents a rapid non-destructive method that provides information on the anisotropic internal structure of nanofibrous layers. A laser beam of a wavelength of 632.8 nm is directed at and passes through a nanofibrous layer prepared by electrostatic spinning. Information about the structural arrangement of nanofibers in the layer is directly visible in the form of a diffraction image formed on a projection screen or obtained from measured intensities of the laser beam passing through the sample which are determined by the dependency of the angle of the main direction of polarization of the laser beam on the axis of alignment of nanofibers in the sample. Both optical methods were verified on Polyvinyl alcohol (PVA) nanofibrous layers (fiber diameter of 470 nm) with random, single-axis aligned and crossed structures. The obtained results match the results of commonly used methods which apply the analysis of electron microscope images. The presented simple method not only allows samples to be analysed much more rapidly and without damaging them but it also makes possible the analysis of much larger areas, up to several square millimetres, at the same time.

  11. Domino Direct Arylation and Cross-Aldol for Rapid Construction of Extended Polycyclic π-Scaffolds.

    Science.gov (United States)

    Nitti, Andrea; Bianchi, Gabriele; Po, Riccardo; Swager, Timothy M; Pasini, Dario

    2017-07-05

    Five-membered aromatic heterocycles are a ubiquitous skeleton of π-conjugated organic compounds, and their incorporation requires synthetic protocols that are not easily industrially sustainable or scalable. Improved methodologies for their insertion into π-scaffolds are therefore necessary. We report an efficient and scalable protocol involving a one-pot cross-Aldol direct arylation reaction protocol for the rapid construction of thiophene- and furan-based π-extended organic materials.

  12. Codeine-binding RNA aptamers and rapid determination of their binding constants using a direct coupling surface plasmon resonance assay

    Science.gov (United States)

    Win, Maung Nyan; Klein, Joshua S.; Smolke, Christina D.

    2006-01-01

    RNA aptamers that bind the opium alkaloid codeine were generated using an iterative in vitro selection process. The binding properties of these aptamers, including equilibrium and kinetic rate constants, were determined through a rapid, high-throughput approach using surface plasmon resonance (SPR) analysis to measure real-time binding. The approach involves direct coupling of the target small molecule onto a sensor chip without utilization of a carrier protein. Two highest binding aptamer sequences, FC5 and FC45 with Kd values of 2.50 and 4.00 μM, respectively, were extensively studied. Corresponding mini-aptamers for FC5 and FC45 were subsequently identified through the described direct coupling Biacore assays. These assays were also employed to confirm the proposed secondary structures of the mini-aptamers. Both aptamers exhibit high specificity to codeine over morphine, which differs from codeine by a methyl group. Finally, the direct coupling method was demonstrated to eliminate potential non-specific interactions that may be associated with indirect coupling methods in which protein linkers are commonly employed. Therefore, in addition to presenting the first RNA aptamers to a subclass of benzylisoquinoline alkaloid molecules, this work highlights a method for characterizing small molecule aptamers that is more robust, precise, rapid and high-throughput than other commonly employed techniques. PMID:17038331

  13. Asymptotic and Numerical Methods for Rapidly Rotating Buoyant Flow

    Science.gov (United States)

    Grooms, Ian G.

    methods generalize directly to the second investigation which simply adds large spatial scales -- the transition from convectively unstable to convectively stable dynamics does not change the mathematical framework. The rotating Navier-Stokes equations in the Boussinesq approximation and the equations derived from them asymptotically in the investigation of rotating convection include dispersive and dissipative linear terms that are stiff, i.e. that hinder numerical solution by explicit methods. A variety of methods which purport to alleviate this difficulty have been derived, and have been tested on and applied largely to problems with purely dissipative linear terms. But it was heretofore unfortunately quite difficult to judge and compare how effectively these methods achieve their goal when the stiff linear term is both dissipative and dispersive. The third investigation therefore introduces a visual, analytical method for comparing the linear stability properties of the various methods (the linear stability properties being a proxy for their ability to alleviate stiffness) and supports the results of this analysis by comprehensive numerical experiments.

  14. Direct current power delivery system and method

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Di; Garces, Luis Jose; Dai, Jian; Lai, Rixin

    2016-09-06

    A power transmission system includes a first unit for carrying out the steps of receiving high voltage direct current (HVDC) power from an HVDC power line, generating an alternating current (AC) component indicative of a status of the first unit, and adding the AC component to the HVDC power line. Further, the power transmission system includes a second unit for carrying out the steps of generating a direct current (DC) voltage to transfer the HVDC power on the HVDC power line, wherein the HVDC power line is coupled between the first unit and the second unit, detecting a presence or an absence of the added AC component in the HVDC power line, and determining the status of the first unit based on the added AC component.

  15. Determination of rapid chlorination rate constants by a stopped-flow spectrophotometric competition kinetics method.

    Science.gov (United States)

    Song, Dean; Liu, Huijuan; Qiang, Zhimin; Qu, Jiuhui

    2014-05-15

    Free chlorine is extensively used for water and wastewater disinfection nowadays. However, it still remains a big challenge to determine the rate constants of rapid chlorination reactions although competition kinetics and stopped-flow spectrophotometric (SFS) methods have been employed individually to investigate fast reaction kinetics. In this work, we proposed an SFS competition kinetics method to determine the rapid chlorination rate constants by using a common colorimetric reagent, N,N-diethyl-p-phenylenediamine (DPD), as a reference probe. A kinetic equation was first derived to estimate the reaction rate constant of DPD towards chlorine under a given pH and temperature condition. Then, on that basis, an SFS competition kinetics method was proposed to determine directly the chlorination rate constants of several representative compounds including tetracycline, ammonia, and four α-amino acids. Although Cl2O is more reactive than HOCl, its contribution to the overall chlorination kinetics of the test compounds could be neglected in this study. Finally, the developed method was validated through comparing the experimentally measured chlorination rate constants of the selected compounds with those obtained or calculated from literature and analyzing with Taft's correlation as well. This study demonstrates that the SFS competition kinetics method can measure the chlorination rate constants of a test compound rapidly and accurately. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Comparison of concentration methods for rapid detection of hookworm ova in wastewater matrices using quantitative PCR.

    Science.gov (United States)

    Gyawali, P; Ahmed, W; Jagals, P; Sidhu, J P S; Toze, S

    2015-12-01

    Hookworm infection contributes around 700 million infections worldwide especially in developing nations due to increased use of wastewater for crop production. The effective recovery of hookworm ova from wastewater matrices is difficult due to their low concentrations and heterogeneous distribution. In this study, we compared the recovery rates of (i) four rapid hookworm ova concentration methods from municipal wastewater, and (ii) two concentration methods from sludge samples. Ancylostoma caninum ova were used as surrogate for human hookworm (Ancylostoma duodenale and Necator americanus). Known concentration of A. caninum hookworm ova were seeded into wastewater (treated and raw) and sludge samples collected from two wastewater treatment plants (WWTPs) in Brisbane and Perth, Australia. The A. caninum ova were concentrated from treated and raw wastewater samples using centrifugation (Method A), hollow fiber ultrafiltration (HFUF) (Method B), filtration (Method C) and flotation (Method D) methods. For sludge samples, flotation (Method E) and direct DNA extraction (Method F) methods were used. Among the four methods tested, filtration (Method C) method was able to recover higher concentrations of A. caninum ova consistently from treated wastewater (39-50%) and raw wastewater (7.1-12%) samples collected from both WWTPs. The remaining methods (Methods A, B and D) yielded variable recovery rate ranging from 0.2 to 40% for treated and raw wastewater samples. The recovery rates for sludge samples were poor (0.02-4.7), although, Method F (direct DNA extraction) provided 1-2 orders of magnitude higher recovery rate than Method E (flotation). Based on our results it can be concluded that the recovery rates of hookworm ova from wastewater matrices, especially sludge samples, can be poor and highly variable. Therefore, choice of concentration method is vital for the sensitive detection of hookworm ova in wastewater matrices. Crown Copyright © 2015. Published by Elsevier

  17. The use of rapid review methods in health technology assessments: 3 case studies.

    Science.gov (United States)

    Kaltenthaler, Eva; Cooper, Katy; Pandor, Abdullah; Martyn-St James, Marrissa; Chatters, Robin; Wong, Ruth

    2016-08-26

    Rapid reviews are of increasing importance within health technology assessment due to time and resource constraints. There are many rapid review methods available although there is little guidance as to the most suitable methods. We present three case studies employing differing methods to suit the evidence base for each review and outline some issues to consider when selecting an appropriate method. Three recently completed systematic review short reports produced for the UK National Institute for Health Research were examined. Different approaches to rapid review methods were used in the three reports which were undertaken to inform the commissioning of services within the NHS and to inform future trial design. We describe the methods used, the reasoning behind the choice of methods and explore the strengths and weaknesses of each method. Rapid review methods were chosen to meet the needs of the review and each review had distinctly different challenges such as heterogeneity in terms of populations, interventions, comparators and outcome measures (PICO) and/or large numbers of relevant trials. All reviews included at least 10 randomised controlled trials (RCTs), each with numerous included outcomes. For the first case study (sexual health interventions), very diverse studies in terms of PICO were included. P-values and summary information only were presented due to substantial heterogeneity between studies and outcomes measured. For the second case study (premature ejaculation treatments), there were over 100 RCTs but also several existing systematic reviews. Data for meta-analyses were extracted directly from existing systematic reviews with new RCT data added where available. For the final case study (cannabis cessation therapies), studies included a wide range of interventions and considerable variation in study populations and outcomes. A brief summary of the key findings for each study was presented and narrative synthesis used to summarise results for each

  18. RAPID TEST METHOD FOR EVALUATION OF ANTIFREEZE ADDITIVE EFFICIENCY

    Directory of Open Access Journals (Sweden)

    S. V. Gushchin

    2015-01-01

    Full Text Available Usage of chemical additives while executing concrete works at negative temperatures is considered as a convenient and economical method. Range of the used antifreeze additives is rather wide. A great number of new additives are advertised but their characteristics have not been practically studied. Evaluation of the antifreeze additive efficiency is unfortunately rather long process and it does not provide comprehensive data on concrete structure formation processes. Due to this development of rapid and comprehensive methodology for construction companies is urgently required.Freezing processes of antifreeze additive aqueous solutions and hardening of cement paste with them have been investigated in the paper. The paper proposes a methodology for determination of freezing point for aqueous solutions of chemical additives of various applications. Identity of  freezing point for a chemical additive aqueous solution and cement paste with an equal concentration of the additive in the paste pore fluid has been determined while taking  calcium nitrate and sodium formate additives as an example. The paper demonstrates the possibility to evaluate efficiency of antifreeze additive action on the basis of kinetics in temperature changes of the cement paste with additives by its consecutive freezing and defrosting.  A methodology for operational evaluation in the field of chemical additive application for concreting items at negative temperatures has been offered in the paper.  The methodology does not require  deficient and expensive test-equipment. It can be applied at ordinary construction companies and it is comprehensible for personnel of low-qualification.  The paper shows the possibility to develop an original methodology for designing concrete structure which is based on operating efficiency determinations  for single and integrated antifreeze additives.

  19. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  20. Piezoelectric immunosensor for the direct and rapid detection of Francisella tularensis.

    Science.gov (United States)

    Pohanka, M; Skládal, P

    2007-01-01

    A novel immunosensing device based on a piezoelectric sensor for direct detection of the biological warfare agent Francisella tularensis was developed. This sensor includes mouse polyclonal antibody immobilized in a layer of protein A covalently linked to the gold electrode of the sensor. The immunosensor is able to detect F. tularensis with the limit of detection 10(5) CFU/mL with a typical measuring cycle > 5 min. The sensor was successfully evaluated for rapid detection of F. tularensis spikes in drinking water and milk; no deterioration of sensitivity in comparison with buffer solutions was observed. The proposed concept of a rapid measurement of microbial agents seems to be promising for evaluation of samples after short pre-cultivation enrichment.

  1. A new rapid method for rockfall energies and distances estimation

    Science.gov (United States)

    Giacomini, Anna; Ferrari, Federica; Thoeni, Klaus; Lambert, Cedric

    2016-04-01

    and distances at the base to block and slope features. The validation of the proposed approach was conducted by comparing predictions to experimental data collected in the field and gathered from the scientific literature. The method can be used for both natural and constructed slopes and easily extended to more complicated and articulated slope geometries. The study shows its great potential for a quick qualitative hazard assessment providing indication about impact energy and horizontal distance of the first impact at the base of a rock cliff. Nevertheless, its application cannot substitute a more detailed quantitative analysis required for site-specific design of mitigation measures. Acknowledgements The authors gratefully acknowledge the financial support of the Australian Coal Association Research Program (ACARP). References Dorren, L.K.A. (2003) A review of rockfall mechanics and modelling approaches, Progress in Physical Geography 27(1), 69-87. Agliardi, F., Crosta, G.B., Frattini, P. (2009) Integrating rockfall risk assessment and countermeasure design by 3D modelling techniques. Natural Hazards and Earth System Sciences 9(4), 1059-1073. Ferrari, F., Thoeni, K., Giacomini, A., Lambert, C. (2016) A rapid approach to estimate the rockfall energies and distances at the base of rock cliffs. Georisk, DOI: 10.1080/17499518.2016.1139729.

  2. Challenges of direct photon production at forward rapidities and large pT

    Science.gov (United States)

    Krelina, Michal; Cepila, Jan; Nemchik, Jan

    2017-02-01

    Direct photons produced in interactions with nuclear targets represent a cleaner probe for investigation of nuclear effects than hadrons, since photons have no final state interaction and no energy loss or absorption is expected in the produced hot medium. Therefore, besides the Cronin enhancement at medium-high transverse momenta pT and isospin effects at larger pT , one should not expect any nuclear effects. However, this fact is in contrast to the PHENIX data providing an evidence for a significant large-pT suppression at mid rapidities in central d + Au and Au + Au collisions that cannot be induced by coherent phenomena (gluon shadowing, Color Glass Condensate). We demonstrate that such an unexpected results is subject to deficit of energy induced universally by multiple initial state interactions (ISI) towards the kinematic limits (large Feynman xF and/or large {x_T} = 2{p_T}/\\sqrt s ). For this reason, in order to enhance the effects of coherence, one should be cautious going to forward rapidities and higher energies. In the LHC kinematic region ISI corrections are irrelevant at mid rapidities but cause rather strong suppression at forward rapidities and large pT . Numerical calculations of invariant pT spectra and the nuclear modification factor were performed within two different models, the color dipole formalism and the model based on kT -factorization, which are successfully confronted with available data from the RHIC and LHC collider experiments. Finally, we perform also predictions for a strong onset of ISI corrections at forward rapidities and corresponding expected suppression can be verified by the future measurements at LHC.

  3. New rapid DNA extraction method with Chelex from Venturia inaequalis spores.

    Science.gov (United States)

    Turan, Ceren; Nanni, Irene Maja; Brunelli, Agostino; Collina, Marina

    2015-08-01

    The objective of this study was to develop a rapid method to isolate DNA from Venturia inaequalis spores for use in diagnostic DNA mutation analysis. Chelex-100 resin was evaluated and compared with a well established DNA exctraction method, utilizing CTAB in order to have a robust comparison. In this research we demonstrated that Chelex-100 efficiently makes extraction of the DNA from V. inaequalis spores available for direct use in molecular analyses. Also, the quantity and quality of extracted DNA were shown to be adequate for PCR analysis. Comparatively, the quality of DNA samples isolated using Chelex method was better than those extracted using CTAB. In conclusion, the Chelex method is recommended for PCR experiments considering its simplicity and cost-effectiveness. Copyright © 2015. Published by Elsevier B.V.

  4. Rapid detection of respiratory viruses by shell vial culture and direct staining by using pooled and individual monoclonal antibodies.

    Science.gov (United States)

    Matthey, S; Nicholson, D; Ruhs, S; Alden, B; Knock, M; Schultz, K; Schmuecker, A

    1992-03-01

    The Bartels respiratory virus panel detection kit is an indirect fluorescent-antibody (IFA) method that uses pooled and individual antisera for tissue culture confirmation of seven respiratory viruses. We evaluated these reagents for detecting viral antigen in shell vial cultures and by direct staining of cells from respiratory specimens. The isolation from 254 specimens of respiratory viruses in shell vial cultures compared with standard tube cultures was highly sensitive (94%) and specific (97.3%). The numbers of viral isolates detected in three consecutive years of testing with shell vial cultures were 68 of 254 (26.8%), 101 of 381 (26.5%), and 122 of 430 (28.4%). IFA direct staining of all 1,065 specimens resulted in 183 (17.2) being uninterpretable because of inadequate numbers of cells or interfering fluorescence. The sensitivity and specificity of the interpretable IFA direct stains in comparison with shell vial cultures were 85.9 and 87.1%, respectively. For detection of 881 adequate specimens, Bartels respiratory syncytial virus IFA direct staining compared with an Ortho Diagnostics Systems direct fluorescent-antibody test for respiratory syncytial virus RSV was highly sensitive (95.5%) and specific (97%). Shell vial cultures combined with Bartels IFA reagents are a rapid alternative to standard tube cultures. Bartels IFA direct staining with individual antisera provides useful same-day screening of respiratory specimens, but the antiserum pool was not effective in screening for positive specimens because of excessive amounts of nonspecific fluorescence.

  5. Rapid method for identification of transgenic fish zygosity

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-07-01

    Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

  6. Airflow-directed in situ electrospinning of a medical glue of cyanoacrylate for rapid hemostasis in liver resection

    Science.gov (United States)

    Jiang, Kai; Long, Yun-Ze; Chen, Zhao-Jun; Liu, Shu-Liang; Huang, Yuan-Yuan; Jiang, Xingyu; Huang, Zhi-Qiang

    2014-06-01

    Rapid hemostasis of solitary organs is still a big challenge in surgical procedures or after major trauma in both civilians and on the battlefield. Here, we report the first use of an airflow-directed in situ electrospinning method to precisely and homogeneously deposit a medical glue of n-octyl-2-cyanoacrylate (OCA) ultrathin fibers onto a wound surface to realize rapid hemostasis in dozens of seconds. In vivo and in vitro experiments on pig liver resection demonstrate that the self-assembled electrospun OCA membrane with high strength, good flexibility and integrity is very compact and no fluid seeping is observed even under a pressure of 147 mm Hg. A similar effect has been achieved in an in vivo experiment on pig lung resection. The results provide a very promising alternative for rapid hemostasis of solitary organs as well as other traumas, providing evidence that the postoperative drainage tube may not be always necessary for surgery in the near future.Rapid hemostasis of solitary organs is still a big challenge in surgical procedures or after major trauma in both civilians and on the battlefield. Here, we report the first use of an airflow-directed in situ electrospinning method to precisely and homogeneously deposit a medical glue of n-octyl-2-cyanoacrylate (OCA) ultrathin fibers onto a wound surface to realize rapid hemostasis in dozens of seconds. In vivo and in vitro experiments on pig liver resection demonstrate that the self-assembled electrospun OCA membrane with high strength, good flexibility and integrity is very compact and no fluid seeping is observed even under a pressure of 147 mm Hg. A similar effect has been achieved in an in vivo experiment on pig lung resection. The results provide a very promising alternative for rapid hemostasis of solitary organs as well as other traumas, providing evidence that the postoperative drainage tube may not be always necessary for surgery in the near future. Electronic supplementary information (ESI) available

  7. Rapid High-throughput Species Identification of Botanical Material Using Direct Analysis in Real Time High Resolution Mass Spectrometry.

    Science.gov (United States)

    Lesiak, Ashton D; Musah, Rabi A

    2016-10-02

    We demonstrate that direct analysis in real time-high resolution mass spectrometry can be used to produce mass spectral profiles of botanical material, and that these chemical fingerprints can be used for plant species identification. The mass spectral data can be acquired rapidly and in a high throughput manner without the need for sample extraction, derivatization or pH adjustment steps. The use of this technique bypasses challenges presented by more conventional techniques including lengthy chromatography analysis times and resource intensive methods. The high throughput capabilities of the direct analysis in real time-high resolution mass spectrometry protocol, coupled with multivariate statistical analysis processing of the data, provide not only class characterization of plants, but also yield species and varietal information. Here, the technique is demonstrated with two psychoactive plant products, Mitragyna speciosa (Kratom) and Datura (Jimsonweed), which were subjected to direct analysis in real time-high resolution mass spectrometry followed by statistical analysis processing of the mass spectral data. The application of these tools in tandem enabled the plant materials to be rapidly identified at the level of variety and species.

  8. Prospective multicentre evaluation of the direct nitrate reductase assay for the rapid detection of extensively drug-resistant tuberculosis.

    Science.gov (United States)

    Martin, Anandi; Imperiale, Belen; Ravolonandriana, Pascaline; Coban, Ahmet Yilmaz; Akgunes, Alper; Ikram, Aamer; Satti, Luqman; Odoun, Mathieu; Pandey, Pooja; Mishra, Manvi; Affolabi, Dissou; Singh, Urvashi; Rasolofo, Voahangy; Morcillo, Nora; Vandamme, Peter; Palomino, Juan Carlos

    2014-02-01

    To perform a multicentre study evaluating the performance of the direct nitrate reductase assay (NRA) for the detection of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis in sputum samples. The study was conducted in six laboratories performing tuberculosis diagnosis that were located in six different countries. The NRA was performed directly on sputum samples in parallel with the reference method used at each site. Detection of resistance was performed for rifampicin, isoniazid, ofloxacin and kanamycin. Excellent agreement was obtained for all drugs tested at the majority of sites. The accuracy was 93.7%-100% for rifampicin, 88.2%-100% for isoniazid, 94.6%-100% for ofloxacin and 100% for kanamycin. The majority of NRA results were available at day 21 for sites 1, 2 and 5. Site 3 had a turnaround time of 13.9 days, at site 4 it was 18.4 days and at site 6 it was 16.2 days. The contamination rate ranged between 2.5% and 12%. Rapid detection of drug resistance by the direct NRA on sputum smear-positive samples was accurate and easy to implement in clinical diagnostic laboratories, making it a good alternative for rapid screening for MDR and XDR tuberculosis.

  9. A rapid cloning method employing orthogonal end protection

    NARCIS (Netherlands)

    Jakobi, A.J.|info:eu-repo/dai/nl/311489621; Huizinga, E.G.|info:eu-repo/dai/nl/12314969X

    2012-01-01

    We describe a novel in vitro cloning strategy that combines standard tools in molecular biology with a basic protecting group concept to create a versatile framework for the rapid and seamless assembly of modular DNA building blocks into functional open reading frames. Analogous to chemical

  10. [Laboratory diagnosis of genital herpes--direct immunofluorescence method].

    Science.gov (United States)

    Majewska, Anna; Romejko-Wolniewicz, Ewa; Zareba-Szczudlik, Julia; Kilijańczyk, Marek; Gajewska, Małgorzata; Młynarczyk, Grazyna

    2013-07-01

    Aim of the study was to determine clinical usefulness of direct immunofluorescence method in the laboratory diagnosis of genital herpes in women. Overall 187 anogenital swabs were collected from 120 women. Using a dacron-tipped applicator 83 swabs were collected from women suspected of genital herpes and 104 from patients with no signs of genital infection. All samples were tested using cell culture (Vero cell line) and then direct immunofluorescence method (DIF) for the identification of antigens of herpes simplex viruses: HSV-1 and HSV-2. Characteristic cytopathic effect (CPE), indicative of alphaherpesvirus infection, was observed in 43.4% of cultures with clinical specimens collected from women with suspected genital herpes and in 29.8% of cultures of clinical specimens taken from patients with no clinical symptoms of genital herpes. Herpes simplex viruses were determined in 73 samples by direct immunofluorescence method after amplification of the virus in cell culture. The DIF test confirmed the diagnosis based on the microscopic CPE observation in 85%. In 15% of samples (taken from pregnant women without clinical signs of infection) we reported positive immunofluorescence in the absence of CPE. The frequency of antigen detection was statistically significantly higher in samples that were positive by culture study (chi-square test with Yates's correction, p genital herpes in swabs taken from the vestibule of the vagina and the vulva. However, there was no statistically significant difference in the frequency of detection of Herpes Simplex Virus antigens in specimens from different parts of the genital tract in both groups of women (chi-square test, p > 0.05). In our study HHV-1 was the main causative agent of genital herpes. The growing worldwide prevalence of genital herpes, challenges with the clinical diagnosis, and availability of effective antiviral therapy are the main reasons for a growing interest in rapid, proper laboratory diagnosis of infected

  11. Rapid determination of ginkgolic acids in Ginkgo biloba kernels and leaves by direct analysis in real time-mass spectrometry.

    Science.gov (United States)

    Huang, Zhongping; Xu, Yueting; Huang, Yilei; Liu, Charles; Jiang, Kezhi; Wang, Lili

    2017-11-14

    A novel method based on direct analysis in real time integrated with mass spectrometry was established and applied into rapid determination of ginkgolic acids in Ginkgo biloba kernels and leaves. Instrument parameter settings were optimized to obtain the sensitive and accurate determination of ginkgolic acids. At the sample introduction speed of 0.2 mm/s, high intensity of [M-H]- ions for ginkgolic acids were observed in the negative ion mode by utilization of high-purity helium gas at 450°C. Two microliters of methanol extract of G. biloba kernels or leaves dropped on the surface of Quick-Strip module was analyzed after solvent evaporated to dryness. A series of standard solutions of ginkgolic acid 13:0 in the range of 2-50 mg/L were analyzed with a correlation coefficient r = 0.9981 and relative standard deviation (n = 5) from 12.5 to 13.7%. The limit of detection was 0.5 mg/L. The results of direct analysis in real time-mass spectrometry were in agreement with those observed by thermochemolysis gas chromatography. The proposed method demonstrated significant potential in the application of the high-throughput screening and rapid analysis for ginkgolic acids in dietary supplements. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A novel rapid and reproducible flow cytometric method for optimization of transfection efficiency in cells

    Science.gov (United States)

    Homann, Stefanie; Hofmann, Christian; Gorin, Aleksandr M.; Nguyen, Huy Cong Xuan; Huynh, Diana; Hamid, Phillip; Maithel, Neil; Yacoubian, Vahe; Mu, Wenli; Kossyvakis, Athanasios; Sen Roy, Shubhendu; Yang, Otto Orlean

    2017-01-01

    Transfection is one of the most frequently used techniques in molecular biology that is also applicable for gene therapy studies in humans. One of the biggest challenges to investigate the protein function and interaction in gene therapy studies is to have reliable monospecific detection reagents, particularly antibodies, for all human gene products. Thus, a reliable method that can optimize transfection efficiency based on not only expression of the target protein of interest but also the uptake of the nucleic acid plasmid, can be an important tool in molecular biology. Here, we present a simple, rapid and robust flow cytometric method that can be used as a tool to optimize transfection efficiency at the single cell level while overcoming limitations of prior established methods that quantify transfection efficiency. By using optimized ratios of transfection reagent and a nucleic acid (DNA or RNA) vector directly labeled with a fluorochrome, this method can be used as a tool to simultaneously quantify cellular toxicity of different transfection reagents, the amount of nucleic acid plasmid that cells have taken up during transfection as well as the amount of the encoded expressed protein. Finally, we demonstrate that this method is reproducible, can be standardized and can reliably and rapidly quantify transfection efficiency, reducing assay costs and increasing throughput while increasing data robustness. PMID:28863132

  13. Rapid directional change degrades GPS distance measurement validity during intermittent intensity running.

    Directory of Open Access Journals (Sweden)

    Jonathan C Rawstorn

    Full Text Available Use of the Global Positioning System (GPS for quantifying athletic performance is common in many team sports. The effect of running velocity on measurement validity is well established, but the influence of rapid directional change is not well understood in team sport applications. This effect was systematically evaluated using multidirectional and curvilinear adaptations of a validated soccer simulation protocol that maintained identical velocity profiles. Team sport athletes completed 90 min trials of the Loughborough Intermittent Shuttle-running Test movement pattern on curvilinear, and multidirectional shuttle running tracks while wearing a 5 Hz (with interpolated 15 Hz output GPS device. Reference total distance (13 200 m was systematically over- and underestimated during curvilinear (2.61±0.80% and shuttle (-3.17±2.46% trials, respectively. Within-epoch measurement uncertainty dispersion was widest during the shuttle trial, particularly during the jog and run phases. Relative measurement reliability was excellent during both trials (Curvilinear r = 1.00, slope = 1.03, ICC = 1.00; Shuttle r = 0.99, slope = 0.97, ICC = 0.99. Absolute measurement reliability was superior during the curvilinear trial (Curvilinear SEM = 0 m, CV = 2.16%, LOA ± 223 m; Shuttle SEM = 119 m, CV = 2.44%, LOA ± 453 m. Rapid directional change degrades the accuracy and absolute reliability of GPS distance measurement, and caution is recommended when using GPS to quantify rapid multidirectional movement patterns.

  14. Rapid methods to detect organic mercury and total selenium in biological samples

    Directory of Open Access Journals (Sweden)

    Basu Niladri

    2011-01-01

    Full Text Available Abstract Background Organic mercury (Hg is a global pollutant of concern and selenium is believed to afford protection against mercury risk though few approaches exist to rapidly assess both chemicals in biological samples. Here, micro-scale and rapid methods to detect organic mercury ( Results For organic Hg, samples are digested using Tris-HCl buffer (with sequential additions of protease, NaOH, cysteine, CuSO4, acidic NaBr followed by extraction with toluene and Na2S2O3. The final product is analyzed via commercially available direct/total mercury analyzers. For Se, a fluorometric assay has been developed for microplate readers that involves digestion (HNO3-HClO4 and HCl, conjugation (2,3-diaminonaphthalene, and cyclohexane extraction. Recovery of organic Hg (86-107% and Se (85-121% were determined through use of Standard Reference Materials and lemon shark kidney tissues. Conclusions The approaches outlined provide an easy, rapid, reproducible, and cost-effective platform for monitoring organic Hg and total Se in biological samples. Owing to the importance of organic Hg and Se in the pathophysiology of Hg, integration of such methods into established research monitoring efforts (that largely focus on screening total Hg only will help increase understanding of Hg's true risks.

  15. Rapid Radiochemical Method for Americium-241 in Building ...

    Science.gov (United States)

    Technical Fact Sheet Analysis Purpose: Qualitative analysis Technique: Alpha spectrometry Method Developed for: Americium-241 in building materials Method Selected for: SAM lists this method for qualitative analysis of americium-241 in concrete or brick building materials. Summary of subject analytical method which will be posted to the SAM website to allow access to the method.

  16. Rapid Radiochemical Method for Radium-226 in Building ...

    Science.gov (United States)

    Technical Fact Sheet Analysis Purpose: Qualitative analysis Technique: Alpha spectrometry Method Developed for: Radium-226 in building materials Method Selected for: SAM lists this method for qualitative analysis of radium-226 in concrete or brick building materials Summary of subject analytical method which will be posted to the SAM website to allow access to the method.

  17. The method of parallel-hierarchical transformation for rapid recognition of dynamic images using GPGPU technology

    Science.gov (United States)

    Timchenko, Leonid; Yarovyi, Andrii; Kokriatskaya, Nataliya; Nakonechna, Svitlana; Abramenko, Ludmila; Ławicki, Tomasz; Popiel, Piotr; Yesmakhanova, Laura

    2016-09-01

    The paper presents a method of parallel-hierarchical transformations for rapid recognition of dynamic images using GPU technology. Direct parallel-hierarchical transformations based on cluster CPU-and GPU-oriented hardware platform. Mathematic models of training of the parallel hierarchical (PH) network for the transformation are developed, as well as a training method of the PH network for recognition of dynamic images. This research is most topical for problems on organizing high-performance computations of super large arrays of information designed to implement multi-stage sensing and processing as well as compaction and recognition of data in the informational structures and computer devices. This method has such advantages as high performance through the use of recent advances in parallelization, possibility to work with images of ultra dimension, ease of scaling in case of changing the number of nodes in the cluster, auto scan of local network to detect compute nodes.

  18. Comparison of the NIDS® rapid assay with ELISA methods in immunogenicity testing of two biotherapeutics.

    Science.gov (United States)

    Pan, Jing; Small, Thomas; Qin, Dujie; Li, Shawn; Wang, Li; Chen, Dave; Pauley, Cindy; Verch, Thorsten; Kaplanski, Catherine; Bakhtiar, Ray; Vallejo, Yli Remo; Yin, Ray

    2011-01-01

    Rapid lateral flow immunogenicity assays for the detection of anti-drug antibodies (ADAs) to two biotherapeutic antibodies, an anti-HER2 antibody and an anti-TNF-α antibody, were developed using ANP Technologies, Inc.'s proprietary Nano-Intelligent Detection System (NIDS®) and compared to their ELISA counterparts. Biotin and hapten-labeled drugs are incubated with the patient serum sample to allow ADA to form a bridge complex with each drug conjugate. The reaction mixture is then added to a test strip with an anti-hapten capture zone which captures the mixed bridge complex. The bridge-complexed biotinylated drug then reacts with streptavidin-labeled gold particles in situ. The signal developed at the capture zone, which is directly proportional to ADA in the sample, is then quantitatively measured with a handheld reader. The counterpart ELISAs were run using the same reagents. Dose-response, specificity/free drug depletion, and screening cut-point assays were performed using both methods. The rapid assays' performance compare very closely to their ELISA counterparts'. Both types of assays identified the same positive samples in screening a limited population of 50 normal serum samples for the anti-HER2 antibody. In the case of anti-TNF-α, both assays identified the same positive samples out of 50 normal and 20 rheumatoid arthritis patient serum samples but differed in the assessment of two others. The rapid assay correctly identified as negative an ELISA false positive sample, and correctly tested as positive an ELISA false negative sample. Positive results were verified with a specificity/free drug depletion assay. The NIDS® rapid immunogenicity assay offers distinct advantages over current methods in simplicity, low cost, and short time to result. More importantly, the method requires no sample dilution and no washing steps which can perturb fragile complexes formed by low-affinity ADAs. Thus, the assay can potentially detect ADAs with various affinities

  19. Efficient 3D frequency response modeling with spectral accuracy by the rapid expansion method

    KAUST Repository

    Chu, Chunlei

    2012-07-01

    Frequency responses of seismic wave propagation can be obtained either by directly solving the frequency domain wave equations or by transforming the time domain wavefields using the Fourier transform. The former approach requires solving systems of linear equations, which becomes progressively difficult to tackle for larger scale models and for higher frequency components. On the contrary, the latter approach can be efficiently implemented using explicit time integration methods in conjunction with running summations as the computation progresses. Commonly used explicit time integration methods correspond to the truncated Taylor series approximations that can cause significant errors for large time steps. The rapid expansion method (REM) uses the Chebyshev expansion and offers an optimal solution to the second-order-in-time wave equations. When applying the Fourier transform to the time domain wavefield solution computed by the REM, we can derive a frequency response modeling formula that has the same form as the original time domain REM equation but with different summation coefficients. In particular, the summation coefficients for the frequency response modeling formula corresponds to the Fourier transform of those for the time domain modeling equation. As a result, we can directly compute frequency responses from the Chebyshev expansion polynomials rather than the time domain wavefield snapshots as do other time domain frequency response modeling methods. When combined with the pseudospectral method in space, this new frequency response modeling method can produce spectrally accurate results with high efficiency. © 2012 Society of Exploration Geophysicists.

  20. Rapid method for plutonium-241 determination in soil samples

    OpenAIRE

    Piekarz, M.; Komosa, A.

    2014-01-01

    A simple and rapid procedure for the determination of plutonium isotopes in the environment is presented. The procedure combines alpha spectrometry, solvent extraction and liquid scintillation measurements to ensure that both alpha- and beta-emitting isotopes are determined. Of five tested extractants, bis-(2-ethylhexyl) phosphoric acid was found to be the best choice. The procedure was applied to soil samples contaminated with Chernobyl fallout.

  1. A rapid, highly accurate method for quantifying CALR mutant allele burden in persons with myeloproliferative neoplasms.

    Science.gov (United States)

    Yao, Qiu-Mei; Zhou, Jiao; Gale, Robert Peter; Li, Jin-Lan; Li, Ling-Di; Li, Ning; Chen, Shan-Shan; Ruan, Guo-Rui

    2015-10-01

    Calreticulin (CALR) mutations were recently identified in a substantial proportion of persons with essential thrombocythemia (ET) and with primary myelofibrosis (PMF) without JAK2(V617F). Consequently rapid, sensitive, and specific methods to detect and quantify these mutations are needed. We studied samples from 1088 persons with myeloproliferative neoplasms (MPNs) including 421 JAK2(V617F) negative subjects with ET, PMF, polycythemia vera (PV), chronic myeloid leukemia (CML) and hyper-eosinophilic syndrome (HES). Detection of CALR exon 9 mutations was done by PCR amplification followed by fragment length analysis and direct sequencing. Dilution assays were used to determine CALR mutant allele burden. We detected CALR mutations in blood and bone marrow samples from 152 subjects with ET and with PMF but not in samples from normal or persons with PV, CML, or HES. CALR mutant peaks were distinct from wild-type peaks and dilution experiments indicated a sensitivity level of 0.5-5% for a CALR mutant allele in a wild-type background. Diverse types of mutations were detected including deletions, insertions, and complex indels. All mutations were confirmed by direct sequencing. We also used dilution experiments to quantify mutant allele burden. We were able to reproducibly detect mutant allele levels as low 5% (0.5-5%) in a wild-type background. PCR amplification followed by fragment length analysis is a rapid, sensitive, and specific method for screening persons with MPNs for CALR mutations, especially those with ET and PMF and for estimating mutant allele burden.

  2. Advanced Methods for Direct Ink Write Additive Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Compel, W. S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Lewicki, J. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-24

    Lawrence Livermore National Laboratory is one of the world’s premier labs for research and development of additive manufacturing processes. Out of these many processes, direct ink write (DIW) is arguably one of the most relevant for the manufacture of architected polymeric materials, components and hardware. However, a bottleneck in this pipeline that has largely been ignored to date is the lack of advanced software implementation with respect to toolpath execution. There remains to be a convenient, automated method to design and produce complex parts that is user-friendly and enabling for the realization of next generation designs and structures. For a material to be suitable as a DIW ink it must possess the appropriate rheological properties for this process. Most importantly, the material must exhibit shear-thinning in order to extrude through a print head and have a rapid recovery of its static shear modulus. This makes it possible for the extrudate to be self-supporting upon exiting the print head. While this and other prerequisites narrow the scope of ‘offthe- shelf’ printable materials directly amenable to DIW, the process still tolerates a wide range of potential feedstock materials. These include metallic alloys, inorganic solvent borne dispersions, polymeric melts, filler stabilized monomer compositions, pre-elastomeric feedstocks and thermoset resins each of which requires custom print conditions tailored to the individual ink. As such, an ink perfectly suited for DIW may be prematurely determined to be undesirable for the process if printed under the wrong conditions. Defining appropriate print conditions such as extrusion rate, layer height, and maximum bridge length is a vital first step in validating an ink’s DIW capability.

  3. A two-step method for rapid characterization of electroosmotic flows in capillary electrophoresis.

    Science.gov (United States)

    Zhang, Wenjing; He, Muyi; Yuan, Tao; Xu, Wei

    2017-12-01

    The measurement of electroosmotic flow (EOF) is important in a capillary electrophoresis (CE) experiment in terms of performance optimization and stability improvement. Although several methods exist, there are demanding needs to accurately characterize ultra-low electroosmotic flow rates (EOF rates), such as in coated capillaries used in protein separations. In this work, a new method, called the two-step method, was developed to accurately and rapidly measure EOF rates in a capillary, especially for measuring the ultra-low EOF rates in coated capillaries. In this two-step method, the EOF rates were calculated by measuring the migration time difference of a neutral marker in two consecutive experiments, in which a pressure driven was introduced to accelerate the migration and the DC voltage was reversed to switch the EOF direction. Uncoated capillaries were first characterized by both this two-step method and a conventional method to confirm the validity of this new method. Then this new method was applied in the study of coated capillaries. Results show that this new method is not only fast in speed, but also better in accuracy. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A rapid, small-scale sedimentation method to predict breadmaking quality of hard winter wheat

    Science.gov (United States)

    Breeders and processors are always looking for rapid and accurate methods to evaluate wheat quality. A rapid small-scale hybrid sedimentation method was developed for predicting breadmaking quality of breeders samples by combining the sodium dodecyl-sulfate (SDS) sedimentation method (AACC 56-70) an...

  5. A rapid method to estimate Westergren sedimentation rates

    Science.gov (United States)

    Alexy, Tamas; Pais, Eszter; Meiselman, Herbert J.

    2009-01-01

    The erythrocyte sedimentation rate (ESR) is a nonspecific but simple and inexpensive test that was introduced into medical practice in 1897. Although it is commonly utilized in the diagnosis and follow-up of various clinical conditions, ESR has several limitations including the required 60 min settling time for the test. Herein we introduce a novel use for a commercially available computerized tube viscometer that allows the accurate prediction of human Westergren ESR rates in as little as 4 min. Owing to an initial pressure gradient, blood moves between two vertical tubes through a horizontal small-bore tube and the top of the red blood cell (RBC) column in each vertical tube is monitored continuously with an accuracy of 0.083 mm. Using data from the final minute of a blood viscosity measurement, a sedimentation index (SI) was calculated and correlated with results from the conventional Westergren ESR test. To date, samples from 119 human subjects have been studied and our results indicate a strong correlation between SI and ESR values (R2=0.92). In addition, we found a close association between SI and RBC aggregation indices as determined by an automated RBC aggregometer (R2=0.71). Determining SI on human blood is rapid, requires no special training and has minimal biohazard risk, thus allowing physicians to rapidly screen for individuals with elevated ESR and to monitor therapeutic responses. PMID:19791973

  6. An automated robotic platform for rapid profiling oligosaccharide analysis of monoclonal antibodies directly from cell culture.

    Science.gov (United States)

    Doherty, Margaret; Bones, Jonathan; McLoughlin, Niaobh; Telford, Jayne E; Harmon, Bryan; DeFelippis, Michael R; Rudd, Pauline M

    2013-11-01

    Oligosaccharides attached to Asn297 in each of the CH2 domains of monoclonal antibodies play an important role in antibody effector functions by modulating the affinity of interaction with Fc receptors displayed on cells of the innate immune system. Rapid, detailed, and quantitative N-glycan analysis is required at all stages of bioprocess development to ensure the safety and efficacy of the therapeutic. The high sample numbers generated during quality by design (QbD) and process analytical technology (PAT) create a demand for high-performance, high-throughput analytical technologies for comprehensive oligosaccharide analysis. We have developed an automated 96-well plate-based sample preparation platform for high-throughput N-glycan analysis using a liquid handling robotic system. Complete process automation includes monoclonal antibody (mAb) purification directly from bioreactor media, glycan release, fluorescent labeling, purification, and subsequent ultra-performance liquid chromatography (UPLC) analysis. The entire sample preparation and commencement of analysis is achieved within a 5-h timeframe. The automated sample preparation platform can easily be interfaced with other downstream analytical technologies, including mass spectrometry (MS) and capillary electrophoresis (CE), for rapid characterization of oligosaccharides present on therapeutic antibodies. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Optical coherence tomography for rapid tissue screening and directed histological sectioning.

    Science.gov (United States)

    Jung, Woonggyu; Boppart, Stephen A

    2013-01-01

    In pathology, histological examination of the tissue is the "gold standard" to diagnose various diseases. It has contributed significantly toward identifying the abnormalities in tissues and cells, but has inherent drawbacks when used for fast and accurate diagnosis. These limitations include the lack of in vivo observation in real time and sampling errors due to limited number and area coverage of tissue sections. Its diagnostic yield also varies depending on the ability of the physician and the effectiveness of any image guidance technique that may be used for tissue screening during excisional biopsy. In order to overcome these current limitations of histology-based diagnostics, there are significant needs for either complementary or alternative imaging techniques which perform non-destructive, high resolution, and rapid tissue screening. Optical coherence tomography (OCT) is an emerging imaging modality which allows real-time cross-sectional imaging with high resolutions that approach those of histology. OCT could be a very promising technique which has the potential to be used as an adjunct to histological tissue observation when it is not practical to take specimens for histological processing, when large areas of tissue need investigating, or when rapid microscopic imaging is needed. This review will describe the use of OCT as an image guidance tool for fast tissue screening and directed histological tissue sectioning in pathology.

  8. Direct comparison between confocal and multiphoton microscopy for rapid histopathological evaluation of unfixed human breast tissue

    Science.gov (United States)

    Yoshitake, Tadayuki; Giacomelli, Michael G.; Cahill, Lucas C.; Schmolze, Daniel B.; Vardeh, Hilde; Faulkner-Jones, Beverly E.; Connolly, James L.; Fujimoto, James G.

    2016-12-01

    Rapid histopathological examination of surgical specimen margins using fluorescence microscopy during breast conservation therapy has the potential to reduce the rate of positive margins on postoperative histopathology and the need for repeat surgeries. To assess the suitability of imaging modalities, we perform a direct comparison between confocal fluorescence microscopy and multiphoton microscopy for imaging unfixed tissue and compare to paraffin-embedded histology. An imaging protocol including dual channel detection of two contrast agents to implement virtual hematoxylin and eosin images is introduced that provides high quality imaging under both one and two photon excitation. Corresponding images of unfixed human breast tissue show that both confocal and multiphoton microscopy can reproduce the appearance of conventional histology without the need for physical sectioning. We further compare normal breast tissue and invasive cancer specimens imaged at multiple magnifications, and assess the effects of photobleaching for both modalities using the staining protocol. The results demonstrate that confocal fluorescence microscopy is a promising and cost-effective alternative to multiphoton microscopy for rapid histopathological evaluation of ex vivo breast tissue.

  9. An Extended Multilocus Sequence Typing (MLST Scheme for Rapid Direct Typing of Leptospira from Clinical Samples.

    Directory of Open Access Journals (Sweden)

    Sabrina Weiss

    2016-09-01

    Full Text Available Rapid typing of Leptospira is currently impaired by requiring time consuming culture of leptospires. The objective of this study was to develop an assay that provides multilocus sequence typing (MLST data direct from patient specimens while minimising costs for subsequent sequencing.An existing PCR based MLST scheme was modified by designing nested primers including anchors for facilitated subsequent sequencing. The assay was applied to various specimen types from patients diagnosed with leptospirosis between 2014 and 2015 in the United Kingdom (UK and the Lao Peoples Democratic Republic (Lao PDR. Of 44 clinical samples (23 serum, 6 whole blood, 3 buffy coat, 12 urine PCR positive for pathogenic Leptospira spp. at least one allele was amplified in 22 samples (50% and used for phylogenetic inference. Full allelic profiles were obtained from ten specimens, representing all sample types (23%. No nonspecific amplicons were observed in any of the samples. Of twelve PCR positive urine specimens three gave full allelic profiles (25% and two a partial profile. Phylogenetic analysis allowed for species assignment. The predominant species detected was L. interrogans (10/14 and 7/8 from UK and Lao PDR, respectively. All other species were detected in samples from only one country (Lao PDR: L. borgpetersenii [1/8]; UK: L. kirschneri [1/14], L. santarosai [1/14], L. weilii [2/14].Typing information of pathogenic Leptospira spp. was obtained directly from a variety of clinical samples using a modified MLST assay. This assay negates the need for time-consuming culture of Leptospira prior to typing and will be of use both in surveillance, as single alleles enable species determination, and outbreaks for the rapid identification of clusters.

  10. Development of Rapid Pipe Moulding Process for Carbon Fiber Reinforced Thermoplastics by Direct Resistance Heating

    Science.gov (United States)

    Tanaka, Kazuto; Harada, Ryuki; Uemura, Toshiki; Katayama, Tsutao; Kuwahara, Hideyuki

    To deal with environmental issues, the gasoline mileage of passenger cars can be improved by reduction of the car weight. The use of car components made of Carbon Fiber Reinforced Plastics (CFRP) is increasing because of its superior mechanical properties and relatively low density. Many vehicle structural parts are pipe-shaped, such as suspension arms, torsion beams, door guard bars and impact beams. A reduction of the car weight is expected by using CFRP for these parts. Especially, when considering the recyclability and ease of production, Carbon Fiber Reinforced Thermoplastics are a prime candidate. On the other hand, the moulding process of CFRTP pipes for mass production has not been well established yet. For this pipe moulding process an induction heating method has been investigated already, however, this method requires a complicated coil system. To reduce the production cost, another system without such complicated equipment is to be developed. In this study, the pipe moulding process of CFRTP using direct resistance heating was developed. This heating method heats up the mould by Joule heating using skin effect of high-frequency current. The direct resistance heating method is desirable from a cost perspective, because this method can heat the mould directly without using any coils. Formerly developed Non-woven Stitched Multi-axial Cloth (NSMC) was used as semi-product material. NSMC is very suitable for the lamination process due to the fact that non-crimp stitched carbon fiber of [0°/+45°/90°/-45°] and polyamide 6 non-woven fabric are stitched to one sheet, resulting in a short production cycle time. The use of the pipe moulding process with the direct resistance heating method in combination with the NSMC, has resulted in the successful moulding of a CFRTP pipe of 300 mm in length, 40 mm in diameter and 2 mm in thickness.

  11. Rapid expansion method (REM) for time‐stepping in reverse time migration (RTM)

    KAUST Repository

    Pestana, Reynam C.

    2009-01-01

    We show that the wave equation solution using a conventional finite‐difference scheme, derived commonly by the Taylor series approach, can be derived directly from the rapid expansion method (REM). After some mathematical manipulation we consider an analytical approximation for the Bessel function where we assume that the time step is sufficiently small. From this derivation we find that if we consider only the first two Chebyshev polynomials terms in the rapid expansion method we can obtain the second order time finite‐difference scheme that is frequently used in more conventional finite‐difference implementations. We then show that if we use more terms from the REM we can obtain a more accurate time integration of the wave field. Consequently, we have demonstrated that the REM is more accurate than the usual finite‐difference schemes and it provides a wave equation solution which allows us to march in large time steps without numerical dispersion and is numerically stable. We illustrate the method with post and pre stack migration results.

  12. Interaction between Rivers and Aquifers: a method for rapid Identification of Transience in Streambed Conductance

    Science.gov (United States)

    Gianni, Guillaume; Perrochet, Pierre; Vogel, Alexandre; Brunner, Philip

    2016-04-01

    Streambed hydraulic conductance controls the interactions between surface water and groundwater. In order to quantify river-aquifer dynamics, quantifying conductance is indispensable. However, the streambed conductance is often subject to transience, as a result of the erosion and deposition processes in rivers. This transience has to be quantified and considered for any approach (i.e. numerical or analytical models) aimed at quantifying exchange fluxes. Directly measuring hydraulic properties in a river yields only point values, is time-consuming and therefore not suited to detect transience of the physical properties. We present a method to continuously and rapidly monitor transience of streambed conductance. Input data are time series of stream stage and hydraulic head variations in the aquifer. The method is based on the inversion of a floodwave response. The analytical model consists of only 3 parameters: x, the distance between streambank and an observation well, α, the aquifer diffusivity and a, the retardation coefficient that is inversely proportional to the streambed conductance. Estimation of a is carried out over successive time steps in order to identify transience in streambed conductance. The method is tested on synthetic data and is applied to field data from the Rhône River and its alluvial aquifer (Switzerland). The synthetic method demonstrated the robustness of the proposed methodology. Application of the method to the field site allowed identifying transience in streambed properties, following flood events in the Rhône. This method requires transience in the surface water, and the river should not change its width significantly with a rising water level. If these conditions are fulfilled, this method allows for a rapid and effective identification of transience of streambed conductance.

  13. Gold Nanoparticles as a Direct and Rapid Sensor for Sensitive Analytical Detection of Biogenic Amines

    Science.gov (United States)

    El-Nour, K. M. A.; Salam, E. T. A.; Soliman, H. M.; Orabi, A. S.

    2017-03-01

    A new optical sensor was developed for rapid screening with high sensitivity for the existence of biogenic amines (BAs) in poultry meat samples. Gold nanoparticles (GNPs) with particle size 11-19 nm function as a fast and sensitive biosensor for detection of histamine resulting from bacterial decarboxylation of histidine as a spoilage marker for stored poultry meat. Upon reaction with histamine, the red color of the GNPs converted into deep blue. The appearance of blue color favorably coincides with the concentration of BAs that can induce symptoms of poisoning. This biosensor enables a semi-quantitative detection of analyte in real samples by eye-vision. Quality evaluation is carried out by measuring histamine and histidine using different analytical techniques such as UV-vis, FTIR, and fluorescence spectroscopy as well as TEM. A rapid quantitative readout of samples by UV-vis and fluorescence methods with standard instrumentation were proposed in a short time unlike chromatographic and electrophoretic methods. Sensitivity and limit of detection (LOD) of 6.59 × 10-4 and 0.6 μM, respectively, are determined for histamine as a spoilage marker with a correlation coefficient ( R 2) of 0.993.

