WorldWideScience

Sample records for rapid direct methods

  1. A direct and rapid method to determine cyanide in urine by capillary electrophoresis.

    Science.gov (United States)

    Zhang, Qiyang; Maddukuri, Naveen; Gong, Maojun

    2015-10-02

    Cyanides are poisonous chemicals that widely exist in nature and industrial processes as well as accidental fires. Rapid and accurate determination of cyanide exposure would facilitate forensic investigation, medical diagnosis, and chronic cyanide monitoring. Here, a rapid and direct method was developed for the determination of cyanide ions in urinary samples. This technique was based on an integrated capillary electrophoresis system coupled with laser-induced fluorescence (LIF) detection. Cyanide ions were derivatized with naphthalene-2,3-dicarboxaldehyde (NDA) and a primary amine (glycine) for LIF detection. Three separate reagents, NDA, glycine, and cyanide sample, were mixed online, which secured uniform conditions between samples for cyanide derivatization and reduced the risk of precipitation formation of mixtures. Conditions were optimized; the derivatization was completed in 2-4min, and the separation was observed in 25s. The limit of detection (LOD) was 4.0nM at 3-fold signal-to-noise ratio for standard cyanide in buffer. The cyanide levels in urine samples from smokers and non-smokers were determined by using the method of standard addition, which demonstrated significant difference of cyanide levels in urinary samples from the two groups of people. The developed method was rapid and accurate, and is anticipated to be applicable to cyanide detection in waste water with appropriate modification. Published by Elsevier B.V.

  2. Rapid analysis of fertilizers by the direct-reading thermometric method.

    Science.gov (United States)

    Sajó, I; Sipos, B

    1972-05-01

    The authors have developed rapid methods for the determination of the main components of fertilizers, namely phosphate, potassium and nitrogen fixed in various forms. In the absence of magnesium ions phosphate is precipitated with magnesia mixture; in the presence of magnesium ions ammonium phosphomolybdate is precipitated and the excess of molybdate is reacted with hydrogen peroxide. Potassium is determined by precipitation with silico-fluoride. For nitrogen fixed as ammonium salts the ammonium ions are condensed in a basic solution with formalin to hexamethylenetetramine; for nitrogen fixed as carbamide the latter is decomposed with sodium nitrite; for nitrogen fixed as nitrate the latter is reduced with titanium(III). In each case the temperature change of the test solution is measured. Practically all essential components of fertilizers may be determined by direct-reading thermometry; with this method and special apparatus the time of analysis is reduced to at most about 15 min for any determination.

  3. A new rapid method for direct antimicrobial susceptibility testing of bacteria from positive blood cultures.

    Science.gov (United States)

    Barnini, Simona; Brucculeri, Veronica; Morici, Paola; Ghelardi, Emilia; Florio, Walter; Lupetti, Antonella

    2016-08-12

    Rapid identification and antimicrobial susceptibility testing (AST) of the causative agent(s) of bloodstream infections can lead to prompt appropriate antimicrobial therapy. To shorten species identification, in this study bacteria were recovered from monomicrobial blood cultures by serum separator tubes and spotted onto the target plate for direct MALDI-TOF MS identification. Proper antibiotics were selected for direct AST based on species identification. In order to obtain rapid AST results, bacteria were recovered from positive blood cultures by two different protocols: by serum separator tubes (further referred to as PR1), or after a short-term subculture in liquid medium (further referred to as PR2). The results were compared with those obtained by the method currently used in our laboratory consisting in identification by MALDI-TOF and AST by Vitek 2 or Sensititre on isolated colonies. The direct MALDI-TOF method concordantly identified with the current method 97.5 % of the Gram-negative bacteria and 96.1 % of the Gram-positive cocci contained in monomicrobial blood cultures. The direct AST by PR1 and PR2 for all isolate/antimicrobial agent combinations was concordant/correct with the current method for 87.8 and 90.5 % of Gram-negative bacteria and for 93.1 and 93.8 % of Gram-positive cocci, respectively. In particular, 100 % categorical agreement was found with levofloxacin for Enterobacteriaceae by both PR1 and PR2, and 99.0 and 100 % categorical agreement was observed with linezolid for Gram-positive cocci by PR1 and PR2, respectively. There was no significant difference in accuracy between PR1 and PR2 for Gram-negative bacteria and Gram-positive cocci. This newly described method seems promising for providing accurate AST results. Most importantly, these results would be available in a few hours from blood culture positivity, which would help clinicians to promptly confirm or streamline an effective antibiotic therapy in patients with bloodstream

  4. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

  5. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  6. A rapid reliability estimation method for directed acyclic lifeline networks with statistically dependent components

    International Nuclear Information System (INIS)

    Kang, Won-Hee; Kliese, Alyce

    2014-01-01

    Lifeline networks, such as transportation, water supply, sewers, telecommunications, and electrical and gas networks, are essential elements for the economic and societal functions of urban areas, but their components are highly susceptible to natural or man-made hazards. In this context, it is essential to provide effective pre-disaster hazard mitigation strategies and prompt post-disaster risk management efforts based on rapid system reliability assessment. This paper proposes a rapid reliability estimation method for node-pair connectivity analysis of lifeline networks especially when the network components are statistically correlated. Recursive procedures are proposed to compound all network nodes until they become a single super node representing the connectivity between the origin and destination nodes. The proposed method is applied to numerical network examples and benchmark interconnected power and water networks in Memphis, Shelby County. The connectivity analysis results show the proposed method's reasonable accuracy and remarkable efficiency as compared to the Monte Carlo simulations

  7. Extraction and identification of cyclobutanones from irradiated cheese employing a rapid direct solvent extraction method.