  14. A Rapid Method for Determining the Concentration of Recombinant Protein Secreted from Pichia pastoris

    Science.gov (United States)

    Sun, L. W.; Zhao, Y.; Niu, L. P.; Jiang, R.; Song, Y.; Feng, H.; feng, K.; Qi, C.

    2011-02-01

    Pichia secretive expression system is one of powerful eukaryotic expression systems in genetic engineering, which is especially suitable for industrial utilization. Because of the low concentration of the target protein in initial experiment, the methods and conditions for expression of the target protein should be optimized according to the protein yield repetitively. It is necessary to set up a rapid, simple and convenient analysis method for protein expression levels instead of the generally used method such as ultrafiltration, purification, dialysis, lyophilization and so on. In this paper, acetone precipitation method was chosen to concentrate the recombinant protein firstly after comparing with four different protein precipitation methods systematically, and then the protein was analyzed by SDS-Polyacrylamide Gel Electrophoresis. The recombinant protein was determined with the feature of protein band by the Automated Image Capture and 1-D Analysis Software directly. With this method, the optimized expression conditions of basic fibroblast growth factor secreted from pichia were obtained, which is as the same as using traditional methods. Hence, a convenient tool to determine the optimized conditions for the expression of recombinant proteins in Pichia was established.

  15. Rapid and Reliable HPLC Method for the Determination of Vitamin ...

    African Journals Online (AJOL)

    Purpose: To develop and validate an accurate, sensitive and reproducible high performance liquid chromatographic (HPLC) method for the quantitation of vitamin C in pharmaceutical samples. Method: The drug and the standard were eluted from Superspher RP-18 (250 mm x 4.6 mm, 10ìm particle size) at 20 0C.

  16. Rapid, cost-effective liquid chromatograghic method for the ...

    African Journals Online (AJOL)

    The method is highly sensitive, with limit of detection of 1 ng/ml. The coefficient of variation for within-day run was less than 4% while that of day-to-day run was less than 6%. There were no interfering peaks from endogenous materials in the serum. The method was validated and used for pharmacokinetic studies ...

  17. Digital Direct-to-Consumer Advertising: A Perfect Storm of Rapid Evolution and Stagnant Regulation

    Science.gov (United States)

    Mackey, Tim K.

    2016-01-01

    The adoption and use of digital forms of direct-to-consumer advertising (also known as "eDTCA") is on the rise. At the same time, the universe of eDTCA is expanding, as technology on Internet-based platforms continues to evolve, from static websites, to social media, and nearly ubiquitous use of mobile devices. However, little is known about how this unique form of pharmaceutical marketing impacts consumer behavior, public health, and overall healthcare utilization. The study by Kim analyzing US Food and Drug Administration (FDA) notices of violations (NOVs) and warning letters regarding online promotional activities takes us in the right direction, but study results raise as many questions as it does answers. Chief among these are unanswered concerns about the unique regulatory challenges posed by the "disruptive" qualities of eDTCA, and whether regulators have sufficient resources and oversight powers to proactively address potential violations. Further, the globalization of eDTCA via borderless Internet-based technologies raises larger concerns about the potential global impact of this form of health marketing unique to only the United States and New Zealand. Collectively, these challenges make it unlikely that regulatory science will be able to keep apace with the continued rapid evolution of eDTCA unless more creative policy solutions are explored. PMID:27239871

  18. Rapid, Time-Division Multiplexed, Direct Absorption- and Wavelength Modulation-Spectroscopy

    Directory of Open Access Journals (Sweden)

    Alexander Klein

    2014-11-01

    Full Text Available We present a tunable diode laser spectrometer with a novel, rapid time multiplexed direct absorption- and wavelength modulation-spectroscopy operation mode. The new technique allows enhancing the precision and dynamic range of a tunable diode laser absorption spectrometer without sacrificing accuracy. The spectroscopic technique combines the benefits of absolute concentration measurements using calibration-free direct tunable diode laser absorption spectroscopy (dTDLAS with the enhanced noise rejection of wavelength modulation spectroscopy (WMS. In this work we demonstrate for the first time a 125 Hz time division multiplexed (TDM-dTDLAS-WMS spectroscopic scheme by alternating the modulation of a DFB-laser between a triangle-ramp (dTDLAS and an additional 20 kHz sinusoidal modulation (WMS. The absolute concentration measurement via the dTDLAS-technique allows one to simultaneously calibrate the normalized 2f/1f-signal of the WMS-technique. A dTDLAS/WMS-spectrometer at 1.37 µm for H2O detection was built for experimental validation of the multiplexing scheme over a concentration range from 50 to 3000 ppmV (0.1 MPa, 293 K. A precision of 190 ppbV was achieved with an absorption length of 12.7 cm and an averaging time of two seconds. Our results show a five-fold improvement in precision over the entire concentration range and a significantly decreased averaging time of the spectrometer.

  19. A comparison of direct and indirect analytical methods of computing ...

    African Journals Online (AJOL)

    The first step in the analysis of gravity anomalies for mineral exploration is the extraction of residual gravity anomalies from the observed gravity anomalies. This can be achieved by graphical or analytical methods. Generally, direct and indirect analytical methods are considered better than graphical methods. Telford et al ...

  20. A simple and rapid molecular method for Leptospira species identification

    NARCIS (Netherlands)

    Ahmed, Ahmed; Anthony, Richard M.; Hartskeerl, Rudy A.

    2010-01-01

    Serological and DNA-based classification systems only have little correlation. Currently serological and molecular methods for characterizing Leptospira are complex and costly restricting their world-wide distribution and use. Ligation mediated amplification combined with microarray analysis

  1. A method of rapid testing of radioactivity of different materials

    Directory of Open Access Journals (Sweden)

    Yu. Zabulonov

    2016-10-01

    Full Text Available A new method for the detection of low-level ionising radiation in solid, liquid or loose materials, which is based on the use of the Bayesian approach for the estimation of probabilistic parameters and a special statistical criterion, is offered in the present paper. We describe the algorithm and show the advantages of the method. The approach can be effective even in the case of extremely low signals whose intensity is much less than the background radiation.

  2. A rapid cloning method employing orthogonal end protection.

    Directory of Open Access Journals (Sweden)

    Arjen J Jakobi

    Full Text Available We describe a novel in vitro cloning strategy that combines standard tools in molecular biology with a basic protecting group concept to create a versatile framework for the rapid and seamless assembly of modular DNA building blocks into functional open reading frames. Analogous to chemical synthesis strategies, our assembly design yields idempotent composite synthons amenable to iterative and recursive split-and-pool reaction cycles. As an example, we illustrate the simplicity, versatility and efficiency of the approach by constructing an open reading frame composed of tandem arrays of a human fibronectin type III (FNIII domain and the von Willebrand Factor A2 domain (VWFA2, as well as chimeric (FNIII(n-VWFA2-(FNIII(n constructs. Although we primarily designed this strategy to accelerate assembly of repetitive constructs for single-molecule force spectroscopy, we anticipate that this approach is equally applicable to the reconstitution and modification of complex modular sequences including structural and functional analysis of multi-domain proteins, synthetic biology or the modular construction of episomal vectors.

  3. Rapid, specific and sensitive method for isoniazid determination in serum.

    Science.gov (United States)

    Sadeg, N; Pertat, N; Dutertre, H; Dumontet, M

    1996-01-12

    An original simple, specific and rapid high-performance liquid chromatographic assay for the determination of isoniazid (INH) in human serum is presented. The drug was extracted from the serum by protein precipitation with 30% (w/v) trichloroacetic acid, then the drug was reacted with the coupling reagent, trans-cinnamaldehyde, to form a derivative absorbing at 340 nm. A 20-microliters aliquot was injected into the chromatograph after neutralization with 1 M KOH solution. A liquid chromatograph equipped with a reversed-phase 30-microns C18 precolumn linked to a 4-microns C18 analytical column was used. The drug was eluted with a mixture of acetonitrile-water-triethylamine-acetic acid (400:600:2:1, v/v), pH value was 5 +/- 1. Flow-rate and wavelength were set at 1 ml/min and 340 nm, respectively. The extraction recoveries from human serum averaged 100% for INH at concentrations of 1, 2 and 4 mg/l. The coefficients of variation for three different concentrations for INH in serum in the within-day study varied between 1.2 and 3.5%, whereas those in the day-to-day study varied between 2.8 and 4.3%.

  4. Extremely rapid directional change during Matuyama-Brunhes geomagnetic polarity reversal

    Science.gov (United States)

    Sagnotti, Leonardo; Scardia, Giancarlo; Giaccio, Biagio; Liddicoat, Joseph C.; Nomade, Sebastien; Renne, Paul R.; Sprain, Courtney J.

    2014-11-01

    We report a palaeomagnetic investigation of the last full geomagnetic field reversal, the Matuyama-Brunhes (M-B) transition, as preserved in a continuous sequence of exposed lacustrine sediments in the Apennines of Central Italy. The palaeomagnetic record provides the most direct evidence for the tempo of transitional field behaviour yet obtained for the M-B transition. 40Ar/39Ar dating of tephra layers bracketing the M-B transition provides high-accuracy age constraints and indicates a mean sediment accumulation rate of about 0.2 mm yr-1 during the transition. Two relative palaeointensity (RPI) minima are present in the M-B transition. During the terminus of the upper RPI minimum, a directional change of about 180 ° occurred at an extremely fast rate, estimated to be less than 2 ° per year, with no intermediate virtual geomagnetic poles (VGPs) documented during the transit from the southern to northern hemisphere. Thus, the entry into the Brunhes Normal Chron as represented by the palaeomagnetic directions and VGPs developed in a time interval comparable to the duration of an average human life, which is an order of magnitude more rapid than suggested by current models. The reported investigation therefore provides high-resolution integrated palaeomagnetic and radioisotopic data that document the fine details of the anatomy and tempo of the M-B transition in Central Italy that in turn are crucial for a better understanding of Earth's magnetic field, and for the development of more sophisticated models that are able to describe its global structure and behaviour.

  5. Aligned carbon nanotube, graphene and graphite oxide thin films via substrate-directed rapid interfacial deposition.

    Science.gov (United States)

    D'Arcy, Julio M; Tran, Henry D; Stieg, Adam Z; Gimzewski, James K; Kaner, Richard B

    2012-05-21

    A procedure for depositing thin films of carbon nanostructures is described that overcomes the limitations typically associated with solution based methods. Transparent and conductively continuous carbon coatings can be grown on virtually any type of substrate within seconds. Interfacial surface tension gradients result in directional fluid flow and film spreading at the water/oil interface. Transparent films of carbon nanostructures are produced including aligned ropes of single-walled carbon nanotubes and assemblies of single sheets of chemically converted graphene and graphite oxide. Process scale-up, layer-by-layer deposition, and a simple method for coating non-activated hydrophobic surfaces are demonstrated.

  6. Rapid changes in gene expression direct rapid shifts in intestinal form and function in the Burmese python after feeding.

    Science.gov (United States)

    Andrew, Audra L; Card, Daren C; Ruggiero, Robert P; Schield, Drew R; Adams, Richard H; Pollock, David D; Secor, Stephen M; Castoe, Todd A

    2015-05-01

    Snakes provide a unique and valuable model system for studying the extremes of physiological remodeling because of the ability of some species to rapidly upregulate organ form and function upon feeding. The predominant model species used to study such extreme responses has been the Burmese python because of the extreme nature of postfeeding response in this species. We analyzed the Burmese python intestine across a time series, before, during, and after feeding to understand the patterns and timing of changes in gene expression and their relationship to changes in intestinal form and function upon feeding. Our results indicate that >2,000 genes show significant changes in expression in the small intestine following feeding, including genes involved in intestinal morphology and function (e.g., hydrolases, microvillus proteins, trafficking and transport proteins), as well as genes involved in cell division and apoptosis. Extensive changes in gene expression occur surprisingly rapidly, within the first 6 h of feeding, coincide with changes in intestinal morphology, and effectively return to prefeeding levels within 10 days. Collectively, our results provide an unprecedented portrait of parallel changes in gene expression and intestinal morphology and physiology on a scale that is extreme both in the magnitude of changes, as well as in the incredibly short time frame of these changes, with up- and downregulation of expression and function occurring in the span of 10 days. Our results also identify conserved vertebrate signaling pathways that modulate these responses, which may suggest pathways for therapeutic modulation of intestinal function in humans. Copyright © 2015 the American Physiological Society.

  7. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Comparison of the direct enzyme assay method with the membrane ...

    African Journals Online (AJOL)

    Comparison of the direct enzyme assay method with the membrane filtration technique in the quantification and monitoring of microbial indicator organisms – seasonal variations in the activities of coliforms and E. coli, temperature and pH.

  9. A Direct Method for Viewing Ferromagnetic Phase Transition.

    Science.gov (United States)

    Lue, Chin-Shan

    1994-01-01

    Provides a method, using the Rowland ring as a specimen, to observe the phase transition process directly on the oscilloscope and even extract the critical exponent of ferromagnetic transition. Includes theory, experimental setup, and results. (MVL)

  10. Direct measurement of the instantaneous linewidth of rapidly wavelength-swept lasers.

    Science.gov (United States)

    Biedermann, Benjamin R; Wieser, Wolfgang; Eigenwillig, Christoph M; Klein, Thomas; Huber, Robert

    2010-11-15

    The instantaneous linewidth of rapidly wavelength-swept laser sources as used for optical coherence tomography (OCT) is of crucial interest for a deeper understanding of physical effects involved in their operation. Swept lasers for OCT, typically sweeping over ~15 THz in ~10 μs, have linewidths of several gigahertz. The high optical-frequency sweep speed makes it impossible to measure the instantaneous spectrum with standard methods. Hence, up to now, experimental access to the instantaneous linewidth was rather indirect by the inverse Fourier transform of the coherence decay. In this Letter, we present a method by fast synchronous time gating and extraction of a "snapshot" of the instantaneous spectrum with an electro-optic modulator, which can subsequently be measured with an optical spectrum analyzer. This new method is analyzed in detail, and systematic artifacts, such as sideband generation due to the modulation and residual wavelength uncertainty due to the sweeping operation, are quantified. The method is checked for consistency with results from the common, more indirect measurement via coherence properties.

  11. Rapid, cost-effective liquid chromatograghic method for the ...

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... Akay C, Ozkan SA, Senturk Z, Cevheroglu S (2002). Simultaneous determination of metronidazole and miconazole in pharmaceutical dosage form by HPLC. Farmaco. Nov.57(11): 953-7. Galmier MJ, Frasey AM, Bastide M, Beyssac E, Petit J, Aiache JM,. Lartigue-Mattei (1998). Simple and sensitive method ...

  12. RESEARCH NOTE A Universal, rapid, and inexpensive method for ...

    Indian Academy of Sciences (India)

    Navya

    very satisfactory for many researchers to prepare reagents for “all in one” ready to use method to extract gDNA from very wide range sources of blood samples. To meet these criteria, a universal and versatile DNA extraction procedure should be developedwith a minimal chemicals and equipment.On the other hand, the ...

  13. Rapid prototyping methods for the manufacture of fuel cells

    Directory of Open Access Journals (Sweden)

    Dudek Piotr

    2016-01-01

    The potential for the application of this method for the manufacture of metallic bipolar plates (BPP for use in proton exchange membrane fuel cells (PEMFCs is presented and discussed. Special attention is paid to the fabrication of light elements for the construction of PEMFC stacks designed for mobile applications such as aviation technology and unmanned aerial vehicles (UAVs.

  14. [Methods for the rapid preparation of paraffin blocks].

    Science.gov (United States)

    Shmurun, R I

    1992-01-01

    Two accelerated chloroform-paraffin processings of materials with the use of ultrasound (US) and microwave (MW) irradiation in the stove "Electronica" as well as a combined method with US- and MW-irradiation are proposed to shorten drastically the duration of the prehistologic processing.

  15. Rapid multi-residue method for the determination of pesticide ...

    African Journals Online (AJOL)

    Exposure to pesticides can represent a potential risk to humans. Agricultural workers are at risk of chronic toxicity. Hence, the evaluation of pesticide residues in their blood gives an indication about the extent of exposure and help in assessing adverse health effects. The aim of our study was to develop analytical method for ...

  16. A dual-direction fringe projection method for the 3D measurement of translucent object

    Science.gov (United States)

    Zhao, Huijie; Liang, Xiaoyue; Jiang, Hongzhi; Li, Hong

    2017-02-01

    The fringe projection technology is widely used in 3D measurement fields. However when the technology is applying to translucent objects, the subsurface scattering and absorbing always leads to a decline of the measurement accuracy. The aim of this paper is to propose a dual-direction fringe projection method in order to obtain an more accurate measurement result for the translucent objects as while as change the whole measurement system little and do not reduce the measuring rapidity. The paper mainly includes three parts: (1) The principle of dual-direction fringe projection method and different forms of dual-direction fringe; (2) Analysis of the different effect for the measurement accuracy brought by different factors; (3) Experiments for artificial tooth by various dual-direction fringes and accuracy analysis. The experiment results showed that by this method it is possible to improve the measurement accuracy for the translucent objects.

  17. Time evolution of the wave equation using rapid expansion method

    KAUST Repository

    Pestana, Reynam C.

    2010-07-01

    Forward modeling of seismic data and reverse time migration are based on the time evolution of wavefields. For the case of spatially varying velocity, we have worked on two approaches to evaluate the time evolution of seismic wavefields. An exact solution for the constant-velocity acoustic wave equation can be used to simulate the pressure response at any time. For a spatially varying velocity, a one-step method can be developed where no intermediate time responses are required. Using this approach, we have solved for the pressure response at intermediate times and have developed a recursive solution. The solution has a very high degree of accuracy and can be reduced to various finite-difference time-derivative methods, depending on the approximations used. Although the two approaches are closely related, each has advantages, depending on the problem being solved. © 2010 Society of Exploration Geophysicists.

  18. Application of direct tracking method for measuring electrospun nanofiber diameter

    Directory of Open Access Journals (Sweden)

    M. Ziabari

    2009-03-01

    Full Text Available In this paper, direct tracking method as an image analysis based technique for measuring electrospun nanofiber diameter has been presented and compared with distance transform method. Samples with known characteristics generated using a simulation scheme known as µ-randomness were employed to evaluate the accuracy of the method. Electrospun webs of polyvinyl alcohol (PVA were also used to verify the applicability of the method on real samples. Since direct tracking as well as distance transform require binary input images, micrographs of the electrospun webs obtained from Scanning Electron Microscopy (SEM were first converted to black and white using local thresholding. Direct tracking resulted in more accurate estimations of fiber diameter for simulated images as well as electrospun webs suggesting the usefulness of the method for electrospun nanofiber diameter measurement.

  19. Apparatus and method for rapid cooling of large area substrates in vacuum

    Science.gov (United States)

    Barth, Kurt L.; Enzenroth, Robert A.; Sampath, Walajabad S.

    2010-09-28

    The present invention is directed to an apparatus and method for rapid cooling of a large substrate in a vacuum environment. A first cooled plate is brought into close proximity with one surface of a flat substrate. The spatial volume between the first cooling plate and the substrate is sealed and brought to a higher pressure than the surrounding vacuum level to increase the cooling efficiency. A second cooled plate is brought into close proximity with the opposite surface of the flat substrate. A second spatial volume between the second cooling plate and the substrate is sealed and the gas pressure is equalized to the gas pressure in the first spatial volume. The equalization of the gas pressure on both sides of the flat substrate eliminates deflection of the substrate and bending stress in the substrate.

  20. A taxonomy of rapid reviews links report types and methods to specific decision-making contexts.

    Science.gov (United States)

    Hartling, Lisa; Guise, Jeanne-Marie; Kato, Elisabeth; Anderson, Johanna; Belinson, Suzanne; Berliner, Elise; Dryden, Donna M; Featherstone, Robin; Mitchell, Matthew D; Motu'apuaka, Makalapua; Noorani, Hussein; Paynter, Robin; Robinson, Karen A; Schoelles, Karen; Umscheid, Craig A; Whitlock, Evelyn

    2015-12-01

    Describe characteristics of rapid reviews and examine the impact of methodological variations on their reliability and validity. We conducted a literature review and interviews with organizations that produce rapid reviews or related products to identify methods, guidance, empiric evidence, and current practices. We identified 36 rapid products from 20 organizations (production time, 5 minutes to 8 months). Methods differed from systematic reviews at all stages. As time frames increased, methods became more rigorous; however, restrictions on database searching, inclusion criteria, data extracted, and independent dual review remained. We categorized rapid products based on extent of synthesis. "Inventories" list what evidence is available. "Rapid responses" present best available evidence with no formal synthesis. "Rapid reviews" synthesize the quality of and findings from the evidence. "Automated approaches" generate meta-analyses in response to user-defined queries. Rapid products rely on a close relationship with end users and support specific decisions in an identified time frame. Limited empiric evidence exists comparing rapid and systematic reviews. Rapid products have tremendous methodological variation; categorization based on time frame or type of synthesis reveals patterns. The similarity across rapid products lies in the close relationship with the end user to meet time-sensitive decision-making needs. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  2. Development of a micropulverized extraction method for rapid toxicological analysis of methamphetamine in hair.

    Science.gov (United States)

    Miyaguchi, Hajime; Kakuta, Masaya; Iwata, Yuko T; Matsuda, Hideaki; Tazawa, Hidekatsu; Kimura, Hiroko; Inoue, Hiroyuki

    2007-09-07

    We developed a rapid sample preparation method for the toxicological analysis of methamphetamine and amphetamine (the major metabolite of methamphetamine) in human hair by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS), to facilitate fast screening and quantitation. Two milligrams of hair were mechanically micropulverized for 5 min in a 2-ml plastic tube together with 100 microl of an aqueous solvent containing 10% acetonitrile, 100 mM trifluoroacetic acid and the corresponding deuterium analogues as internal standards. The pulverizing highly disintegrated the hair components, simultaneously allowing the extraction of any drugs present in the hair. After filtering the suspension with a membrane-filter unit, the clear filtrate was directly analyzed by HPLC-MS/MS. No evaporation processes were required for sample preparation. Method optimization and validation study were carried out using real-case specimens and fortified samples in which the drugs had been artificially absorbed, respectively. Concentration ranges for quantitation were 0.040-125 and 0.040-25 ng/mg for methamphetamine and amphetamine, respectively. Real-case specimens were analyzed by the method presented here and by conventional ones to verify the applicability of our method to real-world analysis. Our method took less than 30 min for a set of chromatograms to be obtained from a washed hair sample.

  3. Rapid detection of sugar alcohol precursors and corresponding nitrate ester explosives using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Sisco, Edward; Forbes, Thomas P

    2015-04-21

    This work highlights the rapid detection of nitrate ester explosives and their sugar alcohol precursors by direct analysis in real time mass spectrometry (DART-MS) using an off-axis geometry. Demonstration of the effect of various parameters, such as ion polarity and in-source collision induced dissociation (CID) on the detection of these compounds is presented. Sensitivity of sugar alcohols and nitrate ester explosives was found to be greatest in negative ion mode with sensitivities ranging from hundreds of picograms to hundreds of nanograms, depending on the characteristics of the particular molecule. Altering the in-source CID potential allowed for acquisition of characteristic molecular ion spectra as well as fragmentation spectra. Additional studies were completed to identify the role of different experimental parameters on the sensitivity for these compounds. Variables that were examined included the DART gas stream temperature, the presence of a related compound (i.e., the effect of a precursor on the detection of a nitrate ester explosive), incorporation of dopant species and the role of the analysis surface. It was determined that each variable affected the response and detection of both sugar alcohols and the corresponding nitrate ester explosives. From this work, a rapid and sensitive method for the detection of individual sugar alcohols and corresponding nitrate ester explosives, or mixtures of the two, has been developed, providing a useful tool in the real-world identification of homemade explosives.

  4. Systems and methods for rapid processing and storage of data

    Science.gov (United States)

    Stalzer, Mark A.

    2017-01-24

    Systems and methods of building massively parallel computing systems using low power computing complexes in accordance with embodiments of the invention are disclosed. A massively parallel computing system in accordance with one embodiment of the invention includes at least one Solid State Blade configured to communicate via a high performance network fabric. In addition, each Solid State Blade includes a processor configured to communicate with a plurality of low power computing complexes interconnected by a router, and each low power computing complex includes at least one general processing core, an accelerator, an I/O interface, and cache memory and is configured to communicate with non-volatile solid state memory.

  5. Rapid detection of Orthopoxvirus by semi-nested PCR directly from clinical specimens: a useful alternative for routine laboratories.

    Science.gov (United States)

    Abrahão, Jônatas Santos; Drumond, Betânia Paiva; Trindade, Giliane de Souza; da Silva-Fernandes, André Tavares; Ferreira, Jaqueline Maria Siqueira; Alves, Pedro Augusto; Campos, Rafael Kroon; Siqueira, Larissa; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien

    2010-04-01

    Orthopoxvirus (OPV) has been associated with worldwide exanthematic outbreaks, which have resulted in serious economic losses as well as impact on public health. Although the current classical and molecular methods are useful for the diagnosis of OPV, they are largely inaccessible to unsophisticated clinical laboratories. The major reason for the inaccessibility is that they require both virus isolation and DNA manipulation. In this report, a rapid, sensitive and low-cost semi-nested PCR method is described for the detection of OPV DNA directly from clinical specimens. A set of primers was designed to amplify the conserved OPV vgf gene. The most useful thermal and chemical conditions were selected and minimum non-inhibitory dilutions were determined. More than 100 Brazilian Vaccinia virus (VACV) field clinical specimens were tested using this semi-nested PCR in order to confirm its applicability. Cowpox virus was also detected by PCR from the ear scabs of scarified Balb/c mice. In addition, the method was highly sensitive for the detection of VACV DNA in murine blood and excreta, which are among the suggested reservoirs of OPV. Together, these data suggest that semi-nested PCR can be used for initial screening for OPV and as a routine diagnostic laboratory method. 2010 Wiley-Liss, Inc.

  6. Direct polymerase chain reaction from blood and tissue samples for rapid diagnosis of bovine leukemia virus infection.

    Science.gov (United States)

    Nishimori, Asami; Konnai, Satoru; Ikebuchi, Ryoyo; Okagawa, Tomohiro; Nakahara, Ayako; Murata, Shiro; Ohashi, Kazuhiko

    2016-06-01

    Bovine leukemia virus (BLV) infection induces bovine leukemia in cattle and causes significant financial harm to farmers and farm management. There is no effective therapy or vaccine; thus, the diagnosis and elimination of BLV-infected cattle are the most effective method to eradicate the infection. Clinical veterinarians need a simpler and more rapid method of diagnosing infection, because both nested polymerase chain reaction (PCR) and real-time PCR are labor intensive, time-consuming, and require specialized molecular biology techniques and expensive equipment. In this study, we describe a novel PCR method for amplifying the BLV provirus from whole blood, thus eliminating the need for DNA extraction. Although the sensitivity of PCR directly from whole blood (PCR-DB) samples as measured in bovine blood containing BLV-infected cell lines was lower than that of nested PCR, the PCR-DB technique showed high specificity and reproducibility. Among 225 clinical samples, 49 samples were positive by nested PCR, and 37 samples were positive by PCR-DB. There were no false positive samples; thus, PCR-DB sensitivity and specificity were 75.51% and 100%, respectively. However, the provirus loads of the samples detected by nested PCR and not PCR-DB were quite low. Moreover, PCR-DB also stably amplified the BLV provirus from tumor tissue samples. PCR-DB method exhibited good reproducibility and excellent specificity and is suitable for screening of thousands of cattle, thus serving as a viable alternative to nested PCR and real-time PCR.

  7. Rapid new methods for paint collection and lead extraction.

    Science.gov (United States)

    Gutknecht, William F; Harper, Sharon L; Winstead, Wayne; Sorrell, Kristen; Binstock, David A; Salmons, Cynthia A; Haas, Curtis; McCombs, Michelle; Studabaker, William; Wall, Constance V; Moore, Curtis

    2009-01-01

    Chronic exposure of children to lead can result in permanent physiological impairment. In adults, it can cause irritability, poor muscle coordination, and nerve damage to the sense organs and nerves controlling the body. Surfaces coated with lead-containing paints are potential sources of exposure to lead. In April 2008, the U.S. Environmental Protection Agency (EPA) finalized new requirements that would reduce exposure to lead hazards created by renovation, repair, and painting activities, which disturb lead-based paint. On-site, inexpensive identification of lead-based paint is required. Two steps have been taken to meet this challenge. First, this paper presents a new, highly efficient method for paint collection that is based on the use of a modified wood drill bit. Second, this paper presents a novel, one-step approach for quantitatively grinding and extracting lead from paint samples for subsequent lead determination. This latter method is based on the use of a high-revolutions per minute rotor with stator to break up the paint into approximately 50 micron-size particles. Nitric acid (25%, v/v) is used to extract the lead in 95% for real-world paints, National Institute of Standards and Technology's standard reference materials, and audit samples from the American Industrial Hygiene Association's Environmental Lead Proficiency Analytical Testing Program. This quantitative extraction procedure, when paired with quantitative paint sample collection and lead determination, may enable the development of a lead paint test kit that will meet the specifications of the final EPA rule.

  8. Development a rapid and accurate multiplex real time PCR method for the detection Chlamydia trachomatis and Mycoplasma hominis.

    Science.gov (United States)

    Safarkar, Roya; Mehrabadi, Jalil Fallah; Noormohammadi, Zahra; Mirnejad, Reza

    2017-11-01

    Sexually transmitted diseases easily spread among sexually active people and often have no symptoms. Rapid and accurate method for detecting these infections are necessary in early stages. The traditional detection methods of them are difficult and time-consuming. In this study, multiplex real time PCR was optimized for rapid identification of Chlamydia trachomatis and Mycoplasma hominis in a single tube and was performed with our designed primers. The sensitivity test was carried out to designed primers with diluted genomic DNA. To defined the specificity, non STD bacteria were used as DNA template. This study indicated that the developed multiplex real time PCR can be an effective alternative procedure to the conventional methods for rapid and accurate identification of C Chlamydia trachomatis and Mycoplasma hominis. Multiplex real-time PCR Results of them were checked with melting curves. The sensitivity of our designed primer by multiplex real time PCR for Chlamydia trachomatis and Mycoplasma hominis were 4.78×1010 and 8.35×1010 , respectively, Which the primers did not amplify any product from a non-STD species. Multiplex real time PCR by our new primers and analysis of melting curves were successfully usable for rapid and accurate detection of Chlamydia trachomatis and Mycoplasma hominis. This assay instead of traditional culture method, has considerable potential to be rapid, accurate and highly sensitive molecular diagnostic tool for simultaneous and direct detection. © 2017 Wiley Periodicals, Inc.

  9. A microfluidic chip for direct and rapid trapping of white blood cells from whole blood

    Science.gov (United States)

    Chen, Jingdong; Chen, Di; Yuan, Tao; Xie, Yao; Chen, Xiang

    2013-01-01

    Blood analysis plays a major role in medical and science applications and white blood cells (WBCs) are an important target of analysis. We proposed an integrated microfluidic chip for direct and rapid trapping WBCs from whole blood. The microfluidic chip consists of two basic functional units: a winding channel to mix and arrays of two-layer trapping structures to trap WBCs. Red blood cells (RBCs) were eliminated through moving the winding channel and then WBCs were trapped by the arrays of trapping structures. We fabricated the PDMS (polydimethylsiloxane) chip using soft lithography and determined the critical flow velocities of tartrazine and brilliant blue water mixing and whole blood and red blood cell lysis buffer mixing in the winding channel. They are 0.25 μl/min and 0.05 μl/min, respectively. The critical flow velocity of the whole blood and red blood cell lysis buffer is lower due to larger volume of the RBCs and higher kinematic viscosity of the whole blood. The time taken for complete lysis of whole blood was about 85 s under the flow velocity 0.05 μl/min. The RBCs were lysed completely by mixing and the WBCs were trapped by the trapping structures. The chip trapped about 2.0 × 103 from 3.3 × 103 WBCs. PMID:24404026

  10. Incorporating Direct Rapid Immunohistochemical Testing into Large-Scale Wildlife Rabies Surveillance

    Directory of Open Access Journals (Sweden)

    Kevin Middel

    2017-06-01

    Full Text Available Following an incursion of the mid-Atlantic raccoon variant of the rabies virus into southern Ontario, Canada, in late 2015, the direct rapid immunohistochemical test for rabies (dRIT was employed on a large scale to establish the outbreak perimeter and to diagnose specific cases to inform rabies control management actions. In a 17-month period, 5800 wildlife carcasses were tested using the dRIT, of which 307 were identified as rabid. When compared with the gold standard fluorescent antibody test (FAT, the dRIT was found to have a sensitivity of 100% and a specificity of 98.2%. Positive and negative test agreement was shown to be 98.3% and 99.1%, respectively, with an overall test agreement of 98.8%. The average cost to test a sample was $3.13 CAD for materials, and hands-on technical time to complete the test is estimated at 0.55 h. The dRIT procedure was found to be accurate, fast, inexpensive, easy to learn and perform, and an excellent tool for monitoring the progression of a wildlife rabies incursion.

  11. Comparison of direct and precipitation methods for the estimation of ...

    African Journals Online (AJOL)

    Background: There is increase in use of direct assays for analysis of high and low density lipoprotein cholesterol by clinical laboratories despite differences in performance characteristics with conventional precipitation methods. Calculation of low density lipoprotein cholesterol in precipitation methods is based on total ...

  12. Susceptibility testing of filamentous fungi to amphotericin B by a rapid radiometric method

    Energy Technology Data Exchange (ETDEWEB)

    Merz, W.G.; Fay, D.; Thumar, B.; Dixon, D.

    1984-01-01

    A rapid, radiometric method was developed to determine the susceptibility of filamentous fungi to amphotericin B. The rapid, radiometric method depended on measurement of the inhibition of /sup 24/CO/sub 2/ production in the presence of amphotericin B. Thirty isolates of filamentous fungi were tested by the rapid, radiometric method and a reference agar dilution method. There was 93% agreement between the two methods when an 80% or greater decrease in CO/sub 2/ production was used to calculate the minimal inhibitory concentration with the rapid, radiometric method. Minimal inhibitory concentrations, based on 80% decrease of CO/sub 2/ production, were achieved within 24 h of incubation with all of the fungi tested.

  13. Microwave as a rapid cooking method for beef tenderness evaluation.

    Science.gov (United States)

    Silva, Douglas R G; Fernandez, Ludimila C; Torres Filho, Robledo A; Fontes, Paulo R; Ramos, Alcinéia L S; Ramos, Eduardo M

    2017-11-20

    Semitendinosus (ST) muscle steaks were grouped according to three locations (proximal, middle, and distal end), grilled to endpoint temperature of 71C or cooked for 20, 30, 40, 50, or 60 s in a microwave oven (Mw). The location did not affect (p > .05) the cooking loss (CL) or shear force (SF) values. The CL increased (p  .05) from the grill samples. None of the microwaves' SF values were different (p > .05) from the grill values, with treatments Mw30 to Mw50 showing moderate repeatability (R = 0.51-0.60) and Mw30 and Mw60 showing higher correlations (r > .71) with grill values. Cooking beef strips with a microwave is a potential method for tenderness evaluation, but requires additional study to evaluate and optimize this application in different muscles and for comparison to sensorial data. The work was intended to evaluate the possibility of using a microwave oven for cooking meat to be used in objective measurement protocols for meat tenderness and to optimize the conditions for this purpose. The use of a standardized microwave procedure allows a dramatic reduction in analysis time and may reduce error variance due to nonuniform cooking procedures. © 2017 Wiley Periodicals, Inc.

  14. A method for rapid abundance estimation of semiplanktonic meiofauna

    Science.gov (United States)

    Armonies, Werner

    2000-12-01

    Many meiofaunal copepods and plathelminths enter the tidal waters at night thus exhibiting a life-style intermediate between benthic and planktonic. At the same time, ostracods may leave their interstitial dwelling and move across the sediment surface. In laboratory experiments, the percentage of plathelminth populations emerging from the sediment varied with the species, temperature, light conditions, and the dimensions of the sediment cores studied, but not with tidal level, season, ambient density of conspecifics, or the sediment composition. Therefore, the swimming activity may be utilised for extraction of semiplanktonic meiofauna provided that the extraction procedure is standardised with respect to temperature, light and core size. For free-living plathelminths from the Wadden Sea intertidal a robust standard procedure is as follows: sediment cores 1.6 cm in diameter (2 cm2 surface area) and 3 cm deep are fitted into cylindrical containers and submerged into aquaria containing filtered seawater (ambient salinity, room temperature, darkness) for 24 h. The sediment containers are then removed and the aquarian water filtered through appropriate meshes; the residue contains the emergent faunal component. For plathelminths, this procedure reduces sorting time by some 90% compared with the standard shaking-decantation method and thus makes it possible to process a high number of samples in a short time. Similar procedures may be developed for copepods and epibenthic ostracods.

  15. A Rapid and Efficient Method for Evaluation of Suspect Testimony: Palynological Scanning.

    Science.gov (United States)

    Wiltshire, Patricia E J; Hawksworth, David L; Edwards, Kevin J

    2015-11-01

    A rapid method for evaluating suspect testimony is valuable at any stage in an inquiry and can result in a change of direction in an investigation. Rape cases, in particular, can present problems where a defendant renders DNA analysis redundant by claiming that the claimant consented to have sexual relations. Forensic palynology is valuable in confirming or eliminating locations as being crime scenes, thus checking the testimony of both parties. In contrast to some forensic disciplines, forensic palynology can provide critical information without time-consuming full analysis. Two cases are described where the palynological assemblages from comparator samples of pertinent places were compared with those obtained from clothing of claimants and defendants. The results of rapid microscopical scanning of relevant preparations led to early confessions, thus obviating the need for costly analyses and protracted court proceedings. A third case demonstrates the unbiased nature of this technique where a man, although innocent of any offense, lied about having visited the crime scene for fear of prosecution. This highlights the need for sensitive policing in claims of rape. © 2015 American Academy of Forensic Sciences.

  16. Novel, rapid optical immunoassay technique for detection of group A streptococci from pharyngeal specimens: comparison with standard culture methods.

    OpenAIRE

    Harbeck, R. J.; Teague, J; Crossen, G R; Maul, D M; Childers, P L

    1993-01-01

    A novel immunoassay system based on the changes in the reflection of light, termed an optical immunoassay (OIA), was utilized to directly detect group A streptococcal (GAS) carbohydrate antigen from clinical specimens. In two studies, a total of 1,275 throat swabs were tested for the presence of this antigen with the Strep A OIA rapid detection system and the results were compared with those of standard culture methods. In both studies, the Strep A OIA yielded more positive results than plati...

  17. Stem cell monitoring with a direct or indirect labeling method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Min Hwan; Lee, Yong Jin [Molecular Imaging Research Center, Korea Institute of Radiological and Medical Sciences (KIRAMS), Seoul (Korea, Republic of)

    2016-12-15

    The molecular imaging techniques allow monitoring of the transplanted cells in the same individuals over time, from early localization to the survival, migration, and differentiation. Generally, there are two methods of stem cell labeling: direct and indirect labeling methods. The direct labeling method introduces a labeling agent into the cell, which is stably incorporated or attached to the cells prior to transplantation. Direct labeling of cells with radionuclides is a simple method with relatively fewer adverse events related to genetic responses. However, it can only allow short-term distribution of transplanted cells because of the decreasing imaging signal with radiodecay, according to the physical half-lives, or the signal becomes more diffuse with cell division and dispersion. The indirect labeling method is based on the expression of a reporter gene transduced into the cell before transplantation, which is then visualized upon the injection of an appropriate probe or substrate. In this review, various imaging strategies to monitor the survival and behavior change of transplanted stem cells are covered. Taking these new approaches together, the direct and indirect labeling methods may provide new insights on the roles of in vivo stem cell monitoring, from bench to bedside.

  18. Alternative method for direct measurement of tibial slope

    Directory of Open Access Journals (Sweden)

    Stijak Lazar

    2014-01-01

    Full Text Available Background/Aim. The tibial slope is one of the most frequently cited anatomical causes of anterior cruciate ligament trauma. The aim of this study was to determine the possibility of direct measuring of the tibial slope of the knee without prior soft tissue dissection in cadavers. Methods. Measurement was performed on the two groups of samples: osteological and cadaveric. The osteological group consisted of 102 matured tibiae and measurement was performed: indirectly by sagittal photographing of the tibia, and directly by a set of parallel bars. The cadaveric group consisted of 50 cadaveric knees and measurement was performed directly by a set of parallel bars. The difference and correlation between indirect and the direct measurements were observed, which included also measuring of the difference and correlation of the tibial slope on the medial and lateral condyles. Results. A statistically significant difference between the direct and indirect method of measuring (p 0.05. However, the slope on the medial condyle, as well as indirect measurement showed a statistically significant difference (p < 0.01. Conclusion. By the use of a set of parallel bars it is possible to measure the tibial slope directly without removal of the soft tissue. The results of indirect, photographic measurement did not statistically differ from the results of direct measurement of the tibial slope.

  19. Alternating direction methods for latent variable gaussian graphical model selection.

    Science.gov (United States)

    Ma, Shiqian; Xue, Lingzhou; Zou, Hui

    2013-08-01

    Chandrasekaran, Parrilo, and Willsky (2012) proposed a convex optimization problem for graphical model selection in the presence of unobserved variables. This convex optimization problem aims to estimate an inverse covariance matrix that can be decomposed into a sparse matrix minus a low-rank matrix from sample data. Solving this convex optimization problem is very challenging, especially for large problems. In this letter, we propose two alternating direction methods for solving this problem. The first method is to apply the classic alternating direction method of multipliers to solve the problem as a consensus problem. The second method is a proximal gradient-based alternating-direction method of multipliers. Our methods take advantage of the special structure of the problem and thus can solve large problems very efficiently. A global convergence result is established for the proposed methods. Numerical results on both synthetic data and gene expression data show that our methods usually solve problems with 1 million variables in 1 to 2 minutes and are usually 5 to 35 times faster than a state-of-the-art Newton-CG proximal point algorithm.

  20. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases. PMID:25628612

  1. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  2. Evaluation of Two New Smoothing Methods in Equating: The Cubic B-Spline Presmoothing Method and the Direct Presmoothing Method

    Science.gov (United States)

    Cui, Zhongmin; Kolen, Michael J.

    2009-01-01

    This article considers two new smoothing methods in equipercentile equating, the cubic B-spline presmoothing method and the direct presmoothing method. Using a simulation study, these two methods are compared with established methods, the beta-4 method, the polynomial loglinear method, and the cubic spline postsmoothing method, under three sample…

  3. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

  4. Alternative method for direct measurement of tibial slope.

    Science.gov (United States)

    Stijak, Lazar; Santrac-Stijak, Gordana; Spasojević, Goran; Radonjić, Vidosava; Malis, Milos; Milovanović, Darko; Filipović, Branislav

    2014-04-01

    The tibial slope is one of the most frequently cited anatomical causes of anterior cruciate ligament trauma. The aim of this study was to determine the possibility of direct measuring of the tibial slope of the knee without prior soft tissue dissection in cadavers. Measurement was performed on the two groups of samples: osteological and cadaveric. The osteological group consisted of 102 matured tibiae and measurement was performed: indirectly by sagittal photographing of the tibia, and directly by a set of parallel bars. The cadaveric group consisted of 50 cadaveric knees and measurement was performed directly by a set of parallel bars. The difference and correlation between indirect and the direct measurements were observed, which included also measuring of the difference and correlation of the tibial slope on the medial and lateral condyles. A statistically significant difference between the direct and indirect method of measuring (p slope on the medial condyle, which is of no practical importance. Direct measurement of the osteological and cadaveric groups of samples did not show a statistically significant difference regarding the values of the tibial slope on the lateral condyle (p > 0.05). However, the slope on the medial condyle, as well as indirect measurement showed a statistically significant difference (p slope directly without removal of the soft tissue. The results of indirect, photographic measurement did not statistically differ from the results of direct measurement of the tibial slope.

  5. A direct sampling method to an inverse medium scattering problem

    KAUST Repository

    Ito, Kazufumi

    2012-01-10

    In this work we present a novel sampling method for time harmonic inverse medium scattering problems. It provides a simple tool to directly estimate the shape of the unknown scatterers (inhomogeneous media), and it is applicable even when the measured data are only available for one or two incident directions. A mathematical derivation is provided for its validation. Two- and three-dimensional numerical simulations are presented, which show that the method is accurate even with a few sets of scattered field data, computationally efficient, and very robust with respect to noises in the data. © 2012 IOP Publishing Ltd.

  6. Direct and indirect immunofluorescence staining of fecal streptococci for rapid assessment of water quality

    Energy Technology Data Exchange (ETDEWEB)

    Pavlova, M.T.; Beauvais, E.; Brezenski, F.T.; Litsky, W.

    1975-01-01

    Immunofluorescence (IF) techniques were employed in an attempt to develop a rapid test for the identification of fecal streptococci. Fresh isolates were obtained from river waters and raw sewage. Identification to species were made by the conventional physiological, biochemical, and serological tests. Both whole and disrupted cells of representative strains of each species were used for the preparation of the fecal streptococcal vaccine. Globulin fractions of individual and pooled antisera were labeled with fluorescein isothiocyanate, and the resulting conjugates were tested with homologous and heterologous antigens. The present findings suggest that the immunofluorescence techniques can be employed in the determination of the presence and source of fecal pollution in water employing the fecal streptococci as indicator organisms. By using this method it was determined that fecal streptococci can be identified from water and sewage samples within 20 hours. Parenthetically it should be noted that the identification procedures using the routine biochemical and serological tests may take as long as 7 to 14 days. The procedure may be automated for continual monitoring.

  7. Rapid Method for the Determination of the Stable Oxygen Isotope Ratio of Water in Alcoholic Beverages.

    Science.gov (United States)

    Wang, Daobing; Zhong, Qiding; Li, Guohui; Huang, Zhanbin

    2015-10-28

    This paper demonstrates the first successful application of an online pyrolysis technique for the direct determination of oxygen isotope ratios (δ(18)O) of water in alcoholic beverages. Similar water concentrations in each sample were achieved by adjustment with absolute ethyl alcohol, and then a fixed GC split ratio can be used. All of the organic ingredients were successfully separated from the analyte on a CP-PoraBond Q column and subsequently vented out, whereas water molecules were transferred into the reaction furnace and converted to CO. With the system presented, 15-30 μL of raw sample was diluted and can be analyzed repeatedly; the analytical precision was better than 0.4‰ (n = 5) in all cases, and more than 50 injections can be made per day. No apparent memory effect was observed even if water samples were injected using the same syringe; a strong correlation (R(2) = 0.9998) was found between the water δ(18)O of measured sample and that of working standards. There was no significant difference (p > 0.05) between the mean δ(18)O value and that obtained by the traditional method (CO2-water equilibration/isotope ratio mass spectrometry) and the newly developed method in this study. The advantages of this new method are its rapidity and straightforwardness, and less test portion is required.

  8. Markov chain Monte Carlo methods in directed graphical models

    DEFF Research Database (Denmark)

    Højbjerre, Malene

    have primarily been based on a Bayesian paradigm, i.e. prior information on the parameters is a prerequisite, but questions about undesirable side effects from the priors are raised.     We present a method, based on MCMC methods, that approximates profile log-likelihood functions in directed graphical...... with-in person and with-in family dependences.     In the second study we compare four different screening methods for cervical cancer. The methods have been performed on a number of women, and the data possess a complicated dependence structure due to the replicate test results for the same woman. We...

  9. Methods and Magnitudes of Rapid Weight Loss in Judo Athletes Over Pre-Competition Periods

    Directory of Open Access Journals (Sweden)

    Kons Rafael Lima

    2017-06-01

    Full Text Available Purpose. The study aimed to analyse the methods and magnitudes of rapid weight loss (RWL in judo team members in distinct periods before the biggest state competition in Southern Brazil.

  10. A rapid method of detecting autoantibody against FcεRIα for chronic spontaneous urticaria.

    Directory of Open Access Journals (Sweden)

    Mey-Fann Lee

    Full Text Available BACKGROUND: Chronic spontaneous urticaria (CU is a common skin disorder, with an estimated prevalence of 0.5-1.8% in most populations. Around 30-50% of CU patients have an autoimmune etiology, with autoantibodies (autoAbs against IgE, FcεRIα, and FcεRII/CD23. Although the in vivo autologous serum skin test (ASST and in vitro histamine release/activation assay are the most frequently used screening methods, these two have many limitations and do not directly measure susceptible autoAbs. This study aimed to establish an in vitro rapid screening test using recombinant autoantigen FcεRIα(rFcεRIα to improve the diagnosis of autoimmune urticaria. METHODS: Forty patients with CU and 20 healthy individuals were enrolled. After PCR-based cloning and the production of extracellular fragments of the FcεRIα protein using the E. coli expression system, serum autoAb to rFcεRIα was evaluated using in-house ELISA and rapid immunodot test. RESULTS: In ELISA-based detection, 14 out of 20 CU-ASST(+ patients exhibited anti- FcεRIα responses, whereas five of the 20 CU-ASST(- and two of the 20 non-CU patients showed autoantibody background in the assay. For the immunodot test, 55% (11/20 of the CU-ASST(+ sera exhibited anti-FcεRIα reactivity. There was no false positive among the CU-ASST(- and non-CU groups. Using clinical urticaria plus ASST(+ as the gold standard, in-house ELISA had 70% sensitivity, 82.5% specificity, and positive likelihood ratio of 4, while immunodot had 55% sensitivity, 100% specificity, and positive likelihood ratio >55. CONCLUSIONS: This study has developed a rapid immunodot method with high specificity for detecting autoAb to FcεRIαin patients with CU. Preliminary data indicates that this immunodot technique has the potential to be a routine diagnostic assay for autoimmune CU.

  11. Method and apparatus using selected superparamagnetic labels for rapid quantification of immunochromatographic tests

    Directory of Open Access Journals (Sweden)

    Mika PA Laitinen

    2009-04-01

    Full Text Available Mika PA Laitinen1, Jari Salmela2, Leona Gilbert1, Risto Kaivola1, Topi Tikkala2, Christian Oker-Blom1, Jukka Pekola3, Matti Vuento11Department of Biological and Environmental Science; 2Department of Physics, University of Jyväskylä, Jyväskylä, Finland; 3Low Temperature Laboratory, Helsinki University of Technology, Helsinki, FinlandAbstract: A rapid method and instrumentation for quantification of immunochromatographic tests (ICT are described. The principle and performance of the method was demonstrated by measuring the levels of human chorionic gonadotropin (hCG present in urine. The test format was a sandwich assay using two distinct monoclonal antibodies directed against hCG. The first anti-hCG antibody was labeled with superparamagnetic particles whereas the second was immobilized as a narrow detection zone on a porous membrane. The human urine sample was mixed with superparamagnetic particles coated with the first anti-hCG antibody, and the mixture was allowed to migrate past the detection zone containing the second anti-hCG antibody. Capillary forces facilitated migration of the immune complexes along the porous membrane. The amount of superparamagnetic particle-labelled monoclonal anti-hCG bound to the detection zone was directly proportional to the amount of hCG present in the sample as detected by measuring magnetization in the detector coil. The method had a practical detection limit of 20 U/l (54 nM of hCG per 5 μl of human urine and a linear range of three decades from 20 U/l to 10 000 U/l. In addition, the analysis was completed within less than 10 minutes. Thus, the test format should be suitable for fast detection and monitoring of a large variety of clinically important parameters and analytes.Keywords: affinity, biosensor, hCG, immunochromatography, magnetization, superparamagnetic

  12. Directed forgetting of complex pictures in an item method paradigm.

    Science.gov (United States)

    Hauswald, Anne; Kissler, Johanna

    2008-11-01

    An item-cued directed forgetting paradigm was used to investigate the ability to control episodic memory and selectively encode complex coloured pictures. A series of photographs was presented to 21 participants who were instructed to either remember or forget each picture after it was presented. Memory performance was later tested with a recognition task where all presented items had to be retrieved, regardless of the initial instructions. A directed forgetting effect--that is, better recognition of "to-be-remembered" than of "to-be-forgotten" pictures--was observed, although its size was smaller than previously reported for words or line drawings. The magnitude of the directed forgetting effect correlated negatively with participants' depression and dissociation scores. The results indicate that, at least in an item method, directed forgetting occurs for complex pictures as well as words and simple line drawings. Furthermore, people with higher levels of dissociative or depressive symptoms exhibit altered memory encoding patterns.

  13. Number-theoretic method for practical indexing of crystal directions

    CERN Document Server

    Sheremetyev, I A

    2001-01-01

    The paper presents new number-theoretic approaches to the solution of orientation problems in single crystal studies. A fast method for indexing any rational crystal lattice direction was developed to be a new 3D generalization of the Euclid algorithm. Based on the latter, a method for indexing directions in any crystal lattice was developed, where the practical problem is reduced to the search of the shortest primitive lattice vector within a certain angular error for the direction in analysis. A multipurpose personal computer system for testing both real and reciprocal lattices of familiar crystals is devised. The compact-in-memory software represents a principally new 'bottomless' atlas of any crystal stereographic projections, where each point of the projection field is indexed within a desired accuracy.

  14. An Extension of the direct Method via an Application | Changzheng ...

    African Journals Online (AJOL)

    The Direct Method due to Clarkson and Kruskal [9] for finding similarity reductions of partial differential equations is extended to obtain similarity reductions of nonlinear partial differential equations with arbitrary functions. The extension is illustrated by the nonlinear hyperbolic equation with arbitrary wave velocity.

  15. Managing Small-Scale Fisheries : Alternative Directions and Methods

    International Development Research Centre (IDRC) Digital Library (Canada)

    Couverture du livre Managing Small-Scale Fisheries: Alternative Directions and Methods ... Small-scale Fisheries va plus loin que le champ d'application de la gestion classique des pêches pour aborder d'autres concepts, outils, méthodes et stratégies de conservation. ... IDRC renews food security partnership with ACIAR.

  16. Calibration method for direct conversion receiver front-ends

    Directory of Open Access Journals (Sweden)

    R. Müller

    2008-05-01

    Full Text Available Technology induced process tolerances in analog circuits cause device characteristics different from specification. For direct conversion receiver front-ends a system level calibration method is presented. The malfunctions of the devices are compensated by tuning dominant circuit parameters. Thereto optimization techniques are applied which use measurement values and special evaluation functions.

  17. A direct and sensitive method for screening fructooligosaccharides ...

    African Journals Online (AJOL)

    A direct and sensitive method for screening fructooligosaccharides-digesting microorganisms useful in food and health science. ... Short-chain fructooligosaccharides (FOS) stimulate selectively the growth and activity of microorganisms in the colon providing positive health effects and well-being in humans and animals.

  18. Rapid identification of salmonella serotypes with stereo and hyperspectral microscope imaging Methods

    Science.gov (United States)

    The hyperspectral microscope imaging (HMI) method can reduce detection time within 8 hours including incubation process. The early and rapid detection with this method in conjunction with the high throughput capabilities makes HMI method a prime candidate for implementation for the food industry. Th...

  19. Porous Ti6Al4V scaffold directly fabricating by rapid prototyping: preparation and in vitro experiment

    NARCIS (Netherlands)

    Li Jiaping, L.; de Wijn, J.R.; van Blitterswijk, Clemens; de Groot, K.

    2006-01-01

    Three-dimensional (3D) fiber deposition (3DF), a rapid prototyping technology, was successfully directly applied to produce novel 3D porous Ti6Al4V scaffolds with fully interconnected porous networks and highly controllable porosity and pore size. A key feature of this technology is the 3D

  20. Additive manufacturing technologies: 3D printing, rapid prototyping, and direct digital manufacturing

    National Research Council Canada - National Science Library

    Gibson, Ian; Rosen, David; Stucker, B

    2015-01-01

    .... This book provides a comprehensive overview of rapid prototyping technologies as well as support technologies such as software systems, vacuum casting, investment casting, plating, infiltration and other systems. This book also...

  1. Liposome immunoassay for rapid identification of group A streptococci directly from throat swabs.

    OpenAIRE

    Gerber, M. A.; Randolph, M. F.; DeMeo, K K

    1990-01-01

    The Q Test Strep (Becton Dickinson and Co., Franklin Lakes, N.J.) is a new solid-phase liposome immunoassay for the rapid diagnosis of group A beta-hemolytic streptococcal pharyngitis. Compared with blood agar plate cultures, the Q Test Strep had a sensitivity of 91%, a specificity of 83%, a positive predictive value of 88%, and a negative predictive value of 87%. Liposome technology can be used to facilitate the rapid diagnosis of group A beta-hemolytic streptococcal pharyngitis.

  2. A direct method for nonlinear ill-posed problems

    Science.gov (United States)

    Lakhal, A.

    2018-02-01

    We propose a direct method for solving nonlinear ill-posed problems in Banach-spaces. The method is based on a stable inversion formula we explicitly compute by applying techniques for analytic functions. Furthermore, we investigate the convergence and stability of the method and prove that the derived noniterative algorithm is a regularization. The inversion formula provides a systematic sensitivity analysis. The approach is applicable to a wide range of nonlinear ill-posed problems. We test the algorithm on a nonlinear problem of travel-time inversion in seismic tomography. Numerical results illustrate the robustness and efficiency of the algorithm.

  3. Scalable force directed graph layout algorithms using fast multipole methods

    KAUST Repository

    Yunis, Enas Abdulrahman

    2012-06-01

    We present an extension to ExaFMM, a Fast Multipole Method library, as a generalized approach for fast and scalable execution of the Force-Directed Graph Layout algorithm. The Force-Directed Graph Layout algorithm is a physics-based approach to graph layout that treats the vertices V as repelling charged particles with the edges E connecting them acting as springs. Traditionally, the amount of work required in applying the Force-Directed Graph Layout algorithm is O(|V|2 + |E|) using direct calculations and O(|V| log |V| + |E|) using truncation, filtering, and/or multi-level techniques. Correct application of the Fast Multipole Method allows us to maintain a lower complexity of O(|V| + |E|) while regaining most of the precision lost in other techniques. Solving layout problems for truly large graphs with millions of vertices still requires a scalable algorithm and implementation. We have been able to leverage the scalability and architectural adaptability of the ExaFMM library to create a Force-Directed Graph Layout implementation that runs efficiently on distributed multicore and multi-GPU architectures. © 2012 IEEE.

  4. A simple and rapid method for optical visualization and quantification of bacteria on textiles

    Science.gov (United States)

    Stiefel, Philipp; Schneider, Jana; Amberg, Caroline; Maniura-Weber, Katharina; Ren, Qun

    2016-01-01

    To prevent bacterial contamination on textiles and the associated undesired effects different biocidal coatings have been investigated and applied. However, due to health and environmental concerns anti-adhesive coatings preventing the binding of bacteria would be favored. To develop such anti-adhesive coatings simple assays for reliable and fast screening are beneficial. Here an easy-to-handle, robust and rapid assay to assess bacteria on textiles utilizing a tetrazolium salt was reported. The assay allowed direct eye visualization of the color change of the textiles containing bacteria, facilitating fast screening. Quantification of the adhered bacteria could be done by generating standard curves which correlate the staining intensity to cell numbers. An additional advantage of the described assay is that with the same detection method anti-adhesive and biocidal effects can be investigated. The method was applied to different coatings, using Pseudomonas aeruginosa and Staphylococcus aureus as model organisms. The detection limit was found to be between 2.5 * 106 and 9.4 * 108 for P. aeruginosa and between 1 * 106 and 3.3 * 108 for S. aureus. The anti-adhesive coating PLUMA was demonstrated to reduce bacterial adhesion without killing them, whereas the biocidal coating TH22-27 caused a clear reduction in the number of viable cells. PMID:28004762

  5. Assessment of three rapid methods for the detection of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Soares, Maria João; Soares, Carlos; Mendes, Ana Constança; Guimarães, Maria Luís; Cabeda, José Manuel; Amorim, José Manuel

    2004-01-01

    We evaluated three rapid methods to detect methicillin-resistant Staphylococcus aureus (MRSA) and compared them with PCR amplification of mecA. A total of 103 S. aureus strains were studied by MRSA-Screen, BBL Crystal, Velogene Genomic and mecA PCR. All the methods detected the 61 MRSA strains having the mecA gene, showing 100% sensitivity and specificity. Despite the correlation between all the rapid methods and PCR, the ease of use and shorter turnaround time of MRSA-Screen were important factors leading to the selection of this method as the routine screening technique for MRSA.

  6. Direct methods for limit and shakedown analysis of structures advanced computational algorithms and material modelling

    CERN Document Server

    Pisano, Aurora; Weichert, Dieter

    2015-01-01

    Articles in this book examine various materials and how to determine directly the limit state of a structure, in the sense of limit analysis and shakedown analysis. Apart from classical applications in mechanical and civil engineering contexts, the book reports on the emerging field of material design beyond the elastic limit, which has further industrial design and technological applications. Readers will discover that “Direct Methods” and the techniques presented here can in fact be used to numerically estimate the strength of structured materials such as composites or nano-materials, which represent fruitful fields of future applications.   Leading researchers outline the latest computational tools and optimization techniques and explore the possibility of obtaining information on the limit state of a structure whose post-elastic loading path and constitutive behavior are not well defined or well known. Readers will discover how Direct Methods allow rapid and direct access to requested information in...

  7. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    Science.gov (United States)

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. A novel method for rapidly isolating microbes that suppress soil-borne phytopathogens

    Science.gov (United States)

    Cooper, Sarah; Agnew, Linda; Pereg, Lily

    2016-04-01

    Seedling establishment faces a large number of challenges related to soil physical properties as well as to fungal root diseases. It is extremely difficult to eliminate fungal pathogens from soils where their populations are established due to the persistent nature of their spores and since fumigation of resident fungi is very ineffective in clay-containing soils. Therefore it is necessary to find ways to overcome disease in areas where the soils are infected with fungal phytopathogens. The phenomenon of disease suppressive soils, where the pathogen is present but no disease observed, suggests that microbial antagonism in the soil may lead to the suppression of the growth of fungal pathogens. There are also cases in the literature where soil microorganisms were isolated that suppress the growth of phytopathogens. Antibiosis is one of the most important mechanisms responsible for fungal antagonism, with some significant antifungal compounds involved including antibiotics, volatile organic compounds, hydrogen cyanide and lytic enzymes. Isolation of pathogen-suppressive microorganisms from the soil is time consuming and tedious. We established a simple method for direct isolation of soil microbes (bacteria and fungi) that suppress fungal phytopathogens as well as procedures for confirmation of disease suppression. We will discuss such methods, which were so far tested with the cotton fungal pathogens Thielaviopsis basicola, Verticillium dahliae and Fusarium oxysporum and Verticillium fungicola. We have isolated a diversity of T. basicola-suppressive fungi and bacteria from two vastly different soil types. Identification of the antagonistic isolates revealed that they are a diverse lot, some belong to groups known to be suppressive of a wide range of fungal pathogens, endorsing the power of this technique to rapidly and directly isolate soil-borne microbes antagonistic to a wide variety of fungal pathogens.

  9. Veterinary drug residues in meat: Concerns and rapid methods for detection.

    Science.gov (United States)

    Reig, Milagro; Toldrá, Fidel

    2008-01-01

    The use of substances having hormonal or thyreostatic action as well as β-agonists is banned in the European Union. However, sometimes forbidden drugs may be added to feeds for illegal administration to farm animals for promoting increased muscle development or increased water retention and thus obtain an economical benefit. The result is a fraudulent overweight of meat but, what is worse, residues of these substances may remain in meat and may pose a real threat to the consumer either through exposure to the residues, transfer of antibiotic resistance or allergy risk. This has exerted a great concern among European consumers. The control of the absence of these forbidden substances in animal foods and feeds is regulated in the European Union by Directive96/23/EC on measures to monitor certain substances and residues in live animals and animal products. Analytical methodology, including criteria for identification and confirmation, for the monitoring of compliance was also given in Decisions 93/256/EEC and 93/257/EEC. More recently, Decision 2002/657/EC provided rules for the analytical methods to be used in testing of official samples. A crucial step is the screening of veterinary drug residues in live animals, feeds and animal products in view of the remarkable number of samples and large variety of residues to be analysed. In recent years, different rapid methods having easy performance, high sensitivity and high throughput have been proposed and are being extensively used. These methods as well as other new methods are reviewed in this manuscript.

  10. Right to privacy and some methods of direct marketing

    Directory of Open Access Journals (Sweden)

    Hana Kelblová

    2013-01-01

    Full Text Available Promotion constitutes part of the marketing mix which consists of advertising, sales support, public relations, personal sale and direct marketing. It may be stated that the law delimits boundaries to all these elements of the communication mix. In the following contribution I will only focus on some methods of direct marketing and I intend to investigate the “purposeful appeal to purchase and consumer behaviour of clients” as viewed by the present Czech law. These communications often disturb the privacy of individuals, harass in an inappropriate time, marketing companies often illegally collect and share customers’ personal information. My target is to list legal limits instituted in the sphere of direct marketing for the individual marketing practices by the Czech law.

  11. Additive manufacturing technologies 3D printing, rapid prototyping, and direct digital manufacturing

    CERN Document Server

    Gibson, Ian; Stucker, Brent

    2015-01-01

    This book covers in detail the various aspects of joining materials to form parts. A conceptual overview of rapid prototyping and layered manufacturing is given,  beginning with the fundamentals so that readers can get up to speed quickly. Unusual and emerging applications such as micro-scale manufacturing, medical applications, aerospace, and rapid manufacturing are also discussed. This book provides a comprehensive overview of rapid prototyping technologies as well as support technologies such as software systems, vacuum casting, investment casting, plating, infiltration and other systems. This book also: Reflects recent developments and trends and adheres to the ASTM, SI, and other standards Includes chapters on automotive technology, aerospace technology and low-cost AM technologies Provides a broad range of technical questions to ensure comprehensive understanding of the concepts covered  

  12. Quantitative methods to direct exploration based on hydrogeologic information

    Science.gov (United States)

    Graettinger, A.J.; Lee, J.; Reeves, H.W.; Dethan, D.

    2006-01-01

    Quantitatively Directed Exploration (QDE) approaches based on information such as model sensitivity, input data covariance and model output covariance are presented. Seven approaches for directing exploration are developed, applied, and evaluated on a synthetic hydrogeologic site. The QDE approaches evaluate input information uncertainty, subsurface model sensitivity and, most importantly, output covariance to identify the next location to sample. Spatial input parameter values and covariances are calculated with the multivariate conditional probability calculation from a limited number of samples. A variogram structure is used during data extrapolation to describe the spatial continuity, or correlation, of subsurface information. Model sensitivity can be determined by perturbing input data and evaluating output response or, as in this work, sensitivities can be programmed directly into an analysis model. Output covariance is calculated by the First-Order Second Moment (FOSM) method, which combines the covariance of input information with model sensitivity. A groundwater flow example, modeled in MODFLOW-2000, is chosen to demonstrate the seven QDE approaches. MODFLOW-2000 is used to obtain the piezometric head and the model sensitivity simultaneously. The seven QDE approaches are evaluated based on the accuracy of the modeled piezometric head after information from a QDE sample is added. For the synthetic site used in this study, the QDE approach that identifies the location of hydraulic conductivity that contributes the most to the overall piezometric head variance proved to be the best method to quantitatively direct exploration. ?? IWA Publishing 2006.

  13. Direct methods for limit states in structures and materials

    CERN Document Server

    Weichert, Dieter

    2014-01-01

    Knowing the safety factor for limit states such as plastic collapse, low cycle fatigue or ratcheting is always a major design consideration for civil and mechanical engineering structures that are subjected to loads. Direct methods of limit or shakedown analysis that proceed to directly find the limit states offer a better alternative than exact time-stepping calculations as, on one hand, an exact loading history is scarcely known, and on the other they are much less time-consuming. This book presents the state of the art on various topics concerning these methods, such as theoretical advances in limit and shakedown analysis, the development of relevant algorithms and computational procedures, sophisticated modeling of inelastic material behavior like hardening, non-associated flow rules, material damage and fatigue, contact and friction, homogenization and composites.

  14. The scope of application of incremental rapid prototyping methods in foundry engineering

    Directory of Open Access Journals (Sweden)

    M. Stankiewicz

    2010-01-01

    Full Text Available The article presents the scope of application of selected incremental Rapid Prototyping methods in the process of manufacturing casting models, casting moulds and casts. The Rapid Prototyping methods (SL, SLA, FDM, 3DP, JS are predominantly used for the production of models and model sets for casting moulds. The Rapid Tooling methods, such as: ZCast-3DP, ProMetalRCT and VoxelJet, enable the fabrication of casting moulds in the incremental process. The application of the RP methods in cast production makes it possible to speed up the prototype preparation process. This is particularly vital to elements of complex shapes. The time required for the manufacture of the model, the mould and the cast proper may vary from a few to several dozen hours.

  15. A rapid and robust method for simultaneously measuring changes in the phytohormones ABA, JA and SA in plants following biotic and abiotic stress

    Directory of Open Access Journals (Sweden)

    Mansfield John W

    2008-06-01

    Full Text Available Abstract We describe an efficient method for the rapid quantitative determination of the abundance of three acidic plant hormones from a single crude extract directly by LC/MS/MS. The method exploits the sensitivity of MS and uses multiple reaction monitoring and isotopically labelled samples to quantify the phytohormones abscisic acid, jasmonic acid and salicylic acid in Arabidopsis leaf tissue.

  16. A rapid and robust method for simultaneously measuring changes in the phytohormones ABA, JA and SA in plants following biotic and abiotic stress.

    OpenAIRE

    Forcat, S; Bennett, M; Mansfield, J; Grant, M

    2008-01-01

    Abstract We describe an efficient method for the rapid quantitative determination of the abundance of three acidic plant hormones from a single crude extract directly by LC/MS/MS. The method exploits the sensitivity of MS and uses multiple reaction monitoring and isotopically labelled samples to quantify the phytohormones abscisic acid, jasmonic acid and salicylic acid in Arabidopsis leaf tissue.

  17. CALCULATION OF COMPANY COSTS THROUGH THE DIRECT-COSTING CALCULATION METHOD

    Directory of Open Access Journals (Sweden)

    Florin-Constantin DIMA

    2013-06-01

    Full Text Available The cost of production has as its starting point the purchase cost of raw materials and consumables, as well as their processing cost and the calculation of the production cost involves complex aspects. This article is based on the two major concepts of costs calculation, namely the concept of full costs and the concept of partial costs, and it analyses the direct-costing calculation method. Necessity of the Development of calculation methods to ensure rapid determination of the cost of production, and the establishment of indicators broad spectrum of information necessary for making decisions to streamline a business activity conducted by direct-costing method. Direct-costing method appeared in the U.S. for the first time in 1934 (applied by Jonathan Harris and G. Charter Harrison. Subsequently, this method was applied to European countries (England, France, Germany etc.. We stopped on this method because it is considered a modern method of costing. Therefore, we analyzed both advantages and limitations of the method in question

  18. Discrete Direct Methods in the Fractional Calculus of Variations

    OpenAIRE

    Pooseh, Shakoor; Almeida, Ricardo; Torres, Delfim F. M.

    2012-01-01

    Finite differences, as a subclass of direct methods in the calculus of variations, consist in discretizing the objective functional using appropriate approximations for derivatives that appear in the problem. This article generalizes the same idea for fractional variational problems. We consider a minimization problem with a Lagrangian that depends on the left Riemann– Liouville fractional derivative. Using the Gr¨unwald–Letnikov definition, we approximate the objective functional in...

  19. The present state and future directions of PDF methods

    Science.gov (United States)

    Pope, S. B.

    1992-01-01

    The objectives of the workshop are presented in viewgraph format, as is this entire article. The objectives are to discuss the present status and the future direction of various levels of engineering turbulence modeling related to Computational Fluid Dynamics (CFD) computations for propulsion; to assure that combustion is an essential part of propulsion; and to discuss Probability Density Function (PDF) methods for turbulent combustion. Essential to the integration of turbulent combustion models is the development of turbulent model, chemical kinetics, and numerical method. Some turbulent combustion models typically used in industry are the k-epsilon turbulent model, the equilibrium/mixing limited combustion, and the finite volume codes.

  20. Direct Methods in Developing Students' Speaking Skills in Form 6

    OpenAIRE

    Circene, Jeļena

    2008-01-01

    Speaking skill is regarded to be one of the basic measures of knowing a language, and foreign language learners often find speaking as the most important skill they can acquire in foreign language learning. The task of English language teacher is to develop speaking skills of the students using different methods. The aim of the Diploma Paper is to explore the use of Direct Methods in developing speaking skills in basic school. The present research is conducted on the basis of a case study,...

  1. A direct method of measuring femoral anteversion using ultrasound.

    Science.gov (United States)

    Moulton, A; Upadhyay, S S

    1982-01-01

    The measurements of the angle of anteversion of the femoral neck by ultrasound scanning is described. The method was compared with direct measurement in 30 dried femora, and was then used in 18 normal volunteers and eight patients. The method is non-invasive, accurate and easily applicable. Findings in normal subjects included variation of the angle of anteversion from 10 to 34 degrees with a maximal difference between sides of six degrees. The expected rotational deformity of the femur was found in patients with unilateral intoeing.

  2. Method of operating a direct dme fuel cell system

    DEFF Research Database (Denmark)

    2011-01-01

    The present invention relates to a method of operating a fuel cell system comprising one or more fuel cells with a proton exchange membrane, wherein the membrane is composed of a polymeric material comprising acid-doped polybenzimidazole (PBI). The method comprises adjusting the operating...... temperature of the fuel cell to between 120 and 250 degrees C, supplying an oxidant stream to the cathode, and supplying a humidified fuel stream to the anode, said fuel stream comprising dimethyl ether, wherein dimethyl ether is directly oxidised at the anode....

  3. Evaluation of two methods of rapid blood-glucose monitoring by unskilled personnel during surgery

    DEFF Research Database (Denmark)

    Madsbad, S; Adelhøj, B; Bigler, Dennis Richard

    1984-01-01

    The accuracy of two rapid methods of blood-glucose monitoring without (Haemo-glucotest 1-44) and with a reflectance meter (Hypocount B) was compared using a laboratory method. The assessment was carried out by personnel with no previous experience in measuring blood glucose. Eighty-five percent o...

  4. A rapid and convenient method for preparing salt-free (. gamma. -/sup 32/P)ATP

    Energy Technology Data Exchange (ETDEWEB)

    Palmer, J.L.; Avruch, J.

    1981-09-15

    (..gamma..-/sup 32/P)ATP is prepared by an existing enzymatic method that yields approximately 95% incorporation of /sup 32/P into ATP. A rapid and convenient method for purifying the (..gamma..-/sup 32/P)ATP which results in a product free of both salt and buffer is reported.

  5. High performance liquid chromatography method for rapid and accurate determination of homocysteine in plasma and serum

    DEFF Research Database (Denmark)

    Vester, Birte; Rasmussen, K

    1991-01-01

    Determination of homocysteine in plasma or serum for evaluation of cobalamin and folate deficiency is becoming an important diagnostic procedure. Accurate, rapid and low cost methods for measuring homocysteine are therefore required. We have improved an HPLC method and made it suitable for clinical...

  6. Sap-direct RT-PCR for the rapid detection of coleus blumei viroids of the genus Coleviroid from natural host plants.

    Science.gov (United States)

    Jiang, Dongmei; Wu, Zujian; Xie, Lianhui; Sano, Teruo; Li, Shifang

    2011-06-01

    A simple and fast sap-direct RT-PCR (reverse transcription-polymerase chain reaction) for the rapid detection of 3 viroids of the genus Coleviroid is presented. The templates for cDNA synthesis were obtained directly from the sap of coleus using a pipettor, a common tool in molecular biology laboratories, and 3 coleus blumei viroids (CbVds) were detected simultaneously using a pair of universal primers designed according to sequences in the central conserved region (CCR) of CbVds. RT-PCR results demonstrated that CbVd-1, CbVd-5, and CbVd-6 can be detected accurately in viroid-infected plants but not in viroid-free plants. The results of RT-PCR, dot-blot, sequencing, and batch-detection revealed that this method can be used to identify CbVds rapidly. The method also reduces cross-contamination among different samples to a minimum. It is considered that this rapid and simple technique is an effective method for the identification and cloning of CbVds. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  7. A rapid method to determine sterol, erythrodiol, and uvaol concentrations in olive oil.

    Science.gov (United States)

    Mathison, Brian; Holstege, Dirk

    2013-05-15

    A rapid, accurate, and efficient method for determining the sterol, uvaol, and erythrodiol concentrations was developed to meet International Olive Council (IOC) certification criteria for extra virgin olive oil (EVOO). The unsaponifiable fraction of the sample (0.2 g) was separated with a diatomaceous earth column, and the sterol and triterpenic dialcohols were isolated with a novel base-activated silica solid-phase extraction (SPE) cartridge cleanup protocol. The improved method and the IOC method provided identical pass/fail results (n = 34) for each of the six sterol and erythrodiol/uvaol IOC criteria used to assess olive oil. This method was validated, and recoveries of stigmasterol (88%) and β-sitosterol (84%) were greater than previously published values obtained using the IOC method. This method requires approximately one-third the time required to complete the IOC method and has great utility for the rapid screening of EVOO to detect adulteration, false labeling, and an inferior product.

  8. HPLC method for rapidly following biodiesel fuel transesterification reaction progress using a core-shell column

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Samuel J.; Ott, Lisa S. [California State University, Chico, CA (United States)

    2012-07-15

    There are a wide and growing variety of feedstocks for biodiesel fuel. Most commonly, these feedstocks contain triglycerides which are transesterified into the fatty acid alkyl esters (FAAEs) which comprise biodiesel fuel. While the tranesterification reaction itself is simple, monitoring the reaction progress and reaction products is not. Gas chromatography-mass spectrometry is useful for assessing the FAAE products, but does not directly address either the tri-, di-, or monoglycerides present from incomplete transesterification or the free fatty acids which may also be present. Analysis of the biodiesel reaction mixture is complicated by the solubility and physical property differences among the components of the tranesterification reaction mixture. In this contribution, we present a simple, rapid HPLC method which allows for monitoring all of the main components in a biodiesel fuel transesterification reaction, with specific emphasis on the ability to monitor the reaction as a function of time. The utilization of a relatively new, core-shell stationary phase for the HPLC column allows for efficient separation of peaks with short elution times, saving both time and solvent. (orig.)

  9. A method for the rapid detection and identification of halo blight pathogen on common bean

    Directory of Open Access Journals (Sweden)

    Popović Tatjana

    2014-01-01

    Full Text Available A diagnostic method based on nested-PCR, followed by ELISA and conventional bacteriology tests, for the rapid and reliable detection of halo blight pathogen Pseudomonas savastanoi pv. phaseolicola (Psp collected from infected bean leaves and seeds is described. Psp formed white, small and flat colonies on nutrient agar medium, creamy white, flat and circular on Milk-Tween agar medium and light yellow, convex and shiny on modified sucrose peptone agar medium. Eighteen Gram-negative, catalase-positive and oxidase-negative strains were subjected to nested PCR with primers P 5.1/P 3.1 and P 5.2/P 3.2, which directed the amplification of the 450 bp target DNA fragment in all tested strains. According to the results of DAS- and PTA-ELISA with respect to reactivity to specific antibodies, all analyzed strains belonged to Psp bacterium. Pathogenicity was tested on bean pods and cotyledon leaves, on which greasy spots were formed. Psp did not cause hypersensitive reaction on the leaves of tobacco and geranium. Strains produced levan, fluorescent pigment, oxidative metabolism of glucose, did not reduce nitrate, did not produce indole and H2S, did not hydrolyze starch, gelatin and esculin; they produced acid from glucose, mannose, sucrose and glycerol, and did not produce acid from maltose, starch, esculin, dulcite, sorbitol, inositol and erythritol.

  10. Rapid determination of benzodiazepines, zolpidem and their metabolites in urine using direct injection liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Jeong, Yu-Dong; Kim, Min Kyung; Suh, Sung Ill; In, Moon Kyo; Kim, Jin Young; Paeng, Ki-Jung

    2015-12-01

    Benzodiazepines and zolpidem are generally prescribed as sedative, hypnotics, anxiolytics or anticonvulsants. These drugs, however, are frequently misused in drug-facilitated crime. Therefore, a rapid and simple liquid chromatography-tandem mass spectrometric (LC-MS/MS) method was developed for identification and quantification of benzodiazepines, zolpidem and their metabolites in urine using deuterium labeled internal standards (IS). Urine samples (120 μL) mixed with 80 μL of the IS solution were centrifuged. An aliquot (5 μL) of the sample solution was directly injected into the LC-MS/MS system for analysis. The mobile phases consisted of water and acetonitrile containing 2mM ammonium trifluoroacetate and 0.2% acetic acid. The analytical column was a Zorbax SB-C18 (100 mm × 2.1 mm i.d., 3.5 μm, Agilent). The separation and detection of 18 analytes were achieved within 10 min. Calibration curves were linear over the concentration ranges of 0.5-20 ng/mL (zolpidem), 1.0-40 ng/mL (flurazepam and temazepam), 2.5-100 ng/mL (7-aminoclonazepam, 1-hydroxymidazolam, midazolam, flunitrazepam and alprazolam), 5.0-200 ng/mL (zolpidem phenyl-4-carboxylic acid, α-hydroxyalprazolam, oxazepam, nordiazepam, triazolam, diazepam and α-hydroxytriazolam), 10-400 ng/mL (lorazepam and desalkylflurazepam) and 10-100 ng/mL (N-desmethylflunitrazepam) with the coefficients of determination (r(2)) above 0.9971. The dilution integrity of the analytes was examined for supplementation of short linear range. Dilution precision and accuracy were tested using two, four and ten-folds dilutions and they ranged from 3.7 to 14.4% and -12.8 to 12.5%, respectively. The process efficiency for this method was 63.0-104.6%. Intra- and inter-day precisions were less than 11.8% and 9.1%, while intra- and inter-day accuracies were less than -10.0 to 8.2%, respectively. The lower limits of quantification were lower than 10 ng/mL for each analyte. The applicability of the developed method was successfully

  11. Comparison of Rice Direct Seeding Methods (Mechanical and Manual with Transplanting Method

    Directory of Open Access Journals (Sweden)

    A Eyvani

    2014-04-01

    Full Text Available The main method of rice planting in Iran is transplanting. Due to poor mechanization of rice production, this method is laborious and costly. The other method is direct seeding in wet lands which is performed in the one third of rice cultivation area of the world. The most important problem in this method is high labor requirement of weed control. In order to compare the different rice planting methods (direct drilling, transplanting, and seed broadcasting a manually operated rice direct seeder (drum seeder was designed and fabricated. The research was conducted using a randomized complete block design with three treatments and three replications. Required draft force, field efficiency, effective field capacity, yield, and yield components were measured and the treatments were compared economically. Results showed that there were significant differences among the treatments from the view point of rice yield at the confidence level of 95% i.e. the transplanting method had the maximum yield. A higher rice yield was obtained from the direct seeder compared to the manual broadcasting method but, the difference between these two methods for crop yield was not significant even at the confidence level of the 95%. The coefficient of variation of seed distribution with direct seeding was more than 20%. The labor and time requirements per hectare reduced to 7 and 20 times, respectively when comparing the newly designed direct seeder with the transplanting method. The direct seeding method had the highest benefit to cost ratio in spite of its lower yield. Therefore, this method could be recommended in the rice growing regions.

  12. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens.

    Science.gov (United States)

    Valderrama, Wladir B; Dudley, Edward G; Doores, Stephanie; Cutter, Catherine N

    2016-07-03

    Generally, the enumeration and isolation of food-borne pathogens is performed using culture-dependent methods. These methods are sensitive, inexpensive, and provide both qualitative and quantitative assessment of the microorganisms present in a sample, but these are time-consuming. For this reason, researchers are developing new techniques that allow detection of food pathogens in shorter period of time. This review identifies commercially available methods for rapid detection and quantification of Listeria monocytogenes, Salmonella spp., Staphylococcus aureus, and Shiga toxin-producing Escherichia coli in food samples. Three categories are discussed: immunologically based methods, nucleic acid-based assays, and biosensors. This review describes the basic mechanism and capabilities of each method, discusses the difficulties of choosing the most convenient method, and provides an overview of the future challenges for the technology for rapid detection of microorganisms.

  13. Rapid identification of a Mycobacterium tuberculosis full genetic drug resistance profile through whole genome sequencing directly from sputum

    Directory of Open Access Journals (Sweden)

    Camus Nimmo

    2017-09-01

    Discussion: Compared to rapid molecular tests (which can only examine a limited number of mutations and WGS of culture isolates (which requires a culture step, WGS directly from sputum can quickly generate a complete genetic drug resistance profile. In this case, WGS altered the clinical management of drug-resistant tuberculosis and demonstrated potential for guiding individualized drug treatment where second-line drug resistance is common.

  14. Rapid high temperature field test method for evaluation of geothermal calcite scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1982-08-01

    A test method is described which allows the rapid field testing of calcite scale inhibitors in high- temperature geothermal brines. Five commercial formulations, chosen on the basis of laboratory screening tests, were tested in brines with low total dissolved solids at ca 500 F. Four were found to be effective; of these, 2 were found to be capable of removing recently deposited scale. One chemical was tested in the full-flow brine line for 6 wks. It was shown to stop a severe surface scaling problem at the well's control valve, thus proving the viability of the rapid test method. (12 refs.)

  15. A direct sampling method for inverse electromagnetic medium scattering

    KAUST Repository

    Ito, Kazufumi

    2013-09-01

    In this paper, we study the inverse electromagnetic medium scattering problem of estimating the support and shape of medium scatterers from scattered electric/magnetic near-field data. We shall develop a novel direct sampling method based on an analysis of electromagnetic scattering and the behavior of the fundamental solution. It is applicable to a few incident fields and needs only to compute inner products of the measured scattered field with the fundamental solutions located at sampling points. Hence, it is strictly direct, computationally very efficient and highly robust to the presence of data noise. Two- and three-dimensional numerical experiments indicate that it can provide reliable support estimates for multiple scatterers in the case of both exact and highly noisy data. © 2013 IOP Publishing Ltd.

  16. Depth-prediction method for direct laser-scribing processes

    Science.gov (United States)

    Canteli, D.; García-Ballesteros, J. J.; Molpeceres, C.; Gandía, J. J.; Torres, I.

    2017-11-01

    Many semiconductor technologies require the patterning of films to create features not easily achieved during growth or deposition. In the case of transparent conductive oxides (TCOs), this is typically realized through direct laser-scribing. Although there are models conceived to predict the depth of a scribe, the necessary parameters to obtain a given depth are usually found by trial and error. This is mostly due to the models usually being highly elaborated and dependent on difficult to measure variables. In this paper we introduce a method for predicting the ablation depth in direct laser-scribing processes based on laser-processing parameters and convenient properties like the ablation threshold fluence and the laser penetration depth. In order to apply this method though, the materials must comply with two conditions: a) the material does not develop incubation with successive pulses and b) the ablation depth obtained at any position by a single pulse is determined by the fluence reaching that point. We present experimental data using nanosecond sources and a wavelength of 355 nm for TCOs Indium doped Tin Oxide and Aluminum doped Zinc Oxide that endorse the proposed method as a tool for predicting the ablated depth in laser scribes.

  17. A photoacoustic imaging reconstruction method based on directional total variation with adaptive directivity.

    Science.gov (United States)

    Wang, Jin; Zhang, Chen; Wang, Yuanyuan

    2017-05-30

    In photoacoustic tomography (PAT), total variation (TV) based iteration algorithm is reported to have a good performance in PAT image reconstruction. However, classical TV based algorithm fails to preserve the edges and texture details of the image because it is not sensitive to the direction of the image. Therefore, it is of great significance to develop a new PAT reconstruction algorithm to effectively solve the drawback of TV. In this paper, a directional total variation with adaptive directivity (DDTV) model-based PAT image reconstruction algorithm, which weightedly sums the image gradients based on the spatially varying directivity pattern of the image is proposed to overcome the shortcomings of TV. The orientation field of the image is adaptively estimated through a gradient-based approach. The image gradients are weighted at every pixel based on both its anisotropic direction and another parameter, which evaluates the estimated orientation field reliability. An efficient algorithm is derived to solve the iteration problem associated with DDTV and possessing directivity of the image adaptively updated for each iteration step. Several texture images with various directivity patterns are chosen as the phantoms for the numerical simulations. The 180-, 90- and 30-view circular scans are conducted. Results obtained show that the DDTV-based PAT reconstructed algorithm outperforms the filtered back-projection method (FBP) and TV algorithms in the quality of reconstructed images with the peak signal-to-noise rations (PSNR) exceeding those of TV and FBP by about 10 and 18 dB, respectively, for all cases. The Shepp-Logan phantom is studied with further discussion of multimode scanning, convergence speed, robustness and universality aspects. In-vitro experiments are performed for both the sparse-view circular scanning and linear scanning. The results further prove the effectiveness of the DDTV, which shows better results than that of the TV with sharper image edges and

  18. Multiple-image shearography: a direct method to determine curvatures.

    Science.gov (United States)

    Tay, C J; Toh, S L; Shang, H M; Lin, Q Y

    1995-05-01

    We present a modified method of shearography, known herein as multiple-image shearography, whereby the curvatures of an object can be measured directly from the resulting fringes. It employs an image-shearing camera that produces three sheared images simultaneously to interfere with each other in the image plane. When film is doubly exposed before and after an object is deformed, three sets of fringes are observed of which one set would depict the second-order derivatives of surface displacement.The theory of the multiple-image shearography technique and its application to curvature measurements in plate bending are presented.

  19. Direct estimation of diffuse gaseous emissions from coal fires: current methods and future directions

    Science.gov (United States)

    Engle, Mark A.; Olea, Ricardo A.; O'Keefe, Jennifer M. K.; Hower, James C.; Geboy, Nicholas J.

    2013-01-01

    Coal fires occur in nature spontaneously, contribute to increases in greenhouse gases, and emit atmospheric toxicants. Increasing interest in quantifying coal fire emissions has resulted in the adaptation and development of specialized approaches and adoption of numerical modeling techniques. Overview of these methods for direct estimation of diffuse gas emissions from coal fires is presented in this paper. Here we take advantage of stochastic Gaussian simulation to interpolate CO2 fluxes measured using a dynamic closed chamber at the Ruth Mullins coal fire in Perry County, Kentucky. This approach allows for preparing a map of diffuse gas emissions, one of the two primary ways that gases emanate from coal fires, and establishing the reliability of the study both locally and for the entire fire. Future research directions include continuous and automated sampling to improve quantification of gaseous coal fire emissions.

  20. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors...... originating from two distinct research environments. Evaluations are performed on the same nine pâté products and within the same period of time. Results are analysed configurationally (graphically) as well as with RV coefficients, semantically and practically. Parametric bootstrapped confidence ellipses...

  1. Spectrophotometric and direct-reading methods for the analysis of gas phase peroxyacetic acid.

    Science.gov (United States)

    Effkemann, S; Brødsgaard, S; Mortensen, P; Linde, S A; Karst, U

    2000-02-01

    A new method for the determination of peroxyacetic acid (PAA) in gas phase samples is described. It is based on the oxidation of ABTS (2,2'-azino-bis(3-ethylbenzothiazoline)-6-sulfonate) by PAA with formation of a radical cation which is characterized by four strong absorption maxima between 405 nm and 810 nm. These allow for sensitive spectrophotometric determination of the peracid. The selectivity of the method towards hydrogen peroxide is strongly dependent on the sampling method used. Impinger sampling and sampling based on the use of coated solid sorbents (test tubes) was performed. Limits of detection are 10(-8) mol, limits of quantification are 5 x 10(-8) mol, the linear range consists of 1.5 concentration decades in both cases. Using ABTS-coated test tubes above 1 x 10(-7) mol, direct reading of the results is possible and may be used as rapid screening method for the PAA concentration.

  2. Improvements in fast-neutron spectroscopy methods (1961); Amelioration des methodes de spectrometrie des neutrons rapides (1961)

    Energy Technology Data Exchange (ETDEWEB)

    Cambou, F. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1961-02-15

    This research aimed at improving fast-neutron electronic detectors based on n-p elastic scattering. The first part concerns proportional counters; careful constructional methods have made it possible to plot mono-energetic neutron spectra in the range 700 keV - 3 MeV with a resolution of 7 per cent. The second part concerns scintillation counters: an organic scintillator and an inorganic scintillator covered with a thin layer of a scattering agent. An exact study of the types of scintillation has made it possible to develop efficient discriminator circuits. Different neutron spectra plotted in the presence of a strong gamma background are presented. The last part deals with the development of form discrimination methods for the study, in the actual beam, of the elastic scattering of 14.58 MeV electrons. With hydrogen, the distribution f ({phi}) of the recoil protons is f({phi}) = 1 + 0.034 cos {phi} + 0.042 cos{sup 2} {phi}. With tritium the scattering is strongly anisotropic; the curve representing the variation of the differential cross-section for the elastic scattering in the centre of mass system is obtained with a target containing 1 cm{sup 3} of tritium. (author) [French] Le travail a porte sur l'amelioration des detecteurs electroniques de neutrons rapides bases sur la diffusion elastique n-p. La premiere partie est relative aux compteurs proportionnels; des methodes soignees de fabrication ont permis des traces de spectres de neutrons monoenergetiques dans le domaine 700 keV - 3 MeV avec une resolution de 7 pour cent. La deuxieme partie est relative au compteur a scintillations; scintillateur organique et scintillateur mineral recouvert d'un diffuseur mince. Une etude precise des formes de scintillations a permis la mise au point de circuits discriminateurs efficaces. Differents spectres de neutrons traces en presence d'un fond gamma intense sont presentes. La derniere partie est relative a la mise en oeuvre des methodes de discrimination de

  3. A rapid method for soil cement design : Louisiana slope value method.

    Science.gov (United States)

    1964-03-01

    The current procedure used by the Louisiana Department of Highways for laboratory design of cement stabilized soil base and subbase courses is taken from standard AASHO test methods, patterned after Portland Cement Association criteria. These methods...

  4. Furuncular myiasis: a simple and rapid method for extraction of intact Dermatobia hominis larvae.

    Science.gov (United States)

    Boggild, Andrea K; Keystone, Jay S; Kain, Kevin C

    2002-08-01

    We report a case of furuncular myiasis complicated by Staphylococcus aureus infection and beta-hemolytic streptococcal cellulitis. The Dermatobia hominis larva that caused this lesion could not be extracted using standard methods, including suffocation and application of lateral pressure, and surgery was contraindicated because of cellulitis. The botfly maggot was completely and rapidly extracted with an inexpensive, disposable, commercial venom extractor.

  5. Collision-induced fragmentation accurate mass spectrometric analysis methods to rapidly characterize phytochemicals in plant extracts

    Science.gov (United States)

    The rapid advances in analytical chromatography equipment have made the reliable and reproducible measurement of a wide range of plant chemical components possible. Full chemical characterization of a given plant material is possible with the new mass spectrometers currently available. New methods a...

  6. Collaborative validation of a rapid method for efficient virus concentration in bottled water

    DEFF Research Database (Denmark)

    Schultz, Anna Charlotte; Perelle, Sylvie; Di Pasquale, Simona

    2011-01-01

    Enteric viruses, including norovirus (NoV) and hepatitis A virus (HAV), have emerged as a major cause of waterborne outbreaks worldwide. Due to their low infectious doses and low concentrations in water samples, an efficient and rapid virus concentration method is required for routine control. Th...

  7. A Rapid Method for Measuring Strontium-90 Activity in Crops in China

    Directory of Open Access Journals (Sweden)

    Pan Lingjing Pan

    2017-01-01

    Full Text Available A rapid method for measuring Sr-90 activity in crop ashes is presented. Liquid scintillation counting, combined with ion exchange columns 4‘, 4“(5“-di-t-butylcyclohexane-18-crown-6, is used to determine the activity of Sr-90 in crops. The yields of chemical procedure are quantified using gravimetric analysis. The conventional method that uses ion-exchange resin with HDEHP could not completely remove all the bismuth when comparatively large lead and bismuth exist in the samples. This is overcome by the rapid method. The chemical yield of this method is about 60% and the MDA for Sr-90 is found to be 2:32 Bq/kg. The whole procedure together with using spectrum analysis to determine the activity only takes about one day, which is really a large improvement compared with the conventional method. A modified conventional method is also described here to verify the value of the rapid one. These two methods can meet di_erent needs of daily monitoring and emergency situation.

  8. A Rapid Method for Measuring Strontium-90 Activity in Crops in China

    Science.gov (United States)

    Pan, Lingjing Pan; Yu, Guobing; Wen, Deyun; Chen, Zhi; Sheng, Liusi; Liu, Chung-King; Xu, X. George

    2017-09-01

    A rapid method for measuring Sr-90 activity in crop ashes is presented. Liquid scintillation counting, combined with ion exchange columns 4`, 4"(5")-di-t-butylcyclohexane-18-crown-6, is used to determine the activity of Sr-90 in crops. The yields of chemical procedure are quantified using gravimetric analysis. The conventional method that uses ion-exchange resin with HDEHP could not completely remove all the bismuth when comparatively large lead and bismuth exist in the samples. This is overcome by the rapid method. The chemical yield of this method is about 60% and the MDA for Sr-90 is found to be 2:32 Bq/kg. The whole procedure together with using spectrum analysis to determine the activity only takes about one day, which is really a large improvement compared with the conventional method. A modified conventional method is also described here to verify the value of the rapid one. These two methods can meet di_erent needs of daily monitoring and emergency situation.

  9. Considerations for Task Analysis Methods and Rapid E-Learning Development Techniques

    Directory of Open Access Journals (Sweden)

    Dr. Ismail Ipek

    2014-02-01

    Full Text Available The purpose of this paper is to provide basic dimensions for rapid training development in e-learning courses in education and business. Principally, it starts with defining task analysis and how to select tasks for analysis and task analysis methods for instructional design. To do this, first, learning and instructional technologies as visions of the future were discussed. Second, the importance of task analysis methods in rapid e-learning was considered, with learning technologies as asynchronous and synchronous e-learning development. Finally, rapid instructional design concepts and e-learning design strategies were defined and clarified with examples, that is, all steps for effective task analysis and rapid training development techniques based on learning and instructional design approaches were discussed, such as m-learning and other delivery systems. As a result, the concept of task analysis, rapid e-learning development strategies and the essentials of online course design were discussed, alongside learner interface design features for learners and designers.

  10. An economical and combined method for rapid and efficient isolation of fungal DNA.

    Science.gov (United States)

    Lech, T; Syguła-Cholewinska, J; Szostak-Kot, J

    2014-12-18

    DNA isolation is a crucial step of conducting genetic studies in any organism. However, this process is quite difficult when studying fungi because of the need to damage the fungal cell walls of specific structures. In this study, we developed a method for the rapid and efficient isolation of fungal DNA based on simultaneous mechanical and enzymatic cell wall degradation. There are several typical modifications of the standard phenol-chloroform DNA extraction method. This method can be modified to degrade the fungal cell wall. The first step of the presented DNA extraction included manual homogenization in modified lysis buffer. Next, enzymatic digestion using 2 enzymes was conducted, including lyticase and proteinase K. To carefully select the most favorable conditions, we developed an economical, rapid, and reliable method for fungal DNA extraction that ensures both high efficiency and proper purity, which are essential for further analyses.

  11. Rapid method for determination of carbonyl groups in lignin compounds by headspace gas chromatography.

    Science.gov (United States)

    Li, Jing; Hu, Hui-Chao; Chai, Xin-Sheng

    2015-07-24

    The paper reports on a novel method for rapid determination of carbonyl in lignins by headspace gas chromatography (HS-GC). The method involves the quantitative carbonyl reduction for aldehydes in 2min at room temperature or for acetones in 30min at 80°C by sodium borohydride solution in a closed headspace sample vial. After the reaction, the solution was acidified by injecting sulfuric acid solution and the hydrogen released to the headspace was determined by GC using thermal-conductivity detector. The results showed that with the addition of SiO2 powder, the reduction reaction of carbonyl groups can be greatly facilitated. The method has a good measurement precision (RSD<7.74%) and accuracy (relative error <10% compared with a reference method) in the carbonyl quantification. It is suitable to be used for rapid determination of carbonyl content in lignin and related materials. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Morphological evidence and direct estimates of rapid melting beneath Totten Glacier Ice Shelf, East Antarctica

    Science.gov (United States)

    Greenbaum, Jamin; Schroeder, Dustin; Grima, Cyril; Habbal, Feras; Dow, Christine; Roberts, Jason; Gwyther, David; van Ommen, Tas; Siegert, Martin; Blankenship, Donald

    2017-04-01

    Totten Glacier drains at least 3.5 meters of eustatic sea level potential from marine-based ice in the Aurora Subglacial Basin (ASB) in East Antarctica, more than the combined total of all glaciers in West Antarctica. Totten Glacier has been the most rapidly thinning glacier in East Antarctica since satellite altimetry time series began and the nature of the thinning suggests that it is driven by enhanced basal melting due to ocean processes. While grounded ice thinning rates have been steady, recent work has shown that Totten's floating ice shelf may not have the same thinning behavior; as a result, it is critical to observe ice shelf and cavity boundary conditions and basal processes to understand this apparent discrepancy. Warm Modified Circumpolar Deep Water (MCDW), which has been linked to glacier retreat in West Antarctica, has been observed in summer and winter on the nearby Sabrina Coast continental shelf and deep depressions in the seafloor provide access for MCDW to reach the ice shelf cavity. Given its northern latitude, numerical ice sheet modeling indicates that Totten Glacier may be prone to retreat caused by hydrofracture in a warming climate, so it is important to understand how intruding MCDW is affecting thinning of Totten Glacier's ice shelf. Here we use post-processed, focused airborne radar observations of the Totten Glacier Ice Shelf to delineate multi-km wide basal channels and flat basal terraces associated with high basal reflectivity and specularity (flatness) anomalies and correspondingly large ice surface depressions that indicate active basal melting. Using a simple temperature-attenuation model, and basal roughness corrections, we present basal melt rates associated with the radar reflection and specularity anomalies and compare them to those derived from numerical ocean circulation modeling and an ice flow divergence calculation. Sub-ice shelf ocean circulation modeling and under-ice robotic observations of Pine Island Glacier Ice

  13. Sensitivity assessment of direct method for diagnosis of Trichomonas vaginalis in comparison with Dorset Culture media

    Directory of Open Access Journals (Sweden)

    ebrahim badparva

    2010-04-01

    Full Text Available Trichomonas vaginalis is a flagellate protozoan that lives in the genital tract and causes trichomoniasis in women. About 200 million people all over the world are infected with T. vaginalis. There are various methods with different sensitivity and specificity for detection of this parasite, that one of them is direct smear of vaginal secretions which is simpler, rapid and cheaper than other diagnostic methods. Materials and Methods: Demographic data was gathered by a questionnaire which contained different variables. Vaginal secretions samples were taken by spicolum and two swaps that maintained in glucose solution in separate tubes from 160 women referred to health centers of Khorramabad. One of the vaginal samples was examined by direct smear in saline solution and the other was cultured in Dorse medium. Results: Of 160 women suspected of trichomoniasis, 11.8% and 18.75% were positive by direct smear and culture respectively. The sensitivity of the direct method was 63.3%. Our findings indicated that 30% of the infected women belonged to the 31 – 35 age group, which had the most relative frequency of positive cases. Most of the patients (43% were illiterate or had elementary educational level. Conclussion: The sensivity of direct method is 63% in compare to culture ( as a Gold standard , which is ralatively low . Although the efficacy of this test could be imporved by shortening the elapsed time between sampling and examination , use of skilled microscopists , and different samples , but we recommend that more sensitive methods such as culture and PCR should be used .

  14. A rapid screening with direct sequencing from blood samples for the diagnosis of Leigh syndrome

    Directory of Open Access Journals (Sweden)

    Hiroko Shimbo

    2014-01-01

    Full Text Available Large numbers of genes are responsible for Leigh syndrome (LS, making genetic confirmation of LS difficult. We screened our patients with LS using a limited set of 21 primers encompassing the frequently reported gene for the respiratory chain complexes I (ND1–ND6, and ND4L, IV(SURF1, and V(ATP6 and the pyruvate dehydrogenase E1α-subunit. Of 18 LS patients, we identified mutations in 11 patients, including 7 in mDNA (two with ATP6, 4 in nuclear (three with SURF1. Overall, we identified mutations in 61% of LS patients (11/18 individuals in this cohort. Sanger sequencing with our limited set of primers allowed us a rapid genetic confirmation of more than half of the LS patients and it appears to be efficient as a primary genetic screening in this cohort.

  15. Apparatus and method for rapid separation and detection of hydrocarbon fractions in a fluid stream

    Science.gov (United States)

    Sluder, Charles S.; Storey, John M.; Lewis, Sr., Samuel A.

    2013-01-22

    An apparatus and method for rapid fractionation of hydrocarbon phases in a sample fluid stream are disclosed. Examples of the disclosed apparatus and method include an assembly of elements in fluid communication with one another including one or more valves and at least one sorbent chamber for removing certain classifications of hydrocarbons and detecting the remaining fractions using a detector. The respective ratios of hydrocarbons are determined by comparison with a non separated fluid stream.