    Science.gov (United States)

    Tewfik, Ihab

    2008-01-01

    2-Alkylcyclobutanones (cyclobutanones) are accepted as chemical markers for irradiated foods containing lipid. However, current extraction procedures (Soxhlet-florisil chromatography) for the isolation of these markers involve a long and tedious clean-up regime prior to gas chromatography-mass spectrophotometry identification. This paper outlines an alternative isolation and clean-up method for the extraction of cyclobutanones in irradiated Camembert cheese. The newly developed direct solvent extraction method enables the efficient screening of large numbers of food samples and is not as resource intensive as the BS EN 1785:1997 method. Direct solvent extraction appears to be a simple, robust method and has the added advantage of a considerably shorter extraction time for the analysis of foods containing lipid.

  8. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  9. Comparison of four methods for rapid identification of Staphylococcus aureus directly from BACTEC 9240 blood culture system

    Directory of Open Access Journals (Sweden)

    N S Ozen

    2011-01-01

    Full Text Available Purpose: Differentiation of Staphylococcus aureus (S. aureus from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT, slide agglutination test (Dry Spot Staphytect Plus, conventional polymerase chain reaction (PCR and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. Materials and Methods: A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. Results: The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Conclusion: Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.

  10. Comparison of four methods for rapid identification of Staphylococcus aureus directly from BACTEC 9240 blood culture system.

    Science.gov (United States)

    Ozen, N S; Ogunc, D; Mutlu, D; Ongut, G; Baysan, B O; Gunseren, F

    2011-01-01

    Differentiation of Staphylococcus aureus (S. aureus) from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS) from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT), slide agglutination test (Dry Spot Staphytect Plus), conventional polymerase chain reaction (PCR) and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs) with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.

  11. Rapid prototyping: een veelbelovende methode

    NARCIS (Netherlands)

    Haverman, T.M.; Karagozoglu, K.H.; Prins, H.; Schulten, E.A.J.M.; Forouzanfar, T.

    2013-01-01

    Rapid prototyping is a method which makes it possible to produce a three-dimensional model based on two-dimensional imaging. Various rapid prototyping methods are available for modelling, such as stereolithography, selective laser sintering, direct laser metal sintering, two-photon polymerization,

  12. Rapid flow imaging method

    International Nuclear Information System (INIS)

    Pelc, N.J.; Spritzer, C.E.; Lee, J.N.

    1988-01-01

    A rapid, phase-contrast, MR imaging method of imaging flow has been implemented. The method, called VIGRE (velocity imaging with gradient recalled echoes), consists of two interleaved, narrow flip angle, gradient-recalled acquisitions. One is flow compensated while the second has a specified flow encoding (both peak velocity and direction) that causes signals to contain additional phase in proportion to velocity in the specified direction. Complex image data from the first acquisition are used as a phase reference for the second, yielding immunity from phase accumulation due to causes other than motion. Images with pixel values equal to MΔΘ where M is the magnitude of the flow compensated image and ΔΘ is the phase difference at the pixel, are produced. The magnitude weighting provides additional vessel contrast, suppresses background noise, maintains the flow direction information, and still allows quantitative data to be retrieved. The method has been validated with phantoms and is undergoing initial clinical evaluation. Early results are extremely encouraging

  13. Direct chromatographic methods for the rapid determination of homogentisic acid in strawberry tree (Arbutus unedo L.) honey.

    Science.gov (United States)

    Scanu, Roberta; Spano, Nadia; Panzanelli, Angelo; Pilo, Maria I; Piu, Paola C; Sanna, Gavino; Tapparo, Andrea

    2005-10-07

    Two rapid and direct chromatographic methods based on reverse phase-high performance liquid chromatography (RP-HPLC) and ion chromatography (IC) were developed for the determination of homogentisic acid (HA) in honey. This is the marker of the botanic origin of strawberry tree honey. The methods were validated and tested using 22 samples from Sardinia, Italy. The IC method is faster than the RP-HPLC one (6 min versus 13 min of total run), but it is slightly less sensitive (the limit of detection (LOD), is 26 mg kg(-1) versus 15 mg kg(-1)) and reproducible (relative standard deviation, RSD, of 10.4 and 4.4%, respectively). The whole dataset of validation parameters allows both the proposed methods to be considered as bias-free (by recovery tests, comparison of analytical results of the two independent methods and analysis of a synthetic sample) and precise (both the techniques show a repeatability better than 2% repeatability in the range between 70 and 600 mg kg(-1)).