  16. Rapid qualitative research methods during complex health emergencies: A systematic review of the literature.

    Science.gov (United States)

    Johnson, Ginger A; Vindrola-Padros, Cecilia

    2017-09-01

    The 2013-2016 Ebola outbreak in West Africa highlighted both the successes and limitations of social science contributions to emergency response operations. An important limitation was the rapid and effective communication of study findings. A systematic review was carried out to explore how rapid qualitative methods have been used during global heath emergencies to understand which methods are commonly used, how they are applied, and the difficulties faced by social science researchers in the field. We also asses their value and benefit for health emergencies. The review findings are used to propose recommendations for qualitative research in this context. Peer-reviewed articles and grey literature were identified through six online databases. An initial search was carried out in July 2016 and updated in February 2017. The PRISMA checklist was used to guide the reporting of methods and findings. The articles were assessed for quality using the MMAT and AACODS checklist. From an initial search yielding 1444 articles, 22 articles met the criteria for inclusion. Thirteen of the articles were qualitative studies and nine used a mixed-methods design. The purpose of the rapid studies included: the identification of causes of the outbreak, and assessment of infrastructure, control strategies, health needs and health facility use. The studies varied in duration (from 4 days to 1 month). The main limitations identified by the authors were: the low quality of the collected data, small sample sizes, and little time for cross-checking facts with other data sources to reduce bias. Rapid qualitative methods were seen as beneficial in highlighting context-specific issues that need to be addressed locally, population-level behaviors influencing health service use, and organizational challenges in response planning and implementation. Recommendations for carrying out rapid qualitative research in this context included the early designation of community leaders as a point of

  17. RAPID AND EFFICIENT METHOD FOR ENVIRONMENTAL DNA EXTRACTION AND PURIFICATION FROM SOIL

    Directory of Open Access Journals (Sweden)

    J. Hamedi

    2016-06-01

    Full Text Available Large proportion of microbial population in the world is unculturable. Extraction of total DNA from soil is usually a crucial step considering to the difficulties of study the uncultivable microorganisms. Humic acid is considered as the main inhibitory agent in the environmental DNA studies. Here, we introduced a rapid and efficient method for DNA extraction and purification from soil. Yield of DNA extraction by the presented method was 130 ng/µl. Three conventional methods of DNA extraction including liquid nitrogen incursion, bead beating and sonication were performed as control methods. Yield of DNA extraction by these methods were 110, 90 and 50 ng/µl, respectively. A rapid and efficient one step DNA purification method was introduced instead of hazardous conventional phenol-chloroform methods. Humic acid removal percentage by the introduced method was 95.8 % that is comparable with 97 % gained by the conventional gel extraction method and yield of DNA after purification was 84 % and 73 %, respectively. This study could be useful in molecular ecology and metagenomics study as a fast and reliable method.

  18. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  19. [Development of a rapid test kit for antibody to HIV by nano immunomagnetic lateral flow method].

    Science.gov (United States)

    Yang, Fa-qing; Lee, Tony; Wang, Chao-nan; Sun, Shu-ye; Li, Shan-shan; Tian, Hui

    2010-06-01

    To develop a rapid test kit for antibody to HIV by nano immunomagnetic lateral flow method. A rapid test kit was developed by conjugation of the HIV antigen gp41 and gp36 to 200nm super paramagnetic particles by carbodiimide (EDC) and coating of the HIV antigen gp41 and gp36 to nitrocellulose membrane. Then the kit was evaluated with serials of experiments. The kit was qualified with examination of national reference panel of anti-HIV antibody for colloidal gold diagnostic kit. The sensitivity was 100% by tested with 20 HIV antibody positive sera, the specificity was 98.5% by tested with 600 HIV antibody negative sera, respectively. The stability of the kit was over 12 month by storage at room temperature. A diagnostic kit for antibody to HIV was developed with the advantages of convenience, rapid test, good stability and point of care.

  20. Direct analysis in real time mass spectrometry for the rapid identification of four highly hazardous pesticides in agrochemicals.

    Science.gov (United States)

    Wang, Lei; Zhao, Pengyue; Zhang, Fengzu; Li, Yanjie; Pan, Canping

    2012-08-30

    Direct analysis in real time (DART) is a new ion source technique, which is conducted in the open air under ambient conditions, applied to the rapid and direct analysis of any material (gases, liquids, and solids) with minimal or no sample preparation. In order to take advantage of the capacity of DART mass spectrometry for the real-time analysis of hazardous ingredients in commercial agrochemicals, a pilot study of rapid qualitative determination of hazardous pesticides was performed. Highly hazardous pesticides were identified by DART ionization coupled to a single-quadrupole mass spectrometer (DART-MS). Acetonitrile was chosen for dissolving samples prior to the analysis. Samples were analyzed by this technique in as little as 5 s. Phorate, carbofuran, ethoprophos and fipronil were be detected directly from commercial agrochemicals. The ionization-related parameters (DART temperature, grid voltage and MS fragment) of these compounds were optimized to obtain highly response. Isotope patterns were taken into consideration for qualitative identification. Relative standard deviations (RSDs, n = 5) of 2.3-15.0% were obtained by measuring the relative abundance of selected isotopes. This study showed that DART-MS technology was able to qualitatively determine the existence of highly hazardous pesticides in commercial pesticide formulations. It is suggested that this technology should be applied for routine monitoring in the market. Copyright © 2012 John Wiley & Sons, Ltd.

  1. Rapid culture-based methods for drug-resistance detection in Mycobacterium tuberculosis.

    Science.gov (United States)

    Palomino, Juan Carlos; Martin, Anandi; Von Groll, Andrea; Portaels, Francoise

    2008-10-01

    Tuberculosis still represents a major public health problem, especially in low-resource countries where the burden of the disease is more important. Multidrug-resistant and extensively drug drug-resistant tuberculosis constitute serious problems for the efficient control of the disease stressing the need to investigate resistance to first- and second-line drugs. Conventional methods for detecting drug-resistance in Mycobacterium tuberculosis are slow and cumbersome. The most commonly used proportion method on Löwenstein-Jensen medium or Middlebrook agar requires a minimum of 3-4 weeks to produce results. Several new approaches have been proposed in the last years for the rapid and timely detection of drug-resistance in tuberculosis. This review will address phenotypic culture-based methods for rapid drug susceptibility testing in M. tuberculosis.

  2. Rapid Column Extraction Method for Actinides and Sr-89/90 in Water Samples

    Energy Technology Data Exchange (ETDEWEB)

    MAXWELL III, SHERROD L.

    2005-06-15

    The SRS Environmental Laboratory analyzes water samples for environmental monitoring, including river water and ground water samples. A new, faster actinide and strontium 89/90 separation method has been developed and implemented to improve productivity, reduce labor costs and add capacity to this laboratory. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and Sr-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), curium (Cm) and thorium (Th) using a single multi-stage column combined with alpha spectrometry. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized. The method can be used for routine analysis or as a rapid method for emergency preparedness. Thorium and curium are often analyzed separately due to the interference of the daughter of Th-229 tracer, actinium (Ac)-225, on curium isotopes when measured by alpha spectrometry. This new method also adds a separation step using DGA Resin{reg_sign}, (Diglycolamide Resin, Eichrom Technologies) to remove Ac-225 and allow the separation and analysis of thorium isotopes and curium isotopes at the same time.

  3. Mycobacteria mobility shift assay: a method for the rapid identification of Mycobacterium tuberculosis and nontuberculous mycobacteria

    Directory of Open Access Journals (Sweden)

    Letícia Muraro Wildner

    2014-06-01

    Full Text Available The identification of mycobacteria is essential because tuberculosis (TB and mycobacteriosis are clinically indistinguishable and require different therapeutic regimens. The traditional phenotypic method is time consuming and may last up to 60 days. Indeed, rapid, affordable, specific and easy-to-perform identification methods are needed. We have previously described a polymerase chain reaction-based method called a mycobacteria mobility shift assay (MMSA that was designed for Mycobacterium tuberculosis complex (MTC and nontuberculous mycobacteria (NTM species identification. The aim of this study was to assess the MMSA for the identification of MTC and NTM clinical isolates and to compare its performance with that of the PRA-hsp65 method. A total of 204 clinical isolates (102 NTM and 102 MTC were identified by the MMSA and PRA-hsp65. For isolates for which these methods gave discordant results, definitive species identification was obtained by sequencing fragments of the 16S rRNA and hsp65 genes. Both methods correctly identified all MTC isolates. Among the NTM isolates, the MMSA alone assigned 94 (92.2% to a complex or species, whereas the PRA-hsp65 method assigned 100% to a species. A 91.5% agreement was observed for the 94 NTM isolates identified by both methods. The MMSA provided correct identification for 96.8% of the NTM isolates compared with 94.7% for PRA-hsp65. The MMSA is a suitable auxiliary method for routine use for the rapid identification of mycobacteria.

  4. Adapting and Evaluating a Rapid, Low-Cost Method to Enumerate Flies in the Household Setting.

    Science.gov (United States)

    Wolfe, Marlene K; Dentz, Holly N; Achando, Beryl; Mureithi, MaryAnne; Wolfe, Tim; Null, Clair; Pickering, Amy J

    2017-02-08

    Diarrhea is a leading cause of death among children under 5 years of age worldwide. Flies are important vectors of diarrheal pathogens in settings lacking networked sanitation services. There is no standardized method for measuring fly density in households; many methods are cumbersome and unvalidated. We adapted a rapid, low-cost fly enumeration technique previously developed for industrial settings, the Scudder fly grill, for field use in household settings. We evaluated its performance in comparison to a sticky tape fly trapping method at latrine and food preparation areas among households in rural Kenya. The grill method was more sensitive; it detected the presence of any flies at 80% (433/543) of sampling locations versus 64% (348/543) of locations by the sticky tape. We found poor concordance between the two methods, suggesting that standardizing protocols is important for comparison of fly densities between studies. Fly species identification was feasible with both methods; however, the sticky tape trap allowed for more nuanced identification. Both methods detected a greater presence of bottle flies near latrines compared with food preparation areas (P < 0.01). The grill method detected more flies at the food preparation area compared with near the latrine (P = 0.014) while the sticky tape method detected no difference. We recommend the Scudder grill as a sensitive fly enumeration tool that is rapid and low cost to implement. © The American Society of Tropical Medicine and Hygiene.

  5. Rapid and effective DNA extraction method with bead grinding for a large amount of fungal DNA.

    Science.gov (United States)

    Watanabe, M; Lee, K; Goto, K; Kumagai, S; Sugita-Konishi, Y; Hara-Kudo, Y

    2010-06-01

    To identify a rapid method for extracting a large amount of DNA from fungi associated with food hygiene, extraction methods were compared using fungal pellets formed rapidly in liquid media. Combinations of physical and chemical methods or commercial kits were evaluated with 3 species of yeast, 10 species of ascomycetous molds, and 4 species of zygomycetous molds. Bead grinding was the physical method, followed by chemical methods involving sodium dodecyl sulfate (SDS), cetyl trimethyl ammonium bromide (CTAB), and benzyl chloride and two commercial kits. Quantity was calculated by UV absorbance at 260 nm, quality was determined by the ratio of UV absorbance at 260 and 280 nm, and gene amplifications and electrophoresis profiles of whole genomes were analyzed. Bead grinding with the SDS method was the most effective for DNA extraction for yeasts and ascomycetous molds, and bead grinding with the CTAB method was most effective with zygomycetous molds. For both groups of molds, bead grinding with the CTAB method was the best approach for DNA extraction. Because this combination also is relatively effective for yeasts, it can be used to extract a large amount of DNA from a wide range of fungi. The DNA extraction methods are useful for developing gene indexes to identify fungi with molecular techniques, such as DNA fingerprinting.

  6. Mycobacteria mobility shift assay: a method for the rapid identification of Mycobacterium tuberculosis and nontuberculous mycobacteria.

    Science.gov (United States)

    Wildner, Letícia Muraro; Bazzo, Maria Luiza; Liedke, Susie Coutinho; Nogueira, Christiane Lourenço; Segat, Gabriela; Senna, Simone Gonçalves; Schlindwein, Aline Daiane; Oliveira, Jaquelline Germano de; Rovaris, Darcita B; Bonjardim, Claudio A; Kroon, Erna G; Ferreira, Paulo C P

    2014-06-01

    The identification of mycobacteria is essential because tuberculosis (TB) and mycobacteriosis are clinically indistinguishable and require different therapeutic regimens. The traditional phenotypic method is time consuming and may last up to 60 days. Indeed, rapid, affordable, specific and easy-to-perform identification methods are needed. We have previously described a polymerase chain reaction-based method called a mycobacteria mobility shift assay (MMSA) that was designed for Mycobacterium tuberculosis complex (MTC) and nontuberculous mycobacteria (NTM) species identification. The aim of this study was to assess the MMSA for the identification of MTC and NTM clinical isolates and to compare its performance with that of the PRA-hsp65 method. A total of 204 clinical isolates (102 NTM and 102 MTC) were identified by the MMSA and PRA-hsp65. For isolates for which these methods gave discordant results, definitive species identification was obtained by sequencing fragments of the 16S rRNA and hsp65 genes. Both methods correctly identified all MTC isolates. Among the NTM isolates, the MMSA alone assigned 94 (92.2%) to a complex or species, whereas the PRA-hsp65 method assigned 100% to a species. A 91.5% agreement was observed for the 94 NTM isolates identified by both methods. The MMSA provided correct identification for 96.8% of the NTM isolates compared with 94.7% for PRA-hsp65. The MMSA is a suitable auxiliary method for routine use for the rapid identification of mycobacteria.

  7. A rapid chromatographic method for quality control of technetium-99m-bicisate.

    Science.gov (United States)

    Amin, K C; Saha, G B; Go, R T

    1997-03-01

    The purpose of this work was to develop a simple and rapid method to determine the radiochemical purity of 99mTc-bicisate. A rapid paper chromatographic (PC) method was developed to determine the radiochemical purity of 99mTc-bicisate and compare the results with those of the manufacturer's recommended method. The present PC method included Whatman 3MM paper as the solid phase and ethyl acetate as the solvent. The time for chromatography by this technique was 4-5 min compared to about 23 min by the manufacturer's method. The Rf value of 99mTc-bicisate (Rf = 0.9-1.0) was widely different from those of 99mTcO4- and reduced 99mTc (Rf = 0.0 for both) so the chromatographic strip after development could be readily cut into two segments, in order to determine the labeling yield. No significant difference in labeling yields was found between the present method and the manufacturer's method. The PC method using Whatman 3MM paper and ethyl acetate is a simple and fast technique to determine the radiochemical purity of 99mTc-bicisate and may be substituted for the manufacturer's recommended method to save time.

  8. A copula method for modeling directional dependence of genes.

    Science.gov (United States)

    Kim, Jong-Min; Jung, Yoon-Sung; Sungur, Engin A; Han, Kap-Hoon; Park, Changyi; Sohn, Insuk

    2008-05-01

    Genes interact with each other as basic building blocks of life, forming a complicated network. The relationship between groups of genes with different functions can be represented as gene networks. With the deposition of huge microarray data sets in public domains, study on gene networking is now possible. In recent years, there has been an increasing interest in the reconstruction of gene networks from gene expression data. Recent work includes linear models, Boolean network models, and Bayesian networks. Among them, Bayesian networks seem to be the most effective in constructing gene networks. A major problem with the Bayesian network approach is the excessive computational time. This problem is due to the interactive feature of the method that requires large search space. Since fitting a model by using the copulas does not require iterations, elicitation of the priors, and complicated calculations of posterior distributions, the need for reference to extensive search spaces can be eliminated leading to manageable computational affords. Bayesian network approach produces a discretely expression of conditional probabilities. Discreteness of the characteristics is not required in the copula approach which involves use of uniform representation of the continuous random variables. Our method is able to overcome the limitation of Bayesian network method for gene-gene interaction, i.e. information loss due to binary transformation. We analyzed the gene interactions for two gene data sets (one group is eight histone genes and the other group is 19 genes which include DNA polymerases, DNA helicase, type B cyclin genes, DNA primases, radiation sensitive genes, repaire related genes, replication protein A encoding gene, DNA replication initiation factor, securin gene, nucleosome assembly factor, and a subunit of the cohesin complex) by adopting a measure of directional dependence based on a copula function. We have compared our results with those from other methods in the

  9. Rapid and Direct VHH and Target Identification by Staphylococcal Surface Display Libraries

    Directory of Open Access Journals (Sweden)

    Marco Cavallari

    2017-07-01

    Full Text Available Unbiased and simultaneous identification of a specific antibody and its target antigen has been difficult without prior knowledge of at least one interaction partner. Immunization with complex mixtures of antigens such as whole organisms and tissue extracts including tumoral ones evokes a highly diverse immune response. During such a response, antibodies are generated against a variety of epitopes in the mixture. Here, we propose a surface display design that is suited to simultaneously identify camelid single domain antibodies and their targets. Immune libraries of single-domain antigen recognition fragments from camelid heavy chain-only antibodies (VHH were attached to the peptidoglycan of Gram-positive Staphylococcus aureus employing its endogenous housekeeping sortase enzyme. The sortase transpeptidation reaction covalently attached the VHH to the bacterial peptidoglycan. The reversible nature of the reaction allowed the recovery of the VHH from the bacterial surface and the use of the VHH in downstream applications. These staphylococcal surface display libraries were used to rapidly identify VHH as well as their targets by immunoprecipitation (IP. Our novel bacterial surface display platform was stable under harsh screening conditions, allowed fast target identification, and readily permitted the recovery of the displayed VHH for downstream analysis.

  10. Rapid and Direct VHH and Target Identification by Staphylococcal Surface Display Libraries.

    Science.gov (United States)

    Cavallari, Marco

    2017-07-12

    Unbiased and simultaneous identification of a specific antibody and its target antigen has been difficult without prior knowledge of at least one interaction partner. Immunization with complex mixtures of antigens such as whole organisms and tissue extracts including tumoral ones evokes a highly diverse immune response. During such a response, antibodies are generated against a variety of epitopes in the mixture. Here, we propose a surface display design that is suited to simultaneously identify camelid single domain antibodies and their targets. Immune libraries of single-domain antigen recognition fragments from camelid heavy chain-only antibodies (VHH) were attached to the peptidoglycan of Gram-positive Staphylococcus aureus employing its endogenous housekeeping sortase enzyme. The sortase transpeptidation reaction covalently attached the VHH to the bacterial peptidoglycan. The reversible nature of the reaction allowed the recovery of the VHH from the bacterial surface and the use of the VHH in downstream applications. These staphylococcal surface display libraries were used to rapidly identify VHH as well as their targets by immunoprecipitation (IP). Our novel bacterial surface display platform was stable under harsh screening conditions, allowed fast target identification, and readily permitted the recovery of the displayed VHH for downstream analysis.

  11. Direct loading of polymer matrices in plastic microchips for rapid DNA analysis: a comparative study.

    Science.gov (United States)

    Hurth, Cedric; Gu, Jian; Aboud, Maurice; Estes, Matthew D; Nordquist, Alan R; McCord, Bruce; Zenhausern, Frederic

    2012-08-01

    We report the design and performance validation of microfluidic separation technologies for human identification using a disposable plastic device suitable for integration into an automated rapid DNA analysis system. A fabrication process for a 15-cm long hot-embossed plastic microfluidic devices with a smooth semielliptical cross section out of cyclic olefin copolymer is presented. We propose a mixed polymer solution of 95% w/v hydroxyethylcellulose and 5% w/v polyvinylpyrrolidone for a final polymer concentration of 2.5 or 3.0% to be used as coating and sieving matrix for DNA separation. This formulation allows preparing the microchip without pretreatment in a single-loading step and provides high-resolution separation (≈1.2 bp for fragments <200 bp), which is superior to existing commercial matrices under the same conditions. The hot-embossed device performance is characterized and compared to injection-molded devices made out of cyclic olefin copolymer based on their respective injector geometry, channel shape, and surface charges. Each device design is assessed by fluorescence videomicroscopy to evaluate the formation of injection plugs, then by comparing electropherograms for the separation of a DNA size standard relevant to human identification. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Visual and colorimetric methods for rapid determination of total tannins in vegetable raw materials

    Directory of Open Access Journals (Sweden)

    S. P. Kalinkina

    2016-01-01

    Full Text Available The article is dedicated to the development of rapid colorimetric method for determining the amount of tannins in aqueous extracts of vegetable raw materials. The sorption-based colorimetric test is determining sorption tannins polyurethane foam, impregnated of FeCl3, receiving on its surface painted in black and green color of the reaction products and the determination of their in sorbent matrix. Selectivity is achieved by determining the tannins specific interaction of polyphenols with iron ions (III. The conditions of sorption-colorimetric method: the concentration of ferric chloride (III, impregnated in the polyurethane foam; sorbent mass in the analytical cartridge; degree of loading his agent; the contact time of the phases. color scales have been developed for the visual determination of the amount of tannins in terms of gallic acid. Spend a digitized image obtained scales using computer program “Sorbfil TLC”, excluding a subjective assessment of the intensity of the color scale of the test. The results obtained determine the amount of tannins in aqueous extracts of vegetable raw rapid method using tablets and analytical cartridges. The results of the test determination of tannins with visual and densitometric analytical signal registration are compared to known methods. Spend a metrological evaluation of the results of determining the amount of tannins sorption rapid colorimetric methods. Time visual and densitometric rapid determination of tannins, taking into account the sample preparation is 25–30 minutes, the relative error does not exceed 28 %. The developed test methods for quantifying the content of tannins allow to exclude the use of sophisticated analytical equipment, carry out the analysis in non-laboratory conditions do not require highly skilled personnel.

  13. A rapid method for soil cement design : Louisiana slope value method : part II : evaluation.

    Science.gov (United States)

    1966-05-01

    This report is an evaluation of the recently developed "Louisiana Slope Value Method". : The conclusion drawn are based on data from 637 separate samples representing nearly all major soil groups in Louisiana that are suitable for cement stabilizatio...

  14. A visual method for direct selection of high-producing Pichia pastoris clones

    Directory of Open Access Journals (Sweden)

    Liu Sheng

    2011-03-01

    Full Text Available Abstract Background The methylotrophic yeast, Pichia pastoris, offers the possibility to generate a high amount of recombinant proteins in a fast and easy way to use expression system. Being a single-celled microorganism, P. pastoris is easy to manipulate and grows rapidly on inexpensive media at high cell densities. A simple and direct method for the selection of high-producing clones can dramatically enhance the whole production process along with significant decrease in production costs. Results A visual method for rapid selection of high-producing clones based on mannanase reporter system was developed. The study explained that it was possible to use mannanase activity as a measure of the expression level of the protein of interest. High-producing target protein clones were directly selected based on the size of hydrolysis holes in the selected plate. As an example, the target gene (9elp-hal18 was expressed and purified in Pichia pastoris using this technology. Conclusions A novel methodology is proposed for obtaining the high-producing clones of proteins of interest, based on the mannanase reporter system. This system may be adapted to other microorganisms, such as Saccharomyces cerevisiae for the selection of clones.

  15. Propafenone HCl fast dissolving tablets containing subliming agent prepared by direct compression method.

    Science.gov (United States)

    Abd El Rasoul, Saleh; Shazly, Gamal A

    2017-11-01

    Propafenone HCl (PPH), an antiarrhythmic drug, has a bitter taste, short half-life, delayed drug dissolution and side effects. Thus, the purpose of this work is to develop orally fast dissolving tablets (OFDTs) containing PPH to provide a rapid drug dissolution and subsequently give rapid onset of action of PPH as an antiarrhythmic drug. Moreover, OFDTs of PPH reduce its side effects and improve its bioavailability. Propafenone HCl (PPH), an antiarrhythmic drug, has a bitter taste, short half-life, delayed drug dissolution and side effects. Direct compression method was used for the preparation of 15 formulations OFDTs containing PPH using directly compressible excipients, subliming agent and superdisintegrants. The prepared tablets were undergone physical characterization, in vitro dissolution and stability studies. All pre- and post-compression tests met the pharmacopoeia specifications. In vitro dissolution of the prepared PPH OFDTs exhibited high dissolution rate than compared to the marketed tablets. It was found that the tablets prepared by using the higher concentration of crospovidone were found to dissolute the drug at a faster rate when compared to other concentrations. A formula containing croscarmellose sodium showed the higher present of PPH dissolved as compared to the other formulations. It was concluded that PPH OFDTs were formulated successfully with acceptable physical and chemical properties with rapid disintegration in the oral cavity, rapid onset of action, and enhanced patient compliance. It was found that F10 showed good stability upon storage at 25 and 40 °C for 3 months. Formulation of PPH OFDTs can result in a significant improvement in the PPH bioavailability since the first pass metabolism will be avoided.

  16. Propafenone HCl fast dissolving tablets containing subliming agent prepared by direct compression method

    Directory of Open Access Journals (Sweden)

    Saleh Abd El Rasoul

    2017-11-01

    Full Text Available Propafenone HCl (PPH, an antiarrhythmic drug, has a bitter taste, short half-life, delayed drug dissolution and side effects. Thus, the purpose of this work is to develop orally fast dissolving tablets (OFDTs containing PPH to provide a rapid drug dissolution and subsequently give rapid onset of action of PPH as an antiarrhythmic drug. Moreover, OFDTs of PPH reduce its side effects and improve its bioavailability. Propafenone HCl (PPH, an antiarrhythmic drug, has a bitter taste, short half-life, delayed drug dissolution and side effects. Direct compression method was used for the preparation of 15 formulations OFDTs containing PPH using directly compressible excipients, subliming agent and superdisintegrants. The prepared tablets were undergone physical characterization, in vitro dissolution and stability studies. All pre- and post-compression tests met the pharmacopoeia specifications. In vitro dissolution of the prepared PPH OFDTs exhibited high dissolution rate than compared to the marketed tablets. It was found that the tablets prepared by using the higher concentration of crospovidone were found to dissolute the drug at a faster rate when compared to other concentrations. A formula containing croscarmellose sodium showed the higher present of PPH dissolved as compared to the other formulations. It was concluded that PPH OFDTs were formulated successfully with acceptable physical and chemical properties with rapid disintegration in the oral cavity, rapid onset of action, and enhanced patient compliance. It was found that F10 showed good stability upon storage at 25 and 40 °C for 3 months. Formulation of PPH OFDTs can result in a significant improvement in the PPH bioavailability since the first pass metabolism will be avoided.

  17. Processing of alnico permanent magnets by advanced directional solidification methods

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Min; Johnson, Francis; Zhang, Wanming; Zhao, Qi; Rutkowski, Stephen F. [Ceramic and Metallurgy Technologies, General Electric Global Research, Niskayuna, NY (United States); Zhou, Lin; Kramer, Matthew J. [Ames Laboratory, Ames, IA (United States); Iowa State University, Ames, IA (United States)

    2016-12-15

    Advanced directional solidification methods have been used to produce large (>15 cm length) castings of Alnico permanent magnets with highly oriented columnar microstructures. In combination with subsequent thermomagnetic and draw thermal treatment, this method was used to enable the high coercivity, high-Titanium Alnico composition of 39% Co, 29.5% Fe, 14% Ni, 7.5% Ti, 7% Al, 3% Cu (wt%) to have an intrinsic coercivity (H{sub ci}) of 2.0 kOe, a remanence (B{sub r}) of 10.2 kG, and an energy product (BH){sub max} of 10.9 MGOe. These properties compare favorably to typical properties for the commercial Alnico 9. Directional solidification of higher Ti compositions yielded anisotropic columnar grained microstructures if high heat extraction rates through the mold surface of at least 200 kW/m{sup 2} were attained. This was achieved through the use of a thin walled (5 mm thick) high thermal conductivity SiC shell mold extracted from a molten Sn bath at a withdrawal rate of at least 200 mm/h. However, higher Ti compositions did not result in further increases in magnet performance. Images of the microstructures collected by scanning electron microscopy (SEM) reveal a majority α phase with inclusions of secondary α{sub γ} phase. Transmission electron microscopy (TEM) reveals that the α phase has a spinodally decomposed microstructure of FeCo-rich needles in a NiAl-rich matrix. In the 7.5% Ti composition the diameter distribution of the FeCo needles was bimodal with the majority having diameters of approximately 50 nm with a small fraction having diameters of approximately 10 nm. The needles formed a mosaic pattern and were elongated along one 〈001〉 crystal direction (parallel to the field used during magnetic annealing). Cu precipitates were observed between the needles. Regions of abnormal spinodal morphology appeared to correlate with secondary phase precipitates. The presence of these abnormalities did not prevent the material from displaying superior magnetic

  18. Processing of alnico permanent magnets by advanced directional solidification methods

    Science.gov (United States)

    Zou, Min; Johnson, Francis; Zhang, Wanming; Zhao, Qi; Rutkowski, Stephen F.; Zhou, Lin; Kramer, Matthew J.

    2016-12-01

    Advanced directional solidification methods have been used to produce large (>15 cm length) castings of Alnico permanent magnets with highly oriented columnar microstructures. In combination with subsequent thermomagnetic and draw thermal treatment, this method was used to enable the high coercivity, high-Titanium Alnico composition of 39% Co, 29.5% Fe, 14% Ni, 7.5% Ti, 7% Al, 3% Cu (wt%) to have an intrinsic coercivity (Hci) of 2.0 kOe, a remanence (Br) of 10.2 kG, and an energy product (BH)max of 10.9 MGOe. These properties compare favorably to typical properties for the commercial Alnico 9. Directional solidification of higher Ti compositions yielded anisotropic columnar grained microstructures if high heat extraction rates through the mold surface of at least 200 kW/m2 were attained. This was achieved through the use of a thin walled (5 mm thick) high thermal conductivity SiC shell mold extracted from a molten Sn bath at a withdrawal rate of at least 200 mm/h. However, higher Ti compositions did not result in further increases in magnet performance. Images of the microstructures collected by scanning electron microscopy (SEM) reveal a majority α phase with inclusions of secondary αγ phase. Transmission electron microscopy (TEM) reveals that the α phase has a spinodally decomposed microstructure of FeCo-rich needles in a NiAl-rich matrix. In the 7.5% Ti composition the diameter distribution of the FeCo needles was bimodal with the majority having diameters of approximately 50 nm with a small fraction having diameters of approximately 10 nm. The needles formed a mosaic pattern and were elongated along one crystal direction (parallel to the field used during magnetic annealing). Cu precipitates were observed between the needles. Regions of abnormal spinodal morphology appeared to correlate with secondary phase precipitates. The presence of these abnormalities did not prevent the material from displaying superior magnetic properties in the 7.5% Ti composition

  19. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  20. Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection.

    Science.gov (United States)

    Niimi, Hideki; Ueno, Tomohiro; Hayashi, Shirou; Abe, Akihito; Tsurue, Takahiro; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Goto, Michihiko; Akiyama, Makoto; Yamamoto, Yoshihiro; Saito, Shigeru; Kitajima, Isao

    2015-07-28

    Acquiring the earliest possible identification of pathogenic microorganisms is critical for selecting the appropriate antimicrobial therapy in infected patients. We herein report the novel "melting temperature (Tm) mapping method" for rapidly identifying the dominant bacteria in a clinical sample from sterile sites. Employing only seven primer sets, more than 100 bacterial species can be identified. In particular, using the Difference Value, it is possible to identify samples suitable for Tm mapping identification. Moreover, this method can be used to rapidly diagnose the absence of bacteria in clinical samples. We tested the Tm mapping method using 200 whole blood samples obtained from patients with suspected sepsis, 85% (171/200) of which matched the culture results based on the detection level. A total of 130 samples were negative according to the Tm mapping method, 98% (128/130) of which were also negative based on the culture method. Meanwhile, 70 samples were positive according to the Tm mapping method, and of the 59 suitable for identification, 100% (59/59) exhibited a "match" or "broad match" with the culture or sequencing results. These findings were obtained within three hours of whole blood collection. The Tm mapping method is therefore useful for identifying infectious diseases requiring prompt treatment.

  1. 3D virtual human rapid modeling method based on top-down modeling mechanism

    Directory of Open Access Journals (Sweden)

    LI Taotao

    2017-01-01

    Full Text Available Aiming to satisfy the vast custom-made character demand of 3D virtual human and the rapid modeling in the field of 3D virtual reality, a new virtual human top-down rapid modeling method is put for-ward in this paper based on the systematic analysis of the current situation and shortage of the virtual hu-man modeling technology. After the top-level realization of virtual human hierarchical structure frame de-sign, modular expression of the virtual human and parameter design for each module is achieved gradu-al-level downwards. While the relationship of connectors and mapping restraints among different modules is established, the definition of the size and texture parameter is also completed. Standardized process is meanwhile produced to support and adapt the virtual human top-down rapid modeling practice operation. Finally, the modeling application, which takes a Chinese captain character as an example, is carried out to validate the virtual human rapid modeling method based on top-down modeling mechanism. The result demonstrates high modelling efficiency and provides one new concept for 3D virtual human geometric mod-eling and texture modeling.

  2. Development of a loop-mediated isothermal amplification method for rapid detection of pigeon circovirus.

    Science.gov (United States)

    Tsai, Shinn Shyong; Chang, Yeng Ling; Huang, Yen Li; Liu, Hung Jen; Ke, Guan Ming; Chiou, Chwei Jang; Hsieh, Yao Ching; Chang, Tsung Chou; Cheng, Li Ting; Chuang, Kuo Pin

    2014-05-01

    There are no effective antiviral treatments for pigeon circovirus (PiCV); thus, rapid diagnosis is critical for effective control of the disease caused by this virus. The recent development of a novel LAMP technique that amplifies nucleic acids rapidly with high specificity and sensitivity under isothermal conditions has overcome some of the deficiencies of nucleic-acid-based diagnostic tests. We established a LAMP method for rapid detection of PiCV using two pairs of primers that were designed from PiCV and compared its sensitivity and specificity with that of PCR. Amplification by LAMP was optimal at 63 °C for 60 min. The detection limit was nearly 0.5 pg of PiCV DNA, making it ten times more sensitive than PCR. There was no cross-reaction with porcine circovirus type 2 (PCV2), pigeon Trichomonas gallinae, or pigeon herpesvirus (PHV) under the same conditions. The assay also successfully detected the pathogen DNA in the tissues of infected pigeons. This is the first report indicating that LAMP is a valuable, rapid method of detecting PiCV with high sensitivity and specificity.

  3. A new alginate-based rapid method for determining coliforms in milk.

    Science.gov (United States)

    Chang, Su-sen; Gray, Peter M; Woo, Gun-Jo; Kang, Dong-Hyun

    2003-11-01

    A new rapid method for monitoring coliforms was developed on the basis of the instant gelling effects of alginate and calcium. The effectiveness of this new method in the detection of coliforms was evaluated. Tests involving Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, total coliforms in milk, cold-injured coliforms, and total coliforms in raw milk were carried out. The bacterial samples were diluted in 0.2% peptone water containing 90 mM CaCl2 and added into test tubes containing modified purple broth base medium. Coliform concentrations were determined on the basis of the time of color change and gas production in the alginate tubes. All results obtained by the alginate method correlated strongly with those obtained by the conventional violet red bile agar (VRBA) plating method. The alginate method reduced detection time by 12 to 14 h compared with the conventional VRBA plating method. The alginate method can be applied in field studies more easily than melted-agar systems can. The results of this study indicate that the alginate method is an accurate, rapid, simple, and economical way to monitor and estimate concentrations of total coliforms in food.

  4. New method for vitrifying water and other liquids by rapid cooling of their aerosols

    Science.gov (United States)

    Mayer, Erwin

    1985-07-01

    A method for the vitrification of pure liquid water and dilute aqueous solutions is described which is the only one without a liquid cryomedium for heat transfer: rapid cooling of aqueous aerosol droplets on a solid cryoplate. This method is not limited to water and aqueous solutions, but can be used for the vitrification of any liquid aerosol, the only impurity being some codeposited vapor. The method can be applied in diverse fields such as cryobiology, cryomicroscopy, and low-temperature spectroscopy of water and dilute aqueous solutions to avoid the formation of crystalline ice.

  5. RAPID METHOD FOR PLUTONIUM, AMERICIUM AND CURIUM IN VERY LARGE SOIL SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, S

    2007-01-08

    The analysis of actinides in environmental soil and sediment samples is very important for environmental monitoring. There is a need to measure actinide isotopes with very low detection limits. A new, rapid actinide separation method has been developed and implemented that allows the measurement of plutonium, americium and curium isotopes in very large soil samples (100-200 g) with high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and DGA-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), americium (Am), and curium (Cm) using a single multistage column combined with alpha spectrometry. The method combines an acid leach step and innovative matrix removal using cerium fluoride precipitation to remove the difficult soil matrix. This method is unique in that it provides high tracer recoveries and effective removal of interferences with small extraction chromatography columns instead of large ion exchange resin columns that generate large amounts of acid waste. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  6. Rapid Evaporative Ionisation Mass Spectrometry (REIMS) Provides Accurate Direct from Culture Species Identification within the Genus Candida.

    Science.gov (United States)

    Cameron, Simon J S; Bolt, Frances; Perdones-Montero, Alvaro; Rickards, Tony; Hardiman, Kate; Abdolrasouli, Alireza; Burke, Adam; Bodai, Zsolt; Karancsi, Tamas; Simon, Daniel; Schaffer, Richard; Rebec, Monica; Balog, Julia; Takáts, Zoltan

    2016-11-14

    Members of the genus Candida, such as C. albicans and C. parapsilosis, are important human pathogens. Other members of this genus, previously believed to carry minimal disease risk, are increasingly recognised as important human pathogens, particularly because of variations in susceptibilities to widely used anti-fungal agents. Thus, rapid and accurate identification of clinical Candida isolates is fundamental in ensuring timely and effective treatments are delivered. Rapid Evaporative Ionisation Mass Spectrometry (REIMS) has previously been shown to provide a high-throughput platform for the rapid and accurate identification of bacterial and fungal isolates. In comparison to commercially available matrix assisted laser desorption ionisation time of flight mass spectrometry (MALDI-ToF), REIMS based methods require no preparative steps nor time-consuming cell extractions. Here, we report on the ability of REIMS-based analysis to rapidly and accurately identify 153 clinical Candida isolates to species level. Both handheld bipolar REIMS and high-throughput REIMS platforms showed high levels of species classification accuracy, with 96% and 100% of isolates classified correctly to species level respectively. In addition, significantly different (FDR corrected P value < 0.05) lipids within the 600 to 1000 m/z mass range were identified, which could act as species-specific biomarkers in complex microbial communities.

  7. A novel sample preparation method using rapid nonheated saponification method for the determination of cholesterol in emulsified foods.

    Science.gov (United States)

    Jeong, In-Seek; Kwak, Byung-Man; Ahn, Jang-Hyuk; Leem, Donggil; Yoon, Taehyung; Yoon, Changyong; Jeong, Jayoung; Park, Jung-Min; Kim, Jin-Man

    2012-10-01

    In this study, nonheated saponification was employed as a novel, rapid, and easy sample preparation method for the determination of cholesterol in emulsified foods. Cholesterol content was analyzed using gas chromatography with a flame ionization detector (GC-FID). The cholesterol extraction method was optimized for maximum recovery from baby food and infant formula. Under these conditions, the optimum extraction solvent was 10 mL ethyl ether per 1 to 2 g sample, and the saponification solution was 0.2 mL KOH in methanol. The cholesterol content in the products was determined to be within the certified range of certified reference materials (CRMs), NIST SRM 1544 and SRM 1849. The results of the recovery test performed using spiked materials were in the range of 98.24% to 99.45% with an relative standard devitation (RSD) between 0.83% and 1.61%. This method could be used to reduce sample pretreatment time and is expected to provide an accurate determination of cholesterol in emulsified food matrices such as infant formula and baby food. A novel, rapid, and easy sample preparation method using nonheated saponification was developed for cholesterol detection in emulsified foods. Recovery tests of CRMs were satisfactory, and the recoveries of spiked materials were accurate and precise. This method was effective and decreased the time required for analysis by 5-fold compared to the official method. © 2012 Institute of Food Technologists®

  8. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Directory of Open Access Journals (Sweden)

    Selvaraju Gayathri Devi

    Full Text Available A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil with high purity (A260/280: 1.76 ± 0.05 and reduced humic substances (A340: 0.047 ± 0.03. The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666.

  9. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666).

  10. Simple and rapid method for the isolation of forskolin from Coleus forskohlii by charcoal column chromatography.

    Science.gov (United States)

    Saleem, A M; Dhasan, P B; Rafiullah, M R M

    2006-01-06

    A simple, safe, rapid and economical method was developed for the isolation of high-purity forskolin from Coleus forskohlii roots using activated charcoal as an adsorbent in a column. The elution was carried out under reduced pressure to make the process rapid. Activated charcoal acted as a reversed phase adsorbent and allowed elution of forskolin without much impurities. The residue, obtained from the eluate was purified and crystallized using different solvent mixtures to obtain pure forskolin. The forskolin isolated was analyzed and characterized by UV, IR, RP-HPLC, electrospray ionization MS, 1H NMR and 13C NMR. The yield was 0.097% w/w (RSD 5.6%). The purity was 96.9% w/w (RSD 0.3%) as determined by RP-HPLC. The present method enables researchers to produce high-purity forskolin in their labs by using common chemicals.

  11. Evaluation of methods for rapid determination of freezing point of aviation fuels

    Science.gov (United States)

    Mathiprakasam, B.

    1982-01-01

    Methods for identification of the more promising concepts for the development of a portable instrument to rapidly determine the freezing point of aviation fuels are described. The evaluation process consisted of: (1) collection of information on techniques previously used for the determination of the freezing point, (2) screening and selection of these techniques for further evaluation of their suitability in a portable unit for rapid measurement, and (3) an extensive experimental evaluation of the selected techniques and a final selection of the most promising technique. Test apparatuses employing differential thermal analysis and the change in optical transparency during phase change were evaluated and tested. A technique similar to differential thermal analysis using no reference fuel was investigated. In this method, the freezing point was obtained by digitizing the data and locating the point of inflection. Results obtained using this technique compare well with those obtained elsewhere using different techniques. A conceptual design of a portable instrument incorporating this technique is presented.

  12. Sex Differences in Knee Flexion Angle During a Rapid Change of Direction While Running.

    Science.gov (United States)

    Sheu, Christopher L; Gray, Aaron M; Brown, David; Smith, Brian A

    2015-12-01

    Females experience greater overall rates of athletic anterior cruciate ligament (ACL) injury than males. The specific mechanisms of the predisposition remain unclear. Modeling of knee kinematics has shown that the more extended the knee joint, the greater the strain on the ACL. The authors hypothesized that female athletes would have a lesser degree of knee flexion than male athletes at initial ground contact while performing change-of-direction cutting maneuvers. Controlled laboratory study. Twenty female and 20 male high school soccer athletes with at least 1 year of experience were recruited for the study. Athletes were excluded if they had a history of any major lower limb injury or current knee pain causing a reduction in training and/or competition. Reflective markers were attached at the greater trochanter of the femur, the lateral epicondyle of the knee, and the lateral malleolus of the ankle to enable motion capture. Each athlete performed 6 change-of-direction maneuvers in random order in front of 2 cameras. Multiple regression analysis was used to determine differences between the sexes from the motion data captured; P angles between male and female participants at the 90° and 135° cutting angles. At 90°, males and females showed initial contact knee flexion angles (mean ± SD) of 39.0° ± 6.8° and 29.3° ± 6.2°, respectively (P angles of 56.4° ± 6.9° and 49.7° ± 7.0°, respectively (P = .0036). At 135°, males and females showed mean initial contact knee flexion angles of 36.8° ± 7.9° and 29.7° ± 7.8°, respectively (P = .0053), and mean maximum flexion angles of 60.7° ± 8.1° and 51.6° ± 9.4°, respectively (P = .0017). The research conducted is intended to foster an awareness of injury disposition in female athletes and guide future endeavors to develop, test, and implement a proactive approach in lowering female noncontact athletic ACL injury rates. This project adds to the literature as wider side-cut maneuvers (≥90°) were

  13. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  14. A Design Methodology for Rapid Implementation of Active Control Systems Across Lean Direct Injection Combustor Platforms

    Science.gov (United States)

    Baumann, William T.; Saunders, William R.; Vandsburger, Uri; Saus, Joseph (Technical Monitor)

    2003-01-01

    The VACCG team is comprised of engineers at Virginia Tech who specialize in the subject areas of combustion physics, chemical kinetics, dynamics and controls, and signal processing. Currently, the team's work on this NRA research grant is designed to determine key factors that influence combustion control performance through a blend of theoretical and experimental investigations targeting design and demonstration of active control for three different combustors. To validiate the accuracy of conclusions about control effectiveness, a sequence of experimental verifications on increasingly complex lean, direct injection combustors is underway. During the work period January 1, 2002 through October 15, 2002, work has focused on two different laboratory-scale combustors that allow access for a wide variety of measurements. As the grant work proceeds, one key goal will be to obtain certain knowledge about a particular combustor process using a minimum of sophisticated measurements, due to the practical limitations of measurements on full-scale combustors. In the second year, results obtained in the first year will be validated on test combustors to be identified in the first quarter of that year. In the third year, it is proposed to validate the results at more realistic pressure and power levels by utilizing the facilities at the Glenn Research Center.

  15. Transverse Single-Spin Asymmetries of Direct Photons from Proton-Proton Collisions at Forward Rapidity

    Science.gov (United States)

    Eyser, Oleg; STAR Collaboration

    2017-09-01

    Transverse single-spin asymmetries in high energy collisions offer unique ways to study the nucleon structure beyond the conventional leading twist collinear picture in hard QCD processes. While transverse momentum dependent distribution and fragmentation functions require two scales (hard and soft), observables with a single hard scale can be described in a collinear framework with multiparton correlations (twist-3). Both are related when the intrinsic transverse momentum is integrated. Initial and final state effects can contribute to different probes and need to be disentangled. In 2015, the STAR experiment at RHIC has extended the forward calorimeter, 2.5< η<4.0 with a preshower detector in order to study transverse asymmetries of direct photon production in proton-proton collisions at a center of mass energy of 200 GeV. This measurement will contribute to the universality test of initial state spin-orbit correlations (sign-change between hadronic collisions and deep inelastic scattering) and serve as first input to a proper evolution of higher twist functions as function of momentum transfer. We will present the status of the analysis and discuss implications on the theoretical description.

  16. Novel methods for improving rapid paper-based protein assays with gold nanoparticle detection

    OpenAIRE

    Lama, Lara

    2017-01-01

    This thesis describes methods for improving sensitivity in rapid singleplex and multiplex microarray assays. The assays utilize the optical characteristics of colloidal gold nanoparticles for the colorimetric detection of proteins. Multiplexed detection in sandwich immunoassays is limited by cross-reactivity between different detection antibodies. The cross-reactivity between antibodies can contribute to increased background noise - decreasing the Limit-of-Detection of the assay - or generate...

  17. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    OpenAIRE

    Nelly eDatukishvili; Tamara eKutateladze; Inga eGabriadze; Kakha eBitskinashvili; Boris eVishnepolsky

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of C...

  18. A low complexity rapid molecular method for detection of Clostridium difficile in stool.

    Directory of Open Access Journals (Sweden)

    Cathal J McElgunn

    Full Text Available Here we describe a method for the detection of Clostridium difficile from stool using a novel low-complexity and rapid extraction process called Heat Elution (HE. The HE method is two-step and takes just 10 minutes, no specialist instruments are required and there is minimal hands-on time. A test method using HE was developed in conjunction with Loop-mediated Isothermal Amplification (LAMP combined with the real-time bioluminescent reporter system known as BART targeting the toxin B gene (tcdB. The HE-LAMP-BART method was evaluated in a pilot study on clinical fecal samples (tcdB(+, n = 111; tcdB(-, n= 107. The HE-LAMP-BART method showed 95.5% sensitivity and 100% specificity against a gold standard reference method using cytotoxigenic culture and also a silica-based robotic extraction followed by tcdB PCR to control for storage. From sample to result, the HE-LAMP-BART method typically took 50 minutes, whereas the PCR method took >2.5 hours. In a further study (tcdB(+, n = 47; tcdB(-, n= 28 HE-LAMP-BART was compared to an alternative commercially available LAMP-based method, Illumigene (Meridian Bioscience, OH, and yielded 87.2% sensitivity and 100% specificity for the HE-LAMP-BART method compared to 76.6% and 100%, respectively, for Illumigene against the reference method. A subset of 27 samples (tcdB(+, n = 25; tcdB(-, n= 2 were further compared between HE-LAMP-BART, Illumigene, GeneXpert (Cepheid, Sunnyvale, CA and RIDA®QUICK C. difficile Toxin A/B lateral flow rapid test (R-Biopharm, Darmstadt, Germany resulting in sensitivities of HE-LAMP-BART 92%, Illumigene 72% GeneXpert 96% and RIDAQuick 76% against the reference method. The HE-LAMP-BART method offers the advantages of molecular based approaches without the cost and complexity usually associated with molecular tests. Further, the rapid time-to-result and simple protocol means the method can be applied away from the centralized laboratory settings.

  19. Gas purge-microsyringe extraction: a rapid and exhaustive direct microextraction technique of polycyclic aromatic hydrocarbons from plants.

    Science.gov (United States)

    Wang, Juan; Yang, Cui; Li, Huijie; Piao, Xiangfan; Li, Donghao

    2013-12-17

    Gas purge-microsyringe extraction (GP-MSE) is a rapid and exhaustive microextraction technique for volatile and semivolatile compounds. In this study, a theoretical system of GP-MSE was established by directly extracting and analyzing 16 kinds of polycyclic aromatic hydrocarbons (PAHs) from plant samples. On the basis of theoretical consideration, a full factorial experimental design was first used to evaluate the main effects and interactions of the experimental parameters affecting the extraction efficiency. Further experiments were carried out to determine the extraction kinetics and desorption temperature-dependent. The results indicated that three factors, namely desorption temperature (temperature of sample phase) Td, extraction time t, and gas flow rate u, had a significantly positive effect on the extraction efficiency of GP-MSE for PAHs. Extraction processes of PAHs in plant samples followed by first-order kinetics (relative coefficient R(2) of simulation curves were 0.731-1.000, with an average of 0.958 and 4.06% relative standard deviation), and obviously depended on the desorption temperature. Furthermore, the effect of the matrix was determined from the difference in Eapp,d. Finally, satisfactory recoveries of 16 PAHs were obtained using optimal parameters. The study demonstrated that GP-MSE could provide a rapid and exhaustive means of direct extraction of PAHs from plant samples. The extraction kinetics were similar that of the inverse process of the desorption kinetics of the sample phase. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Conventional rapid latex agglutination in estimation of von Willebrand factor: method revisited and potential clinical applications.

    Science.gov (United States)

    Mahat, Marianor; Abdullah, Wan Zaidah; Hussin, Che Maraina Che

    2014-01-01

    Measurement of von Willebrand factor antigen (VWF : Ag) levels is usually performed in a specialised laboratory which limits its application in routine clinical practice. So far, no commercial rapid test kit is available for VWF : Ag estimation. This paper discusses the technical aspect of latex agglutination method which was established to suit the purpose of estimating von Willebrand factor (VWF) levels in the plasma sample. The latex agglutination test can be performed qualitatively and semiquantitatively. Reproducibility, stability, linearity, limit of detection, interference, and method comparison studies were conducted to evaluate the performance of this test. Semiquantitative latex agglutination test was strongly correlated with the reference immunoturbidimetric assay (Spearman's rho = 0.946, P agglutination test and the reference assay. Using the scoring system for the rapid latex test, no agglutination is with 0% VWF : Ag (control negative), 1+ reaction is equivalent to 150% VWF : Ag (when comparing with immunoturbidimetric assay). The findings from evaluation studies suggest that latex agglutination method is suitable to be used as a rapid test kit for the estimation of VWF : Ag levels in various clinical conditions associated with high levels and low levels of VWF : Ag.

  1. GSMA: Gene Set Matrix Analysis, An Automated Method for Rapid Hypothesis Testing of Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Chris Cheadle

    2007-01-01

    Full Text Available Background: Microarray technology has become highly valuable for identifying complex global changes in gene expression patterns. The assignment of functional information to these complex patterns remains a challenging task in effectively interpreting data and correlating results from across experiments, projects and laboratories. Methods which allow the rapid and robust evaluation of multiple functional hypotheses increase the power of individual researchers to data mine gene expression data more efficiently.Results: We have developed (gene set matrix analysis GSMA as a useful method for the rapid testing of group-wise up- or downregulation of gene expression simultaneously for multiple lists of genes (gene sets against entire distributions of gene expression changes (datasets for single or multiple experiments. The utility of GSMA lies in its flexibility to rapidly poll gene sets related by known biological function or as designated solely by the end-user against large numbers of datasets simultaneously.Conclusions: GSMA provides a simple and straightforward method for hypothesis testing in which genes are tested by groups across multiple datasets for patterns of expression enrichment.