  14. Rapid detection of methicillin-resistant Staphylococcus aureus directly from clinical samples: methods, effectiveness and cost considerations

    Directory of Open Access Journals (Sweden)

    Stürenburg, Enno

    2009-07-01

    Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA isolates is a serious public health problem whose ever-increasing rate is commensurate with the pressure it is exerting on the healthcare system. At present, more than 20% of clinical S. aureus isolates in German hospitals are methicillin resistant. Strategies from low-prevalence countries show that this development is not necessarily inevitable. In the Scandinavian countries and the Netherlands, thanks to a rigorous prevention programme, MRSA prevalence has been kept at an acceptably low level (<1–3%. Central to these ‘search and destroy’ control strategies is an admission screening using several MRSA swabs taken from mucocutaneous colonisation sites of high-risk patients (‘MRSA surveillance’. It has also been reported that the speed with which MRSA carriage is detected has an important role to play, as it is a key component of any effective strategy to prevent the pathogen from spreading. Since MRSA culturing involves a 2–3 day delay before the final results are available, rapid detection techniques (commonly referred to as ‘MRSA rapid tests’ using PCR methods and, most recently, rapid culturing methods have been developed. The implementation of rapid tests reduces the time of detection of MRSA carriers from 48–72 to 2–5 h. Clinical evaluation data have shown that MRSA can thus be detected with very high sensitivity. Specificity however is sometimes impaired due to false-positive PCR signals occurring in mixed flora specimens. In order to rule out any false-positive PCR results, a culture screen must always be carried out simultaneously.The data provide preliminary evidence that a PCR assay can reduce nosocomial MRSA transmission in high-risk patients or high-risk areas, whereas an approach that screens all patients admitted to the hospital is probably not effective. Information concerning the cost-effectiveness of rapid MRSA tests is still sparse and thus the issue remains

  15. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    . The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

  16. Rapid and direct spectrophotometric method for kinetics studies and routine assay of peroxidase based on aniline diazo substrates.

    Science.gov (United States)

    Mirazizi, Fatemeh; Bahrami, Azita; Haghbeen, Kamahldin; Shahbani Zahiri, Hossein; Bakavoli, Mehdi; Legge, Raymond L

    2016-12-01

    Peroxidases are ubiquitous enzymes that play an important role in living organisms. Current spectrophotometrically based peroxidase assay methods are based on the production of chromophoric substances at the end of the enzymatic reaction. The ambiguity regarding the formation and identity of the final chromophoric product and its possible reactions with other molecules have raised concerns about the accuracy of these methods. This can be of serious concern in inhibition studies. A novel spectrophotometric assay for peroxidase, based on direct measurement of a soluble aniline diazo substrate, is introduced. In addition to the routine assays, this method can be used in comprehensive kinetics studies. 4-[(4-Sulfophenyl)azo]aniline (λmax = 390 nm, ɛ = 32 880 M(-1) cm(-1) at pH 4.5 to 9) was introduced for routine assay of peroxidase. This compound is commercially available and is indexed as a food dye. Using this method, a detection limit of 0.05 nmol mL(-1) was achieved for peroxidase.

  17. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold Piotr; Vogensen, Finn Kvist; Sørensen, Søren Johannes

    2014-01-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful...

  18. [Rapid prototyping: a very promising method].

    Science.gov (United States)

    Haverman, T M; Karagozoglu, K H; Prins, H-J; Schulten, E A J M; Forouzanfar, T

    2013-03-01

    Rapid prototyping is a method which makes it possible to produce a three-dimensional model based on two-dimensional imaging. Various rapid prototyping methods are available for modelling, such as stereolithography, selective laser sintering, direct laser metal sintering, two-photon polymerization, laminated object manufacturing, three-dimensional printing, three-dimensional plotting, polyjet inkjet technology,fused deposition modelling, vacuum casting and milling. The various methods currently being used in the biomedical sector differ in production, materials and properties of the three-dimensional model which is produced. Rapid prototyping is mainly usedforpreoperative planning, simulation, education, and research into and development of bioengineering possibilities.

  19. A rapid, simple method for the genetic discrimination of intact Arabidopsis thaliana mutant seeds using metabolic profiling by direct analysis in real-time mass spectrometry

    Directory of Open Access Journals (Sweden)

    Jang Young

    2011-06-01

    Full Text Available Abstract Background Efficient high throughput screening systems of useful mutants are prerequisite for study of plant functional genomics and lots of application fields. Advance in such screening tools, thanks to the development of analytic instruments. Direct analysis in real-time (DART-mass spectrometry (MS by ionization of complex materials at atmospheric pressure is a rapid, simple, high-resolution analytical technique. Here we describe a rapid, simple method for the genetic discrimination of intact Arabidopsis thaliana mutant seeds using metabolic profiling by DART-MS. Results To determine whether this DART-MS combined by multivariate analysis can perform genetic discrimination based on global metabolic profiling, intact Arabidopsis thaliana mutant seeds were subjected to DART-MS without any sample preparation. Partial least squares-discriminant analysis (PLS-DA of DART-MS spectral data from intact seeds classified 14 different lines of seeds into two distinct groups: Columbia (Col-0 and Landsberg erecta (Ler ecotype backgrounds. A hierarchical dendrogram based on partial least squares-discriminant analysis (PLS-DA subdivided the Col-0 ecotype into two groups: mutant lines harboring defects in the phenylpropanoid biosynthetic pathway and mutants without these defects. These results indicated that metabolic profiling with DART-MS could discriminate intact Arabidopsis seeds at least ecotype level and metabolic pathway level within same ecotype. Conclusion The described DART-MS combined by multivariate analysis allows for rapid screening and metabolic characterization of lots of Arabidopsis mutant seeds without complex metabolic preparation steps. Moreover, potential novel metabolic markers can be detected and used to clarify the genetic relationship between Arabidopsis cultivars. Furthermore this technique can be applied to predict the novel gene function of metabolic mutants regardless of morphological phenotypes.

  20. Sorptive thin film microextraction followed by direct solid state spectrofluorimetry: A simple, rapid and sensitive method for determination of carvedilol in human plasma.

    Science.gov (United States)

    Karimi, Shima; Talebpour, Zahra; Adib, Noushin

    2016-06-14

    A poly acrylate-ethylene glycol (PA-EG) thin film is introduced for the first time as a novel polar sorbent for sorptive extraction method coupled directly to solid-state spectrofluorimetry without the necessity of a desorption step. The structure, polarity, fluorescence property and extraction performance of the developed thin film were investigated systematically. Carvedilol was used as the model analyte to evaluate the proposed method. The entire procedure involved one-step extraction of carvedilol from plasma using PA-EG thin film sorptive phase without protein precipitation. Extraction variables were studied in order to establish the best experimental conditions. Optimum extraction conditions were the followings: stirring speed of 1000 rpm, pH of 6.8, extraction temperature of 60 °C, and extraction time of 60 min. Under optimal conditions, extraction of carvedilol was carried out in spiked human plasma; and the linear range of calibration curve was 15-300 ng mL(-1) with regression coefficient of 0.998. Limit of detection (LOD) for the method was 4.5 ng mL(-1). The intra- and inter-day accuracy and precision of the proposed method were evaluated in plasma sample spiked with three concentration levels of carvedilol; yielding a recovery of 91-112% and relative standard deviation of less than 8%, respectively. The established procedure was successfully applied for quantification of carvedilol in plasma sample of a volunteer patient. The developed PA-EG thin film sorptive phase followed by solid-state spectrofluorimetric method provides a simple, rapid and sensitive approach for the analysis of carvedilol in human plasma. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Rapid characterization of chemical markers for discrimination of Moutan Cortex and its processed products by direct injection-based mass spectrometry profiling and metabolomic method.

    Science.gov (United States)

    Li, Chao-Ran; Li, Meng-Ning; Yang, Hua; Li, Ping; Gao, Wen

    2018-06-01

    Processing of herbal medicines is a characteristic pharmaceutical technique in Traditional Chinese Medicine, which can reduce toxicity and side effect, improve the flavor and efficacy, and even change the pharmacological action entirely. It is significant and crucial to perform a method to find chemical markers for differentiating herbal medicines in different processed degrees. The aim of this study was to perform a rapid and reasonable method to discriminate Moutan Cortex and its processed products, and to reveal the characteristics of chemical components depend on chemical markers. Thirty batches of Moutan Cortex and its processed products, including 11 batches of Raw Moutan Cortex (RMC), 9 batches of Moutan Cortex Tostus (MCT) and 10 batches of Moutan Cortex Carbonisatus (MCC), were directly injected in electrospray ionization quadrupole time-of-flight mass spectrometry (ESI-QTOF MS) for rapid analysis in positive and negative mode. Without chromatographic separation, each run was completed within 3 min. The raw MS data were automatically extracted by background deduction and molecular feature (MF) extraction algorithm. In negative mode, a total of 452 MFs were obtained and then pretreated by data filtration and differential analysis. After that, the filtered 85 MFs were treated by principal component analysis (PCA) to reduce the dimensions. Subsequently, a partial least squares discrimination analysis (PLS-DA) model was constructed for differentiation and chemical markers detection of Moutan Cortex in different processed degrees. The positive mode data were treated as same as those in negative mode. RMC, MCT and MCC were successfully classified. Moreover, 14 and 3 chemical markers from negative and positive mode respectively, were screened by the combination of their relative peak areas and the parameter variable importance in the projection (VIP) values in PLS-DA model. The content changes of these chemical markers were employed in order to illustrate

  2. Rapid identification of pathogens directly from blood culture bottles by Bruker matrix-assisted laser desorption laser ionization-time of flight mass spectrometry versus routine methods.

    Science.gov (United States)

    Jamal, Wafaa; Saleem, Rola; Rotimi, Vincent O

    2013-08-01

    The use of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) for identification of microorganisms directly from blood culture is an exciting dimension to the microbiologists. We evaluated the performance of Bruker SepsiTyper kit™ (STK) for direct identification of bacteria from positive blood culture. This was done in parallel with conventional methods. Nonrepetitive positive blood cultures from 160 consecutive patients were prospectively evaluated by both methods. Of 160 positive blood cultures, the STK identified 114 (75.6%) isolates and routine conventional method 150 (93%). Thirty-six isolates were misidentified or not identified by the kit. Of these, 5 had score of >2.000 and 31 had an unreliable low score of <1.7. Four of 8 yeasts were identified correctly. The average turnaround time using the STK was 35 min, including extraction steps and 30:12 to 36:12 h with routine method. The STK holds promise for timely management of bacteremic patients. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Effect of phenolic compounds on the rapid direct enzymatic ...