  2. An integrated photo-thermal sensing system for rapid and direct diagnosis of anemia.

    Science.gov (United States)

    Kwak, Bong Seop; Kim, Hyung Joon; Kim, Hyun Ok; Jung, Hyo-Il

    2010-12-15

    This article presents a thermal biosensor to diagnose the anemia without chemical treatments using temperature increase of red blood cells (RBC) when hemoglobin molecules absorb specific wavelength of photons and convert them to thermal energy. For measuring temperature change of red blood cell, the micro-scaled platinum resistance temperature detector (Pt RTD) was developed. For maintenance of constant ambient temperature, we designed and fabricated a thermostat system. The thermostat system consists of a K-type thermocouple and two electric heaters that serve to increase the system temperature, which is monitored by the thermocouple. Both heaters and the thermocouple were connected to a proportional-integral-derivative (PID) controller and enabled to maintain the temperature constant (temperature variations (from 66.33±2.72°C to 74.16±2.06°C) of whole blood samples from 10 anemic patients and subsequently determined the concentration of hemoglobin (from 7.2 g/dL to 9.8 g/dL). The method proposed in this paper requires significantly less amount of whole blood sample (6 μl) compared with the conventional methods (175 μl) and allows instantaneous diagnosis (3 s) of anemia. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Solid-phase microextraction low temperature plasma mass spectrometry for the direct and rapid analysis of chemical warfare simulants in complex mixtures.

    Science.gov (United States)

    Dumlao, Morphy C; Jeffress, Laura E; Gooding, J Justin; Donald, William A

    2016-06-21

    Solid-phase microextraction (SPME) is directly integrated with low temperature plasma ionisation mass spectrometry to rapidly detect organophosphate chemical warfare agent simulants and their hydrolysis products in chemical mixtures, including urine. In this sampling and ionization method, the fibre serves: (i) to extract molecules from their native environment, and (ii) as the ionization electrode that is used to desorb and ionize molecules directly from the SPME surface. By use of a custom fabricated SPME fibre consisting of a stainless steel needle coated with a Linde Type A (LTA) zeolitic microporous material and low temperature plasma mass spectrometry, protonated dimethyl methylphosphonate (DMMP), diethyl ethylphosphonate (DEEP) and pinacolyl methylphosphonic acid (PinMPA) can be detected at less than 100 ppb directly in water and urine. Organophosphates were not readily detected by this approach using an uncoated needle in negative control experiments. The use of the LTA coating significantly outperformed the use of a high alumina Zeolite Socony Mobil-5 (ZSM-5) coating of comparable thickness that is significantly less polar than LTA. By conditioning the LTA probe by immersion in an aqueous CuSO4 solution, the ion abundance for protonated DMMP increased by more than 300% compared to that obtained without any conditioning. Sample recovery values were between 96 and 100% for each analyte. The detection of chemical warfare agent analogues and hydrolysis products required less than 2 min per sample. A key advantage of this sampling and ionization method is that analyte ions can be directly and rapidly sampled from chemical mixtures, such as urine and seawater, without sample preparation or chromatography for sensitive detection by mass spectrometry. This ion source should prove beneficial for portable mass spectrometry applications because relatively low detection limits can be obtained without the use of compressed gases, fluid pumps, and lasers. Moreover, the

  4. Rapid resolution of chronic shoulder pain classified as derangement using the McKenzie method: a case series.

    Science.gov (United States)

    Aytona, Maria Corazon; Dudley, Karlene

    2013-11-01

    The McKenzie method, also known as Mechanical Diagnosis and Therapy (MDT), is primarily recognized as an evaluation and treatment method for the spine. However, McKenzie suggested that this method could also be applied to the extremities. Derangement is an MDT classification defined as an anatomical disturbance in the normal resting position of the joint, and McKenzie proposed that repeated movements could be applied to reduce internal joint displacement and rapidly reduce derangement symptoms. However, the current literature on MDT application to shoulder disorders is limited. Here, we present a case series involving four patients with chronic shoulder pain from a duration of 2-18 months classified as derangement and treated using MDT principles. Each patient underwent mechanical assessment and was treated with repeated movements based on their directional preference. All patients demonstrated rapid and clinically significant improvement in baseline measures and the disabilities of the arm, shoulder, and hand (QuickDASH) scores from an average of 38% at initial evaluation to 5% at discharge within 3-5 visits. Our findings suggest that MDT may be an effective treatment approach for shoulder pain.

  5. Interactive Rapid Dose Assessment Model (IRDAM): reactor-accident assessment methods. Vol. 2

    Energy Technology Data Exchange (ETDEWEB)

    Poeton, R.W.; Moeller, M.P.; Laughlin, G.J.; Desrosiers, A.E.

    1983-05-01

    As part of the continuing emphasis on emergency preparedness, the US Nuclear Regulatory Commission (NRC) sponsored the development of a rapid dose assessment system by Pacific Northwest Laboratory (PNL). This system, the Interactive Rapid Dose Assessment Model (IRDAM) is a micro-computer based program for rapidly assessing the radiological impact of accidents at nuclear power plants. This document describes the technical bases for IRDAM including methods, models and assumptions used in calculations. IRDAM calculates whole body (5-cm depth) and infant thyroid doses at six fixed downwind distances between 500 and 20,000 meters. Radionuclides considered primarily consist of noble gases and radioiodines. In order to provide a rapid assessment capability consistent with the capacity of the Osborne-1 computer, certain simplifying approximations and assumptions are made. These are described, along with default values (assumptions used in the absence of specific input) in the text of this document. Two companion volumes to this one provide additional information on IRDAM. The user's Guide (NUREG/CR-3012, Volume 1) describes the setup and operation of equipment necessary to run IRDAM. Scenarios for Comparing Dose Assessment Models (NUREG/CR-3012, Volume 3) provides the results of calculations made by IRDAM and other models for specific accident scenarios.

  6. The Benefit of Directed Forgetting Persists After a Daytime Nap: The Role of Spindles and Rapid Eye Movement Sleep in the Consolidation of Relevant Memories.

    Science.gov (United States)

    Blaskovich, Borbála; Szollosi, Ágnes; Gombos, Ferenc; Racsmány, Mihály; Simor, Péter

    2017-03-01

    We aimed to investigate the effect of directed forgetting instruction on memory retention after a 2-hour delay involving a daytime nap or an equivalent amount of time spent awake. We examined the associations between sleep-specific oscillations and the retention of relevant and irrelevant study materials. We applied a list-method directed forgetting paradigm manipulating the perceived relevance of previously encoded lists of words. Participants were randomly assigned to either a nap or an awake group, and to a remember or a forget subgroup. The remember and the forget subgroups were both instructed to study two consecutive lists of words, although, the forget subgroup was manipulated to forget the first list and memorize only the second one. Participants were 112 healthy individuals (44 men; Mage = 21.4 years, SD = 2.4). A significant directed forgetting effect emerged after a 2-hour delay both in the awake and sleep conditions; however, the effect was more pronounced within the sleep group. The benefit of directed forgetting, that is, relatively enhanced recall of relevant words in the forget group, was evidenced only in those participants that reached rapid eye movement (REM) phase. Non-rapid eye movement (NREM) sigma power was correlated with memory performance for the relevant (second) list, and sleep spindle amplitude was associated with the retention of both lists. These associations, however, were detected only within the forget subgroup. REM duration correlated with recall performance for the relevant (second) list within the forget subgroup, and with recall performance for the first list within the remember subgroup. A directed forgetting effect persists after a 2-hour delay spent awake or asleep. Spindle-related activity and subsequent REM sleep might selectively facilitate the processing of memories that are considered to be relevant for the future.

  7. Rapid Determination of Isomeric Benzoylpaeoniflorin and Benzoylalbiflorin in Rat Plasma by LC-MS/MS Method

    Directory of Open Access Journals (Sweden)

    Chuanqi Zhou

    2017-01-01

    Full Text Available Benzoylpaeoniflorin (BP is a potential therapeutic agent against oxidative stress related Alzheimer’s disease. In this study, a more rapid, selective, and sensitive liquid chromatography-tandem mass spectrometric (LC-MS/MS method was developed to determine BP in rat plasma distinguishing with a monoterpene isomer, benzoylalbiflorin (BA. The method showed a linear response from 1 to 1000 ng/mL (r>0.9950. The precision of the interday and intraday ranged from 2.03 to 12.48% and the accuracy values ranged from −8.00 to 10.33%. Each running of the method could be finished in 4 minutes. The LC-MS/MS method was validated for specificity, linearity, precision, accuracy, recovery, and stability and was found to be acceptable for bioanalytical application. Finally, this fully validated method was successfully applied to a pharmacokinetic study in rats following oral administration.

  8. Multifrequency excitation method for rapid and accurate dynamic test of micromachined gyroscope chips.

    Science.gov (United States)

    Deng, Yan; Zhou, Bin; Xing, Chao; Zhang, Rong

    2014-10-17

    A novel multifrequency excitation (MFE) method is proposed to realize rapid and accurate dynamic testing of micromachined gyroscope chips. Compared with the traditional sweep-frequency excitation (SFE) method, the computational time for testing one chip under four modes at a 1-Hz frequency resolution and 600-Hz bandwidth was dramatically reduced from 10 min to 6 s. A multifrequency signal with an equal amplitude and initial linear-phase-difference distribution was generated to ensure test repeatability and accuracy. The current test system based on LabVIEW using the SFE method was modified to use the MFE method without any hardware changes. The experimental results verified that the MFE method can be an ideal solution for large-scale dynamic testing of gyroscope chips and gyroscopes.

  9. Multifrequency Excitation Method for Rapid and Accurate Dynamic Test of Micromachined Gyroscope Chips

    Directory of Open Access Journals (Sweden)

    Yan Deng

    2014-10-01

    Full Text Available A novel multifrequency excitation (MFE method is proposed to realize rapid and accurate dynamic testing of micromachined gyroscope chips. Compared with the traditional sweep-frequency excitation (SFE method, the computational time for testing one chip under four modes at a 1-Hz frequency resolution and 600-Hz bandwidth was dramatically reduced from 10 min to 6 s. A multifrequency signal with an equal amplitude and initial linear-phase-difference distribution was generated to ensure test repeatability and accuracy. The current test system based on LabVIEW using the SFE method was modified to use the MFE method without any hardware changes. The experimental results verified that the MFE method can be an ideal solution for large-scale dynamic testing of gyroscope chips and gyroscopes.

  10. A Microfluidic Channel Method for Rapid Drug-Susceptibility Testing of Pseudomonas aeruginosa

    Science.gov (United States)

    Matsumoto, Yoshimi; Grushnikov, Andrey; Kikuchi, Kazuma; Noji, Hiroyuki; Yamaguchi, Akihito; Yagi, Yasushi

    2016-01-01

    The recent global increase in the prevalence of antibiotic-resistant bacteria and lack of development of new therapeutic agents emphasize the importance of selecting appropriate antimicrobials for the treatment of infections. However, to date, the development of completely accelerated drug susceptibility testing methods has not been achieved despite the availability of a rapid identification method. We proposed an innovative rapid method for drug susceptibility testing for Pseudomonas aeruginosa that provides results within 3 h. The drug susceptibility testing microfluidic (DSTM) device was prepared using soft lithography. It consisted of five sets of four microfluidic channels sharing one inlet slot, and the four channels are gathered in a small area, permitting simultaneous microscopic observation. Antimicrobials were pre-introduced into each channel and dried before use. Bacterial suspensions in cation-adjusted Mueller–Hinton broth were introduced from the inlet slot and incubated for 3 h. Susceptibilities were microscopically evaluated on the basis of differences in cell numbers and shapes between drug-treated and control cells, using dedicated software. The results of 101 clinically isolated strains of P. aeruginosa obtained using the DSTM method strongly correlated with results obtained using the ordinary microbroth dilution method. Ciprofloxacin, meropenem, ceftazidime, and piperacillin caused elongation in susceptible cells, while meropenem also induced spheroplast and bulge formation. Morphological observation could alternatively be used to determine the susceptibility of P. aeruginosa to these drugs, although amikacin had little effect on cell shape. The rapid determination of bacterial drug susceptibility using the DSTM method could also be applicable to other pathogenic species, and it could easily be introduced into clinical laboratories without the need for expensive instrumentation. PMID:26872134

  11. A Microfluidic Channel Method for Rapid Drug-Susceptibility Testing of Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Yoshimi Matsumoto

    Full Text Available The recent global increase in the prevalence of antibiotic-resistant bacteria and lack of development of new therapeutic agents emphasize the importance of selecting appropriate antimicrobials for the treatment of infections. However, to date, the development of completely accelerated drug susceptibility testing methods has not been achieved despite the availability of a rapid identification method. We proposed an innovative rapid method for drug susceptibility testing for Pseudomonas aeruginosa that provides results within 3 h. The drug susceptibility testing microfluidic (DSTM device was prepared using soft lithography. It consisted of five sets of four microfluidic channels sharing one inlet slot, and the four channels are gathered in a small area, permitting simultaneous microscopic observation. Antimicrobials were pre-introduced into each channel and dried before use. Bacterial suspensions in cation-adjusted Mueller-Hinton broth were introduced from the inlet slot and incubated for 3 h. Susceptibilities were microscopically evaluated on the basis of differences in cell numbers and shapes between drug-treated and control cells, using dedicated software. The results of 101 clinically isolated strains of P. aeruginosa obtained using the DSTM method strongly correlated with results obtained using the ordinary microbroth dilution method. Ciprofloxacin, meropenem, ceftazidime, and piperacillin caused elongation in susceptible cells, while meropenem also induced spheroplast and bulge formation. Morphological observation could alternatively be used to determine the susceptibility of P. aeruginosa to these drugs, although amikacin had little effect on cell shape. The rapid determination of bacterial drug susceptibility using the DSTM method could also be applicable to other pathogenic species, and it could easily be introduced into clinical laboratories without the need for expensive instrumentation.

  12. Direct PCR Offers a Fast and Reliable Alternative to Conventional DNA Isolation Methods for Gut Microbiomes.

    Science.gov (United States)

    Videvall, Elin; Strandh, Maria; Engelbrecht, Anel; Cloete, Schalk; Cornwallis, Charlie K

    2017-01-01

    The gut microbiome of animals is emerging as an important factor influencing ecological and evolutionary processes. A major bottleneck in obtaining microbiome data from large numbers of samples is the time-consuming laboratory procedures required, specifically the isolation of DNA and generation of amplicon libraries. Recently, direct PCR kits have been developed that circumvent conventional DNA extraction steps, thereby streamlining the laboratory process by reducing preparation time and costs. However, the reliability and efficacy of direct PCR for measuring host microbiomes have not yet been investigated other than in humans with 454 sequencing. Here, we conduct a comprehensive evaluation of the microbial communities obtained with direct PCR and the widely used Mo Bio PowerSoil DNA extraction kit in five distinct gut sample types (ileum, cecum, colon, feces, and cloaca) from 20 juvenile ostriches, using 16S rRNA Illumina MiSeq sequencing. We found that direct PCR was highly comparable over a range of measures to the DNA extraction method in cecal, colon, and fecal samples. However, the two methods significantly differed in samples with comparably low bacterial biomass: cloacal and especially ileal samples. We also sequenced 100 replicate sample pairs to evaluate repeatability during both extraction and PCR stages and found that both methods were highly consistent for cecal, colon, and fecal samples (rs > 0.7) but had low repeatability for cloacal (rs = 0.39) and ileal (rs = -0.24) samples. This study indicates that direct PCR provides a fast, cheap, and reliable alternative to conventional DNA extraction methods for retrieving 16S rRNA data, which can aid future gut microbiome studies. IMPORTANCE The microbial communities of animals can have large impacts on their hosts, and the number of studies using high-throughput sequencing to measure gut microbiomes is rapidly increasing. However, the library preparation procedure in microbiome research is both costly and

  13. Calibration of CNC milling machine by direct method

    Science.gov (United States)

    Khan, Abdul Wahid; Chen, Wuyi

    2008-12-01

    Calibration refers to the system of quantity value determination of instruments, equipments and test devices according to industrial requirement, based on metrological characteristics. In present research critical parameter which affects the accuracy and product quality of a CNC milling machine, was investigated and quantified by using direct method. These parameters consist of position dependent or position independent parameters, like linear displacement errors, angular errors of linear axes, straightness error of linear axes and squareness error between the axes. Repeatability, lead screw and resolution error of the CNC milling machine were also quantified to provide additional information to the user, because in absence of this additional information a misconception persists causing a major contributor to the inaccuracy and quality of the product. Parameters were measured and quantified by using a laser interferometer and artifacts as working standards under controlled environmental conditions on a manufacturing CNC milling machine. Polynomial regression analyses were carried out for finding the coefficients to predict the errors at each and every desired position which is quite useful for compensation and enhancing the accuracy of a machine system. Machine accuracy detailed chart was also made to assess and assure the accuracy, capability or for accuracy monitoring of the CNC milling machine

  14. Adjustment of a rapid method for quantification of Fusarium spp. spore suspensions in plant pathology.

    Science.gov (United States)

    Caligiore-Gei, Pablo F; Valdez, Jorge G

    2015-01-01

    The use of a Neubauer chamber is a broadly employed method when cell suspensions need to be quantified. However, this technique may take a long time and needs trained personnel. Spectrophotometry has proved to be a rapid, simple and accurate method to estimate the concentration of spore suspensions of isolates of the genus Fusarium. In this work we present a linear formula to relate absorbance measurements at 530nm with the number of microconidia/ml in a suspension. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  15. Rapid method for protein quantitation by Bradford assay after elimination of the interference of polysorbate 80.

    Science.gov (United States)

    Cheng, Yongfeng; Wei, Haiming; Sun, Rui; Tian, Zhigang; Zheng, Xiaodong

    2016-02-01

    Bradford assay is one of the most common methods for measuring protein concentrations. However, some pharmaceutical excipients, such as detergents, interfere with Bradford assay even at low concentrations. Protein precipitation can be used to overcome sample incompatibility with protein quantitation. But the rate of protein recovery caused by acetone precipitation is only about 70%. In this study, we found that sucrose not only could increase the rate of protein recovery after 1 h acetone precipitation, but also did not interfere with Bradford assay. So we developed a method for rapid protein quantitation in protein drugs even if they contained interfering substances. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Method Development for Rapid Analysis of Natural Radioactive Nuclides Using Sector Field Inductively Coupled Plasma Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Lim, J.M.; Ji, Y.Y.; Lee, H.; Park, J.H.; Jang, M.; Chung, K.H.; Kang, M.J.; Choi, G.S. [Korea Atomic Energy Research Institute (Korea, Republic of)

    2014-07-01

    As an attempt to reduce the social costs and apprehension arising from radioactivity in the environment, an accurate and rapid assessment of radioactivity is highly desirable. Naturally occurring radioactive materials (NORM) are widely spread throughout the environment. The concern with radioactivity from these materials has therefore been growing for the last decade. In particular, radiation exposure in the industry when handling raw materials (e.g., coal mining and combustion, oil and gas production, metal mining and smelting, mineral sands (REE, Ti, Zr), fertilizer (phosphate), and building materials) has been brought to the public's attention. To decide the proper handling options, a rapid and accurate analytical method that can be used to evaluate the radioactivity of radionuclides (e.g., {sup 238}U, {sup 235}U, {sup 232}Th, {sup 226}Ra, and {sup 40}K) should be developed and validated. Direct measuring methods such as alpha spectrometry, a liquid scintillation counter (LSC), and mass-spectrometry are usually used for the measurement of radioactivity in NORM samples, and they encounter the most significant difficulties during pretreatment (e.g., purification, speciation, and dilution/enrichment). Since the pretreatment process consequently plays an important role in the measurement uncertainty, method development and validation should be performed. Furthermore, a-spectrometry has a major disadvantage of a long counting time, while it has a prominent measurement capability at a very low activity level of {sup 238}U, {sup 235}U, {sup 232}Th, and {sup 226}Ra. Contrary to the α-spectrometry method, a measurement technique using ICP-MS allow radioactivity in many samples to be measured in a short time period with a high degree of accuracy and precision. In this study, a method was developed for a rapid analysis of natural radioactive nuclides using ICP-MS. A sample digestion process was established using LiBO{sub 2} fusion and Fe co-precipitation. A magnetic

  17. A TLC-Direct Bioautography Method for Detection of Antiurolithiatic Metabolites.

    Science.gov (United States)

    Patil, Anita Surendra; Paikrao, Hariprasad Madhukarrao; Kale, Ankit Subhash; Manik, Surendra Raghoba

    2017-05-01

    Hyperoxaluria is major urinary disorder troubling largest population throughout the world predominantly involving calcium oxalate (CaOx) crystals. Ancient Ayurvedic system of medicine in India claims better option in treatment of urolithiasis. A plant from "Pashanbheda" group is Phyllanthus niruri L., possessing antiurolithiatic activity, needed to be screened and validated. In the present study, a rapid, easy and efficient method for CaOx crystal inhibition in the agar gel system analogous to antimicrobial well diffusion assay is proposed. A novel thin-layer chromatography (TLC)-direct bioautography method was also proposed to detect the antilithiatic metabolites. It helps to localize the active metabolites in P. niruri, further the partial structure elucidation was characterized by High Resolution Liquid Chromatography by mass spectroscopy (LC-HRMS) analysis. The agar well diffusion method shows 50% inhibitory concentration (IC50) value at 228.55 and 493.529 mg/mL for tri-sodium citrate and P. niruri extract, respectively. The lowest concentration showing visible crystal inhibition (minimum inhibitory concentration, MIC) in both samples was found to be 20 mg/mL. In this study, a unique agar gel well diffusion and TLC-direct bioautography method successfully screened, detected and confirmed CaOx crystal inhibitory metabolites from P. niruri. The tuberonic acid was detected in bioactive fraction of P. niruri by LC-HRMS characterization. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R.; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely “powdered glass method” from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method’s applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666). PMID:26167854

  19. New modelling method for fast reactor neutronic behaviours analysis; Nouvelles methodes de modelisation neutronique des reacteurs rapides de quatrieme Generation

    Energy Technology Data Exchange (ETDEWEB)

    Jacquet, P.

    2011-05-23

    Due to safety rules running on fourth generation reactors' core development, neutronics simulation tools have to be as accurate as never before. First part of this report enumerates every step of fast reactor's neutronics simulation implemented in current reference code: ECCO. Considering the field of fast reactors that meet criteria of fourth generation, ability of models to describe self-shielding phenomenon, to simulate neutrons leakage in a lattice of fuel assemblies and to produce representative macroscopic sections is evaluated. The second part of this thesis is dedicated to the simulation of fast reactors' core with steel reflector. These require the development of advanced methods of condensation and homogenization. Several methods are proposed and compared on a typical case: the ZONA2B core of MASURCA reactor. (author) [French] Les criteres de surete qui regissent le developpement de coeurs de reacteurs de quatrieme generation implique l'usage d'outils de calcul neutronique performants. Une premiere partie de la these reprend toutes les etapes de modelisation neutronique des reacteurs rapides actuellement d'usage dans le code de reference ECCO. La capacite des modeles a decrire le phenomene d'autoprotection, a representer les fuites neutroniques au niveau d'un reseau d'assemblages combustibles et a generer des sections macroscopiques representatives est appreciee sur le domaine des reacteurs rapides innovants respectant les criteres de quatrieme generation. La deuxieme partie de ce memoire se consacre a la modelisation des coeurs rapides avec reflecteur acier. Ces derniers necessitent le developpement de methodes avancees de condensation et d'homogenisation. Plusieurs methodes sont proposees et confrontees sur un probleme de modelisation typique: le coeur ZONA2B du reacteur maquette MASURCA

  20. A rapid Salmonella detection method involving thermophilic helicase-dependent amplification and a lateral flow assay.

    Science.gov (United States)

    Du, Xin-Jun; Zhou, Tian-Jiao; Li, Ping; Wang, Shuo

    2017-08-01

    Salmonella is a major foodborne pathogen that is widespread in the environment and can cause serious human and animal disease. Since conventional culture methods to detect Salmonella are time-consuming and laborious, rapid and accurate techniques to detect this pathogen are critically important for food safety and diagnosing foodborne illness. In this study, we developed a rapid, simple and portable Salmonella detection strategy that combines thermophilic helicase-dependent amplification (tHDA) with a lateral flow assay to provide a detection result based on visual signals within 90 min. Performance analyses indicated that the method had detection limits for DNA and pure cultured bacteria of 73.4-80.7 fg and 35-40 CFU, respectively. Specificity analyses showed no cross reactions with Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Enterobacter aerogenes, Shigella and Campylobacter jejuni. The results for detection in real food samples showed that 1.3-1.9 CFU/g or 1.3-1.9 CFU/mL of Salmonella in contaminated chicken products and infant nutritional cereal could be detected after 2 h of enrichment. The same amount of Salmonella in contaminated milk could be detected after 4 h of enrichment. This tHDA-strip can be used for the rapid detection of Salmonella in food samples and is particularly suitable for use in areas with limited equipment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Rocket nozzle lip flow by direct simulation Monte Carlo method

    Science.gov (United States)

    Hueser, J. E.; Brock, F. J.; Melfi, L. T., Jr.; Bird, G. A.

    1985-01-01

    The flow in the immediate vicinity of a rocket nozzle lip has been analyzed, and the results are presented. A rapid change in gas composition is observed in the flow around the lip depending principally on species molecular mass and local flow angle. The divergence of axial and radial temperatures indicating breakdown of translational equilibrium is observed in the results.

  2. Application of rapid cloud point extraction method for trace cobalt analysis coupled with spectrophotometric determination

    Science.gov (United States)

    Wen, Xiaodong; He, Lei; Shi, Chunsheng; Deng, Qingwen; Wang, Jiwei; Zhao, Xia

    2013-11-01

    In this work, the analytical performance of conventional spectrophotometer was improved through the coupling of effective preconcentration method with spectrophotometric determination. Rapidly synergistic cloud point extraction (RS-CPE) was used to pre-concentrate ultra trace cobalt and firstly coupled with spectrophotometric determination. The developed coupling was simple, rapid and efficient. The factors influencing RS-CPE and spectrophotometer were optimized. Under the optimal conditions, the limit of detection (LOD) was 0.6 μg L-1, with sensitivity enhancement factor of 23. The relative standard deviation (RSD) for seven replicate measurements of 50 μg L-1 of cobalt was 4.3%. The recoveries for the spiked samples were in the acceptable range of 93.8-105%.

  3. A rapid method for counting nucleated erythrocytes on stained blood smears by digital image analysis

    Science.gov (United States)

    Gering, E.; Atkinson, C.T.

    2004-01-01

    Measures of parasitemia by intraerythrocytic hematozoan parasites are normally expressed as the number of infected erythrocytes per n erythrocytes and are notoriously tedious and time consuming to measure. We describe a protocol for generating rapid counts of nucleated erythrocytes from digital micrographs of thin blood smears that can be used to estimate intensity of hematozoan infections in nonmammalian vertebrate hosts. This method takes advantage of the bold contrast and relatively uniform size and morphology of erythrocyte nuclei on Giemsa-stained blood smears and uses ImageJ, a java-based image analysis program developed at the U.S. National Institutes of Health and available on the internet, to recognize and count these nuclei. This technique makes feasible rapid and accurate counts of total erythrocytes in large numbers of microscope fields, which can be used in the calculation of peripheral parasitemias in low-intensity infections.

  4. [Three-Iindex-Value Method for Rapid Screening Unqualified Vegetable Oil].

    Science.gov (United States)

    He, Wen-xuan; Hong, Gui-shui; Fang, Run; Cai, Xian-chun; Huang, Sheng

    2015-04-01

    In the present study, by measuring the A3 005 (representing unsaturation), A985 (representing conjugated fatty acids), A960 + A985 (representing trans-fatty acid ) of southern common vegetable oils (peanut oil, corn oil, canola oil, soybean oil, sunflower oil, tea seed oil and olive oil), "waste oil" and overdue vegetable oils, the pass-setting-range of these three index values for the vegetable oils was obtained. On this basis, a method for rapid screening unqualified vegetable oil (expired, adding low-cost oil, adding "waste oil") was established. The method effectively improved the monitoring efficiency of vegetable oil. With this method of screening a number of suspected substandard oils were proved unqualified by determination of fatty acid composition and 11, 12, 13, 17 fatty acid content. Through the combination of several detection methods, the causes for disqualification of vegetable oils can be further inferred.

  5. Rapid and sensitive liquid chromatography-mass spectrometry method for determination of ropinirole in human plasma.

    Science.gov (United States)

    Bhatt, Jignesh; Jangid, Arvind; Shetty, Raghavendra; Shah, Bhavin; Kambli, Sandeep; Subbaiah, Gunta; Singh, Sadhana

    2006-03-18

    A rapid and robust liquid chromatography-mass spectrometry (LC-MS/MS) method was developed for non-ergoline dopamine D(2)-receptor agonist, ropinirole in human plasma using Es-citalopram oxalate as an internal standard. The method involves solid phase extraction from plasma, reversed-phase simple isocratic chromatographic conditions and mass spectrometric detection that enables a detection limit at picogram levels. The proposed method was validated with linear range of 20-1,200 pg/ml. The extraction recoveries for ropinirole and internal standard were 90.45 and 65.42%, respectively. The R.S.D.% of intra-day and inter-day assay was lower than 15%. For its sensitivity and reliability, the proposed method is particularly suitable for pharmacokinetic studies.

  6. Purification of crude glycerol from transesterification reaction of palm oil using direct method and multistep method

    Science.gov (United States)

    Nasir, N. F.; Mirus, M. F.; Ismail, M.

    2017-09-01

    Crude glycerol which produced from transesterification reaction has limited usage if it does not undergo purification process. It also contains excess methanol, catalyst and soap. Conventionally, purification method of the crude glycerol involves high cost and complex processes. This study aimed to determine the effects of using different purification methods which are direct method (comprises of ion exchange and methanol removal steps) and multistep method (comprises of neutralization, filtration, ion exchange and methanol removal steps). Two crude glycerol samples were investigated; the self-produced sample through the transesterification process of palm oil and the sample obtained from biodiesel plant. Samples were analysed using Fourier Transform Infrared Spectroscopy, Gas Chromatography and High Performance Liquid Chromatography. The results of this study for both samples after purification have showed that the pure glycerol was successfully produced and fatty acid salts were eliminated. Also, the results indicated the absence of methanol in both samples after purification process. In short, the combination of 4 purification steps has contributed to a higher quality of glycerol. Multistep purification method gave a better result compared to the direct method as neutralization and filtration steps helped in removing most excess salt, fatty acid and catalyst.

  7. A Novel Laser Direct Writing System Integrated with A&F XXY Alignment Platform for Rapid Fabrication of Flexible Electronics

    Directory of Open Access Journals (Sweden)

    Yi-Kai Liu

    2015-05-01

    Full Text Available In this study, a novel laser direct synthesis and pattering technology is applied in conjunction with an A&F XXY alignment platform to rapidly fabricate flexible conductors on a polymer substrate (polyimide film with designated patterns. In the process, a focused continuous wave green laser was focused onto the polymer substrate that is mounted and directed using the XXY alignment platform. The focused laser energy absorbed by the polymer substrate is used to heat the transparent and particle-free reactive silver ink on the polymer substrate surface. With appropriate programing of the XXY alignment platform motion to control the laser scanning parameters, silver patterns with good electrical conductivity were successfully obtained. This technology can be operated directly at atmospheric pressure and room temperature. It does not require the use of vacuum chamber, oven and photo-mask, etc. Therefore, this novel technology and system offers a new approach to the cost-effective and green fabrication for flexible electronics. The compact size and excellent stability of the XXY alignment platform make the fabrication system even more competitive. In particular, the programmable small radius plane rotation function of the XXY alignment platform provides flexibility in the pattern design with turnings while keeps the uniformity of the resulted micro metal lines.

  8. Simple and rapid methods for detecting Salmonella enteritidis in raw eggs.

    Science.gov (United States)

    Seo, Kun-Ho; Holt, Peter S; Stone, Henry D; Gast, Richard K

    2003-10-15

    The Centers for Disease Control and Prevention estimates there were 300,000 cases of Salmonella enteritidis (SE) in 1997. Egg products were associated with many of the cases. To address this problem, many producers implemented flock surveillance of the SE situation at their facilities. A rapid and simple method for detecting SE from poultry samples is critical for the effective implementation of such testing strategies. A lateral flow device for the detection of SE utilized in this study was manufactured by Neogen, Lansing, MI. The test panel is a presumptive qualitative test system that detects only members of Group D1 Salmonella species. A series of studies were conducted to optimize the test procedure for raw eggs with different sample preparations. A novel antigen extraction method was developed for use with the test panel kit. The detection limit of the test panel kit was increased approximately tenfold when the extraction method was used. Detection of SE was 100% in raw egg pools inoculated with 10 SE cells per ml of egg and incubated at a 1:10 ratio in buffered peptone water (BPW) or tetrathionate brilliant green broth (TBG) for 24 h at 37 degrees C. The developed lateral flow test kit could provide a simple, rapid, and inexpensive method for egg producers and processors to test specifically for Salmonella group D1 serovars, such as SE, in egg samples.

  9. Use of refractometry and colorimetry as field methods to rapidly assess antimalarial drug quality.

    Science.gov (United States)

    Green, Michael D; Nettey, Henry; Villalva Rojas, Ofelia; Pamanivong, Chansapha; Khounsaknalath, Lamphet; Grande Ortiz, Miguel; Newton, Paul N; Fernández, Facundo M; Vongsack, Latsamy; Manolin, Ot

    2007-01-04

    The proliferation of counterfeit and poor-quality drugs is a major public health problem; especially in developing countries lacking adequate resources to effectively monitor their prevalence. Simple and affordable field methods provide a practical means of rapidly monitoring drug quality in circumstances where more advanced techniques are not available. Therefore, we have evaluated refractometry, colorimetry and a technique combining both processes as simple and accurate field assays to rapidly test the quality of the commonly available antimalarial drugs; artesunate, chloroquine, quinine, and sulfadoxine. Method bias, sensitivity, specificity and accuracy relative to high-performance liquid chromatographic (HPLC) analysis of drugs collected in the Lao PDR were assessed for each technique. The HPLC method for each drug was evaluated in terms of assay variability and accuracy. The accuracy of the combined method ranged from 0.96 to 1.00 for artesunate tablets, chloroquine injectables, quinine capsules, and sulfadoxine tablets while the accuracy was 0.78 for enterically coated chloroquine tablets. These techniques provide a generally accurate, yet simple and affordable means to assess drug quality in resource-poor settings.

  10. Direct Survival Analysis: a new stock assessment method

    Directory of Open Access Journals (Sweden)

    Eduardo Ferrandis

    2007-03-01

    Full Text Available In this work, a new stock assessment method, Direct Survival Analysis, is proposed and described. The parameter estimation of the Weibull survival model proposed by Ferrandis (2007 is obtained using trawl survey data. This estimation is used to establish a baseline survival function, which is in turn used to estimate the specific survival functions in the different cohorts considered through an adaptation of the separable model of the fishing mortality rates introduced by Pope and Shepherd (1982. It is thus possible to test hypotheses on the evolution of survival during the period studied and to identify trends in recruitment. A link is established between the preceding analysis of trawl survey data and the commercial catch-at-age data that are generally obtained to evaluate the population using analytical models. The estimated baseline survival, with the proposed versions of the stock and catch equations and the adaptation of the Separable Model, may be applied to commercial catch-at-age data. This makes it possible to estimate the survival corresponding to the landing data, the initial size of the cohort and finally, an effective age of first capture, in order to complete the parameter model estimation and consequently the estimation of the whole survival and mortality, along with the reference parameters that are useful for management purposes. Alternatively, this estimation of an effective age of first capture may be obtained by adapting the demographic structure of trawl survey data to that of the commercial fleet through suitable selectivity models of the commercial gears. The complete model provides the evaluation of the stock at any age. The coherence (and hence the mutual “calibration” between the two kinds of information may be analysed and compared with results obtained by other methods, such as virtual population analysis (VPA, in order to improve the diagnosis of the state of exploitation of the population. The model may be

  11. Rapid and simple methods for quantitative analysis of some antidepressant in pharmaceutical formulations by using first derivative spectrophotometry and HPLC.

    Science.gov (United States)

    Erk, Nevin

    2003-12-01

    Two rapid, simple and accurate first derivative spectrophotometry and HPLC method for the determination of nefazodone hydrochloride and sertraline hydrochloride in pharmaceutical formulations are discussed. The first one is a derivative spectrophotometric procedure and the second one is based on a HPLC method with a UV detector. In the first method, first derivative spectrophotometry, nefazodone hydrochloride or sertraline hydrochloride by measurement of their first derivative signals at 241.8-256.7 nm (peak-to-peak amplitude), or 271.6-275.5 nm (peak-to-peak amplitude), respectively. Calibration graphs were established for 10.0-42.0 microg ml(-1) nefazodone hydrochloride, or 8.0-46.0 microg ml(-1) sertraline hydrochloride. In the other method, HPLC, the UV detection was carried out at 265.0 nm (nefazodone hydrochloride) and 270.0 nm (sertraline hydrochloride). The samples were chromatographed on a Supercosil RP-18 column. The mobile phases were methanol:acetonitrile:phosphate buffer at pH 5.5 (10:50:40 v/v/v) (nefazodone hydrochloride) and methanol:phosphate buffer at pH 4.5 (20:80 v/v) (sertraline hydrochloride). The results obtained from first derivative spectrophotometric method were comparable with those obtained by using HPLC. It was concluded that both the developed methods are equally accurate, sensitive, and precision could be applied directly and easily to the pharmaceutical formulations of nefazodone hydrochloride and sertraline hydrochloride, respectively.

  12. Non-supervised method for early forest fire detection and rapid mapping

    Science.gov (United States)

    Artés, Tomás; Boca, Roberto; Liberta, Giorgio; San-Miguel, Jesús

    2017-09-01

    Natural hazards are a challenge for the society. Scientific community efforts have been severely increased assessing tasks about prevention and damage mitigation. The most important points to minimize natural hazard damages are monitoring and prevention. This work focuses particularly on forest fires. This phenomenon depends on small-scale factors and fire behavior is strongly related to the local weather. Forest fire spread forecast is a complex task because of the scale of the phenomena, the input data uncertainty and time constraints in forest fire monitoring. Forest fire simulators have been improved, including some calibration techniques avoiding data uncertainty and taking into account complex factors as the atmosphere. Such techniques increase dramatically the computational cost in a context where the available time to provide a forecast is a hard constraint. Furthermore, an early mapping of the fire becomes crucial to assess it. In this work, a non-supervised method for forest fire early detection and mapping is proposed. As main sources, the method uses daily thermal anomalies from MODIS and VIIRS combined with land cover map to identify and monitor forest fires with very few resources. This method relies on a clustering technique (DBSCAN algorithm) and on filtering thermal anomalies to detect the forest fires. In addition, a concave hull (alpha shape algorithm) is applied to obtain rapid mapping of the fire area (very coarse accuracy mapping). Therefore, the method leads to a potential use for high-resolution forest fire rapid mapping based on satellite imagery using the extent of each early fire detection. It shows the way to an automatic rapid mapping of the fire at high resolution processing as few data as possible.

  13. Rapid detection by direct analysis in real time-mass spectrometry (DART-MS) of psychoactive plant drugs of abuse: the case of Mitragyna speciosa aka "Kratom".

    Science.gov (United States)

    Lesiak, Ashton D; Cody, Robert B; Dane, A John; Musah, Rabi A

    2014-09-01

    Mitragyna speciosa, also known commonly as "Kratom" or "Ketum", is a plant with psychoactive properties that have been attributed to the presence of various indole alkaloids such as mitragynine and 7-hydroxymitragynine. M. speciosa use is gaining popularity internationally as a natural and legal alternative to narcotics. As a drug of abuse, its detection and identification are not straightforward, since M. speciosa plant material is not particularly distinctive. Here, we show that direct analysis in real time-mass spectrometry (DART-MS) can be used not only to rapidly identify M. speciosa plant material and distinguish it from other plants, but also to distinguish between M. speciosa plant varieties, based on differences between their chemical profiles. The method is rapid and the analysis expeditious. Plant material such as that found at a crime scene can be analyzed directly with no sample pre-preparation steps. Furthermore, we show that the basis set of principal components that permit characterization of the plant material can be used to positively identify M. speciosa. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Dynamics of rapid dopamine release in the nucleus accumbens during goal-directed behaviors for cocaine versus natural rewards.

    Science.gov (United States)

    Cameron, Courtney M; Wightman, R Mark; Carelli, Regina M

    2014-11-01

    Electrophysiological studies show that distinct subsets of nucleus accumbens (NAc) neurons differentially encode information about goal-directed behaviors for intravenous cocaine versus natural (food/water) rewards. Further, NAc rapid dopamine signaling occurs on a timescale similar to phasic cell firing during cocaine and natural reward-seeking behaviors. However, it is not known whether dopamine signaling is reinforcer specific (i.e., is released during responding for only one type of reinforcer) within discrete NAc locations, similar to neural firing dynamics. Here, fast-scan cyclic voltammetry (FSCV) was used to measure rapid dopamine release during multiple schedules involving sucrose reward and cocaine self-administration (n = 8 rats) and, in a separate group of rats (n = 6), during a sucrose/food multiple schedule. During the sucrose/cocaine multiple schedule, dopamine increased within seconds of operant responding for both reinforcers. Although dopamine release was not reinforcer specific, more subtle differences were observed in peak dopamine concentration [DA] across reinforcer conditions. Specifically, peak [DA] was higher during the first phase of the multiple schedule, regardless of reinforcer type. Further, the time to reach peak [DA] was delayed during cocaine-responding compared to sucrose. During the sucrose/food multiple schedule, increases in dopamine release were also observed relative to operant responding for both natural rewards. However, peak [DA] was higher relative to responding for sucrose than food, regardless of reinforcer order. Overall, the results reveal the dynamics of rapid dopamine signaling in discrete locations in the NAc across reward conditions, and provide novel insight into the functional role of this system in reward-seeking behaviors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Loco-regional cancer drug therapy: present approaches and rapidly reversible hydrophobization (RRH) of therapeutic agents as the future direction.

    Science.gov (United States)

    Budker, Vladimir G; Monahan, Sean D; Subbotin, Vladimir M

    2014-12-01

    Insufficient drug uptake by solid tumors remains the major problem for systemic chemotherapy. Many studies have demonstrated anticancer drug effects to be dose-dependent, although dose-escalation studies have resulted in limited survival benefit with increased systemic toxicities. One solution to this has been the idea of loco-regional drug treatments, which offer dramatically higher drug concentrations in tumor tissues while minimizing systemic toxicity. Although loco-regional delivery has been most prominent in cancers of the liver, soft tissues and serosal peritoneal malignancies, survival benefits are very far from desirable. This review discusses the evolution of loco-regional treatments, the present approaches and offers rapidly reversible hydrophobization of drugs as the new future direction. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Novel Design Integrating a Microwave Applicator into a Crystallizer for Rapid Temperature Cycling. A Direct Nucleation Control Study

    Science.gov (United States)

    2017-01-01

    The control of nucleation in crystallization processes is a challenging task due to the often lacking knowledge on the process kinetics. Inflexible (predetermined) control strategies fail to grow the nucleated crystals to the desired quality because of the variability in the process conditions, disturbances, and the stochastic nature of crystal nucleation. Previously, the concept of microwave assisted direct nucleation control (DNC) was demonstrated in a laboratory setup to control the crystal size distribution in a batch crystallization process by manipulating the number of particles in the system. Rapid temperature cycling was used to manipulate the super(under)saturation and hence the number of crystals. The rapid heating response achieved with the microwave heating improved the DNC control efficiency, resulting in halving of the batch time. As an extension, this work presents a novel design in which the microwave applicator is integrated in the crystallizer, hence avoiding the external loop though the microwaves oven. DNC implemented in the 4 L unseeded crystallizer, at various count set points, resulted in strong efficiency enhancement of DNC, when compared to the performance with a slow responding system. The demonstrated crystallizer design is a basis for extending the enhanced process control opportunity to other applications. PMID:28729813

  17. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-01

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  18. Rapid detection of carbapenemase production in Enterobacteriaceae using a modified paper strip Carba NP method.

    Science.gov (United States)

    Ho, Pak-Leung; Wang, Ya; Tse, Cindy Wing-Sze; Fung, Kitty Sau-Chun; Cheng, Vincent Ch-Chung; Lee, Rodney; To, Wing-Kin; Lai, Raymond Wai-Man; Luk, Wei-Kwang; Que, Tak-Lun; Tsang, Dominic Ngai-Chong

    2017-10-25

    Rapid and accurate detection of carbapenemase-producing Enterobacteriaceae (CPE) is important for preventing their spread in healthcare settings. We compared the performance of the Carba NP test using the CLSI tube method with that using a modified paper strip method for detection of carbapenemase in 390 Enterobacteriaceae isolates. The isolates were identified by Hong Kong's carbapenem-resistant Enterobacteriaceae surveillance program in 2016 and comprised 213 CPE and 177 carbapenemase-negative Enterobacteriaceae Molecular genotype was used as the reference. Test results were read at different time points for the CLSI method (1 min, 5 min, 1 h and 2 h) and strip method (1 min, 5 min). The strip CNP and CLSI CNP tests correctly detect carbapenemase production in 93% and 93% KPC producers, 100% and 38% IMI producers, 94% and 85% IMP producers, 98% and 90% NDM producers, and, 29% and 12% OXA producers, respectively. Overall, the strip method has superior sensitivity than the CLSI method (86% vs. 75%, respectively, P NP test using the modified strip method has a higher sensitivity and a shorter assay time than using the CLSI tube method. Copyright © 2017 American Society for Microbiology.

  19. Rapid screening and quantification of residual pesticides and illegal adulterants in red wine by direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Guo, Tianyang; Fang, Pingping; Jiang, Juanjuan; Zhang, Feng; Yong, Wei; Liu, Jiahui; Dong, Yiyang

    2016-11-04

    A rapid method to screen and quantify multi-class analytic targets in red wine has been developed by direct analysis in real time (DART) coupled with triple quadruple tandem mass spectrometry (QqQ-MS). A modified QuEChERS (Quick, Easy, Cheap, Effective, Rugged, and Safe) procedure was used for increasing analytical speed and reducing matrix effect, and the multiple reaction monitoring (MRM) in DART-MS/MS ensured accurate analysis. One bottle of wine containing 50 pesticides and 12 adulterants, i.e., preservatives, antioxidant, sweeteners, and azo dyes, could be totally determined less than 12min. This method exhibited proper linearity (R2≥0.99) in the range of 1-1000ng/mL for pesticides and 10-5000ng/mL for adulterants. The limits of detection (LODs) were obtained in a 0.5-50ng/mL range for pesticides and 5-50ng/mL range for adulterants, and the limits of quantification (LOQs) were in a 1-100ng/mL range for pesticides and 10-250ng/mL range for adulterants. Three spiked levels for each analyte in wine were evaluated, and the recoveries were in a scope of 75-120%. The results demonstrated DART-MS/MS was a rapid and simple method, and could be applied to rapid analyze residual pesticides and illegal adulterants in a large quantities of red wine. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Rapid Staining Method to Detect and Identify Downy Mildew (Peronospora belbahrii in Basil

    Directory of Open Access Journals (Sweden)

    Adolfina R. Koroch

    2013-07-01

    Full Text Available Premise of the study: Demand for fresh-market sweet basil continues to increase, but in 2009 a new pathogen emerged, threatening commercial field/greenhouse production and leading to high crop losses. This study describes a simple and effective staining method for rapid microscopic detection of basil downy mildew (Peronospora belbahrii from leaves of basil (Ocimum basilicum. Methods and Results: Fresh leaf sections infected with P. belbahrii were placed on a microscope slide, cleared with Visikol™, and stained with iodine solution followed by one drop of 70% sulfuric acid. Cell walls of the pathogen were stained with a distinct coloration, providing a high-contrast image between the pathogen and plant. Conclusions: This new staining method can be used successfully to identify downy mildew in basil, which then can significantly reduce its spread if identified early, coupled with mitigation strategies. This technique can facilitate the control of the disease, without expensive and specialized equipment.

  1. Large Rapidity Gap Method to Select Soft Diffraction Dissociation at the LHC

    Directory of Open Access Journals (Sweden)

    Emily Nurse

    2016-01-01

    Full Text Available In proton-proton (pp collisions, any process involves exchanging the vacuum quantum numbers is known as diffractive process. A diffractive process with no large Q2 is called soft diffractive process. The diffractive processes are important for understanding nonperturbative QCD effects and they also constitute a significant fraction of the total pp cross section. The diffractive events are typically characterized by a region of the detector without particles, known as a rapidity gap. In order to observe diffractive events in this way, we consider the pseudorapidity acceptance in the forward region of the ATLAS and CMS detectors at the Large Hadron Collider (LHC and discuss the methods to select soft diffractive dissociation for pp collisions at s=7 TeV. It is shown that, in the limited detector rapidity acceptance, it is possible to select diffractive dissociation events by requiring a rapidity gap in the event; however, without using forward detectors, it seems not possible to fully separate single and double diffractive dissociation events. The Zero Degree Calorimeters can be used to distinguish the type of the diffractive processes up to a certain extent.

  2. Hierarchically rough, mechanically durable and superhydrophobic epoxy coatings through rapid evaporation spray method

    Energy Technology Data Exchange (ETDEWEB)

    Simovich, Tomer; Wu, Alex H.; Lamb, Robert N., E-mail: rnlamb@unimelb.edu.au

    2015-08-31

    A mechanically durable and scalable superhydrophobic coating was fabricated by combining the advantages of both bottom-up and top-down approaches into a one-pot, one-step application method. This is achieved by spray coating a solution consisting of silica nanoparticles, which are embedded within epoxy resin, onto a heated substrate to rapidly drive both solvent evaporation and curing simultaneously. By maintaining a high substrate temperature, the arrival of spray-delivered micrometer-sized droplets are rapidly cured onto the substrate to form surface microroughness, while simultaneously, rapid solvent evaporation within each droplet results in the formation of a nanoporous structure. SEM, dual-beam FIB, and cross-sectional TEM/EDAX elemental mapping were used to confirm both the chemistry and the requisite micro- and nano-porosity within the coating structure requisite for superhydrophobicity. The resultant coatings exhibit contact angles greater than 150° (153.8° ± 0.8°) and roll-off angles of 8° ± 2°, with a coating hardness of 6H on the pencil hardness scale, and a rating of 5 on an ASTM crosshatch test. - Highlights: • A highly superhydrophobic coating was fabricated utilizing epoxy and nanoparticles. • The coating was demonstrated to be very durable and abrasion resistant. • The fabrication involves a novel, scalable one-pot synthesis technique.

  3. Rapid Method for Ra-226 and Ra-228 in Water Samples

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod, L. III

    2006-02-10

    The measurement of radium isotopes in natural waters is important for oceanographic studies and for public health reasons. Ra-226 (1620 year half-life) is one of the most toxic of the long-lived alpha emitters present in the environment due to its long life and its tendency to concentrate in bones, which increases the internal radiation dose of individuals. The analysis of radium-226 and radium-228 in natural waters can be tedious and time-consuming. Different sample preparation methods are often required to prepare Ra-226 and Ra-228 for separate analyses. A rapid method has been developed at the Savannah River Environmental Laboratory that effectively separates both Ra-226 and Ra-228 (via Ac-228) for assay. This method uses MnO{sub 2} Resin from Eichrom Technologies (Darien, IL, USA) to preconcentrate Ra-226 and Ra-228 rapidly from water samples, along with Ba-133 tracer. DGA Resin{reg_sign} (Eichrom) and Ln-Resin{reg_sign} (Eichrom) are employed in tandem to prepare Ra-226 for assay by alpha spectrometry and to determine Ra-228 via the measurement of Ac-228 by gas proportional counting. After preconcentration, the manganese dioxide is dissolved from the resin and passed through stacked Ln-Resin-DGA Resin cartridges that remove uranium and thorium interferences and retain Ac-228 on DGA Resin. The eluate that passed through this column is evaporated, redissolved in a lower acidity and passed through Ln-Resin again to further remove interferences before performing a barium sulfate microprecipitation. The Ac-228 is stripped from the resin, collected using cerium fluoride microprecipitation and counted by gas proportional counting. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  4. A rapid and sensitive method for measuring N-acetylglucosaminidase activity in cultured cells.