    African Journals Online (AJOL)

    2009-05-15

    May 15, 2009 ... A range of bioprobes and biosensors have recently been developed for the rapid, direct and in situ .... maximum absorbance of 4 mOD (milli optical density). ..... FIKSDAL L and TRYLAND I (2008) Application of rapid enzyme.

  4. Development of an improved rapid BACpro® protocol and a method for direct identification from blood-culture-positive bottles using matrix-assisted laser desorption ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Yonezawa, Takatoshi; Watari, Tomohisa; Ashizawa, Kazuho; Hanada, Daisuke; Yanagiya, Takako; Watanabe, Naoki; Terada, Takashi; Tomoda, Yutaka; Fujii, Satoshi

    2018-05-01

    Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been incorporated into pathogenic bacterial identification methods and has improved their rapidity. Various methods have been reported to directly identify bacteria with MALDI-TOF MS by pretreating culture medium in blood culture bottles. Rapid BACpro® (Nittobo Medical Co., Ltd.) is a pretreatment kit for effective collection of bacteria with cationic copolymers. However, the Rapid BACpro® pretreatment kit is adapted only for MALDI Biotyper (Bruker Daltonics K.K.), and there has been a desire to expand its use to VITEK MS (VMS; bioMerieux SA). We improved the protocol and made it possible to analyze with VMS. The culture medium bacteria collection method was changed to a method with centrifugation after hemolysis using saponin; the cationic copolymer concentration was changed to 30% of the original concentration; the sequence with which reagents were added was changed; and a change was made to an ethanol/formic acid extraction method. The improved protocol enhanced the identification performance. When VMS was used, the identification rate was 100% with control samples. With clinical samples, the identification agreement rate with the cell smear method was 96.3%. The improved protocol is effective in blood culture rapid identification, being both simpler and having an improved identification performance compared with the original. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Rapid methods for detection of bacteria

    DEFF Research Database (Denmark)

    Corfitzen, Charlotte B.; Andersen, B.Ø.; Miller, M.

    2006-01-01

    Traditional methods for detection of bacteria in drinking water e.g. Heterotrophic Plate Counts (HPC) or Most Probable Number (MNP) take 48-72 hours to give the result. New rapid methods for detection of bacteria are needed to protect the consumers against contaminations. Two rapid methods...

  6. A new rapid method for isolating nucleoli.

    Science.gov (United States)

    Li, Zhou Fang; Lam, Yun Wah

    2015-01-01

    The nucleolus was one of the first subcellular organelles to be isolated from the cell. The advent of modern proteomic techniques has resulted in the identification of thousands of proteins in this organelle, and live cell imaging technology has allowed the study of the dynamics of these proteins. However, the limitations of current nucleolar isolation methods hinder the further exploration of this structure. In particular, these methods require the use of a large number of cells and tedious procedures. In this chapter we describe a new and improved nucleolar isolation method for cultured adherent cells. In this method cells are snap-frozen before direct sonication and centrifugation onto a sucrose cushion. The nucleoli can be obtained within a time as short as 20 min, and the high yield allows the use of less starting material. As a result, this method can capture rapid biochemical changes in nucleoli by freezing the cells at a precise time, hence faithfully reflecting the protein composition of nucleoli at the specified time point. This protocol will be useful for proteomic studies of dynamic events in the nucleolus and for better understanding of the biology of mammalian cells.

  7. Direct oxide reducing method

    International Nuclear Information System (INIS)

    Tokiwai, Moriyasu.

    1995-01-01

    Calcium oxides and magnetic oxides as wastes generated upon direct reduction are subjected to molten salt electrolysis, and reduced metallic calcium and magnesium are separated and recovered. Then calcium and magnesium are used recyclically as the reducing agent upon conducting direct oxide reduction. Even calcium oxides and magnesium oxides, which have high melting points and difficult to be melted usually, can be melted in molten salts of mixed fluorides or chlorides by molten-salt electrolysis. Oxides are decomposed by electrolysis, and oxygen is removed in the form of carbon monoxide, while the reduced metallic calcium and magnesium rise above the molten salts on the side of a cathode, and then separated. Since only carbon monoxide is generated as radioactive wastes upon molten salt electrolysis, the amount of radioactive wastes can be greatly reduced, and the amount of the reducing agent used can also be decreased remarkably. (N.H.)

  8. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  9. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  10. Rapid method for direct identification of bacteria in urine and blood culture samples by matrix-assisted laser desorption ionization time-of-flight mass spectrometry: intact cell vs. extraction method.

    Science.gov (United States)

    Ferreira, L; Sánchez-Juanes, F; Muñoz-Bellido, J L; González-Buitrago, J M

    2011-07-01

    Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) is a fast and reliable technology for the identification of microorganisms with proteomics approaches. Here, we compare an intact cell method and a protein extraction method before application on the MALDI plate for the direct identification of microorganisms in both urine and blood culture samples from clinical microbiology laboratories. The results show that the intact cell method provides excellent results for urine and is a good initial method for blood cultures. The extraction method complements the intact cell method, improving microorganism identification from blood culture. Thus, we consider that MALDI-TOF MS performed directly on urine and blood culture samples, with the protocols that we propose, is a suitable technique for microorganism identification, as compared with the routine methods used in the clinical microbiology laboratory. © 2010 The Authors. Clinical Microbiology and Infection © 2010 European Society of Clinical Microbiology and Infectious Diseases.