    Directory of Open Access Journals (Sweden)

    Victor Mauri

    Full Text Available A rapid and sensitive method to quantitatively assess N-acetylglucosaminidase (NAG activity in cultured cells is highly desirable for both basic research and clinical studies. NAG activity is deficient in cells from patients with Mucopolysaccharidosis type IIIB (MPS IIIB due to mutations in NAGLU, the gene that encodes NAG. Currently available techniques for measuring NAG activity in patient-derived cell lines include chromogenic and fluorogenic assays and provide a biochemical method for the diagnosis of MPS IIIB. However, standard protocols require large amounts of cells, cell disruption by sonication or freeze-thawing, and normalization to the cellular protein content, resulting in an error-prone procedure that is material- and time-consuming and that produces highly variable results. Here we report a new procedure for measuring NAG activity in cultured cells. This procedure is based on the use of the fluorogenic NAG substrate, 4-Methylumbelliferyl-2-acetamido-2-deoxy-alpha-D-glucopyranoside (MUG, in a one-step cell assay that does not require cell disruption or post-assay normalization and that employs a low number of cells in 96-well plate format. We show that the NAG one-step cell assay greatly discriminates between wild-type and MPS IIIB patient-derived fibroblasts, thus providing a rapid method for the detection of deficiencies in NAG activity. We also show that the assay is sensitive to changes in NAG activity due to increases in NAGLU expression achieved by either overexpressing the transcription factor EB (TFEB, a master regulator of lysosomal function, or by inducing TFEB activation chemically. Because of its small format, rapidity, sensitivity and reproducibility, the NAG one-step cell assay is suitable for multiple procedures, including the high-throughput screening of chemical libraries to identify modulators of NAG expression, folding and activity, and the investigation of candidate molecules and constructs for applications in

  5. An evaluation of rapid methods for monitoring vegetation characteristics of wetland bird habitat

    Science.gov (United States)

    Tavernia, Brian G.; Lyons, James E.; Loges, Brian W.; Wilson, Andrew; Collazo, Jaime A.; Runge, Michael C.

    2016-01-01

    Wetland managers benefit from monitoring data of sufficient precision and accuracy to assess wildlife habitat conditions and to evaluate and learn from past management decisions. For large-scale monitoring programs focused on waterbirds (waterfowl, wading birds, secretive marsh birds, and shorebirds), precision and accuracy of habitat measurements must be balanced with fiscal and logistic constraints. We evaluated a set of protocols for rapid, visual estimates of key waterbird habitat characteristics made from the wetland perimeter against estimates from (1) plots sampled within wetlands, and (2) cover maps made from aerial photographs. Estimated percent cover of annuals and perennials using a perimeter-based protocol fell within 10 percent of plot-based estimates, and percent cover estimates for seven vegetation height classes were within 20 % of plot-based estimates. Perimeter-based estimates of total emergent vegetation cover did not differ significantly from cover map estimates. Post-hoc analyses revealed evidence for observer effects in estimates of annual and perennial covers and vegetation height. Median time required to complete perimeter-based methods was less than 7 percent of the time needed for intensive plot-based methods. Our results show that rapid, perimeter-based assessments, which increase sample size and efficiency, provide vegetation estimates comparable to more intensive methods.

  6. wzi Gene Sequencing, a Rapid Method for Determination of Capsular Type for Klebsiella Strains

    Science.gov (United States)

    Passet, Virginie; Haugaard, Anita Björk; Babosan, Anamaria; Kassis-Chikhani, Najiby; Struve, Carsten; Decré, Dominique

    2013-01-01

    Pathogens of the genus Klebsiella have been classified into distinct capsular (K) types for nearly a century. K typing of Klebsiella species still has important applications in epidemiology and clinical microbiology, but the serological method has strong practical limitations. Our objective was to evaluate the sequencing of wzi, a gene conserved in all capsular types of Klebsiella pneumoniae that codes for an outer membrane protein involved in capsule attachment to the cell surface, as a simple and rapid method for the prediction of K type. The sequencing of a 447-nucleotide region of wzi distinguished the K-type reference strains with only nine exceptions. A reference wzi sequence database was created by the inclusion of multiple strains representing K types associated with high virulence and multidrug resistance. A collection of 119 prospective clinical isolates of K. pneumoniae were then analyzed in parallel by wzi sequencing and classical K typing. Whereas K typing achieved typeability for 81% and discrimination for 94.4% of the isolates, these figures were 98.1% and 98.3%, respectively, for wzi sequencing. The prediction of K type once the wzi allele was known was 94%. wzi sequencing is a rapid and simple method for the determination of the K types of most K. pneumoniae clinical isolates. PMID:24088853

  7. A rapid method for measuring soil water content in the field with a areometer

    Directory of Open Access Journals (Sweden)

    Calbo Adonai Gimenez

    2002-01-01

    Full Text Available The availability of a rapid method to evaluate the soil water content (U can be an important tool to determine the moment to irrigate. The soil areometer consists of an elongated hydrostatic balance with a weighing pan, a graduated neck, a float and a pynometric flask. In this work an areometer was adapted to rapidly measure soil water content without the need of drying the soil. The expression U = (M A - M AD/(M M -M A was used to calculate the soil water content. In this equation M M is the mass to level the areometer with the pycnometric flask filled with water, M A the mass to level the areometer with a mass M M of soil in the pycnometer, the volume being completed with water, and similarly M AD the mass added to the pan to level the areometer with a mass M M of dried soil in the pycnometric flask. The convenience of this method is that the values M M and M AD are known. Consequently, the decision on irrigation can be made after a measurement that takes, about, ten minutes. The procedure involves only stirring the soil with water for at least 2 minutes to remove the adhered air. The soil water content data obtained with the areometric method were similar to those obtained weighing the soil before and after drying to constant weight, in an oven at 105º C.

  8. Stress and displacement patterns in the craniofacial skeleton with rapid maxillary expansion—a finite element method study

    Directory of Open Access Journals (Sweden)

    J. Priyadarshini

    2017-07-01

    Full Text Available Abstract Background Rapid maxillary expansion (RME, indicated in the treatment of maxillary deficiency directs high forces to maxillary basal bone and to other adjacent skeletal bones. The aim of this study is to (i evaluate stress distribution along craniofacial sutures and (ii study the displacement of various craniofacial structures with rapid maxillary expansion therapy by using a Finite Element model. Methods An analytical model was developed from a dried human skull of a 12 year old male. CT scan images of the skull were taken in axial direction parallel to the F-H plane at 1 mm interval, processed using Mimics software, required portion of the skull was exported into stereo-lithography model. ANSYS software was used to solve the mathematical equation. Contour plots of the displacement and stresses were obtained from the results of the analysis performed. Results At Node 47005, maximum X-displacement was 5.073 mm corresponding to the incisal edge of the upper central incisor. At Node 3971, maximum negative Y-displacement was -0.86 mm which corresponds to the anterior zygomatic arch, indicating posterior movement of craniofacial complex. At Node 32324, maximum negative Z-displacement was -0.92 mm representing the anterior and deepest convex portion of the nasal septum; indicating downward displacement of structures medial to the area of force application. Conclusions Pyramidal displacement of maxilla was evident. Apex of pyramid faced the nasal bone and base was located on the oral side. Posterosuperior part of nasal cavity moved minimally in lateral direction and width of nasal cavity at the floor of the nose increased, there was downward and forward movement of maxilla with a tendency toward posterior rotation. Maximum von Mises stresses were found along midpalatal, pterygomaxillary, nasomaxillary and frontomaxillary sutures.

  9. Rapid Automatic Lighting Control of a Mixed Light Source for Image Acquisition using Derivative Optimum Search Methods

    Directory of Open Access Journals (Sweden)

    Kim HyungTae

    2015-01-01

    Full Text Available Automatic lighting (auto-lighting is a function that maximizes the image quality of a vision inspection system by adjusting the light intensity and color.In most inspection systems, a single color light source is used, and an equal step search is employed to determine the maximum image quality. However, when a mixed light source is used, the number of iterations becomes large, and therefore, a rapid search method must be applied to reduce their number. Derivative optimum search methods follow the tangential direction of a function and are usually faster than other methods. In this study, multi-dimensional forms of derivative optimum search methods are applied to obtain the maximum image quality considering a mixed-light source. The auto-lighting algorithms were derived from the steepest descent and conjugate gradient methods, which have N-size inputs of driving voltage and one output of image quality. Experiments in which the proposed algorithm was applied to semiconductor patterns showed that a reduced number of iterations is required to determine the locally maximized image quality.

  10. Baryon interactions in lattice QCD: the direct method vs. the HAL QCD potential method

    CERN Document Server

    Iritani, Takumi

    2016-01-01

    We make a detailed comparison between the direct method and the HAL QCD potential method for the baryon-baryon interactions, taking the $\\Xi\\Xi$ system at $m_\\pi= 0.51$ GeV in 2+1 flavor QCD and using both smeared and wall quark sources. The energy shift $\\Delta E_\\mathrm{eff}(t)$ in the direct method shows the strong dependence on the choice of quark source operators, which means that the results with either (or both) source are false. The time-dependent HAL QCD method, on the other hand, gives the quark source independent $\\Xi\\Xi$ potential, thanks to the derivative expansion of the potential, which absorbs the source dependence to the next leading order correction. The HAL QCD potential predicts the absence of the bound state in the $\\Xi\\Xi$($^1$S$_0$) channel at $m_\\pi= 0.51$ GeV, which is also confirmed by the volume dependence of finite volume energy from the potential. We also demonstrate that the origin of the fake plateau in the effective energy shift $\\Delta E_\\mathrm{eff}(t)$ at $t \\sim 1$ fm can b...

  11. Assessing direct analysis in real-time-mass spectrometry (DART-MS) for the rapid identification of additives in food packaging.

    Science.gov (United States)

    Ackerman, L K; Noonan, G O; Begley, T H

    2009-12-01

    The ambient ionization technique direct analysis in real time (DART) was characterized and evaluated for the screening of food packaging for the presence of packaging additives using a benchtop mass spectrometer (MS). Approximate optimum conditions were determined for 13 common food-packaging additives, including plasticizers, anti-oxidants, colorants, grease-proofers, and ultraviolet light stabilizers. Method sensitivity and linearity were evaluated using solutions and characterized polymer samples. Additionally, the response of a model additive (di-ethyl-hexyl-phthalate) was examined across a range of sample positions, DART, and MS conditions (temperature, voltage and helium flow). Under optimal conditions, molecular ion (M+H+) was the major ion for most additives. Additive responses were highly sensitive to sample and DART source orientation, as well as to DART flow rates, temperatures, and MS inlet voltages, respectively. DART-MS response was neither consistently linear nor quantitative in this setting, and sensitivity varied by additive. All additives studied were rapidly identified in multiple food-packaging materials by DART-MS/MS, suggesting this technique can be used to screen food packaging rapidly. However, method sensitivity and quantitation requires further study and improvement.

  12. A novel rapid direct haemagglutination-inhibition assay for measurements of humoral immune response against non-haemagglutinating Fowlpox virus strains in vaccinated chickens

    Directory of Open Access Journals (Sweden)

    Philemon N. Wambura

    2017-10-01

    Full Text Available Fowlpox (FP is a serious disease in chickens caused by Fowlpox virus (FPV. One method currently used to control FPV is vaccination followed by confirmation that antibody titres are protective using the indirect haemagglutination assay (IHA. The direct haemagglutination inhibition (HI assay is not done because most FPV strains do not agglutinate chicken red blood cells (RBCs. A novel FPV strain TPV-1 which agglutinates chicken RBCs was discovered recently and enabled a direct HI assay to be conducted using homologous sera. This study is therefore aimed at assessing the direct HI assay using a recently discovered novel haemagglutinating FPV strain TPV-1 in chickens vaccinated with a commercial vaccine containing a non-haemagglutinating FPV.Chicks vaccinated with FPV at 1 day-old had antibody geometric mean titres (GMT of log2 3.7 at 7 days after vaccination and log2 8.0 at 28 days after vaccination when tested in the direct HI. Chickens vaccinated at 6 weeks-old had antibody geometric mean titres (GMT of log2 5.0 at 7 days after vaccination and log2 8.4 at 28 days after vaccination when tested in the direct HI. The GMT recorded 28 days after vaccination was slightly higher in chickens vaccinated at 6-week-old than in chicks vaccinated at one-day-old. However, this difference was not significant (P > 0.05. All vaccinated chickens showed “takes”. No antibody response to FPV and “takes” were detected in unvaccinated chickens (GMT 0.05. Conclusion: These findings indicate that a simple and rapid direct HI assay using the FPV TPV-1 strain as antigen may be used to measure antibody levels in chickens vaccinated with non-haemagglutinating strains of FPV, and that the titres are comparable to those obtained by indirect IHA. Keywords: Veterinary medicine, Veterinary science, Vaccines, Immunology, Zoology

  13. A novel rapid direct haemagglutination-inhibition assay for measurements of humoral immune response against non-haemagglutinatingFowlpox virusstrains in vaccinated chickens.

    Science.gov (United States)

    Wambura, Philemon N; Mzula, Alexanda

    2017-10-01

    Fowlpox (FP) is a serious disease in chickens caused by Fowlpox virus (FPV). One method currently used to control FPV is vaccination followed by confirmation that antibody titres are protective using the indirect haemagglutination assay (IHA). The direct haemagglutination inhibition (HI) assay is not done because most FPV strains do not agglutinate chicken red blood cells (RBCs). A novel FPV strain TPV-1 which agglutinates chicken RBCs was discovered recently and enabled a direct HI assay to be conducted using homologous sera. This study is therefore aimed at assessing the direct HI assay using a recently discovered novel haemagglutinating FPV strain TPV-1 in chickens vaccinated with a commercial vaccine containing a non-haemagglutinating FPV.Chicks vaccinated with FPV at 1 day-old had antibody geometric mean titres (GMT) of log 2 3.7 at 7 days after vaccination and log 2 8.0 at 28 days after vaccination when tested in the direct HI. Chickens vaccinated at 6 weeks-old had antibody geometric mean titres (GMT) of log 2 5.0 at 7 days after vaccination and log 2 8.4 at 28 days after vaccination when tested in the direct HI. The GMT recorded 28 days after vaccination was slightly higher in chickens vaccinated at 6-week-old than in chicks vaccinated at one-day-old. However, this difference was not significant (P > 0.05). All vaccinated chickens showed "takes". No antibody response to FPV and "takes" were detected in unvaccinated chickens (GMT 0.05). These findings indicate that a simple and rapid direct HI assay using the FPV TPV-1 strain as antigen may be used to measure antibody levels in chickens vaccinated with non-haemagglutinating strains of FPV, and that the titres are comparable to those obtained by indirect IHA.

  14. Rapid Reticulin Fiber Staining Method is Helpful for the Diagnosis of Pituitary Adenoma in Frozen Section.

    Science.gov (United States)

    Noh, Songmi; Kim, Sun Ho; Cho, Nam Hoon; Kim, Se Hoon

    2015-05-01

    Approximately 90% of neoplasms found in the sellar region are adenoma of the pituitary gland. The use of frozen sections for the diagnosis of pituitary adenomas has an accuracy of 90% and is useful in evaluating complete tumor removal. However, it is sometimes difficult to diagnose pituitary adenomas using frozen sections because of the small sample size and marked artifact, and the contiguity of the pituitary adenoma with normal pituitary gland tissue. In this study, we evaluated the use of our modified reticulin stain to make correct decision in frozen section with reduced stain time and investigated the objective diagnostic criteria of pituitary adenoma with reticulin stain. We used Gomori's silver impregnation methods to stain reticulin fibers in frozen pituitary gland sections of 36 samples from 24 patients. We modified the conventional staining method by reducing the overall staining time. We diagnosed pituitary lesion according to our interpretation criteria and compared the results to those of the conventional method and findings of hematoxylin and eosin-stained slides. Reticulin fiber staining of normal adenohypophysis outlines the supporting stroma around the blood vessels and shows regular of the gland meshwork interconnecting the capillaries. In contrast, reticulin fiber staining of the adenomatous tissue shows loss of meshwork or frequent fragmentation. Our modified reticulin stain is more rapid than the established method and shows similar levels of accuracy. Independent evaluation by two pathologists showed discrepancies in diagnosis in four out of 36 cases with modified reticulin stain. Our rapid modified reticulin staining method for frozen sections may be useful as a diagnostic tool for pituitary adenomas and can complement routine hematoxylin and eosin staining.

  15. Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method.

    Science.gov (United States)

    Nihonyanagi, Shin; Kanoh, Yuhsaku; Okada, Kiyomi; Uozumi, Toshiki; Kazuyama, Yukumasa; Yamaguchi, Tokiko; Nakazaki, Nobuhiko; Sakurai, Keizou; Hirata, Yasuyoshi; Munekata, Shinichi; Ohtani, Shinichi; Takemoto, Tsuyoshi; Bandoh, Yuki; Akahoshi, Tohru

    2012-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) with exogenous cassette DNA containing the methicillin-resistant gene mecA (SCCmec) poses a problem as a drug-resistant bacterium responsible for hospital- and community-acquired infections. The frequency of MRSA detection has recently been increasing rapidly in Japan, and SCCmec has also been classified more diversely into types I-V. A rapid test is essential for early diagnosis and treatment of MRSA infections, but detection by conventional methods requires at least two days. The newly developed multiplex PCR lateral flow method allows specific amplification of femA to detect S. aureus, mecA to detect SCCmec, and kdpC to detect SCCmec type II; moreover, PCR products can be evaluated visually in about 3 h. In the present study, we developed a PCR lateral flow method for MRSA using this method and investigated its clinical usefulness in the detection of MRSA. The results showed a diagnostic concordance rate of 91.7% for MRSA and methicillin-susceptible S. aureus between bacteriological examination and PCR lateral flow, and a high level of specificity in PCR lateral flow. In addition, a higher detection rate for S. aureus using the same sample was observed for PCR lateral flow (70.2%) than for bacteriological tests (48.6%). The above results show that PCR lateral flow for MRSA detection has high sensitivity, specificity, and speed, and its clinical application as a method for early diagnosis of MRSA infections appears to be feasible.

  16. Optimal estimation and scheduling in aquifer management using the rapid feedback control method

    Science.gov (United States)

    Ghorbanidehno, Hojat; Kokkinaki, Amalia; Kitanidis, Peter K.; Darve, Eric

    2017-12-01

    Management of water resources systems often involves a large number of parameters, as in the case of large, spatially heterogeneous aquifers, and a large number of "noisy" observations, as in the case of pressure observation in wells. Optimizing the operation of such systems requires both searching among many possible solutions and utilizing new information as it becomes available. However, the computational cost of this task increases rapidly with the size of the problem to the extent that textbook optimization methods are practically impossible to apply. In this paper, we present a new computationally efficient technique as a practical alternative for optimally operating large-scale dynamical systems. The proposed method, which we term Rapid Feedback Controller (RFC), provides a practical approach for combined monitoring, parameter estimation, uncertainty quantification, and optimal control for linear and nonlinear systems with a quadratic cost function. For illustration, we consider the case of a weakly nonlinear uncertain dynamical system with a quadratic objective function, specifically a two-dimensional heterogeneous aquifer management problem. To validate our method, we compare our results with the linear quadratic Gaussian (LQG) method, which is the basic approach for feedback control. We show that the computational cost of the RFC scales only linearly with the number of unknowns, a great improvement compared to the basic LQG control with a computational cost that scales quadratically. We demonstrate that the RFC method can obtain the optimal control values at a greatly reduced computational cost compared to the conventional LQG algorithm with small and controllable losses in the accuracy of the state and parameter estimation.

  17. Development and Validation of a Bioanalytical Method for Direct ...

    African Journals Online (AJOL)

    ... the sample was stable for over one month. Conclusion: The proposed method may be applied to routine bioanalysis, particularly for NSAIDs, due to its high sensitivity, specificity, repeatability, reproducibility, robustness and ruggedness. Keywords: Bioanalytical method, Diclofenac potassium, RP-HPLC method, NSAIDs, ...

  18. A new method for rapid determination of carbohydrate and total carbon concentrations using UV spectrophotometry.

    Science.gov (United States)

    Albalasmeh, Ammar A; Berhe, Asmeret Asefaw; Ghezzehei, Teamrat A

    2013-09-12

    A new UV spectrophotometry based method for determining the concentration and carbon content of carbohydrate solution was developed. This method depends on the inherent UV absorption potential of hydrolysis byproducts of carbohydrates formed by reaction with concentrated sulfuric acid (furfural derivatives). The proposed method is a major improvement over the widely used Phenol-Sulfuric Acid method developed by DuBois, Gilles, Hamilton, Rebers, and Smith (1956). In the old method, furfural is allowed to develop color by reaction with phenol and its concentration is detected by visible light absorption. Here we present a method that eliminates the coloration step and avoids the health and environmental hazards associated with phenol use. In addition, avoidance of this step was shown to improve measurement accuracy while significantly reducing waiting time prior to light absorption reading. The carbohydrates for which concentrations and carbon content can be reliably estimated with this new rapid Sulfuric Acid-UV technique include: monosaccharides, disaccharides and polysaccharides with very high molecular weight. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. A Simple and Rapid Data Extraction Method for the Precision Aspheric Optical Surface Height

    Science.gov (United States)

    Xing, Guohua; Peng, Yunfeng; Su, Xing

    2017-10-01

    Nowadays, the application of aspheric optics is becoming more and more popular in the precision optical engineering field. Therefore, it urges the rapid development of the precision machining and measuring technology. Generally, the aspheric optical component is measured by the interferometer. The underlying question is that the figure output by interferometer can’t be always recognized by other analysis software or program though the interferometer has its own unique data processing system. In this paper, a robust, rapid and simple method is presented to interpret the surface height data of the precision machined aspheric optical surface. The optical surface is measured by interferometer. The result figure is split into two parts, one of which is the interferogram picture of the whole aspheric optical surface and the other is the colour reference column indicating the height value. The ratios of the red (R), green (G) and blue (B) are analysed based on the middle of the colour reference column, and the corresponding relationship between the colours and surface height is established and looked as a reference data base. Then the interferogram picture of the whole aspheric optical surface is also analysed and divided according to the red (R), green (G) and blue (B) colours. By comparing the ratios and values of RGB colour, the aspheric optical surface height can be extracted approximately. The feasibility of this method was approved by the extraction processing experiment of a polished aspheric optical surface.

  20. Rapid fabrication method of a microneedle mold with controllable needle height and width.

    Science.gov (United States)

    Lin, Yen-Heng; Lee, I-Chi; Hsu, Wei-Chieh; Hsu, Ching-Hong; Chang, Kai-Ping; Gao, Shao-Syuan

    2016-10-01

    The main issue of transdermal drug delivery is that macromolecular drugs cannot diffuse through the stratum corneum of skin. Many studies have pursued micro-sized needles encapsulated with drugs to overcome this problem, as these needles can pierce the stratum corneum and allow drugs to enter the circulatory system of the human body. However, most microneedle fabrication processes are time-consuming and require expensive equipment. In this study, we demonstrate a rapid method for fabricating a microneedle mold using drawing lithography and a UV-cured resin. The mold was filled with a water-soluble material, polyvinylpyrrolidone (PVP), which was then demolded to produce a water-soluble microneedle array. The results of an in vitro skin insertion test using PVP microneedles and pig ear skin demonstrated the feasibility of the microneedle mold. In addition, by controlling the viscosity of the UV-cured resin through various heat treatments, microneedles with different heights and aspect ratios were produced. Compared with other methods, this technology significantly simplifies and accelerates the mold fabrication process. In addition, the required equipment is relatively simple and inexpensive. Through this technology, we can rapidly fabricate microneedle molds with controllable dimensions for various applications.

  1. Passive acoustic methods for fine-scale tracking of harbour porpoises in tidal rapids.

    Science.gov (United States)

    Macaulay, Jamie; Gordon, Jonathan; Gillespie, Douglas; Malinka, Chloë; Northridge, Simon

    2017-02-01

    The growing interest in generating electrical power from tidal currents using tidal turbine generators raises a number of environmental concerns, including the risk that marine mammals might be injured or killed through collision with rotating turbine blades. To understand this risk, information on how marine mammals use tidal rapid habitats and in particular, their underwater movements and dive behaviour is required. Porpoises, which are the most abundant small cetacean at most European tidal sites, are difficult animals to tag, and the limited size of tidal habitats means that any telemetered animal would be likely to spend only a small proportion of time within them. Here, an alternative approach is explored, whereby passive acoustic monitoring (PAM) is used to obtain fine scale geo-referenced tracks of harbour porpoises in tidal rapid areas. Large aperture hydrophone arrays are required to obtain accurate locations of animals from PAM data and automated algorithms are necessary to process the large quantities of acoustic data collected on such systems during a typical survey. Methods to automate localisation, including a method to match porpoise detections on different hydrophones and separate different vocalising animals, and an assessment of the localisation accuracy of the large aperture hydrophone array are presented.

  2. Miniaturized fluorescent RNA dot blot method for rapid quantitation of gene expression

    Directory of Open Access Journals (Sweden)

    Yadetie Fekadu

    2004-06-01

    Full Text Available Abstract Background RNA dot blot hybridization is a commonly used technique for gene expression assays. However, membrane based RNA dot/slot blot hybridization is time consuming, requires large amounts of RNA, and is less suited for parallel assays of more than one gene at a time. Here, we describe a glass-slide based miniaturized RNA dot blot (RNA array procedure for rapid and parallel gene expression analysis using fluorescently labeled probes. Results RNA arrays were prepared by simple manual spotting of RNA onto amino-silane coated microarray glass slides, and used for two-color fluorescent hybridization with specific probes labeled with Cy3 and 18S ribosomal RNA house-keeping gene probe labeled with Cy5 fluorescent dyes. After hybridization, arrays were scanned on a fluorescent microarray scanner and images analyzed using microarray image analysis software. We demonstrate that this method gives comparable results to Northern blot analysis, and enables high throughput quantification of transcripts from nanogram quantities of total RNA in hundreds of samples. Conclusion RNA array on glass slide and detection by fluorescently labeled probes can be used for rapid and parallel gene expression analysis. The method is particularly well suited for gene expression assays that involve quantitation of many transcripts in large numbers of samples.

  3. Hyperspectral Imaging as a Rapid Quality Control Method for Herbal Tea Blends

    Directory of Open Access Journals (Sweden)

    Majolie Djokam

    2017-03-01

    Full Text Available In South Africa, indigenous herbal teas are enjoyed due to their distinct taste and aroma. The acclaimed health benefits of herbal teas include the management of chronic diseases such as hypertension and diabetes. Quality control of herbal teas has become important due to the availability of different brands of varying quality and the production of tea blends. The potential of hyperspectral imaging as a rapid quality control method for herbal tea blends from rooibos (Aspalathus linearis, honeybush (Cyclopia intermedia, buchu (Agathosma Betulina and cancerbush (Sutherlandia frutescens was investigated. Hyperspectral images of raw materials and intact tea bags were acquired using a sisuChema shortwave infrared (SWIR hyperspectral pushbroom imaging system (920–2514 nm. Principal component analysis (PCA plots showed clear discrimination between raw materials. Partial least squares discriminant analysis (PLS-DA models correctly predicted the raw material constituents of each blend and accurately determined the relative proportions. The results were corroborated independently using ultra-high performance liquid chromatography coupled to mass spectrometry (UHPLC-MS. This study demonstrated the application of hyperspectral imaging coupled with chemometric modelling as a reliable, rapid and non-destructive quality control method for authenticating herbal tea blends and to determine relative proportions in a tea bag.

  4. Rapid and label-free bioanalytical method of alpha fetoprotein detection using LSPR chip

    Science.gov (United States)

    Kim, Dongjoo; Kim, Jinwoon; Kwak, Cheol Hwan; Heo, Nam Su; Oh, Seo Yeong; Lee, Hoomin; Lee, Go-Woon; Vilian, A. T. Ezhil; Han, Young-Kyu; Kim, Woo-Sik; Kim, Gi-bum; Kwon, Soonjo; Huh, Yun Suk

    2017-07-01

    Alpha fetoprotein (AFP) is a cancer marker, particularly for hepatocellular carcinoma. Normal levels of AFP are less than 20 ng/mL; however, its levels can reach more than 400 ng/mL in patients with HCC. Enzyme linked immunosorbent assay (ELISA) and radioimmunoassay (RIA) have been employed for clinical diagnosis of AFP; however, these methods are time consuming and labor intensive. In this study, we developed a localized surface plasmon resonance (LSPR) based biosensor for simple and rapid detection of AFP. This biosensor consists of a UV-Vis spectrometer, a cuvette cell, and a biosensor chip nanopatterned with gold nanoparticles (AuNPs). In our LSPR biosensor, binding of AFP to the surface of the sensor chip led to an increasing magnitude of the LSPR signals, which was measured by an ultraviolet-visible (UV-Vis) spectrometer. Our LSPR biosensor showed sufficient detectability of AFP at concentrations of 1 ng/mL to 1 μg/mL. Moreover, the overall procedure for detection of AFP was completed within 20 min. This biosensor could also be utilized for a point of care test (POCT) by employing a portable UV-Vis spectrometer. Owing to the simplicity and rapidity of the detection process, our LSPR biosensor is expected to replace traditional diagnostic methods for the early detection of diseases.

  5. Systems and methods for bi-directional energy delivery with galvanic isolation

    Science.gov (United States)

    Kajouke, Lateef A.

    2013-06-18

    Systems and methods are provided for bi-directional energy delivery. A charging system comprises a first bi-directional conversion module, a second bi-directional conversion module, and an isolation module coupled between the first bi-directional conversion module and the second bi-directional conversion module. The isolation module provides galvanic isolation between the first bi-directional conversion module and the second bi-directional conversion module.

  6. Rapid HPLC method for the simultaneous monitoring of duloxetine, venlaflaxine, fluoxetine and paroxetine in biofluids.

    Science.gov (United States)

    Samanidou, Victoria F; Kourti, Paraskevi V

    2009-08-01

    A simple and rapid HPLC method is developed for the determination of two serotonin-norepinephrine-reuptake inhibitors (duloxetine and venlaflaxine) and two selective serotonin-reuptake inhibitors (fluoxetine and paroxetine) in human biofluids. Separation was performed on an Inertsil ODS-3 column (250 x 4.0 mm, 5 µm) with acetonitrile-ammonium acetate (0.05 M, 41:59 v/v) at 235 nm, within 7 min. SPE on Oasis(®) HLB cartridges was applied for the isolation of analytes from biofluids. The developed methodology was validated in terms of sensitivity, linearity, accuracy, precision, stability and selectivity. Relative standard deviation was less than 10.4%. Limit of detection was 0.2-0.6 ng/µl in blood plasma and 0.1-0.8 ng/µl in urine. The method was successfully applied to biofluids from a patient under duloxetine treatment.

  7. A rapid and scalable method for selecting recombinant mouse monoclonal antibodies

    Directory of Open Access Journals (Sweden)

    Wright Gavin J

    2010-06-01

    Full Text Available Abstract Background Monoclonal antibodies with high affinity and selectivity that work on wholemount fixed tissues are valuable reagents to the cell and developmental biologist, and yet isolating them remains a long and unpredictable process. Here we report a rapid and scalable method to select and express recombinant mouse monoclonal antibodies that are essentially equivalent to those secreted by parental IgG-isotype hybridomas. Results Increased throughput was achieved by immunizing mice with pools of antigens and cloning - from small numbers of hybridoma cells - the functionally rearranged light and heavy chains into a single expression plasmid. By immunizing with the ectodomains of zebrafish cell surface receptor proteins expressed in mammalian cells and screening for formalin-resistant epitopes, we selected antibodies that gave expected staining patterns on wholemount fixed zebrafish embryos. Conclusions This method can be used to quickly select several high quality monoclonal antibodies from a single immunized mouse and facilitates their distribution using plasmids.

  8. A method for rapidly screening functionality of actin mutants and tagged actins

    Directory of Open Access Journals (Sweden)

    Rommelaere Heidi

    2004-01-01

    Full Text Available Recombinant production and biochemical analysis of actin mutants has been hampered by the fact that actin has an absolute requirement for the eukaryotic chaperone CCT to reach its native state. We therefore have developed a method to rapidly screen the folding capacity and functionality of actin variants, by combining in vitro expression of labelled actin with analysis on native gels, band shift assays or copolymerization tests. Additionally, we monitor, using immuno-fluorescence, incorporation of actin variants in cytoskeletal structures in transfected cells. We illustrate the method by two examples. In one we show that tagged versions of actin do not always behave native-like and in the other we study some of the molecular defects of three &bgr;-actin mutants that have been associated with diseases.

  9. A rapid and efficient DNA extraction method suitable for marine macroalgae.

    Science.gov (United States)

    Ramakrishnan, Gautham Subramaniam; Fathima, Anwar Aliya; Ramya, Mohandass

    2017-12-01

    Macroalgae are a diverse group of organisms. Marine macroalgae, in particular, have numerous medicinal and industrial applications. Molecular studies of macroalgae require suitable concentrations of DNA free of contaminants. At present, numerous protocols exist for DNA extraction from macroalgae. However, they are either time consuming, expensive or work only with few species. The method described in this study is rapid and efficient and applicable to different types of marine macroalgae. This method yields an average of 3.85 µg of DNA per 50 mg of algal tissue, with an average purity of 1.88. The isolated DNA was suitable for PCR amplification of universal plastid region of macroalgae.

  10. A Rapid Colorimetric Method Reveals Fraudulent Substitutions in Sea Urchin Roe Marketed in Sardinia (Italy).

    Science.gov (United States)

    Meloni, Domenico; Spina, Antonio; Satta, Gianluca; Chessa, Vittorio

    2016-06-25

    In recent years, besides the consumption of fresh sea urchin specimens, the demand of minimally-processed roe has grown considerably. This product has made frequent consumption in restaurants possible and frauds are becoming widespread with the partial replacement of sea urchin roe with surrogates that are similar in colour. One of the main factors that determines the quality of the roe is its colour and small differences in colour scale cannot be easily discerned by the consumers. In this study we have applied a rapid colorimetric method for reveal the fraudulent partial substitution of semi-solid sea urchin roe with liquid egg yolk. Objective assessment of whiteness (L*), redness (a*), yellowness (b*), hue (h*), and chroma (C*) was carried out with a digital spectrophotometer using the CIE L*a*b* colour measurement system. The colorimetric method highlighted statistically significant differences among sea urchin roe and liquid egg yolk that could be easily discerned quantitatively.

  11. Sleep Can Eliminate List-Method Directed Forgetting

    Science.gov (United States)

    Abel, Magdalena; Bäuml, Karl-Heinz T.

    2013-01-01

    Recent work suggests a link between sleep and memory consolidation, indicating that sleep in comparison to wakefulness stabilizes memories. However, relatively little is known about how sleep affects forgetting. Here we examined whether sleep influences directed forgetting, the finding that people can intentionally forget obsolete memories when…

  12. Research of dynamic goniometer method for direction measurements

    Science.gov (United States)

    Filatov, Yu. V.; Bokhman, E. D.; Ivanov, P. A.; Larichev, R. A.; Pavlov, P. A.

    2016-10-01

    The report presents the results of experimental research of the angle measurement system intended for measuring angles between normal to some mirrors setting directions in the space. Dynamic mode of system operation is defined by continuous rotation of platform with the autocollimating null-indicator. The angle measurements are provided by the holographic optical encoder.

  13. Direct method for calculating temperature-dependent transport properties

    NARCIS (Netherlands)

    Liu, Y.; Yuan, Z.; Wesselink, R.J.H.; Starikov, A.A.; van Schilfgaarde, M.; Kelly, Paul J.

    2015-01-01

    We show how temperature-induced disorder can be combined in a direct way with first-principles scattering theory to study diffusive transport in real materials. Excellent (good) agreement with experiment is found for the resistivity of Cu, Pd, Pt (and Fe) when lattice (and spin) disorder are

  14. Rapid Discrimination of Closely Related Seed Herbs (Cumin, Caraway, and Fennel) by Direct Analysis in Real Time Mass Spectrometry (DART-MS).

    Science.gov (United States)

    Antal, Borbála; Kuki, Ákos; Nagy, Lajos; Nagy, Tibor; Zsuga, Miklós; M-Hamvas, Márta; Vasas, Gábor; Kéki, Sándor

    2016-01-01

    Direct analysis in real time mass spectrometry (DART-MS) was applied as a rapid method for the discrimination of the spices and traditional medicines cumin (Cuminum cyminum L.), caraway (Carum carvi L.), and fennel (Foeniculum vulgare Mill.). The seeds of these plants were analyzed without sample preparation by DART ion source coupled with quadrupole time-of-flight (QTOF) tandem mass spectrometry. The relatively clean DART spectra showed characteristic patterns, fingerprints, for each herb. It was found that a marker compound can be assigned to each species that can identify unambiguously these plants. Principal component analysis has also been used to analyze the DART-MS data of these seed herbs. Crispanone, carvone, and fenchone are the dominant compounds in the positive DART spectra of cumin, caraway, and fennel, respectively. Crispanone was first time identified as a constituent of cumin. Furthermore, the collision-induced dissociation (CID) behavior of the [M+NH4](+) ion of crispanone was also described.

  15. Simple and rapid high-performance liquid chromatographic method for the determination of aspartame and its metabolites in foods.

    Science.gov (United States)

    Gibbs, B F; Alli, I; Mulligan, C N

    1996-02-23

    A method for the determination of aspartame (N-L-alpha-aspartyl-L-phenylalanine methyl ester) and its metabolites, applicable on a routine quality assurance basis, is described. Liquid samples (diet Coke, 7-Up, Pepsi, etc.) were injected directly onto a mini-cartridge reversed-phase column on a high-performance liquid chromatographic system, whereas solid samples (Equal, hot chocolate powder, pudding, etc.) were extracted with water. Optimising chromatographic conditions resulted in resolved components of interest within 12 min. The by-products were confirmed by mass spectrometry. Although the method was developed on a two-pump HPLC system fitted with a diode-array detector, it is straightforward and can be transformed to the simplest HPLC configuration. Using a single-piston pump (with damper), a fixed-wavelength detector and a recorder/integrator, the degradation of products can be monitored as they decompose. The results obtained were in harmony with previously reported tedious methods. The method is simple, rapid, quantitative and does not involve complex, hazardous or toxic chemistry.

  16. Meselect – A rapid and effective method for the separation of the main leaf tissue types

    Directory of Open Access Journals (Sweden)

    Julia Svozil

    2016-11-01

    Full Text Available Individual tissues of complex eukaryotic organisms have specific gene expression programs that control their functions. Therefore, tissue-specific molecular information is required to increase our understanding of tissue-specific processes. Established methods in plants to obtain specific tissues or cell types from their organ or tissue context typically require the enzymatic degradation of cell walls followed by fluorescence-activated cell sorting (FACS using plants engineered for localized expression of green fluorescent protein (GFP. This has facilitated the acquisition of valuable data, mainly on root cell type-specific transcript and protein expression. However, FACS of different leaf cell types is difficult because of chlorophyll autofluorescence that interferes with the sorting process. Furthermore, the cell wall composition is different in each cell type. This results in long incubation times for refractory cell types, and cell sorting itself can take several hours. To overcome these limitations, we developed Meselect (mechanical separation of leaf compound tissues, a rapid and effective method for the separation of leaf epidermal, vascular and mesophyll tissues. Meselect is a novel combination of mechanical separation and rapid protoplasting, which benefits from the unique cell wall composition of the different tissue types. Meselect has several advantages over cell sorting: it does not require expensive equipment such as a cell sorter and does not depend on specific fluorescent reporter lines, the use of blenders as well as the inherent mixing of different cell types and of intact and damaged cells can be avoided, and the time between wounding of the leaf and freezing of the sample is short. The efficacy and specificity of the method to enrich the different leaf tissue types has been confirmed using Arabidopsis leaves, but it has also been successfully used for leaves of other plants such as tomato or cassava. The method is therefore

  17. Direct analysis in real time-mass spectrometry (DART-MS) for rapid qualitative screening of toxic glycols in glycerin-containing products.

    Science.gov (United States)

    Self, Randy L

    2013-06-01

    In 2007, the United States Food and Drug Administration released guidance recommending testing of glycerin used in regulated consumer products, such as cough syrup preparations, toothpaste, and other pharmaceutical and food products, for the toxic compounds ethylene glycol and diethylene glycol. Regulatory laboratories routinely test glycerin, and products containing glycerin or related compounds for these toxic glycols, using an official gas chromatographic method, to ensure the safety of these products. The current work describes a companion technique to compliment this GC-FID method utilizing Orbitrap mass spectrometry with direct analysis in real time ionization to rapidly screen these samples qualitatively, with results in as little as five seconds, with no sample preparation required. This allows the more time and resource intensive method to be reserved for those rare cases when these compounds are detected, potentially greatly improving laboratory efficiency. The technique was evaluated for qualitative sensitivity and repeatability, and compared against the GC-FID method. The method appears to perform well against these metrics. Published by Elsevier B.V.

  18. Direct determination of anabolic steroids in pig urine by a new SPME-GC-MS method.

    Science.gov (United States)

    Zhang, Zhuomin; Duan, Hongbin; Zhang, Lan; Chen, Xi; Liu, Wei; Chen, Guonan

    2009-05-15

    A new solid phase microextraction (SPME) method coupled with gas chromatography-mass spectrometry (GC-MS) was developed for rapid determination of four anabolic steroids such as 3alpha-hydroxy-5alpha-androstane-17-one (HA), dihydrotestosterone (DHT), androstenedione (AD) and methyltestosterone (MT) in pig urine. SPME was used to extract the four anabolic compounds directly without derivatization. The optimum SPME sampling conditions were based on the home-made carbowax-divinylbenzene (CW-DVB) fiber coating during extraction at 40 degrees C for 50 min with 0.18 g/mL NaCl solution and 750 rpm stirring speed. The linear ranges of the proposed method were in the range of 8-640 pg/mL for HA and DHT and 16-510 pg/mL for AD and MT, respectively. The detection limits (S/N=3) were from 2 to 8 pg/mL for the four anabolic steroids. This SPME method provided very high enrichment factors for the four anabolic steroids, which were 1063-fold and 965-fold for HA and DHT at the concentration of 8 pg/mL and 207-fold and 451-fold for AD and MT at the concentration of 16 pg/mL, respectively. The recoveries ranged from 71.3 to 121%, and the RSDs were lower than 12.9%. The method was sensitive and reliable for determination of trace anabolic steroids in biological samples.

  19. Development of rapid methods for relaxation time mapping and motion estimation using magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Gilani, Syed Irtiza Ali

    2008-09-15

    Recent technological developments in the field of magnetic resonance imaging have resulted in advanced techniques that can reduce the total time to acquire images. For applications such as relaxation time mapping, which enables improved visualisation of in vivo structures, rapid imaging techniques are highly desirable. TAPIR is a Look- Locker-based sequence for high-resolution, multislice T{sub 1} relaxation time mapping. Despite the high accuracy and precision of TAPIR, an improvement in the k-space sampling trajectory is desired to acquire data in clinically acceptable times. In this thesis, a new trajectory, termed line-sharing, is introduced for TAPIR that can potentially reduce the acquisition time by 40 %. Additionally, the line-sharing method was compared with the GRAPPA parallel imaging method. These methods were employed to reconstruct time-point images from the data acquired on a 4T high-field MR research scanner. Multislice, multipoint in vivo results obtained using these methods are presented. Despite improvement in acquisition speed, through line-sharing, for example, motion remains a problem and artefact-free data cannot always be obtained. Therefore, in this thesis, a rapid technique is introduced to estimate in-plane motion. The presented technique is based on calculating the in-plane motion parameters, i.e., translation and rotation, by registering the low-resolution MR images. The rotation estimation method is based on the pseudo-polar FFT, where the Fourier domain is composed of frequencies that reside in an oversampled set of non-angularly, equispaced points. The essence of the method is that unlike other Fourier-based registration schemes, the employed approach does not require any interpolation to calculate the pseudo-polar FFT grid coordinates. Translation parameters are estimated by the phase correlation method. However, instead of two-dimensional analysis of the phase correlation matrix, a low complexity subspace identification of the phase

  20. Application of a novel automatic disintegration apparatus for the development and evaluation of a direct compression rapidly disintegrating tablet.

    Science.gov (United States)

    Jung, Huijeong Ashley; Augsburger, Larry L

    2012-07-01

    An automatic disintegration tester was developed and used to explore disintegration mechanism and times of rapidly disintegrating tablets. DT50, the time required for a tablet to decrease in its thickness by half, allowed an unbiased determination of disintegration time. Calcium silicate concentration, Explotab® concentration, DiPac®/Xylitab® ratio as fillers, and compression pressure were evaluated using a central composite model design analysis for their DT50, tensile strength, and friability. Tablets that could reasonably be handled (friability tablets, originally measured by Caramella et al. using force kinetics, could be determined from axial displacement data measured directly without the need to assume that disintegration force generation was indicative of changes in tablet volume. The n values of tablets containing calcium silicate, Ditab® and/or Xylitab®, magnesium stearate, and Explotab® suggested that the amount of Explotab® was not a significant factor in determining the disintegration mechanism; however, the type of disintegrant used did alter the n value. Primojel® and Explotab®, which are in the same class of disintegrants, exhibited similar DT50, n, and k. Polyplasdone® XL exhibited a much higher n, while yielding faster DT50, suggesting that its performance is more dependent on facilitating the interfacial separation of particles. AcDiSol® showed no apparent moisture sensitivity in regards to disintegration efficiency. The use of the novel apparatus proved to be useful in measuring disintegration efficiency of rapidly disintegrating tablets and in providing valuable information on the disintegration phenomena.

  1. A tree-based method for the rapid screening of chemical fingerprints

    Directory of Open Access Journals (Sweden)

    Pedersen Christian NS

    2010-01-01

    Full Text Available Abstract Background The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase of drug development for identifying novel drug candidates by screening large databases for molecules with fingerprints similar to a query fingerprint. Results In this paper, we present a method which efficiently finds all fingerprints in a database with Tanimoto coefficient to the query fingerprint above a user defined threshold. The method is based on two novel data structures for rapid screening of large databases: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds. We have implemented our method and tested it on a large real-world data set. Our experiments show that our method yields approximately a three-fold speed-up over previous methods. Conclusions Using the novel kD grid and Multibit tree significantly reduce the time needed for searching databases of fingerprints. This will allow researchers to (1 perform more searches than previously possible and (2 to easily search large databases.

  2. C-MAC videolaryngoscope compared with direct laryngoscopy for rapid sequence intubation in an emergency department: A randomised clinical trial.

    Science.gov (United States)

    Sulser, Simon; Ubmann, Dirk; Schlaepfer, Martin; Brueesch, Martin; Goliasch, Georg; Seifert, Burkhardt; Spahn, Donat R; Ruetzler, Kurt

    2016-12-01

    Airway management in the emergency room can be challenging when patients suffer from life-threatening conditions. Mental stress, ignorance of the patient's medical history, potential cervical injury or immobilisation and the presence of vomit and/or blood may also contribute to a difficult airway. Videolaryngoscopes have been introduced into clinical practice to visualise the airway and ultimately increase the success rate of airway management. The aim of this study was to test the hypothesis that the C-MAC videolaryngoscope improves first-attempt intubation success rate compared with direct laryngoscopy in patients undergoing emergency rapid sequence intubation in the emergency room setting. A randomised clinical trial. Emergency Department of the University Hospital, Zurich, Switzerland. With approval of the local ethics committee, we prospectively enrolled 150 patients between 18 and 99 years of age requiring emergency rapid sequence intubation in the emergency room of the University Hospital Zurich. Patients were randomised (1 : 1) to undergo tracheal intubation using the C-MAC videolaryngoscope or by direct laryngoscopy. Owing to ethical considerations, patients who had sustained maxillo-facial trauma, immobilised cervical spine, known difficult airway or ongoing cardiopulmonary resuscitation were excluded from our study. All intubations were performed by one of three very experienced anaesthesia consultants. First-attempt success rate served as our primary outcome parameter. Secondary outcome parameters were time to intubation; total number of intubation attempts; Cormack and Lehane score; inadvertent oesophageal intubation; ease of intubation; complications including violations of the teeth, injury/bleeding of the larynx/pharynx and aspiration/regurgitation of gastric contents; necessity of using further alternative airway devices for successful intubation; maximum decrease of oxygen saturation and technical problems with the device. A total of 150

  3. Directions for Mind, Brain, and Education: Methods, Models, and Morality

    Science.gov (United States)

    Stein, Zachary; Fischer, Kurt W.

    2011-01-01

    In this article we frame a set of important issues in the emerging field of Mind, Brain, and Education in terms of three broad headings: methods, models, and morality. Under the heading of methods we suggest that the need for synthesis across scientific and practical disciplines entails the pursuit of usable knowledge via a catalytic symbiosis…

  4. Direct Method of Analysis of an Isotropic Rectangular Plate Using ...

    African Journals Online (AJOL)

    Finally, comparison has been done for the coefficients of deflection and moments at various aspect ratios of the plate for different support conditions. The results obtained by the use of the COP in the classical Ritz method are in close agreement with the results obtained from exact solutions from classical method.

  5. Semantics-directed implementation of method-call interception

    NARCIS (Netherlands)

    R. Lämmel (Ralf); C. Stenzel

    2003-01-01

    textabstractWe describe a form of method-call interception (MCI) that allows the programmer to superimpose extra functionality onto method calls at run-time. We provide a reference semantics and a reference implementation for corresponding language constructs. The setup applies to class-based,

  6. Development and Validation of a Bioanalytical Method for Direct ...

    African Journals Online (AJOL)

    Erah

    2011-01-16

    Jan 16, 2011 ... indicated that the sample was stable for over one month. Conclusion: The proposed method may be applied to routine bioanalysis, particularly for NSAIDs, due to its high sensitivity, specificity, repeatability, reproducibility, robustness and ruggedness. Keywords: Bioanalytical method, Diclofenac potassium, ...

  7. NATO Advanced Research Workshop, 19-22 May 1997: Rapid Method for Monitoring the Environment for Biological Hazards.

    Science.gov (United States)

    1997-05-22

    The NATO Advanced Research Workshop met for the purpose of bringing to light rapid methods for monitoring the environment for biological hazards such as biological warfare agents, naturally occurring diseases, detection and identification of different biological threats in the environment , dormancy in non-sporulating bacteria and bioluminescence techniques with respect to the rapid detection of microbes in air, water and food.

  8. [Simple and rapid screening for methamphetamine and 3,4-methylenedioxymethamphetamine (MDMA) and their metabolites in urine using direct analysis in real time (DART)-TOFMS].

    Science.gov (United States)

    Kawamura, Maiko; Kikura-Hanajiri, Ruri; Goda, Yukihiro

    2011-01-01

    An ionization technique, direct analysis in real time (DART) has recently been developed for the ambient ionization of a variety samples. The DART coupled with time-of-flight mass spectrometry (TOFMS) would be useful as a simple and rapid screening for the targeted compounds in various samples, because it provides the molecular information of these compounds without time-consuming extraction. In this study, we investigated rapid screening methods of illicit drugs and their metabolites, such as methamphetamine (MA), 3,4-methylenedioxymethamphetamine (MDMA), amphetamine (AP) and 3,4-methylenedioxyamphetamine (MDA) in human urine using DART-TOFMS. As serious matrix effects caused by urea in urine samples and ionizations of the targeted compounds were greatly suppressed in the DART-TOFMS analyses, simple pretreatment methods to remove the urea from the samples were investigated. When a pipette tip-type solid-phase extraction with a dichloromethane and isopropanol mixed solution as an eluent was used for the pretreatment, the limits of detection (LODs) of 4 compounds added to control urine samples were 0.25 µg/ml. On the other hand, the LODs of these compounds were 0.5 µg/ml by a liquid-liquid extraction using a dichloromethane and hexane mixed solution. In both extractions, the recoveries of 4 compounds from urine samples were over 70% and these extraction methods showed good linearity in the range of 0.5-5 µg/ml by GC-MS analyses. In conclusion, our proposed method using DART-TOFMS could simultaneously detect MA, MDMA and their metabolites in urine at 0.5 µg/ml without time-consuming pretreatment steps. Therefore it would be useful for screening drugs in urine with the molecular information.

  9. Rapid direct analysis to discriminate geographic origin of extra virgin olive oils by flash gas chromatography electronic nose and chemometrics.

    Science.gov (United States)

    Melucci, Dora; Bendini, Alessandra; Tesini, Federica; Barbieri, Sara; Zappi, Alessandro; Vichi, Stefania; Conte, Lanfranco; Gallina Toschi, Tullia

    2016-08-01

    At present, the geographical origin of extra virgin olive oils can be ensured by documented traceability, although chemical analysis may add information that is useful for possible confirmation. This preliminary study investigated the effectiveness of flash gas chromatography electronic nose and multivariate data analysis to perform rapid screening of commercial extra virgin olive oils characterized by a different geographical origin declared in the label. A comparison with solid phase micro extraction coupled to gas chromatography mass spectrometry was also performed. The new method is suitable to verify the geographic origin of extra virgin olive oils based on principal components analysis and discriminant analysis applied to the volatile profile of the headspace as a fingerprint. The selected variables were suitable in discriminating between "100% Italian" and "non-100% Italian" oils. Partial least squares discriminant analysis also allowed prediction of the degree of membership of unknown samples to the classes examined. Copyright © 2016. Published by Elsevier Ltd.