  11. A scoping review of rapid review methods.

    Science.gov (United States)

    Tricco, Andrea C; Antony, Jesmin; Zarin, Wasifa; Strifler, Lisa; Ghassemi, Marco; Ivory, John; Perrier, Laure; Hutton, Brian; Moher, David; Straus, Sharon E

    2015-09-16

    Rapid reviews are a form of knowledge synthesis in which components of the systematic review process are simplified or omitted to produce information in a timely manner. Although numerous centers are conducting rapid reviews internationally, few studies have examined the methodological characteristics of rapid reviews. We aimed to examine articles, books, and reports that evaluated, compared, used or described rapid reviews or methods through a scoping review. MEDLINE, EMBASE, the Cochrane Library, internet websites of rapid review producers, and reference lists were searched to identify articles for inclusion. Two reviewers independently screened literature search results and abstracted data from included studies. Descriptive analysis was conducted. We included 100 articles plus one companion report that were published between 1997 and 2013. The studies were categorized as 84 application papers, seven development papers, six impact papers, and four comparison papers (one was included in two categories). The rapid reviews were conducted between 1 and 12 months, predominantly in Europe (58 %) and North America (20 %). The included studies failed to report 6 % to 73 % of the specific systematic review steps examined. Fifty unique rapid review methods were identified; 16 methods occurred more than once. Streamlined methods that were used in the 82 rapid reviews included limiting the literature search to published literature (24 %) or one database (2 %), limiting inclusion criteria by date (68 %) or language (49 %), having one person screen and another verify or screen excluded studies (6 %), having one person abstract data and another verify (23 %), not conducting risk of bias/quality appraisal (7 %) or having only one reviewer conduct the quality appraisal (7 %), and presenting results as a narrative summary (78 %). Four case studies were identified that compared the results of rapid reviews to systematic reviews. Three studies found that the conclusions between

  12. Experimental study on rapid embankment construction methods

    International Nuclear Information System (INIS)

    Hirano, Hideaki; Egawa, Kikuji; Hyodo, Kazuya; Kannoto, Yasuo; Sekimoto, Tsuyoshi; Kobayashi, Kokichi.

    1982-01-01

    In the construction of a thermal or nuclear power plant in a coastal area, shorter embankment construction period has come to be called for recently. This tendency is remarkable where construction period is limited due to meteorological or sea conditions. To meet this requirement, the authors have been conducting basic experimental studies on two methods for the rapid execution of embankment construction, that is, Steel Plate Cellular Bulkhead Embedding Method and Ship Hull Caisson Method. This paper presents an outline of the results of the experimental study on these two methods. (author)

  13. Rapid Radiochemical Methods for Asphalt Paving Material ...

    Science.gov (United States)

    Technical Brief Validated rapid radiochemical methods for alpha and beta emitters in solid matrices that are commonly encountered in urban environments were previously unavailable for public use by responding laboratories. A lack of tested rapid methods would delay the quick determination of contamination levels and the assessment of acceptable site-specific exposure levels. Of special concern are matrices with rough and porous surfaces, which allow the movement of radioactive material deep into the building material making it difficult to detect. This research focuses on methods that address preparation, radiochemical separation, and analysis of asphalt paving materials and asphalt roofing shingles. These matrices, common to outdoor environments, challenge the capability and capacity of very experienced radiochemistry laboratories. Generally, routine sample preparation and dissolution techniques produce liquid samples (representative of the original sample material) that can be processed using available radiochemical methods. The asphalt materials are especially difficult because they do not readily lend themselves to these routine sample preparation and dissolution techniques. The HSRP and ORIA coordinate radiological reference laboratory priorities and activities in conjunction with HSRP’s Partner Process. As part of the collaboration, the HSRP worked with ORIA to publish rapid radioanalytical methods for selected radionuclides in building material matrice

  14. Survey of methods for rapid spin reversal

    International Nuclear Information System (INIS)

    McKibben, J.L.

    1980-01-01

    The need for rapid spin reversal technique in polarization experiments is discussed. The ground-state atomic-beam source equipped with two rf transitions for hydrogen can be reversed rapidly, and is now in use on several accelerators. It is the optimum choice provided the accelerator can accept H + ions. At present all rapid reversal experiments using H - ions are done with Lamb-shift sources; however, this is not a unique choice. Three methods for the reversal of the spin of the atomic beam within the Lamb-shift source are discussed in order of development. Coherent intensity and perhaps focus modulation seem to be the biggest problems in both types of sources. Methods for reducing these modulations in the Lamb-shift source are discussed. The same Lamb-shift apparatus is easily modified to provide information on the atomic physics of quenching of the 2S/sub 1/2/ states versus spin orientation, and this is also discussed. 2 figures

  15. A Rapid Aeroelasticity Optimization Method Based on the Stiffness characteristics

    OpenAIRE

    Yuan, Zhe; Huo, Shihui; Ren, Jianting

    2018-01-01

    A rapid aeroelasticity optimization method based on the stiffness characteristics was proposed in the present study. Large time expense in static aeroelasticity analysis based on traditional time domain aeroelasticity method is solved. Elastic axis location and torsional stiffness are discussed firstly. Both torsional stiffness and the distance between stiffness center and aerodynamic center have a direct impact on divergent velocity. The divergent velocity can be adjusted by changing the cor...