  10. Group IV direct band gap photonics: Methods, Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Richard eGeiger

    2015-07-01

    Full Text Available The concept of direct band gap group IV materials offers a paradigm change for Si-photonics concerning the monolithic implementation of light emitters: The idea is to integrate fully compatible group IV materials with equally favorable optical properties as the chemically incompatible group III-V-based systems. The concept involves either mechanically applied strain on Ge or alloying of Ge with Sn and permits to drastically improve the insufficient radiative efficiency of Ge. The favorable optical properties result from a modified band structure transformed from an indirect to a direct one. The first demonstration of such a direct band gap laser, accomplished in GeSn, exemplifies the capability of this new concept. These systems may permit a qualitative as well as a quantitative expansion of Si-photonics into traditional but also new areas of applications, provided they can be operated energy efficiently, under ambient conditions and integrated with current Si technologies. This review aims to discuss the challenges along this path in terms of fabrication, characterization and fundamental understanding, and will elaborate on evoking opportunities of this new class of group IV-based laser materials.

  11. Rapid Assessment of Health Services in Punjab using a Mixed Method Approach

    Directory of Open Access Journals (Sweden)

    Rajesh Kumar

    2015-06-01

    Full Text Available Introduction: The out-of-pocket expenditure is quite high in Punjab. Hence, a rapid review of health facilities was undertaken to suggest remedial measures. Methods: Mixed method research approach was used to identify strengths and weaknesses of the health services in Punjab. All health institutions were included in the assessment from the three purposively sampled districts – one from each of the three regions of Punjab. Tools were developed to collect data from record review, observations, and in-depth interviews. Six building blocks framework proposed by the World Health Organization was used for data collection and analyses. Results: In general physical infrastructure, especially the buildings were found to be reasonably constructed at most of the healthcare facilities. However, the maintenance was not regular. The vacancies for general doctors, specialist doctors, nurses, and paramedics were 26%, 38%, 31% and 12% respectively. Supply of drugs was irregular and inadequate. A large proportion (45% of ‘user charges’ were spent on purchase of drugs and other consumables. Most registers were found to be updated, and reports were transmitted to higher levels usually on time. However, institutionalized system of monitoring and supervision was lacking. Govt. hospitals were providing in-patient care to about 35.5% of those who were estimated to need hospitalization. State had allocated about Rs. 1200 crores to health (0.46% of GDP, thus, spending only Rs. 433 per capita per year. Conclusions: Despite constraints, the government health service is catering to the needs of a large section of the population. Rapid health system assessment at periodic intervals using a mixed method approach can supplement routine monitoring of the health system.

  12. Bioluminescence-based identification of nisin producers - a rapid and simple screening method for nisinogenic bacteria in food samples.

    Science.gov (United States)

    Virolainen, Nina; Guglielmetti, Simone; Arioli, Stefania; Karp, Matti

    2012-08-17

    We present a simple and rapid method for screening nisin producers that directly identifies nisinogenic bacteria by induction of bioluminescence within the Lactococcus lactis NZ9800lux biosensor strain (Immonen and Karp, 2007, Biosensors and Bioelectronics 22, 1982-7). An overlay of putative nisinogenic colonies with the biosensor strain gives identification results within 1h. Functionality and specificity of the method were verified by screening nisin producers among 144 raw milk colonies and a panel of 91 lactococcal strains. Studies performed on strains and colonies that did not induce bioluminescence but inhibited growth of the biosensor demonstrated that only nisinogenic bacteria can cause induction. Bacteria known to produce bacteriocins other than nisin failed to induce bioluminescence, further verifying the specificity of the assay. We discovered a non-inducing but inhibitory lactococcal strain harboring a modified nisin Z gene, and demonstrated that the source of the inhibitory action is not a non-inducing variant of nisin, but a bacteriocin of lower molecular weight. The concentration of nisin producers in a raw milk sample was 1.3 × 10(2)CFU/ml. We identified from raw milk a total of seven nisin Z producing L. lactis subsp. lactis colonies, which were shown by genetic fingerprinting to belong to three different groups. Among the panel of 91 lactococci, four strains were nisin A producers, and one strain harbored the modified nisin Z gene. The method presented here is robust, cost-effective and simple to perform, and avoids the pitfalls of traditional screening methods by directly specifying the identity of the inhibitory substance. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Rapid Hydrothermal Synthesis of Zinc Oxide Nanowires by Annealing Methods on Seed Layers

    Directory of Open Access Journals (Sweden)

    Jang Bo Shim

    2011-01-01

    Full Text Available Well-aligned zinc oxide (ZnO nanowire arrays were successfully synthesized on a glass substrate using the rapid microwave heating process. The ZnO seed layers were produced by spinning the precursor solutions onto the substrate. Among coatings, the ZnO seed layers were annealed at 100°C for 5 minutes to ensure particle adhesion to the glass surface in air, nitrogen, and vacuum atmospheres. The annealing treatment of the ZnO seed layer was most important for achieving the high quality of ZnO nanowire arrays as ZnO seed nanoparticles of larger than 30 nm in diameter evolve into ZnO nanowire arrays. Transmission electron microscopy analysis revealed a single-crystalline lattice of the ZnO nanowires. Because of their low power (140 W, low operating temperatures (90°C, easy fabrication (variable microwave sintering system, and low cost (90% cost reduction compared with gas condensation methods, high quality ZnO nanowires created with the rapid microwave heating process show great promise for use in flexible solar cells and flexible display devices.

  14. Rapid and Sensitive Lateral Flow Immunoassay Method for Procalcitonin (PCT Based on Time-Resolved Immunochromatography

    Directory of Open Access Journals (Sweden)

    Xiang-Yang Shao

    2017-02-01

    Full Text Available Procalcitonin (PCT is a current, frequently-used marker for severe bacterial infection. The aim of this study was to develop a cost-effective detection kit for rapid quantitative and on-site detection of PCT. To develop the new PCT quantitative detecting kit, a double-antibody sandwich immunofluorescent assay was employed based on time-resolved immunofluorescent assay (TRFIA combined with lateral flow immunoassay (LFIA. The performance of the new developed kit was evaluated in the aspects of linearity, precision, accuracy, and specificity. Two-hundred thirty-four serum samples were enrolled to carry out the comparison test. The new PCT quantitative detecting kit exhibited a higher sensitivity (0.08 ng/mL. The inter-assay coefficient of variation (CV and the intra-assay CV were 5.4%–7.7% and 5.7%–13.4%, respectively. The recovery rates ranged from 93% to 105%. Furthermore, a high correlation (n = 234, r = 0.977, p < 0.0001 and consistency (Kappa = 0.875 were obtained when compared with the PCT kit from Roche Elecsys BRAHMS. Thus, the new quantitative method for detecting PCT has been successfully established. The results indicated that the newly-developed system based on TRFIA combined with LFIA was suitable for rapid and on-site detection for PCT, which might be a useful platform for other biomarkers in point-of-care tests.

  15. Bacterial Cytological Profiling (BCP as a Rapid and Accurate Antimicrobial Susceptibility Testing Method for Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    D.T. Quach

    2016-02-01

    Full Text Available Successful treatment of bacterial infections requires the timely administration of appropriate antimicrobial therapy. The failure to initiate the correct therapy in a timely fashion results in poor clinical outcomes, longer hospital stays, and higher medical costs. Current approaches to antibiotic susceptibility testing of cultured pathogens have key limitations ranging from long run times to dependence on prior knowledge of genetic mechanisms of resistance. We have developed a rapid antimicrobial susceptibility assay for Staphylococcus aureus based on bacterial cytological profiling (BCP, which uses quantitative fluorescence microscopy to measure antibiotic induced changes in cellular architecture. BCP discriminated between methicillin-susceptible (MSSA and -resistant (MRSA clinical isolates of S. aureus (n = 71 within 1–2 h with 100% accuracy. Similarly, BCP correctly distinguished daptomycin susceptible (DS from daptomycin non-susceptible (DNS S. aureus strains (n = 20 within 30 min. Among MRSA isolates, BCP further identified two classes of strains that differ in their susceptibility to specific combinations of beta-lactam antibiotics. BCP provides a rapid and flexible alternative to gene-based susceptibility testing methods for S. aureus, and should be readily adaptable to different antibiotics and bacterial species as new mechanisms of resistance or multidrug-resistant pathogens evolve and appear in mainstream clinical practice.

  16. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  17. Performance of a Micro-UAV lifting system built with the usage of rapid prototyping methods

    Science.gov (United States)

    Dalewski, R. T.; Gumowski, K.; Barczak, T.; Godek, J.

    2014-08-01

    This article presents results of the aerodynamic testing of a micro unmanned aerial vehicle rotor efficiency. The rotors were prepared as a set of two rotors in a counter-rotating ducted drive. Prototypes of the drives were made using two rapid prototyping techniques - FDM - fused deposition modelling method and SLS - selective laser sintering. Rotors were made then treated by introducing additional finishing cyanoacrylate coating and abrasive processing. Main differences between those models were observed in fan shape, porosity, surface roughness and mechanical properties - stiffness. An influence of these factors was observed on an aerodynamic efficiency. For the obtained prototypes both simulations and experimental testing were conducted with thrust, power, torque measurements, as well as the measurement of velocity and pressure distribution at the outlet of the duct. The results show the possibility of using rapid prototyping techniques to produce prototypes of drives operating in the low and medium Reynolds numbers (6000-60000), and the aerodynamic shape relevant factors affecting the preparation and performance of such drives. In addition, simulation studies were performed using the Fluent environment where experimental results were confronted with the results of simulation studies.

  18. Use of a modified cluster sampling method to perform rapid needs assessment after Hurricane Andrew.

    Science.gov (United States)

    Hlady, W G; Quenemoen, L E; Armenia-Cope, R R; Hurt, K J; Malilay, J; Noji, E K; Wurm, G

    1994-04-01

    To rapidly obtain population-based estimates of needs in the early aftermath of Hurricane Andrew in South Florida. We used a modified cluster-sampling method (the Expanded Programme on Immunization [EPI] method) for three surveys. We selected a systematic sample of 30 quarter-mile square clusters for each survey and, beginning from a random start, interviewed members of seven consecutive occupied households in each cluster. Two surveys were of the most affected area (1990 population, 32,672) at three and ten days after the hurricane struck; one survey was of a less affected area (1990 population, 15,576) seven days after the hurricane struck. Results were available within 24 hours of beginning each survey. Initial findings emphasized the need for restoring utilities and sanitation and helped to focus medical relief on primary care and preventive services. The second survey of the most affected area showed improvement in the availability of food, water, electricity, and sanitation (P < or = .05). There was no evidence of disease outbreaks. For the first time, the EPI method provided population-based information to guide and evaluate relief operations after a sudden-impact natural disaster. An improvement over previous approaches, the EPI method warrants further evaluation as a needs assessment tool in acute disasters.

  19. ATP bioluminescence method: tool for rapid screening of organic and microbial contaminants on deteriorated mural paintings.

    Science.gov (United States)

    Unković, Nikola; Ljaljević Grbić, Milica; Stupar, Miloš; Vukojević, Jelena; Subakov-Simić, Gordana; Jelikić, Aleksa; Stanojević, Dragan

    2015-11-24

    The extent of the microbial contamination of the seventeenth-century wall paintings in the nave of the old Church of the Holy Ascension (Veliki Krčimir, Serbia) was evaluated via newly implemented ATP bioluminescence method, and traditional cultivation-based method, utilising commercially available dip slides. To assess the validity of ATP, as a biomarker for rapid detection of mural surface contamination, obtained zones of cleanliness values, in range from 1.0 to 5.3, were compared to documented total microbial counts, ranging between seven and 247 CFU/cm 2 . Small coefficients of determination, 0.0106-0.0385, suggest poor correlation between microbial counts and surface ATP levels; however, zones of cleanliness values are of great help in determining the high points of contamination, aka 'hotspots', which should be given special attention during sampling and investigation using other methods. In addition, various aspects of the possible implementation of the ATP bioluminescence method in an integrated system of wall painting conservation are discussed.

  20. A Rapid Dialysis Method for Analysis of Artificial Sweeteners in Foods (2nd Report).

    Science.gov (United States)

    Tahara, Shoichi; Yamamoto, Sumiyo; Yamajima, Yukiko; Miyakawa, Hiroyuki; Uematsu, Yoko; Monma, Kimio

    2017-01-01

    Following the previous report, a rapid dialysis method was developed for the extraction and purification of four artificial sweeteners, namely, sodium saccharide (Sa), acesulfame potassium (AK), aspartame (APM), and dulcin (Du), which are present in various foods. The method was evaluated by the addition of 0.02 g/kg of these sweeteners to a cookie sample, in the same manner as in the previous report. Revisions from the previous method were: reduction of the total dialysis volume from 200 to 100 mL, change of tube length from 55 to 50 cm, change of dialysate from 0.01 mol/L hydrochloric aqueous solution containing 10% sodium chloride to 30% methanol solution, and change of dialysis conditions from ambient temperature with occasional shaking to 50℃ with shaking at 160 rpm. As a result of these revisions, the recovery reached 99.3-103.8% with one hour dialysis. The obtained recovery yields were comparable to the recovery yields in the previous method with four hour dialysis.

  1. ReagentTF: a rapid and versatile optical clearing method for biological imaging(Conference Presentation)

    Science.gov (United States)

    Yu, Tingting; Zhu, Jingtan; Li, Yusha; Qi, Yisong; Xu, Jianyi; Gong, Hui; Luo, Qingming; Zhu, Dan

    2017-02-01

    The emergence of various optical clearing methods provides a great potential for imaging deep inside tissues by combining with multiple-labelling and microscopic imaging techniques. They were generally developed for specific imaging demand thus presented some non-negligible limitations such as long incubation time, tissue deformation, fluorescence quenching, incompatibility with immunostaining or lipophilic tracers. In this study, we developed a rapid and versatile clearing method, termed ReagentTF, for deep imaging of various fluorescent samples. This method can not only efficiently clear embryos, neonatal whole-brains and adult thick brain sections by simple immersion in aqueous mixtures with minimal volume change, but also can preserve fluorescence of various fluorescent proteins and simultaneously be compatible with immunostaining and lipophilic neuronal dyes. We demonstrate the effectiveness of this method in reconstructing the cell distributions of mouse hippocampus, visualizing the neural projection from CA1 (Cornu Ammonis 1) to HDB (nucleus of the horizontal limb of the diagonal band), and observing the growth of forelimb plexus in whole-mount embryos. These results suggest that ReagentTF is useful for large-volume imaging and will be an option for the deep imaging of biological tissues.

  2. Computationally rapid method of estimating signal-to-noise ratio for phased array image reconstructions.

    Science.gov (United States)

    Wiens, Curtis N; Kisch, Shawn J; Willig-Onwuachi, Jacob D; McKenzie, Charles A

    2011-10-01

    Measuring signal-to-noise ratio (SNR) for parallel MRI reconstructions is difficult due to spatially dependent noise amplification. Existing approaches for measuring parallel MRI SNR are limited because they are not applicable to all reconstructions, require significant computation time, or rely on repeated image acquisitions. A new SNR estimation approach is proposed, a hybrid of the repeated image acquisitions method detailed in the National Electrical Manufacturers Association (NEMA) standard and the Monte Carlo based pseudo-multiple replica method, in which the difference between images reconstructed from the unaltered acquired data and that same data reconstructed after the addition of calibrated pseudo-noise is used to estimate the noise in the parallel MRI image reconstruction. This new noise estimation method can be used to rapidly compute the pixel-wise SNR of the image generated from any parallel MRI reconstruction of a single acquisition. SNR maps calculated with the new method are validated against existing SNR calculation techniques. Copyright © 2011 Wiley-Liss, Inc.

  3. A rapid and sensitive method for the detection of aromatic amines in cosmetics.

    Science.gov (United States)

    Hailong, Xiao; Fen, Qian; Ying, Xu; Jianhong, Pan; Haiyun, Tu; Hongqing, Wang; Saijun, Lin; Jichun, Han

    2014-02-01

    Aromatic amines (AAs) are common chemical pollutants and banned ingredients in cosmetics. In this study, a rapid, simple and stable method for the detection of nine AAs in cosmetics was established based on the optimization of cation exchange solid-phase extraction and liquid chromatography tandem mass spectrometry. The method displayed good linearity within a range of 2-1,000 µg/kg, with limits of quantitation at the level of µg/kg for cosmetic samples. The recoveries obtained for all analyzed amines ranged between 83.6 and 97.8%, and the repeatability (r) and reproducibility (R) values indicated that all nine AAs showed good precision (r ≤ 4.5% and R ≤ 7.7%). The method was applied for the detection of 36 cosmetic samples. It was found that the primary pollutants of AAs were 3, 3'-dichlorobenzidine and 4-aminoazobenzene. The total amine concentration in cosmetic samples ranged from 880 to 5,200 µg/kg. The proposed method is applicable for the analysis of most cosmetic samples.

  4. A simple and rapid method to characterize lipid fate in skeletal muscle.

    Science.gov (United States)

    Massart, Julie; Zierath, Juleen R; Chibalin, Alexander V

    2014-06-24

    Elevated fatty acids contribute to the development of type 2 diabetes and affect skeletal muscle insulin sensitivity. Since elevated intramuscular lipids and insulin resistance is strongly correlated, aberrant lipid storage or lipid intermediates may be involved in diabetes pathogenesis. The aim of this study was to develop a method to determine the dynamic metabolic fate of lipids in primary human skeletal muscle cells and in intact mouse skeletal muscle. We report a simple and fast method to characterize lipid profiles in skeletal muscle using thin layer chromatography. The described method was specifically developed to assess lipid utilization in cultured and intact skeletal muscle. We determined the effect of a pan-diacylglycerol kinase (DGK) class I inhibitor (R59949) on lipid metabolism to validate the method. In human skeletal muscle cells, DGK inhibition impaired diacylglycerol (DAG) conversion to phosphatidic acid and increased triglyceride synthesis. In intact glycolytic mouse skeletal muscle, DGK inhibition triggered the accumulation of DAG species. Conversely, the DGK inhibitor did not affect DAG content in oxidative muscle. This simple assay detects rapid changes in the lipid species composition of skeletal muscle with high sensitivity and specificity. Determination of lipid metabolism in skeletal muscle may further elucidate the mechanisms contributing to the pathogenesis of insulin resistance in type 2 diabetes or obesity.

  5. Method to Rapidly Collect Thousands of Velocity Observations to Validate Million-Element 2D Hydrodynamic Models

    Science.gov (United States)

    Barker, J. R.; Pasternack, G. B.; Bratovich, P.; Massa, D.; Reedy, G.; Johnson, T.

    2010-12-01

    Two-dimensional (depth-averaged) hydrodynamic models have existed for decades and are used to study a variety of hydrogeomorphic processes as well as to design river rehabilitation projects. Rapid computer and coding advances are revolutionizing the size and detail of 2D models. Meanwhile, advances in topo mapping and environmental informatics are providing the data inputs to drive large, detailed simulations. Million-element computational meshes are in hand. With simulations of this size and detail, the primary challenge has shifted to finding rapid and inexpensive means for testing model predictions against observations. Standard methods for collecting velocity data include boat-mounted ADCP and point-based sensors on boats or wading rods. These methods are labor intensive and often limited to a narrow flow range. Also, they generate small datasets at a few cross-sections, which is inadequate to characterize the statistical structure of the relation between predictions and observations. Drawing on the long-standing oceanographic method of using drogues to track water currents, previous studies have demonstrated the potential of small dGPS units to obtain surface velocity in rivers. However, dGPS is too inaccurate to test 2D models. Also, there is financial risk in losing drogues in rough currents. In this study, an RTK GPS unit was mounted onto a manned whitewater kayak. The boater positioned himself into the current and used floating debris to maintain a speed and heading consistent with the ambient surface flow field. RTK GPS measurements were taken ever 5 sec. From these positions, a 2D velocity vector was obtained. The method was tested over ~20 km of the lower Yuba River in California in flows ranging from 500-5000 cfs, yielding 5816 observations. To compare velocity magnitude against the 2D model-predicted depth-averaged value, kayak-based surface values were scaled down by an optimized constant (0.72), which had no negative effect on regression analysis

  6. A rapid decision-making method for the evaluation of pollution-sensitive coastal areas in the Mediterranean sea.

    Science.gov (United States)

    Angelidis, Michael O; Kamizoulis, George

    2005-06-01

    Places of natural beauty and/or cultural value in the Mediterranean Sea are presenting adverse effects due to pollution. These environmental threats caused by point and nonpoint sources are mainly the reason why these areas represent "pollution-sensitive areas," where the risk of deterioration is immediate. However, the risk will decrease and eventually disappear if protective measures are applied. In the present article, a multicriteria decision-making method is proposed for the prioritization of the Mediterranean sensitive coastal areas, taking into consideration criteria of pollution risk such as impact on human health, aquatic ecosystems, and socioeconomic value of the area. Weighting factors were then attributed to the different criteria according to their regional priorities, and a total pollution risk score was calculated for every sensitive area. However, some sensitive areas are more vulnerable than others because of their natural characteristics. Therefore, the total pollution risk score was then multiplied by a vulnerability weighting factor and a Total Sensitivity Score was calculated for every sensitive area. With this method, Mediterranean sensitive areas in coastal zones can be ranked on a priority list and then categorized according to their "sensitivity," in a way that decision-makers can select the most urgent cases to direct their attention for the effective protection of the Mediterranean marine environment. The method is rapid and practicable and has already been used with existing data and information in several Mediterranean countries.

  7. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing

    National Research Council Canada - National Science Library

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR...

  8. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  9. A robust and rapid method of producing soluble, stable, and functional G-protein coupled receptors.

    Directory of Open Access Journals (Sweden)

    Karolina Corin

    Full Text Available Membrane proteins, particularly G-protein coupled receptors (GPCRs, are notoriously difficult to express. Using commercial E. coli cell-free systems with the detergent Brij-35, we could rapidly produce milligram quantities of 13 unique GPCRs. Immunoaffinity purification yielded receptors at >90% purity. Secondary structure analysis using circular dichroism indicated that the purified receptors were properly folded. Microscale thermophoresis, a novel label-free and surface-free detection technique that uses thermal gradients, showed that these receptors bound their ligands. The secondary structure and ligand-binding results from cell-free produced proteins were comparable to those expressed and purified from HEK293 cells. Our study demonstrates that cell-free protein production using commercially available kits and optimal detergents is a robust technology that can be used to produce sufficient GPCRs for biochemical, structural, and functional analyses. This robust and simple method may further stimulate others to study the structure and function of membrane proteins.

  10. Rapid method for surveying CO concentrations in high-rise buildings

    Energy Technology Data Exchange (ETDEWEB)

    Flachsbart, P.G.; Ott, W.R.

    1986-01-01

    A rapid method for employing personal exposure monitors (PEMs) to measure carbon monoxide (CO) concentrations in high-rise buildings is described. The purpose is to determine whether or not a CO problem exists in a building, and, if so, what corrective actions should be taken. The methodology was applied to a 15-story building in Palo Alto, CA, where elevated CO concentrations were discovered on the first 11 floors. The source appeared to be an underground parking garage. A follow-up survey four years later revealed that mitigative measures designed to reduce these concentrations had been successful. The survey methodology is inexpensive and can be applied to a number of buildings in a city.

  11. Evaluation of rapid alternative methods for drug susceptibility testing in clinical isolates of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Luciano Mengatto

    2006-08-01

    Full Text Available A study was carried out to compare the performance of a commercial method (MGIT and four inexpensive drug susceptibility methods: nitrate reductase assay (NRA, microscopic observation drug susceptibility (MODS assay, MTT test, and broth microdilution method (BMM. A total of 64 clinical isolates of Mycobacterium tuberculosis were studied. The Lowenstein-Jensen proportion method (PM was used as gold standard. MGIT, NRA, MODS, and MTT results were available on an average of less than 10 days, whereas BMM results could be reported in about 20 days. Most of the evaluated tests showed excellent performance for isoniazid and rifampicin, with sensitivity and specificity values > 90%. With most of the assays, sensitivity for ethambutol was low (62-87% whereas for streptomycin, sensitivity values ranged from 84 to 100%; NRA-discrepancies were associated with cultures with a low proportion of EMB-resistant organisms while most discrepancies with quantitative tests (MMT and BMM were seen with isolates whose minimal inhibitory concentrations fell close the cutoff. MGIT is reliable but still expensive. NRA is the most inexpensive and easiest method to perform without changing the organization of the routine PM laboratory performance. While MODS, MTT, and BMM, have the disadvantage from the point of view of biosafety, they offer the possibility of detecting partial resistant strains. This study shows a very good level of agreement of the four low-cost methods compared to the PM for rapid detection of isoniazid, rifampicin and streptomycin resistance (Kappa values > 0.8; more standardization is needed for ethambutol.

  12. A rapid and efficient method for assessing pathogenicity of ustilago maydis on maize and teosinte lines.

    Science.gov (United States)

    Chavan, Suchitra; Smith, Shavannor M

    2014-01-03

    Maize is a major cereal crop worldwide. However, susceptibility to biotrophic pathogens is the primary constraint to increasing productivity. U. maydis is a biotrophic fungal pathogen and the causal agent of corn smut on maize. This disease is responsible for significant yield losses of approximately $1.0 billion annually in the U.S.(1) Several methods including crop rotation, fungicide application and seed treatments are currently used to control corn smut(2). However, host resistance is the only practical method for managing corn smut. Identification of crop plants including maize, wheat, and rice that are resistant to various biotrophic pathogens has significantly decreased yield losses annually(3-5). Therefore, the use of a pathogen inoculation method that efficiently and reproducibly delivers the pathogen in between the plant leaves, would facilitate the rapid identification of maize lines that are resistant to U. maydis. As, a first step toward indentifying maize lines that are resistant to U. maydis, a needle injection inoculation method and a resistance reaction screening method was utilized to inoculate maize, teosinte, and maize x teosinte introgression lines with a U. maydis strain and to select resistant plants. Maize, teosinte and maize x teosinte introgression lines, consisting of about 700 plants, were planted, inoculated with a strain of U. maydis, and screened for resistance. The inoculation and screening methods successfully identified three teosinte lines resistant to U. maydis. Here a detailed needle injection inoculation and resistance reaction screening protocol for maize, teosinte, and maize x teosinte introgression lines is presented. This study demonstrates that needle injection inoculation is an invaluable tool in agriculture that can efficiently deliver U. maydis in between the plant leaves and has provided plant lines that are resistant to U. maydis that can now be combined and tested in breeding programs for improved disease resistance.

  13. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Science.gov (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  14. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Directory of Open Access Journals (Sweden)

    Will Rowe

    Full Text Available Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring.Here we present the Search Engine for Antimicrobial Resistance (SEAR, a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei.We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we

  15. A method for rapid measurement of laser ablation rate of hard dental tissue

    Science.gov (United States)

    Perhavec, T.; Gorkič, A.; Bračun, D.; Diaci, J.

    2009-06-01

    The aim of the study reported here is the development of a new method which allows rapid and accurate in-vitro measurements of three-dimensional (3D) shape of laser ablated craters in hard dental tissues and the determination of crater volume, ablation rate and speed. The method is based on the optical triangulation principle. A laser sheet projector illuminates the surface of a tooth, mounted on a linear translation stage. As the tooth is moved by the translation stage a fast digital video camera captures series of images of the illuminated surface. The images are analyzed to determine a 3D model of the surface. Custom software is employed to analyze the 3D model and to determine the volume of the ablated craters. Key characteristics of the method are discussed as well as some practical aspects pertinent to its use. The method has been employed in an in-vitro study to examine the ablation rates and speeds of the two main laser types currently employed in dentistry, Er:YAG and Er,Cr:YSGG. Ten samples of extracted human molar teeth were irradiated with laser pulse energies from 80 mJ to the maximum available energy (970 mJ with the Er:YAG, and 260 mJ with the Er,Cr:YSGG). About 2000 images of each ablated tooth surface have been acquired along a translation range of 10 mm, taking about 10 s and providing close to 1 million surface measurement points. Volumes of 170 ablated craters (half of them in dentine and the other half in enamel) were determined from this data and used to examine the ablated volume per pulse energy and ablation speed. The results show that, under the same conditions, the ablated volume per pulse energy achieved by the Er:YAG laser exceeds that of the Er,Cr:YSGG laser in almost all regimes for dentine and enamel. The maximum Er:YAG laser ablation speeds (1.2 mm 3/s in dentine and 0.7 mm 3/s in enamel) exceed those obtained by the Er,Cr:YSGG laser (0.39 mm 3/s in dentine and 0.12 mm 3/s in enamel). Since the presented method proves to be easy to

  16. Rapid, convenient method for screening imidazole-containing compounds for heme oxygenase inhibition.

    Science.gov (United States)

    Vlahakis, Jason Z; Rahman, Mona N; Roman, Gheorghe; Jia, Zongchao; Nakatsu, Kanji; Szarek, Walter A

    2011-01-01

    Sensitive assays for measuring heme oxygenase activity have been based on the gas-chromatographic detection of carbon monoxide using elaborate, expensive equipment. The present study describes a rapid and convenient method for screening imidazole-containing candidates for inhibitory activity against heme oxygenase using a plate reader, based on the spectroscopic evaluation of heme degradation. A PowerWave XS plate reader was used to monitor the absorbance (as a function of time) of heme bound to purified truncated human heme oxygenase-1 (hHO-1) in the individual wells of a standard 96-well plate (with or without the addition of a test compound). The degradation of heme by heme oxygenase-1 was initiated using l-ascorbic acid, and the collected relevant absorbance data were analyzed by three different methods to calculate the percent control activity occurring in wells containing test compounds relative to that occurring in control wells with no test compound present. In the cases of wells containing inhibitory compounds, significant shifts in λ(max) from 404 to near 412 nm were observed as well as a decrease in the rate of heme degradation relative to that of the control. Each of the three methods of data processing (overall percent drop in absorbance over 1.5h, initial rate of reaction determined over the first 5 min, and estimated pseudo first-order reaction rate constant determined over 1.5h) gave similar and reproducible results for percent control activity. The fastest and easiest method of data analysis was determined to be that using initial rates, involving data acquisition for only 5 min once reactions have been initiated using l-ascorbic acid. The results of the study demonstrate that this simple assay based on the spectroscopic detection of heme represents a rapid, convenient method to determine the relative inhibitory activity of candidate compounds, and is useful in quickly screening a series or library of compounds for heme oxygenase inhibition

  17. A rapid method of fruit cell isolation for cell size and shape measurements

    Directory of Open Access Journals (Sweden)

    Johnston Jason W

    2009-04-01

    Full Text Available Abstract Background Cell size is a structural component of fleshy fruit, contributing to important traits such as fruit size and texture. There are currently a number of methods for measuring cell size; most rely either on tissue sectioning or digestion of the tissue with cell wall degrading enzymes or chemicals to release single cells. Neither of these approaches is ideal for assaying large fruit numbers as both require a considerable time to prepare the tissue, with current methods of cell wall digestions taking 24 to 48 hours. Additionally, sectioning can lead to a measurement of a plane that does not represent the widest point of the cell. Results To develop a more rapid way of measuring fruit cell size we have developed a protocol that solubilises pectin in the middle lamella of the plant cell wall releasing single cells into a buffered solution. Gently boiling small fruit samples in a 0.05 M Na2CO3 solution, osmotically balanced with 0.3 M mannitol, produced good cell separation with little cellular damage in less than 30 minutes. The advantage of combining a chemical treatment with boiling is that the cells are rapidly killed. This stopped cell shape changes that could potentially occur during separation. With this method both the rounded and angular cells of the apple cultivars SciRos 'Pacific Rose' and SciFresh 'Jazz'™ were observed in the separated cells. Using this technique, an in-depth analysis was performed measuring cell size from 5 different apple cultivars. Cell size was measured using the public domain ImageJ software. For each cultivar a minimum of 1000 cells were measured and it was found that each cultivar displayed a different distribution of cell size. Cell size within cultivars was similar and there was no correlation between flesh firmness and cell size. This protocol was tested on tissue from other fleshy fruit including tomato, rock melon and kiwifruit. It was found that good cell separation was achieved with flesh

  18. Use of predictive models and rapid methods to nowcast bacteria levels at coastal beaches

    Science.gov (United States)

    Francy, Donna S.

    2009-01-01

    The need for rapid assessments of recreational water quality to better protect public health is well accepted throughout the research and regulatory communities. Rapid analytical methods, such as quantitative polymerase chain reaction (qPCR) and immunomagnetic separation/adenosine triphosphate (ATP) analysis, are being tested but are not yet ready for widespread use.Another solution is the use of predictive models, wherein variable(s) that are easily and quickly measured are surrogates for concentrations of fecal-indicator bacteria. Rainfall-based alerts, the simplest type of model, have been used by several communities for a number of years. Deterministic models use mathematical representations of the processes that affect bacteria concentrations; this type of model is being used for beach-closure decisions at one location in the USA. Multivariable statistical models are being developed and tested in many areas of the USA; however, they are only used in three areas of the Great Lakes to aid in notifications of beach advisories or closings. These “operational” statistical models can result in more accurate assessments of recreational water quality than use of the previous day's Escherichia coli (E. coli)concentration as determined by traditional culture methods. The Ohio Nowcast, at Huntington Beach, Bay Village, Ohio, is described in this paper as an example of an operational statistical model. Because predictive modeling is a dynamic process, water-resource managers continue to collect additional data to improve the predictive ability of the nowcast and expand the nowcast to other Ohio beaches and a recreational river. Although predictive models have been shown to work well at some beaches and are becoming more widely accepted, implementation in many areas is limited by funding, lack of coordinated technical leadership, and lack of supporting epidemiological data.

  19. Rapid radiometric methods to detect and differentiate Mycobacterium tuberculosis/M. bovis from other mycobacterial species

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqi, S.H.; Hwangbo, C.C.; Silcox, V.; Good, R.C.; Snider, D.E. Jr.; Middlebrook, G.

    1984-10-01

    Rapid methods for the differentiation of Mycobacterium tuberculosis/M. bovis (TB complex) from other mycobacteria (MOTT bacilli) were developed and evaluated in a three-phase study. In the first phase, techniques for identification of Mycobacterium species were developed by using radiometric technology and BACTEC Middlebrook 7H12 liquid medium. Based on /sup 14/CO/sub 2/ evolution, characteristic growth patterns were established for 13 commonly encountered mycobacterial species. Mycobacteria belonging to the TB complex were differentiated from other mycobacteria by cellular morphology and rate of /sup 14/CO/sub 2/ evolution. For further differentiation, radiometric tests for niacin production and inhibition by Q-nitro-alpha-acetyl amino-beta-hydroxy-propiophenone (NAP) were developed. In the second phase, 100 coded specimens on Lowenstein-Jensen medium were identified as members of the TB complex, MOTT bacilli, bacteria other than mycobacteria, or ''no viable organisms'' within 3 to 12 (average 6.4) days of receipt from the Centers for Disease Control. Isolation and identification of mycobacteria from 20 simulated sputum specimens were carried out in phase III. Out of 20 sputum specimens, 16 contained culturable mycobacteria, and all of the positives were detected by the BACTEC method in an average of 7.3 days. The positive mycobacterial cultures were isolated and identified as TB complex or MOTT bacilli in an average of 12.8 days. The radiometric NAP test was found to be highly sensitive and specific for a rapid identification of TB complex, whereas the radiometric niacin test was found to have some inherent problems. Radiometric BACTEC and conventional methodologies were in complete agreement in Phase II as well as in Phase III.

  20. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  1. Animal models of transcranial direct current stimulation: Methods and mechanisms.

    Science.gov (United States)

    Jackson, Mark P; Rahman, Asif; Lafon, Belen; Kronberg, Gregory; Ling, Doris; Parra, Lucas C; Bikson, Marom

    2016-11-01

    The objective of this review is to summarize the contribution of animal research using direct current stimulation (DCS) to our understanding of the physiological effects of transcranial direct current stimulation (tDCS). We comprehensively address experimental methodology in animal studies, broadly classified as: (1) transcranial stimulation; (2) direct cortical stimulation in vivo and (3) in vitro models. In each case advantages and disadvantages for translational research are discussed including dose translation and the overarching "quasi-uniform" assumption, which underpins translational relevance in all animal models of tDCS. Terminology such as anode, cathode, inward current, outward current, current density, electric field, and uniform are defined. Though we put key animal experiments spanning decades in perspective, our goal is not simply an exhaustive cataloging of relevant animal studies, but rather to put them in context of ongoing efforts to improve tDCS. Cellular targets, including excitatory neuronal somas, dendrites, axons, interneurons, glial cells, and endothelial cells are considered. We emphasize neurons are always depolarized and hyperpolarized such that effects of DCS on neuronal excitability can only be evaluated within subcellular regions of the neuron. Findings from animal studies on the effects of DCS on plasticity (LTP/LTD) and network oscillations are reviewed extensively. Any endogenous phenomena dependent on membrane potential changes are, in theory, susceptible to modulation by DCS. The relevance of morphological changes (galvanotropy) to tDCS is also considered, as we suggest microscopic migration of axon terminals or dendritic spines may be relevant during tDCS. A majority of clinical studies using tDCS employ a simplistic dose strategy where excitability is singularly increased or decreased under the anode and cathode, respectively. We discuss how this strategy, itself based on classic animal studies, cannot account for the

  2. Animal Models of transcranial Direct Current Stimulation: Methods and Mechanisms

    Science.gov (United States)

    Jackson, Mark P.; Rahman, Asif; Lafon, Belen; Kronberg, Gregory; Ling, Doris; Parra, Lucas C.; Bikson, Marom

    2016-01-01

    The objective of this review is to summarize the contribution of animal research using direct current stimulation (DCS) to our understanding of the physiological effects of transcranial direct current stimulation (tDCS). We comprehensively address experimental methodology in animal studies, broadly classified as: 1) transcranial stimulation; 2) direct cortical stimulation in vivo and 3) in vitro models. In each case advantages and disadvantages for translational research are discussed including dose translation and the overarching “quasi-uniform” assumption, which underpins translational relevance in all animal models of tDCS. Terminology such as anode, cathode, inward current, outward current, current density, electric field, and uniform are defined. Though we put key animal experiments spanning decades in perspective, our goal is not simply an exhaustive cataloging of relevant animal studies, but rather to put them in context of ongoing efforts to improve tDCS. Cellular targets, including excitatory neuronal somas, dendrites, axons, interneurons, glial cells, and endothelial cells are considered. We emphasize neurons are always depolarized and hyperpolarized such that effects of DCS on neuronal excitability can only be evaluated within subcellular regions of the neuron. Findings from animal studies on the effects of DCS on plasticity (LTP/LTD) and network oscillations are reviewed extensively. Any endogenous phenomena dependent on membrane potential changes are, in theory, susceptible to modulation by DCS. The relevance of morphological changes (galvanotropy) to tDCS is also considered, as we suggest microscopic migration of axon terminals or dendritic spines may be relevant during tDCS. A majority of clinical studies using tDCS employ a simplistic dose strategy where excitability is singularly increased or decreased under the anode and cathode, respectively. We discuss how this strategy, itself based on classic animal studies, cannot account for the

  3. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  4. Performance of traditional and direct labour procurement methods ...

    African Journals Online (AJOL)

    The objective was to find out if one has any advantage over the other. Project success determinants like cost, time and quality formed the basis for evaluation and comparison of the performance of the two methods. Thirty completed building projects made up of ten new buildings and twenty renovation works were examined.

  5. "Whole" Ballet Education: Exploring Direct and Indirect Teaching Methods

    Science.gov (United States)

    Choi, Euichang; Kim, Na-ye

    2015-01-01

    The purpose of this study was to explore teaching methods for whole ballet in Korean ballet education. This study built upon a first phase of research that identified the educational content of "whole" ballet. Four dimensions were identified as the educational content: "physical," "cognitive," "emotional"…

  6. Transplantation and direct sowing as methods of propagation of ...

    African Journals Online (AJOL)

    The establishment of Cordeauxia edulis Hemsley (yeheb) was assessed using two methods of propagation in glasshouse and in the field in 2006 and 2007 at Haramaya University, Ethiopia. In experiment 1, seedlings were transplanted into the field, with and without shade, 10, 20, 30, 40 and 50 days after germination.

  7. Divergence of Scientific Heuristic Method and Direct Algebraic Instruction

    Science.gov (United States)

    Calucag, Lina S.

    2016-01-01

    This is an experimental study, made used of the non-randomized experimental and control groups, pretest-posttest designs. The experimental and control groups were two separate intact classes in Algebra. For a period of twelve sessions, the experimental group was subjected to the scientific heuristic method, but the control group instead was given…

  8. A Structured Method for Direct Assessment of Writing.

    Science.gov (United States)

    Nevo, David

    The purpose of this study was to develop a testing method for the assessment of various types of writing at the elementary school level that would meet acceptable standards for educational measurement instruments as well as standards of utility and feasibility within a given educational system. The study was conducted within the framework of an…

  9. Method for Determination of Tinidazole using Direct UV-Visible ...

    African Journals Online (AJOL)

    MEC

    Gas liquid chromatography, high performance liquid chromatography [5], voltammetry [6] and ... The filter paper was washed several times with distilled water. The washings were added to the filtrate and final volume was made up to 100 ml with distilled water. Method I: 0.8 ml of filtrate of the sample solution was diluted to ...

  10. Ducted combustion chamber for direct injection engines and method

    Science.gov (United States)

    Mueller, Charles

    2015-03-03

    An internal combustion engine includes an engine block having a cylinder bore and a cylinder head having a flame deck surface disposed at one end of the cylinder bore. A piston connected to a rotatable crankshaft and configured to reciprocate within the cylinder bore has a piston crown portion facing the flame deck surface such that a combustion chamber is defined within the cylinder bore and between the piston crown and the flame deck surface. A fuel injector having a nozzle tip disposed in fluid communication with the combustion chamber has at least one nozzle opening configured to inject a fuel jet into the combustion chamber along a fuel jet centerline. At least one duct defined in the combustion chamber between the piston crown and the flame deck surface has a generally rectangular cross section and extends in a radial direction relative to the cylinder bore substantially along the fuel jet centerline.

  11. Direct mounted photovoltaic device with improved adhesion and method thereof

    Science.gov (United States)

    Boven, Michelle L; Keenihan, James R; Lickly, Stan; Brown, Jr., Claude; Cleereman, Robert J; Plum, Timothy C

    2014-12-23

    The present invention is premised upon a photovoltaic device suitable for directly mounting on a structure. The device includes an active portion including a photovoltaic cell assembly having a top surface portion that allows transmission of light energy to a photoactive portion of the photovoltaic device for conversion into electrical energy and a bottom surface having a bottom bonding zone; and an inactive portion immediately adjacent to and connected to the active portion, the inactive portion having a region for receiving a fastener to connect the device to the structure and having on a top surface, a top bonding zone; wherein one of the top and bottom bonding zones comprises a first bonding element and the other comprises a second bonding element, the second bonding element designed to interact with the first bonding element on a vertically overlapped adjacent photovoltaic device to bond the device to such adjacent device or to the structure.

  12. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  13. Modified agar dilution method for rapid antibiotic susceptibility testing of anaerobic bacteria.

    Science.gov (United States)

    Hanson, C W; Martin, W J

    1978-01-01

    A simplified method has been developed for agar dilution antimicrobial susceptibility testing of anaerobic bacteria, designed to economize on time and money when only a few isolates need to be tested. The procedure is based on the principle of using filter paper disks as carriers of the antibiotic and 35- by 10-mm petri dishes which, when inoculated with the Steers replicator, can test up to four organisms per plate. The procedure was run in parallel with conventional agar dilution techniques and showed 95% agreement to within one dilution for all minimal inhibitory concentrations recorded on fresh anaerobic isolates from clinical specimens. The technique was further simplified by using commercially available antibiotic-containing disks, thereby alleviating the tedious and time-consuming procedure of preparing the disks. The data indicated that 48- to 72-h diffusion periods were sufficient to achieve a uniform concentration of the antibiotic in the petri plate and that the antibiotics were stable at room temperature for that period of time. In terms of applicability and relevance to the needs of the clinical microbiology laboratory, the modified agar dilution method for rapid antimicrobial susceptibility testing of individual anaerobic isolates was found to be superior to the broth dilution method since it was easier to read and required considerably less set up time. PMID:400819

  14. Development of a rapid HRM genotyping method for detection of dog-derived Giardia lamblia.

    Science.gov (United States)

    Tan, Liping; Yu, Xingang; Abdullahi, Auwalu Yusuf; Wu, Sheng; Zheng, Guochao; Hu, Wei; Song, Meiran; Wang, Zhen; Jiang, Biao; Li, Guoqing

    2015-11-01

    Giardia lamblia is a zoonotic flagellate protozoan in the intestine of human and many mammals including dogs. To assess a threat of dog-derived G. lamblia to humans, the common dog-derived G. lamblia assemblages A, C, and D were genotyped by high-resolution melting (HRM) technology. According to β-giardin gene sequence, the qPCR-HRM primers BG5 and BG7 were designed. A series of experiments on the stability, sensitivity, and accuracy of the HRM method were also tested. Results showed that the primers BG5 and BG7 could distinguish among three assemblages A, C, and D, which Tm value differences were about 1 °C to each other. The melting curves of intra-assay reproducibility were almost coincided, and those of inter-assay reproducibility were much the same shape. The lowest detection concentration was about 5 × 10(-6)-ng/μL sample. The genotyping results from 21 G. lamblia samples by the HRM method were in complete accordance with sequencing results. It is concluded that the HRM genotyping method is rapid, stable, specific, highly sensitive, and suitable for clinical detection and molecular epidemiological survey of dog-derived G. lamblia.

  15. Rapid, high-temperature, field test method for evaluation of geothermal calcium carbonate scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1986-09-01

    A new test method is described that allows the rapid field testing of calcium carbonate scale inhibitors at 500/sup 0/F (260/sup 0/C). The method evolved from use of a full-flow test loop on a well with a mass flow rate of about 1 x 10/sup 6/ lbm/hr (126 kg/s). It is a simple, effective way to evaluate the effectiveness of inhibitors under field conditions. Five commercial formulations were chosen for field evaluation on the basis of nonflowing, laboratory screening tests at 500/sup 0/F (260/sup 0/C). Four of these formulations from different suppliers controlled calcium carbonate scale deposition as measured by the test method. Two of these could dislodge recently deposited scale that had not age-hardened. Performance-profile diagrams, which were measured for these four effective inhibitors, show the concentration interrelationship between brine calcium and inhibitor concentrations at which the formulations will and will not stop scale formation in the test apparatus. With these diagrams, one formulation was chosen for testing on the full-flow brine line. The composition was tested for 6 weeks and showed a dramatic decrease in the scaling occurring at the flow-control valve. This scaling was about to force a shutdown of a major, long-term flow test being done for reservoir economic evaluations. The inhibitor stopped the scaling, and the test was performed without interruption.

  16. A simple and rapid cultural method for detection of Enterobacter sakazakii in environmental samples.

    Science.gov (United States)

    Guillaume-Gentil, O; Sonnard, V; Kandhai, M C; Marugg, J D; Joosten, H

    2005-01-01

    A method was developed to detect and identify Enterobacter sakazakii in environmental samples. The method is based on selective enrichment at 45+/-0.5 degrees C in lauryl sulfate tryptose broth supplemented with 0.5 M NaCl and 10 mg/liter vancomycin (mLST) for 22 to 24 h followed by streaking on tryptone soy agar with bile salts. When exposed to light during incubation at 37 degrees C, E. sakazakii produces yellow colonies within 24 h; identification was confirmed by testing for alpha-glucosidase activity and by using API 20E strips. All of the E. sakazakii strains tested (n = 99) were able to grow in mLST at 45+/-0.5 degrees C, whereas 35 of 39 strains of potential competitors, all belonging to the Enterobacteriaceae, were suppressed. A survey was carried out with 192 environmental samples from four different milk powder factories. Using this new protocol, E. sakazakii was isolated from almost 40% of the samples, whereas the reference procedure (enrichment in buffered peptone water, isolation on violet red bile glucose agar, and biochemical identification of randomly chosen colonies) only yielded 26% positive results. This selective method can be very useful for the rapid and reliable detection of E. sakazakii in environmental samples.

  17. Rapid, Simple, and Sensitive Spectrofluorimetric Method for the Estimation of Ganciclovir in Bulk and Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Garima Balwani

    2013-01-01

    Full Text Available A new, simple, rapid, sensitive, accurate, and affordable spectrofluorimetric method was developed and validated for the estimation of ganciclovir in bulk as well as in marketed formulations. The method was based on measuring the native fluorescence of ganciclovir in 0.2 M hydrochloric acid buffer of pH 1.2 at 374 nm after excitation at 257 nm. The calibration graph was found to be rectilinear in the concentration range of 0.25–2.00 μg mL−1. The limit of quantification and limit of detection were found to be 0.029 μg mL−1 and 0.010 μg mL−1, respectively. The method was fully validated for various parameters according to ICH guidelines. The results demonstrated that the procedure is accurate, precise, and reproducible (relative standard deviation <2% and can be successfully applied for the determination of ganciclovir in its commercial capsules with average percentage recovery of 101.31 ± 0.90.

  18. A rapid and efficient electroporation method for transformation of Halomonas sp. O-1.

    Science.gov (United States)

    Harris, Joshua R; Lundgren, Benjamin R; Grzeskowiak, Brian R; Mizuno, Kouhei; Nomura, Christopher T

    2016-10-01

    Halomonas sp. O-1 is a halophilic bacterium with a high potential for industrial application due to its natural ability to produce polyhydroxyalkanoates (PHAs) using seawater-based media. However, a major barrier preventing industrial scale implementation of this organism is a lack of molecular methodologies capable of readily transforming members of the Halomonas genus. Currently, the only reliable method used for introducing DNA into Halomonas spp. is bacterial conjugation, a somewhat tedious and time-consuming technique compared to electroporation-based methodologies. Here we describe a rapid and reproducible method for the electroporation of Halomonas sp. O-1 with plasmid DNA. Electrocompetent cells were generated by growing Halomonas sp. O-1 in a yeast extract-tryptone medium with a final salinity of 3.5%, pH of 7.5, followed by several washes using 300mM sucrose. Results show that plasmids containing chloramphenicol (Cm(R)) and gentamicin (Gm(R)) resistance cassettes are suitable antibiotic selection markers for transformation and yields of 10(4) transformants per μg of DNA were obtained. This method is simple to perform and the materials used are readily available in most research labs. Additionally, this plasmid-based transformation procedure has the potential to be adapted for a number of applications including the creation of recombinant stains and the generation of deletion mutants of Halomonas spp. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. A Rapid and Sensitive Method to Measure the Functional Activity of Shiga Toxins in Human Serum

    Directory of Open Access Journals (Sweden)

    Valentina Arfilli

    2015-11-01

    Full Text Available Shiga toxins (Stx have a definite role in the development of hemolytic uremic syndrome in children with hemorrhagic colitis caused by pathogenic Stx-producing Escherichia coli (STEC strains. The dramatic effects of these toxins on the microvasculature of different organs, particularly of the kidney, are well known, whereas there is no consensus on the mechanism by which Stx reach the endothelia of target organs and/or indirectly injure these body sites. We hereby describe a quick (4 h, radioactive, Raji cell-based method designed for the detection of Stx in human sera. The assay monitors the translation impairment induced by these powerful inhibitors of protein synthesis, which are identified properly by neutralizing their activity with specific monoclonal antibodies. By this method, we detected for the first time the functional activity of Stx in sera of STEC-infected patients during hemorrhagic colitis. Recent research has pointed to a dynamic process of Stx-induced renal intoxication in which concurrent and interactive steps are involved. Our rapid and specific method could be useful for studying the kinetics of Stx during the natural course of STEC infection and the interplay between Stx activity in serum and Stx presence in different blood fractions (neutrophils, monocytes, platelets, leukocyte-platelet aggregates, microvesicles, lipoproteins.