  16. Methods and compositions for rapid thermal cycling

    Energy Technology Data Exchange (ETDEWEB)

    Beer, Neil Reginald; Benett, William J.; Frank, James M.; Deotte, Joshua R.; Spadaccini, Christopher

    2018-04-10

    The rapid thermal cycling of a material is targeted. A microfluidic heat exchanger with an internal porous medium is coupled to tanks containing cold fluid and hot fluid. Fluid flows alternately from the cold tank and the hot tank into the porous medium, cooling and heating samples contained in the microfluidic heat exchanger's sample wells. A valve may be coupled to the tanks and a pump, and switching the position of the valve may switch the source and direction of fluid flowing through the porous medium. A controller may control the switching of valve positions based on the temperature of the samples and determined temperature thresholds. A sample tray for containing samples to be thermally cycled may be used in conjunction with the thermal cycling system. A surface or internal electrical heater may aid in heating the samples, or may replace the necessity for the hot tank.

  17. Computerized method for rapid optimization of immunoassays

    International Nuclear Information System (INIS)

    Rousseau, F.; Forest, J.C.

    1990-01-01

    The authors have developed an one step quantitative method for radioimmunoassay optimization. The method is rapid and necessitates only to perform a series of saturation curves with different titres of the antiserum. After calculating the saturation point at several antiserum titres using the Scatchard plot, the authors have produced a table that predicts the main characteristics of the standard curve (Bo/T, Bo and T) that will prevail for any combination of antiserum titre and percentage of sites saturation. The authors have developed a microcomputer program able to interpolate all the data needed to produce such a table from the results of the saturation curves. This computer program permits also to predict the sensitivity of the assay at any experimental conditions if the antibody does not discriminate between the labeled and the non labeled antigen. The authors have tested the accuracy of this optimization table with two in house RIA systems: 17-β-estradiol, and hLH. The results obtained experimentally, including sensitivity determinations, were concordant with those predicted from the optimization table. This method accerelates and improves greatly the process of optimization of radioimmunoassays [fr

  18. Rapidly patterning micro/nano devices by directly assembling ions and nanomaterials

    OpenAIRE

    Na Liu; Feifei Wang; Lianqing Liu; Haibo Yu; Shaorong Xie; Jun Wang; Yuechao Wang; Gwo-Bin Lee; Wen J. Li

    2016-01-01

    The synthesis and assembly of components are key steps in micro/nano device manufacturing. In this article, we report an optically controlled assembly method that can rapidly pattern micro/nano devices by directly assembling ions and nanomaterials without expensive physical masks and complex etching processes. Utilizing this controllable process, different types of device components (e.g., metallic and semiconductor) can be fabricated and assembled in 10?30?seconds, which is far more rapid an...

  19. Direct methods in protein crystallography.

    Science.gov (United States)

    Karle, J

    1989-11-01

    It is pointed out that the 'direct methods' of phase determination for small-structure crystallography do not have immediate applicability to macromolecular structures. The term 'direct methods in macromolecular crystallography' is suggested to categorize a spectrum of approaches to macromolecular structure determination in which the analyses are characterized by the use of two-phase and higher-order-phase invariants. The evaluation of the invariants is generally obtained by the use of heavy-atom techniques. The results of a number of the more recent algebraic and probabilistic studies involving isomorphous replacement and anomalous dispersion thus become valid subjects for discussion here. These studies are described and suggestions are also presented concerning future applicability. Additional discussion concerns the special techniques of filtering, the use of non-crystallographic symmetry, some features of maximum entropy and attempts to apply phase-determining formulas to the refinement of macromolecular structure. It is noted that, in addition to the continuing remarkable progress in macromolecular crystallography based on the traditional applications of isomorphous replacement and anomalous dispersion, recent valuable advances have been made in the application of non-crystallographic symmetry, in particular, to virus structures and in applications of filtering. Good progress has also been reported in the application of exact linear algebra to multiple-wavelength anomalous-dispersion investigations of structures containing anomalous scatterers of only moderate scattering power.

  20. Rapid direct laser writing of desired plasmonic nanostructures.

    Science.gov (United States)

    Tong, Quang Cong; Luong, Mai Hoang; Remmel, Jacqueline; Do, Minh Thanh; Nguyen, Dam Thuy Trang; Lai, Ngoc Diep

    2017-06-15

    We demonstrate a direct way to realize arbitrary gold nanostructures via a local dewetting method. This technique was based on the optically induced local thermal effect at the focusing region of a direct laser writing (DLW) system employing a green continuous-wave laser. The local high temperature allowed the creation of gold nano-islands only at the focusing area of the optical system. By moving the focusing spot, this DLW method allowed us to "write" desired two-dimensional gold patterns with a feature size down to sub-lambda. A heat model was also proposed to theoretically explain the localized heating process of the absorbing gold layer. The preliminary results were demonstrated for data storage and color printer applications.