  20. FLASH: A rapid method for prototyping paper-based microfluidic devices‡

    Science.gov (United States)

    Martinez, Andres W.; Phillips, Scott T.; Wiley, Benjamin J.; Gupta, Malancha

    2011-01-01

    This article describes FLASH (Fast Lithographic Activation of Sheets), a rapid method for laboratory prototyping of microfluidic devices in paper. Paper-based microfluidic devices are emerging as a new technology for applications in diagnostics for the developing world, where low cost and simplicity are essential. FLASH is based on photolithography, but requires only a UV lamp and a hotplate; no clean-room or special facilities are required (FLASH patterning can even be performed in sunlight if a UV lamp and hotplate are unavailable). The method provides channels in paper with dimensions as small as 200 μm in width and 70 μm in height; the height is defined by the thickness of the paper. Photomasks for patterning paper-based microfluidic devices can be printed using an ink-jet printer or photocopier, or drawn by hand using a waterproof black pen. FLASH provides a straightforward method for prototyping paper-based microfluidic devices in regions where the technological support for conventional photolithography is not available. PMID:19023478

  1. AO–MW–PLS method applied to rapid quantification of teicoplanin with near-infrared spectroscopy

    Directory of Open Access Journals (Sweden)

    Jiemei Chen

    2017-01-01

    Full Text Available Teicoplanin (TCP is an important lipoglycopeptide antibiotic produced by fermenting Actinoplanes teichomyceticus. The change in TCP concentration is important to measure in the fermentation process. In this study, a reagent-free and rapid quantification method for TCP in the TCP–Tris–HCl mixture samples was developed using near-infrared (NIR spectroscopy by focusing our attention on the fermentation process for TCP. The absorbance optimization (AO partial least squares (PLS was proposed and integrated with the moving window (MW PLS, which is called AO–MW–PLS method, to select appropriate wavebands. A model set that includes various wavebands that were equivalent to the optimal AO–MW–PLS waveband was proposed based on statistical considerations. The public region of all equivalent wavebands was just one of the equivalent wavebands. The obtained public regions were 1540–1868nm for TCP and 1114–1310nm for Tris. The root-mean-square error and correlation coefficient for leave-one-out cross validation were 0.046mg mL−1 and 0.9998mg mL−1 for TCP, and 0.235mg mL−1 and 0.9986mg mL−1 for Tris, respectively. All the models achieved highly accurate prediction effects, and the selected wavebands provided valuable references for designing specialized spectrometers. This study provided a valuable reference for further application of the proposed methods to TCP fermentation broth and to other spectroscopic analysis fields.

  2. A simple electrochemical method for the rapid estimation of antioxidant potentials of some selected medicinal plants.

    Science.gov (United States)

    Amidi, Salimeh; Mojab, Faraz; Bayandori Moghaddam, Abdolmajid; Tabib, Kimia; Kobarfard, Farzad

    2012-01-01

    Clinical and Epidemiological studies have shown that a diet rich in fruits and vegetables is associated with a decreased risk of cardiovascular diseases, cancers and other related disorders. These beneficial health effects have been attributed in part to the presence of antioxidants in dietary plants. Therefore screening for antioxidant properties of plant extracts has been one of the interests of scientists in this field. Different screening methods have been reported for the evaluation of antioxidant properties of plant extracts in the literature. In the present research a rapid screening method has been introduced based on cyclic voltammetry for antioxidant screening of some selected medicinal plant extracts. CYCLIC VOLTAMMETRY OF METHANOLIC EXTRACTS OF SEVEN MEDICINAL PLANTS: Buxus hyrcana, Rumex crispus, Achillea millefolium, Zataria multiflora, Ginkgo biloba, Lippia citriodora and Heptaptera anisoptera was carried out at different scan rates. Based on the interpretation of voltammograms, Rumex crispus, Achillea millefolium and Ginkgo biloba showed higher antioxidant capability than the others while Lippia citriodora contained the highest amount of antioxidants. Cyclic voltammetry is expected to be a simple method for screening antioxidants and estimating the antioxidant activity of foods and medicinal plants.

  3. A Rapid and Sensitive Method to Measure the Functional Activity of Shiga Toxins in Human Serum

    Science.gov (United States)

    Arfilli, Valentina; Carnicelli, Domenica; Ardissino, Gianluigi; Torresani, Erminio; Scavia, Gaia; Brigotti, Maurizio

    2015-01-01

    Shiga toxins (Stx) have a definite role in the development of hemolytic uremic syndrome in children with hemorrhagic colitis caused by pathogenic Stx-producing Escherichia coli (STEC) strains. The dramatic effects of these toxins on the microvasculature of different organs, particularly of the kidney, are well known, whereas there is no consensus on the mechanism by which Stx reach the endothelia of target organs and/or indirectly injure these body sites. We hereby describe a quick (4 h), radioactive, Raji cell-based method designed for the detection of Stx in human sera. The assay monitors the translation impairment induced by these powerful inhibitors of protein synthesis, which are identified properly by neutralizing their activity with specific monoclonal antibodies. By this method, we detected for the first time the functional activity of Stx in sera of STEC-infected patients during hemorrhagic colitis. Recent research has pointed to a dynamic process of Stx-induced renal intoxication in which concurrent and interactive steps are involved. Our rapid and specific method could be useful for studying the kinetics of Stx during the natural course of STEC infection and the interplay between Stx activity in serum and Stx presence in different blood fractions (neutrophils, monocytes, platelets, leukocyte-platelet aggregates, microvesicles, lipoproteins). PMID:26556372

  4. Rapid and sensitive method for determination of withaferin-A in human plasma by HPLC.

    Science.gov (United States)

    Patial, Pankaj; Gota, Vikram

    2011-02-01

    To develop and validate a rapid and sensitive high-performance liquid chromatographic method for determination of withaferin-A in human plasma. Withaferin-A, the active molecule of a traditional Indian herb, has demonstrated several biological activities in preclinical models. A validated bioassay is not available for its pharmacokinetic evaluation. The chromatographic system used a reverse-phase C18 column with UV-visible detection at 225 nm. The mobile phase consisted of water and acetonitrile applied in a gradient flow. Withaferin-A was extracted by simple protein-precipitation technique. The calibration curve was linear in the concentration range of 0.05-1.6 µg/ml. The method has the desired sensitivity to detect the plasma concentration range of withaferin-A that is likely to show biological activity based on in vitro data. This is the first HPLC method ever described for the estimation of withaferin-A in human plasma which could be applied for pharmacokinetic studies.

  5. Validation of a user-friendly and rapid method for quantifying iodine content of salt.

    Science.gov (United States)

    Rohner, Fabian; Garrett, Greg S; Laillou, Arnaud; Frey, Simone K; Mothes, Ralf; Schweigert, Florian J; Locatelli-Rossi, Lorenzo

    2012-12-01

    Despite considerable progress made in the past decade through salt iodization programs, over 2 billion people worldwide still have inadequate iodine intake, with devastating consequences for brain development and intellectual capacity. To optimize these programs with regard to salt iodine content, careful monitoring of salt iodine content is essential, but few methods are available to quantitatively measure iodine concentration in a simple, fast, and safe way. We have validated a newly developed device that quantitatively measures the content of potassium iodate in salt in a simple, safe, and rapid way. The linearity, determination and detection limit, and inter- and intra-assay variability of this colorimetric method were assessed and the method was compared with iodometric titration, using salt samples from several countries. Linearity of analysis ranged from 5 to 75 mg/kg iodine, with 1 mg/kg being the determination limit; the intra- and interassay imprecision was 0.9%, 0.5%, and 0.7% and 1.5%, 1.7%, and 2.5% for salt samples with iodine contents of 17, 30, and 55 mg/kg, respectively; the interoperator imprecision for the same samples was 1.2%, 4.9%, and 4.7%, respectively. Comparison with the iodometric method showed high agreement between the methods (R2 = 0.978; limits of agreement, -10.5 to 10.0 mg/kg). The device offers a field- and user-friendly solution to quantifying potassium iodate salt content reliably. For countries that use potassium iodide in salt iodization programs, further validation is required.

  6. Validity and feasibility of a satellite imagery-based method for rapid estimation of displaced populations

    Directory of Open Access Journals (Sweden)

    Checchi Francesco

    2013-01-01

    Full Text Available Abstract Background Estimating the size of forcibly displaced populations is key to documenting their plight and allocating sufficient resources to their assistance, but is often not done, particularly during the acute phase of displacement, due to methodological challenges and inaccessibility. In this study, we explored the potential use of very high resolution satellite imagery to remotely estimate forcibly displaced populations. Methods Our method consisted of multiplying (i manual counts of assumed residential structures on a satellite image and (ii estimates of the mean number of people per structure (structure occupancy obtained from publicly available reports. We computed population estimates for 11 sites in Bangladesh, Chad, Democratic Republic of Congo, Ethiopia, Haiti, Kenya and Mozambique (six refugee camps, three internally displaced persons’ camps and two urban neighbourhoods with a mixture of residents and displaced ranging in population from 1,969 to 90,547, and compared these to “gold standard” reference population figures from census or other robust methods. Results Structure counts by independent analysts were reasonably consistent. Between one and 11 occupancy reports were available per site and most of these reported people per household rather than per structure. The imagery-based method had a precision relative to reference population figures of Conclusions In settings with clearly distinguishable individual structures, the remote, imagery-based method had reasonable accuracy for the purposes of rapid estimation, was simple and quick to implement, and would likely perform better in more current application. However, it may have insurmountable limitations in settings featuring connected buildings or shelters, a complex pattern of roofs and multi-level buildings. Based on these results, we discuss possible ways forward for the method’s development.

  7. A method for rapid measurement of intrarenal and other tissue pressures.

    Science.gov (United States)

    SWANN, H G; MONTGOMERY, A V; DAVIS, J C; MICKLE, E R

    1950-12-01

    A rapid method for measuring tissue pressures has been designed. A pressure of 250 mm. Hg is imposed on a manometer. Then the system is allowed to discharge into a needle cannula inserted in the tissue. The manometer forces out fluid (about 10 c.mm.) until the pressure within it is the same as that within the tissue. Records of the pressure changes are made. Each observation takes about a minute. The method gives results that are closely comparable with other reports of tissue pressures. With this method, the pressure in the following organs of dogs was found to be: kidney, 26 mm. Hg, cerebral cortex, 0 to 5 mm., muscle, 1 to 10 mm., spleen, S to 16 mm., subcutaneous tissue, 0 to 3 mm., and liver -2 to 14 mm. The reliability of the method was tested on the kidneys of decerebrate dogs. Measurements were found to be the same within narrow limits over a period of an hour; they were the same when taken simultaneously in different regions of the same kidney or in opposite kidneys. They were independent of the volume of fluid forced into the tissue. Similar pressures were observed with 1 or 5 or 10 holes bored in the shaft of the cannulating needle. The intrarenal pressure was also measured by inserting a needle cannula into the tissue and then allowing the pressure to reach equilibrium passively with a manometer. This method gave similar results. The intrarenal pressure has now found to be the same when measured by three different technics.

  8. Improved Savitzky-Golay-method-based fluorescence subtraction algorithm for rapid recovery of Raman spectra.

    Science.gov (United States)

    Chen, Kun; Zhang, Hongyuan; Wei, Haoyun; Li, Yan

    2014-08-20

    In this paper, we propose an improved subtraction algorithm for rapid recovery of Raman spectra that can substantially reduce the computation time. This algorithm is based on an improved Savitzky-Golay (SG) iterative smoothing method, which involves two key novel approaches: (a) the use of the Gauss-Seidel method and (b) the introduction of a relaxation factor into the iterative procedure. By applying a novel successive relaxation (SG-SR) iterative method to the relaxation factor, additional improvement in the convergence speed over the standard Savitzky-Golay procedure is realized. The proposed improved algorithm (the RIA-SG-SR algorithm), which uses SG-SR-based iteration instead of Savitzky-Golay iteration, has been optimized and validated with a mathematically simulated Raman spectrum, as well as experimentally measured Raman spectra from non-biological and biological samples. The method results in a significant reduction in computing cost while yielding consistent rejection of fluorescence and noise for spectra with low signal-to-fluorescence ratios and varied baselines. In the simulation, RIA-SG-SR achieved 1 order of magnitude improvement in iteration number and 2 orders of magnitude improvement in computation time compared with the range-independent background-subtraction algorithm (RIA). Furthermore the computation time of the experimentally measured raw Raman spectrum processing from skin tissue decreased from 6.72 to 0.094 s. In general, the processing of the SG-SR method can be conducted within dozens of milliseconds, which can provide a real-time procedure in practical situations.

  9. A Rapid Method for Quantifying Viable Mycobacterium avium subsp. paratuberculosis in Cellular Infection Assays

    Science.gov (United States)

    Pooley, Hannah B.; de Silva, Kumudika; Purdie, Auriol C.; Begg, Douglas J.; Whittington, Richard J.

    2016-01-01

    ABSTRACT Determining the viability of bacteria is a key outcome of in vitro cellular infection assays. Currently, this is done by culture, which is problematic for fastidious slow-growing bacteria such as Mycobacterium avium subsp. paratuberculosis, where it can take up to 4 months to confirm growth. This study aimed to identify an assay that can rapidly quantify the number of viable M. avium subsp. paratuberculosis cells in a cellular sample. Three commercially available bacterial viability assays along with a modified liquid culture method coupled with high-throughput quantitative PCR growth detection were assessed. Criteria for assessment included the ability of each assay to differentiate live and dead M. avium subsp. paratuberculosis organisms and their accuracy at low bacterial concentrations. Using the culture-based method, M. avium subsp. paratuberculosis growth was reliably detected and quantified within 2 weeks. There was a strong linear association between the 2-week growth rate and the initial inoculum concentration. The number of viable M. avium subsp. paratuberculosis cells in an unknown sample was quantified based on the growth rate, by using growth standards. In contrast, none of the commercially available viability assays were suitable for use with samples from in vitro cellular infection assays. IMPORTANCE Rapid quantification of the viability of Mycobacterium avium subsp. paratuberculosis in samples from in vitro cellular infection assays is important, as it allows these assays to be carried out on a large scale. In vitro cellular infection assays can function as a preliminary screening tool, for vaccine development or antimicrobial screening, and also to extend findings derived from experimental animal trials. Currently, by using culture, it takes up to 4 months to obtain quantifiable results regarding M. avium subsp. paratuberculosis viability after an in vitro infection assay; however, with the quantitative PCR and liquid culture method

  10. HybriFree: a robust and rapid method for the development of monoclonal antibodies from different host species.

    Science.gov (United States)

    Kivi, Gaily; Teesalu, Kaupo; Parik, Jüri; Kontkar, Elen; Ustav, Mart; Noodla, Liis; Ustav, Mart; Männik, Andres

    2016-01-08

    The production of recombinant monoclonal antibodies in mammalian cell culture is of high priority in research and medical fields. A critical step in this process is the isolation of the antigen-binding domain sequences of antibodies possessing the desired properties. Many different techniques have been described to achieve this goal, but all have shortcomings; most techniques have problems with robustness, are time-consuming and costly, or have complications in the transfer from isolation to production phase. Here, we report a novel HybriFree technology for the development of monoclonal antibodies from different species that is robust, rapid, inexpensive and flexible and can be used for the subsequent production of antibodies in mammalian cell factories. HybriFree technology is illustrated herein via detailed examples of isolating mouse, rabbit and chicken monoclonal antibody sequences from immunized animals. Starting from crude spleen samples, antigen capturing of specific B-cells is performed initially. cDNA of antibody variable domains is amplified from the captured cells and used a source material for simple and rapid restriction/ligation free cloning of expression vector library in order to produce scFv-Fc or intact IgG antibodies. The vectors can be directly used for screening purposes as well as for the subsequent production of the developed monoclonal antibodies in mammalian cell culture. The antibodies isolated by the method have been shown to be functional in different immunoassays, including ELISA, immunofluorescence and Western blot. In addition, we demonstrate that by using a modified method including a negative selection step, we can isolate specific antibodies targeting the desired epitope and eliminate antibodies directed to undesired off-targets. HybriFree can be used for the reliable development of monoclonal antibodies and their subsequent production in mammalian cells. This simple protocol requires neither the culturing of B-cells nor single

  11. Contained Morcellation: Review of Current Methods and Future Directions.

    Science.gov (United States)

    Taylan, Enes; Sahin, Cagdas; Zeybek, Burak; Akdemir, Ali

    2017-01-01

    Power morcellation of surgical specimen during laparoscopic surgery is a practical technology that provides the opportunity to perform several minimally invasive procedures. However, this technology brought forward additional risks and complications associated with dissemination of both benign and malignant tissues inside the abdominal cavity. Based on startling cases, Food and Drug Administration (FDA) announced a discouraging statement on the use of power morcellators that decreased the number of minimally invasive approaches in the following period. As a response to these concerns and negative impacts of the FDA statement, researchers developed several new approaches resulting in contained or in-bag morcellation methods. In this review, we aimed to discuss these current methods and provide an insight for future developments.

  12. Ecosytem Services: A Rapid Assessment Method Tested at 35 Sites of the LTER-Europe Network

    Directory of Open Access Journals (Sweden)

    Dick Jan

    2014-08-01

    Full Text Available The identification of parameters to monitor the ecosystem services delivered at a site is fundamental to the concept’s adoption as a useful policy instrument at local, national and international scales. In this paper we (i describe the process of developing a rapid comprehensive ecosystem service assessment methodology and (ii test the applicability of the protocol at 35 long-term research (LTER sites across 14 countries in the LTER-Europe network (www.lter-europe.net including marine, urban, agricultural, forest, desert and conservation sites. An assessment of probability of occurrence with estimated confidence score using 83 ecosystem service parameters was tested. The parameters were either specific services like food production or proxies such as human activities which were considered surrogates for cultural diversity and economic activity. This initial test of the ecosystem service parameter list revealed that the parameters tested were relatively easy to score by site managers with a high level of certainty (92% scored as either occurring or not occurring at the site with certainty of over 90%. Based on this assessment, we concluded that (i this approach to operationalise the concept of ecosystem services is practical and applicable by many sectors of civil society as a first screen of the ecosystem services present at a site, (ii this study has direct relevance to land management and policy decision makers as a transparent vehicle to focus testing scenarios and target data gathering, but (iii further work beyond the scale investigated here is required to ensure global applicability.

  13. Novel Simplified and Rapid Method for Screening and Isolation of Polyunsaturated Fatty Acids Producing Marine Bacteria

    Directory of Open Access Journals (Sweden)

    Ashwini Tilay

    2012-01-01

    Full Text Available Bacterial production of polyunsaturated fatty acids (PUFAs is a potential biotechnological approach for production of valuable nutraceuticals. Reliable method for screening of number of strains within short period of time is great need. Here, we report a novel simplified method for screening and isolation of PUFA-producing bacteria by direct visualization using the H2O2-plate assay. The oxidative stability of PUFAs in growing bacteria towards added H2O2 is a distinguishing characteristic between the PUFAs producers (no zone of inhibition and non-PUFAs producers (zone of inhibition by direct visualization. The confirmation of assay results was performed by injecting fatty acid methyl esters (FAMEs produced by selected marine bacteria to Gas Chromatography-Mass Spectrometry (GCMS. To date, this assay is the most effective, inexpensive, and specific method for bacteria producing PUFAs and shows drastically reduction in the number of samples thus saves the time, effort, and cost of screening and isolating strains of bacterial PUFAs producers.

  14. Temperature measurement methods during direct heat arterial tissue fusion.

    Science.gov (United States)

    Cezo, James D; Kramer, Eric; Taylor, Kenneth D; Ferguson, Virginia; Rentschler, Mark E

    2013-09-01

    Fusion of biological tissues through direct and indirect heating is a growing area of medical research, yet there are still major gaps in understanding this procedure. Several companies have developed devices which fuse blood vessels, but little is known about the tissue's response to the stimuli. The need for accurate measurements of tissue behavior during tissue fusion is essential for the continued development and improvement of energy delivery devices. An experimental study was performed to measure the temperatures experienced during tissue fusion and the resulting burst pressure of the fused arteries. An array of thermocouples was placed in the lumen of a porcine splenic artery segment and sealed using a ConMed Altrus thermal fusion device. The temperatures within the tissue, in the device, and at the tissue-device interface were recorded. These measurements were then analyzed to calculate the temperature profile in the lumen of the artery. The temperature in the artery at the site of tissue fusion was measured to range from 142 to 163 °C using the ConMed Altrus. The corresponding burst pressure for arteries fused at this temperature was measured as 416 ± 79 mmHg. This study represents the first known experimental measurement of temperature at the site of vessel sealing found in the literature.

  15. A Simple and Rapid Identification Method for Mycobacterium bovis BCG with Loop-Mediated Isothermal Amplification.

    Directory of Open Access Journals (Sweden)

    Yuji Kouzaki

    Full Text Available Bacillus Calmette-Guérin (BCG is widely used as a live attenuated vaccine against Mycobacterium tuberculosis and is an agent for standard prophylaxis against the recurrence of bladder cancer. Unfortunately, it can cause severe infectious diseases, especially in immunocompromised patients, and the ability to immediately distinguish BCG from other M. tuberculosis complexes is therefore important. In this study, we developed a simple and easy-to-perform identification procedure using loop-mediated amplification (LAMP to detect deletions within the region of difference, which is deleted specifically in all M. bovis BCG strains. Reactions were performed at 64 °C for 30 min and successful targeted gene amplifications were detected by real-time turbidity using a turbidimeter and visual inspection of color change. The assay had an equivalent detection limit of 1.0 pg of genomic DNA using a turbidimeter whereas it was 10 pg with visual inspection, and it showed specificity against 49 strains of 44 pathogens, including M. tuberculosis complex. The expected LAMP products were confirmed through identical melting curves in real-time LAMP procedures. We employed the Procedure for Ultra Rapid Extraction (PURE kit to isolate mycobacterial DNA and found that the highest sensitivity limit with a minimum total cell count of mycobacterium (including DNA purification with PURE was up to 1 × 10(3 cells/reaction, based on color changes under natural light with FDA reagents. The detection limit of this procedure when applied to artificial serum, urine, cerebrospinal fluid, and bronchoalveolar lavage fluid samples was also about 1 × 10(3 cells/reaction. Therefore, this substitute method using conventional culture or clinical specimens followed by LAMP combined with PURE could be a powerful tool to enable the rapid identification of M. bovis BCG as point-of-care testing. It is suitable for practical use not only in resource-limited situations, but also in any

  16. Development of a fluorescence in situ hybridization (FISH) method for rapid detection of Ulva prolifera

    Science.gov (United States)

    Zhang, Qing-Chun; Liu, Qing; Kang, Zhen-Jun; Yu, Ren-Cheng; Yan, Tian; Zhou, Ming-Jiang

    2015-09-01

    Large-scale green tides have occurred consecutively since 2007 in the Yellow Sea (YS), China. The dominant causative species of the green tides has been identified as Ulva prolifera. The origin of green tides in the YS has been traced back to the Subei Shoal based on the results of remote-sensing, numerical simulations and field investigations. However, it is difficult to study the early development of green tides in the Subei Shoal because of the mixture of multiple green algae and the morphological diversity of U. prolifera when under variable environmental conditions. In this study, a rapid and accurate fluorescence in situ hybridization (FISH) method was developed to detect U. prolifera from the community of green algae targeting the 5S rDNA spacer region of U. prolifera. Two specific probes, 5S-1 and 5S-2, were designed based on the sequences of the 5S rDNA spacer regions of U. prolifera, Ulva linza and Ulva flexuosa. Specificity of the FISH method was tested using the six species of green algae commonly occurring in the Subei Shoal, including U. prolifera, U. linza, U. flexuosa, Ulva compressa, Ulva pertusa and Blidingia sp. The results showed that only U. prolifera could be labeled with both probes. Probe 5S-1, which showed a much higher labeling efficiency on U. prolifera, was ultimately selected as the probe for the FISH detection. The sample preparation method was optimized, particularly for the mature green algae, by the addition of cellulase and proteinase K in the pre-hybridization solution. Labeling efficiency with the probe 5S-1 reached 96% on average under the optimized conditions. The successful development of the FISH method has been applied to qualitative and quantitative analysis of field samples collected from the YS, and the results indicate a potential use in future green algae studies.

  17. A rapid method for the sequential separation of polonium, plutonium, americium and uranium in drinking water.

    Science.gov (United States)

    Lemons, B; Khaing, H; Ward, A; Thakur, P

    2018-02-06

    A new sequential separation method for the determination of polonium and actinides (Pu, Am and U) in drinking water samples has been developed that can be used for emergency response or routine water analyses. For the first time, the application of TEVA chromatography column in the sequential separation of polonium and plutonium has been studied. This method utilizes a rapid Fe +3 co-precipitation step to remove matrix interferences, followed by plutonium oxidation state adjustment to Pu 4+ and an incubation period of ~ 1 h at 50-60 °C to allow Po 2+ to oxidize to Po 4+ . The polonium and plutonium were then separated on a TEVA column, while separation of americium from uranium was performed on a TRU column. After separation, polonium was micro-precipitated with copper sulfide (CuS), while actinides were micro co-precipitated using neodymium fluoride (NdF 3 ) for counting by the alpha spectrometry. The method is simple, robust and can be performed quickly with excellent removal of interferences, high chemical recovery and very good alpha peak resolution. The efficiency and reliability of the procedures were tested by using spiked samples. The effect of several transition metals (Cu 2+ , Pb 2+ , Fe 3+ , Fe 2+ , and Ni 2+ ) on the performance of this method were also assessed to evaluate the potential matrix effects. Studies indicate that presence of up to 25 mg of these cations in the samples had no adverse effect on the recovery or the resolution of polonium alpha peaks. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. TranScreen-N: Method for rapid screening of trans-ungual drug delivery enhancers.

    Science.gov (United States)

    Murthy, S Narasimha; Vaka, Siva Ram Kiran; Sammeta, Srinivasa Murthy; Nair, Anroop B

    2009-11-01

    Topical monotherapy of nail diseases such as onychomycosis and nail psoriasis has been less successful due to poor permeability of the human nail plate to topically administered drugs. Chemical enhancers are utilized to improve the drug delivery across the nail plate. Choosing the most effective chemical enhancers for the given drug and formulation is highly critical in determining the efficacy of topical therapy of nail diseases. Screening the large pool of enhancers using currently followed diffusion cell experiments would be tedious and expensive. The main objective of this study is to develop TranScreen-N, a high throughput method of screening trans-ungual drug permeation enhancers. It is a rapid microwell plate based method which involves two different treatment procedures; the simultaneous exposure treatment and the sequential exposure treatment. In the present study, several chemicals were evaluated by TranScreen-N and by diffusion studies in the Franz diffusion cell (FDC). Good agreement of in vitro drug delivery data with TranScreen-N data provided validity to the screening technique. In TranScreen-N technique, the enhancers can be grouped according to whether they need to be applied before or simultaneously with drugs (or by either procedures) to enhance the drug delivery across the nail plate. TranScreen-N technique can significantly reduce the cost and duration required to screen trans-ungual drug delivery enhancers. (c) 2009 Wiley-Liss, Inc. and the American Pharmacists Association

  19. A rapid method to authenticate vegetable oils through surface-enhanced Raman scattering

    Science.gov (United States)

    Lv, Ming Yang; Zhang, Xin; Ren, Hai Rui; Liu, Luo; Zhao, Yong Mei; Wang, Zheng; Wu, Zheng Long; Liu, Li Min; Xu, Hai Jun

    2016-03-01

    Vegetable oils are essential in our daily diet. Among various vegetable oils, the major difference lies in the composition of fatty acids, including unsaturated fatty acids (USFA) and saturated fatty acids (SFA). USFA include oleic acid (OA), linoleic acid (LA), and α-linolenic acid (ALA), while SFA are mainly palmitic acid (PA). In this study, the most typical and abundant USFA present with PA in vegetable oils were quantified. More importantly, certain proportional relationships between the integrated intensities of peaks centered at 1656 cm-1 (S1656) in the surface-enhanced Raman scattering spectra of different USFA were confirmed. Therefore, the LA or ALA content could be converted into an equivalent virtual OA content enabling the characterization of the USFA content in vegetable oils using the equivalent total OA content. In combination with the S1656 of pure OA and using peanut, sesame, and soybean oils as examples, the ranges of S1656 corresponding to the National Standards of China were established to allow the rapid authentication of vegetable oils. Gas chromatograph-mass spectrometer analyses verified the accuracy of the method, with relative errors of less than 5%. Moreover, this method can be extended to other detection fields, such as diseases.

  20. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  1. The rapid interphase chromosome assay (RICA implementation: comparison with other PCC methods

    Directory of Open Access Journals (Sweden)

    Sommer Sylwester

    2015-12-01

    Full Text Available A report is presented on the advantages of the rapid interphase chromosome assay (RICA and the difficulties that may be met while implementing this method for application in biological dosimetry. The RICA test can be applied on unstimulated human lymphocytes; this is an advantage in comparison with the dicentric chromosomes or micronucleus tests. In the former two tests, stimulated lymphocytes are examined and hence, 48 h more are needed to obtain cells traversing the cell cycle. Due to the use of unstimulated nondividing cells, higher numbers of cells are available for RICA analysis than for dicentric chromosomes or micronuclei tests. Moreover, the method can be applied after exposure to ionizing radiation doses in excess of 5 Gy. Such doses cause a significant cell cycle delay or result in the loss of G2 phase and mitotic cells because of apoptosis. Therefore, the traditional biodosimetry based on the evaluation of the incidence of damage to chromosomes is very difficult to carry out. This is due to the lack of an adequate number of mitotic cells for analysis. RICA is free of this disadvantage. An automatic microscope can be used to retrieve cell images; automatic image analysis can also be used.

  2. Development of a Rapid and Simple Method to Remove Polyphenols from Plant Extracts

    Directory of Open Access Journals (Sweden)

    Imali Ranatunge

    2017-01-01

    Full Text Available Polyphenols are secondary metabolites of plants, which are responsible for prevention of many diseases. Polyvinylpolypyrrolidone (PVPP has a high affinity towards polyphenols. This method involves the use of PVPP column to remove polyphenols under centrifugal force. Standards of gallic acid, epigallocatechin gallate, vanillin, and tea extracts (Camellia sinensis were used in this study. PVPP powder was packed in a syringe with different quantities. The test samples were layered over the PVPP column and subjected to centrifugation. Supernatant was tested for the total phenol content. The presence of phenolic compounds and caffeine was screened by HPLC and measuring the absorbance at 280. The antioxidant capacity of standards and tea extracts was compared with the polyphenol removed fractions using DPPH scavenging assay. No polyphenols were found in polyphenolic standards or tea extracts after PVPP treatment. The method described in the present study to remove polyphenols is simple, inexpensive, rapid, and efficient and can be employed to investigate the contribution of polyphenols present in natural products to their biological activity.

  3. A Rapid and Low-Cost Nonlithographic Method to Fabricate Biomedical Microdevices for Blood Flow Analysis

    Directory of Open Access Journals (Sweden)

    Elmano Pinto

    2014-12-01

    Full Text Available Microfluidic devices are electrical/mechanical systems that offer the ability to work with minimal sample volumes, short reactions times, and have the possibility to perform massive parallel operations. An important application of microfluidics is blood rheology in microdevices, which has played a key role in recent developments of lab-on-chip devices for blood sampling and analysis. The most popular and traditional method to fabricate these types of devices is the polydimethylsiloxane (PDMS soft lithography technique, which requires molds, usually produced by photolithography. Although the research results are extremely encouraging, the high costs and time involved in the production of molds by photolithography is currently slowing down the development cycle of these types of devices. Here we present a simple, rapid, and low-cost nonlithographic technique to create microfluidic systems for biomedical applications. The results demonstrate the ability of the proposed method to perform cell free layer (CFL measurements and the formation of microbubbles in continuous blood flow.

  4. A rapid and sensitive spectrophotometric method for the determination of benzoyl peroxide in wheat flour samples

    Directory of Open Access Journals (Sweden)

    Kraingkrai Ponhong

    2015-12-01

    Full Text Available A simple, rapid, and sensitive spectrophotometric method for the determination of benzoyl peroxide (BPO in wheat flour samples was developed. The detection principle is based on BPO reacted with 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS to obtain a blue-green colored product that was detected at 415 nm by spectrophotometry. The effect of factors influencing the color reaction was investigated. Under the selected conditions, the linear range for quantification of BPO was observed between 0.2–1.0 mg L−1 with r2 = 0.998. The limit of detection (LOD was 0.025 mg L−1. The developed method obtained superior precision (relative standard deviation < 2% using 11 repeatability at 0.2 mg L−1, 0.6 mg L−1, and 0.8 mg L−1. The proposed methodology was successfully applied to determine BPO in wheat flour samples.

  5. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  6. Regional distribution of methionine adenosyltransferase in rat brain as measured by a rapid radiochemical method

    Energy Technology Data Exchange (ETDEWEB)

    Hiemke, C.; Ghraf, R.

    1981-09-01

    The distribution of methionine adenosyltransferase (MAT) in the CNS of the rat was studied by use of a rapid, sensitive and specific radiochemical method. The S-adenosyl-(methyl-/sup 14/C)L-methionine ((/sup 14/C)SAM) generated by adenosyl transfer from ATP to (methyl-/sup 14/C)L-methionine is quantitated by use of a SAM-consuming transmethylation reaction. Catechol O-methyltransferase (COMT), prepared from rat liver, transfers the methyl-/sup 14/C group of SAM to 3,4-dihydroxybenzoic acid. The /sup 14/C-labelled methylation products, vanillic acid and isovanillic acid, are separated from unreacted methionine by solvent extraction and quantitated by liquid scintillation counting. Compared to other methods of MAT determination, which include separation of generated SAM from methionine by ion-exchange chromatography, the assay described exhibited the same high degree of specificity and sensitivity but proved to be less time consuming. MAT activity was found to be uniformly distributed between various brain regions and the pituitary gland of adult male rats. In the pineal gland the enzyme activity is about tenfold higher.

  7. The direct midpoint method as a quantum mechanical integrator

    CERN Document Server

    Mutze, U

    2006-01-01

    A computational implementation of quantum dynamics for an arbitrary time-independent Hamilton operator is defined and analyzed. The proposed evolution algorithm for a time step needs three additions of state vectors, three multiplications of state vectors with real numbers, and one application of the square of the Hamilton operator to a state vector. A trajectory starting from a unit-vector remains totally within the unit-sphere in Hilbert space if the time step is smaller than 2 divided by the norm of the Hamilton operator.If the time step is larger than this bound, the trajectory grows exponentially over all limits. The method is exemplified with a computational quantum system which models collision and inelastic scattering of two particles. Each of these particles lives in a discrete finite space which is a subset of a line. The two lines thus associated with the particles cross each other at right angle.

  8. Rapid diagnosis of diarrhea caused by Shigella sonnei using dipsticks; comparison of rectal swabs, direct stool and stool culture.

    Directory of Open Access Journals (Sweden)

    Claudia Duran

    Full Text Available BACKGROUND: We evaluated a dipstick test for rapid detection of Shigella sonnei on bacterial colonies, directly on stools and from rectal swabs because in actual field situations, most pathologic specimens for diagnosis correspond to stool samples or rectal swabs. METHODOLOGY/PRINCIPAL FINDINGS: The test is based on the detection of S. sonnei lipopolysaccharide (LPS O-side chains using phase I-specific monoclonal antibodies coupled to gold particles, and displayed on a one-step immunochromatographic dipstick. A concentration as low as 5 ng/ml of LPS was detected in distilled water and in reconstituted stools in 6 minutes. This is the optimal time for lecture to avoid errors of interpretation. In distilled water and in reconstituted stools, an unequivocal positive reaction was obtained with 4 x 10(6 CFU/ml of S. sonnei. The specificity was 100% when tested with a battery of Shigella and different unrelated strains. When tested on 342 rectal swabs in Chile, specificity (281/295 was 95.3% (95% CI: 92.9% - 97.7% and sensitivity (47/47 was 100%. Stool cultures and the immunochromatographic test showed concordant results in 95.5 % of cases (328/342 in comparative studies. Positive and negative predictive values were 77% (95% CI: 65% - 86.5% and 100% respectively. When tested on 219 stools in Chile, Vietnam, India and France, specificity (190/198 was 96% (95% CI 92%-98% and sensitivity (21/21 was 100%. Stool cultures and the immunochromatographic test showed concordant results in 96.3 % of cases (211/219 in comparative studies. Positive and negative predictive values were 72.4% (95% CI 56.1%-88.6% and 100 %, respectively. CONCLUSION: This one-step dipstick test performed well for diagnosis of S. sonnei both on stools and on rectal swabs. These data confirm a preliminary study done in Chile.

  9. A Rapid and Quantitative Flow Cytometry Method for the Analysis of Membrane Disruptive Antimicrobial Activity.

    Directory of Open Access Journals (Sweden)

    Neil M O'Brien-Simpson

    Full Text Available We describe a microbial flow cytometry method that quantifies within 3 hours antimicrobial peptide (AMP activity, termed Minimum Membrane Disruptive Concentration (MDC. Increasing peptide concentration positively correlates with the extent of bacterial membrane disruption and the calculated MDC is equivalent to its MBC. The activity of AMPs representing three different membranolytic modes of action could be determined for a range of Gram positive and negative bacteria, including the ESKAPE pathogens, E. coli and MRSA. By using the MDC50 concentration of the parent AMP, the method provides high-throughput, quantitative screening of AMP analogues. A unique feature of the MDC assay is that it directly measures peptide/bacteria interactions and lysed cell numbers rather than bacteria survival as with MIC and MBC assays. With the threat of multi-drug resistant bacteria, this high-throughput MDC assay has the potential to aid in the development of novel antimicrobials that target bacteria with improved efficacy.

  10. Characteristics and comparative performance of direct culture, direct PCR and enumeration methods for detection and quantification of Campylobacter spp. in broiler caeca.

    Science.gov (United States)

    Rodgers, J D; Lawes, J R; Vidal, A B; Ellis-Iversen, J; Ridley, A; Pleydell, E J; Powell, L F; Toszeghy, M; Stapleton, K; Clifton-Hadley, F A

    2012-10-12

    Detection and enumeration of Campylobacter spp. in broiler chicken flocks are key components of research and surveillance studies aimed at reducing Campylobacter infections in people. Direct culture of caecal contents onto selective agar is the typical method used to confirm flock colonisation. Modified charcoal cefoperazone deoxycholate agar (mCCDA) is commonly used for this method, although alternative selective media have been used. Additionally, PCR methods to detect Campylobacter DNA from caecal contents may provide a rapid alternative. However comparative performance data for these methods is limited and therefore required to ensure optimal detection methods for this sample type. In this study, 306 broiler caeca were tested for Campylobacter using direct culture on mCCDA, Skirrows and Preston agars and two real-time PCR methods, one specific for mapA/ceuE regions and another for the flaA gene region. Additionally, the suitability of spread plating and spiral plating methods for enumeration of Campylobacter and the impact of sample storage were assessed. This study confirmed modified CCDA as an optimal media for detection of Campylobacter in broiler caeca. It was significantly more sensitive than Skirrows or Preston agars. This study also demonstrated that the mapA/ceuE PCR had excellent agreement with culture on mCCDA and is a genuine alternative method. Spread plating and spiral plating methods were suitable for enumeration although spiral plating appeared more sensitive for stored samples (72 h). A 1 log reduction in viable Campylobacters was observed in stored samples, therefore storage effects should be considered for quantitative studies with broiler caeca. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  11. Directions in implementation research methods for behavioral and social science.

    Science.gov (United States)

    Irwin, Molly; Supplee, Lauren H

    2012-10-01

    There is a growing interest, by researchers, policymakers, and practitioners, in evidence-based policy and practice. As a result, more dollars are being invested in program evaluation in order to establish "what works," and in some cases, funding is specifically tied to those programs found to be effective. However, reproducing positive effects found in research requires more than simply adopting an evidence-based program. Implementation research can provide guidance on which components of an intervention matter most for program impacts and how implementation components can best be implemented. However, while the body of rigorous research on effective practices continues to grow, research on implementation lags behind. To address these issues, the Administration for Children and Families and federal partners convened a roundtable meeting entitled, Improving Implementation Research Methods for Behavioral and Social Science, in the fall of 2010. This special section of the Journal of Behavioral Health Services & Research includes papers from the roundtable and highlights the role implementation science can play in shedding light on the difficult task of taking evidence-based practices to scale.

  12. Rapid methods to assess sanitizing efficacy of benzalkonium chloride to Listeria monocytogenes biofilms.

    Science.gov (United States)

    Romanova, Nadya A; Gawande, Purushottam V; Brovko, Lubov Y; Griffiths, Mansel W

    2007-12-01

    Different methods were used to investigate biofilm growth including crystal violet staining, ATP bioluminescence and total viable count. Seven strains of Listeria monocytogenes and 8 of their derivative strains were screened for their capacity to form biofilms. Both adaptation to benzalkonium chloride (BC) and curing of plasmids did not significantly affect biofilm-forming ability. The strains of L. monocytogenes belonging to serotype 1 formed biofilms significantly better as compared to serotype 4 (P=0.0003). To estimate the efficacy of BC for biofilm elimination the best and the poorest biofilm-formers were used (C719 and LJH 381). It was observed that, L. monocytogenes strain C719 in biofilms is at least 1000 times more resistant to BC than in planktonic form. Cells present in biofilms were shown to recover and grow after BC treatment thus providing a source of recontamination. It was shown that ATP bioluminescence provides good correlation with bacterial counts of L. monocytogenes in biofilms. Staining with crystal violet, on the contrary, did not correlate with bacterial growth in biofilms in the presence of high concentrations of BC but provided information on the concentration of bacterial cells, both live and dead, attached to the surface. ATP bioluminescence was found to be a reliable method for rapid estimation of the efficacy of sanitizers for biofilm disinfection. Crystal violet staining, on the other hand, was shown to be a suitable method to monitor removal of biofilms. Our investigation showed that for Listeria biofilms concentrations of BC higher then 10 mg/ml should be applied for at least 30 min to kill almost all the live cells in biofilms. However, this concentration was still not enough to remove biofilms from the surface of plastic.

  13. Development of a rapid, one-step screening method for the isolation of presumptive proteolytic enterococci.

    Science.gov (United States)

    Graham, Ken; Rea, Rosemary; Simpson, Paul; Stack, Helena

    2017-01-01

    Enterococci show higher proteolytic activities than other lactic acid bacteria and thus have received considerable attention in scientific literature in recent years. Proteolytic enzymes of enterococci have warranted the use of some species as starter, adjuncts or protective cultures and as probiotics, while in some strains they have also been linked with virulence. Consequently, the isolation and identification of proteolytic enterococci is becoming of increasing interest and importance. However, current screening methods for proteolytic enterococci can be time consuming, requiring a two-step procedure which may take up to 96h. This study describes a method, utilising Kanamycin Skim Milk Aesculin Azide (KSMEA) agar, for the isolation of proteolytic enterococci in one-step, thereby significantly reducing screening time. KSMEA combines the selective properties of Kanamycin Aesculin Azide Agar (KAA) with skim milk powder for the detection of proteolytic enterococci. Enterococci produced colonies with a black halo on KSMEA which were accompanied by a zone of clearing in the media when enterococci were proteolytic. KSMEA medium retained the selectivity of KAA, while proteolytic enterococci were easily distinguished from non-proteolytic enterococci when two known strains were propagated on KSMEA. KSMEA also proved effective at isolating and detecting enterococci in raw milk, faeces and soil. Isolates recovered from the screen were confirmed as enterococci using genus-specific primers. Proteolytic enterococci were present in the raw milk sample only and were easily distinguishable from non-proteolytic enterococci and other microorganisms. Therefore, KSMEA provides a rapid, one-step screening method for the isolation of presumptive proteolytic enterococci. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Directory of Open Access Journals (Sweden)

    Vijay K Chaudhary

    Full Text Available Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  15. Rapid method for the determination of metamizole residues in bovine muscle by LC-MS/MS.

    Science.gov (United States)

    Jedziniak, Piotr; Pietruk, Konrad; Śledzińska, Edyta; Olejnik, Małgorzata; Szprengier-Juszkiewicz, Teresa; Żmudzki, Jan

    2013-01-01

    Metamizole is a pyrazolone non-steroidal anti-inflammatory drug allowed for use in food-producing animals. According to Council Directive 96/23, residues of this drug have to be monitored because of the potential risk to consumers' health. Metamizole is hydrolysed to its marker residue 4-methylaminoantypyrine.This compound is further metabolised to three main metabolites: 4-formylaminoantipyrine, 4-aminoantipyrine and 4-acetylaminoantipyrine. The MRL of 4-methylaminoantipyrine in animal tissues is 100 µg kg(-1). Considering the above points, a method for the detection of four metamizole metabolites in bovine muscles was developed. Analytes were extracted from muscle by a mixture of acetonitrile and sodium acetate buffer. After centrifugation, the supernatant was passed through alumina cartridges, diluted with mobile phase and analysed by using LC-MS/MS. Four metamizole metabolites were separated on a C8 column in 23 min with a gradient of methanol:acetonitrile:ammonium formate solution and analysed by using positive ionisation. Validation of the method indicated a within-laboratory reproducibility in the range of 7-30% and recovery in the range of 45-95%. The method fulfils the criteria for confirmatory methods and, thanks to its labour efficiency, may also be used for screening purposes.

  16. Rapid Analysis of Ingredients in Cream Using Ultrasonic Mist-Direct Analysis in Real-Time Time-of-Flight Mass Spectrometry

    Science.gov (United States)

    Shimada, Haruo; Maeno, Katsuyuki; Kinoshita, Kazumasa; Shida, Yasuo

    2017-07-01

    A novel method for the simultaneous detection of ingredients in pharmaceutical applications such as creams and lotions was developed. An ultrasonic atomizer has been used to produce a mist containing ingredients. The analyte molecules in the mist can be ionized by using direct analysis in real time (DART) at lower temperature than traditionally used, and we thus solved the problem of normal DART-MS measurement using a high-temperature gas. Thereby, molecular-related ions of heat-unstable components and nonvolatile components became detectable. The deprotonated molecular ion of glycyrrhizic acid (m/z 821), which is unstable at high temperatures, was detected without pyrolysis by ultrasonic mist-DART-MS using unheated helium gas, although it was not detected by normal DART-MS using heated helium gas. The cationized molecular ions of derivatives of polyethylene glycol fatty acid monoesters, which are nonvolatile compounds, were also detected as m/z peaks observed from 800 to 2300. Although the protonated molecular ion of tocopherol acetate was not detected in ionization by ultrasonic mist, it was detected by ultrasonic mist-DART-MS even in the emulsion. It was not necessary to dissolve a sample completely to detect its ions. This method enabled us to obtain the composition of pharmaceutical applications simply and rapidly.

  17. Development of a rapid method for the quantitative determination of deoxynivalenol using Quenchbody

    Energy Technology Data Exchange (ETDEWEB)

    Yoshinari, Tomoya [Division of Microbiology, National Institute of Health Sciences, 1-18-1, Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ohashi, Hiroyuki; Abe, Ryoji; Kaigome, Rena [Biomedical Division, Ushio Inc., 1-12 Minamiwatarida-cho, Kawasaki-ku, Kawasaki 210-0855 (Japan); Ohkawa, Hideo [Research Center for Environmental Genomics, Kobe University, 1-1 Rokkodai, Nada, Kobe 657-8501 (Japan); Sugita-Konishi, Yoshiko, E-mail: y-konishi@azabu-u.ac.jp [Department of Food and Life Science, Azabu University, 1-17-71 Fuchinobe, Chuo-ku, Sagamihara, Kanagawa 252-5201 (Japan)

    2015-08-12

    Quenchbody (Q-body) is a novel fluorescent biosensor based on the antigen-dependent removal of a quenching effect on a fluorophore attached to antibody domains. In order to develop a method using Q-body for the quantitative determination of deoxynivalenol (DON), a trichothecene mycotoxin produced by some Fusarium species, anti-DON Q-body was synthesized from the sequence information of a monoclonal antibody specific to DON. When the purified anti-DON Q-body was mixed with DON, a dose-dependent increase in the fluorescence intensity was observed and the detection range was between 0.0003 and 3 mg L{sup −1}. The coefficients of variation were 7.9% at 0.003 mg L{sup −1}, 5.0% at 0.03 mg L{sup −1} and 13.7% at 0.3 mg L{sup −1}, respectively. The limit of detection was 0.006 mg L{sup −1} for DON in wheat. The Q-body showed an antigen-dependent fluorescence enhancement even in the presence of wheat extracts. To validate the analytical method using Q-body, a spike-and-recovery experiment was performed using four spiked wheat samples. The recoveries were in the range of 94.9–100.2%. The concentrations of DON in twenty-one naturally contaminated wheat samples were quantitated by the Q-body method, LC-MS/MS and an immunochromatographic assay kit. The LC-MS/MS analysis showed that the levels of DON contamination in the samples were between 0.001 and 2.68 mg kg{sup −1}. The concentrations of DON quantitated by LC-MS/MS were more strongly correlated with those using the Q-body method (R{sup 2} = 0.9760) than the immunochromatographic assay kit (R{sup 2} = 0.8824). These data indicate that the Q-body system for the determination of DON in wheat samples was successfully developed and Q-body is expected to have a range of applications in the field of food safety. - Highlights: • A rapid method for quantitation of DON using Q-body has been developed. • A recovery test using the anti-DON Q-body was performed. • The concentrations of DON in wheat

  18. A rapid method for detection of five known mutations associated with aminoglycoside-induced deafness

    Directory of Open Access Journals (Sweden)

    Greinwald John H

    2009-01-01

    Full Text Available Abstract Background South Africa has one of the highest incidences of multidrug-resistant tuberculosis (MDR-TB in the world. Concomitantly, aminoglycosides are commonly used in this country as a treatment against MDR-TB. To date, at least five mutations are known to confer susceptibility to aminoglycoside-induced hearing loss. The aim of the present study was to develop a rapid screening method to determine whether these mutations are present in the South African population. Methods A multiplex method using the SNaPshot technique was used to screen for five mutations in the MT-RNR1 gene: A1555G, C1494T, T1095C, 961delT+C(n and A827G. A total of 204 South African control samples, comprising 98 Mixed ancestry and 106 Black individuals were screened for the presence of the five mutations. Results A robust, cost-effective method was developed that detected the presence of all five sequence variants simultaneously. In this pilot study, the A1555G mutation was identified at a frequency of 0.9% in the Black control samples. The 961delT+C(n variant was present in 6.6% of the Black controls and 2% of the Mixed ancestry controls. The T1095C, C1494T and A827G variants were not identified in any of the study participants. Conclusion The frequency of 0.9% for the A1555G mutation in the Black population in South Africa is of concern given the high incidence of MDR-TB in this particular ethnic group. Future larger studies are warranted to determine the true frequencies of the aminoglycoside deafness mutations in the general South African population. The high frequencies of the 961delT+C(n variant observed in the controls suggest that this change is a common non-pathogenic polymorphism. This genetic method facilitates the identification of individuals at high risk of developing hearing loss prior to the start of aminoglycoside therapy. This is important in a low-resource country like South Africa where, despite their adverse side-effects, aminoglycosides will

  19. Rapid Diagnosis of Staphylococcal Catheter-Related Bacteraemia in Direct Blood Samples by Real-Time PCR.

    Science.gov (United States)

    Zboromyrska, Yuliya; De la Calle, Cristina; Soto, Marcelo; Sampietro-Colom, Laura; Soriano, Alex; Alvarez-Martínez, Míriam José; Almela, Manel; Marco, Francesc; Arjona, Ruth; Cobos-Trigueros, Nazaret; Morata, Laura; Mensa, José; Martínez, José Antonio; Mira, Aurea; Vila, Jordi

    2016-01-01

    Catheter-related bacteremia (CRB) is an important cause of morbidity and mortality among hospitalized patients, being staphylococci the main etiologic agents. The objective of this study was to assess the use of a PCR-based assay for detection of staphylococci directly from blood obtained through the catheter to diagnose CRB caused by these microorganisms and to perform a cost-effectiveness analysis. A total of 92 patients with suspected CRB were included in the study. Samples were obtained through the catheter. Paired blood cultures were processed by standard culture methods and 4 ml blood samples were processed by GeneXpert-MRSA assay for the detection of methicillin-susceptible (MSSA) or methicillin-resistant (MRSA) Staphylococcus aureus, and methicillin-resistant coagulase-negative staphylococci (MR-CoNS). Sixteen CRB caused by staphylococci were diagnosed among 92 suspected patients. GeneXpert detected 14 out of 16 cases (87.5%), including 4 MSSA and 10 MR-CoNS in approximately 1 hour after specimen receipt. The sensitivity and specificity of GeneXpert were 87.5% (CI 95%: 60.4-97.8) and 92.1% (CI 95%: 83-96.7), respectively, compared with standard culture methods. The sensitivity of GeneXpert for S. aureus was 100%. Regarding a cost-effectiveness analysis, the incremental cost of using GeneXpert was of 31.1€ per patient while the incremental cost-effectiveness ratio of GeneXpert compared with blood culture alones was about 180€ per life year gained. In conclusion, GeneXpert can be used directly with blood samples obtained through infected catheters to detect S. aureus and MR-CoNS in approximately 1h after sampling. In addition, it is cost-e