  1. Method for rapidly determining a pulp kappa number using spectrophotometry

    Science.gov (United States)

    Chai, Xin-Sheng; Zhu, Jun Yong

    2002-01-01

    A system and method for rapidly determining the pulp kappa number through direct measurement of the potassium permanganate concentration in a pulp-permanganate solution using spectrophotometry. Specifically, the present invention uses strong acidification to carry out the pulp-permanganate oxidation reaction in the pulp-permanganate solution to prevent the precipitation of manganese dioxide (MnO.sub.2). Consequently, spectral interference from the precipitated MnO.sub.2 is eliminated and the oxidation reaction becomes dominant. The spectral intensity of the oxidation reaction is then analyzed to determine the pulp kappa number.

  2. Instabilities in rapid directional solidification under weak flow

    Science.gov (United States)

    Kowal, Katarzyna N.; Davis, Stephen H.; Voorhees, Peter W.

    2017-12-01

    We examine a rapidly solidifying binary alloy under directional solidification with nonequilibrium interfacial thermodynamics viz. the segregation coefficient and the liquidus slope are speed dependent and attachment-kinetic effects are present. Both of these effects alone give rise to (steady) cellular instabilities, mode S , and a pulsatile instability, mode P . We examine how weak imposed boundary-layer flow of magnitude |V | affects these instabilities. For small |V | , mode S becomes a traveling and the flow stabilizes (destabilizes) the interface for small (large) surface energies. For small |V | , mode P has a critical wave number that shifts from zero to nonzero giving spatial structure. The flow promotes this instability and the frequencies of the complex conjugate pairs each increase (decrease) with flow for large (small) wave numbers. These results are obtained by regular perturbation theory in powers of V far from the point where the neutral curves cross, but requires a modified expansion in powers of V1 /3 near the crossing. A uniform composite expansion is then obtained valid for all small |V | .

  3. Rapid selective metal patterning on polydimethylsiloxane (PDMS) fabricated by capillarity-assisted laser direct write

    KAUST Repository

    Lee, Ming-Tsang

    2011-08-12

    In this study we demonstrate a novel approach for the rapid fabricating micro scale metal (silver) patterning directly on a polydimethylsiloxane (PDMS) substrate. Silver nanoparticles were sintered on PDMS to form conductive metal films using laser direct write (LDW) technology. To achieve good metal film quality, a capillarity-assisted laser direct writing (CALDW) of nanoparticle suspensions on a low surface energy material (PDMS) was utilized. Experimental results showed controllable electrical conductivities and good film properties of the sintered silver patterns. This study reveals an advanced method of metal patterning on PDMS, and proposes a new research application of LDW in a nanoparticle colloidal environment. © 2011 IOP Publishing Ltd.

  4. Rapid die manufacturing using direct laser metal deposition

    CSIR Research Space (South Africa)

    Pereira, MFVT

    2009-01-01

    Full Text Available This paper highlights the work undertaken at the CSIR on the issue of rapid die manufacturing through the application and evaluation of a rapid prototyping technique and coating technologies applied to die components of a high pressure casting die...

  5. Rapid Vegetative Propagation Method for Carob

    OpenAIRE

    Hamide GUBBUK; Esma GUNES; Tomas AYALA-SILVA; Sezai ERCISLI

    2011-01-01

    Most of fruit species are propagated by vegetative methods such as budding, grafting, cutting, suckering, layering etc. to avoid heterozygocity. Carob trees (Ceratonia siliqua L.) are of highly economical value and are among the most difficult to propagate fruit species. In the study, air-layering propagation method was investigated first time to compare wild and cultivated (�Sisam�) carob types. In the experiment, one year old carob limbs were air-layered on coco peat medium by wrapping with...

  6. A simple method for rapidly processing HEU from weapons returns

    Energy Technology Data Exchange (ETDEWEB)

    McLean, W. II; Miller, P.E.

    1994-01-01

    A method based on the use of a high temperature fluidized bed for rapidly oxidizing, homogenizing and down-blending Highly Enriched Uranium (HEU) from dismantled nuclear weapons is presented. This technology directly addresses many of the most important issues that inhibit progress in international commerce in HEU; viz., transaction verification, materials accountability, transportation and environmental safety. The equipment used to carry out the oxidation and blending is simple, inexpensive and highly portable. Mobile facilities to be used for point-of-sale blending and analysis of the product material are presented along with a phased implementation plan that addresses the conversion of HEU derived from domestic weapons and related waste streams as well as material from possible foreign sources such as South Africa or the former Soviet Union.

  7. An efficient direct method for image registration of flat objects

    Science.gov (United States)

    Nikolaev, Dmitry; Tihonkih, Dmitrii; Makovetskii, Artyom; Voronin, Sergei

    2017-09-01

    Image alignment of rigid surfaces is a rapidly developing area of research and has many practical applications. Alignment methods can be roughly divided into two types: feature-based methods and direct methods. Known SURF and SIFT algorithms are examples of the feature-based methods. Direct methods refer to those that exploit the pixel intensities without resorting to image features and image-based deformations are general direct method to align images of deformable objects in 3D space. Nevertheless, it is not good for the registration of images of 3D rigid objects since the underlying structure cannot be directly evaluated. In the article, we propose a model that is suitable for image alignment of rigid flat objects under various illumination models. The brightness consistency assumptions used for reconstruction of optimal geometrical transformation. Computer simulation results are provided to illustrate the performance of the proposed algorithm for computing of an accordance between pixels of two images.

  8. A multi-directional rapidly exploring random graph (mRRG) for protein folding

    KAUST Repository

    Nath, Shuvra Kanti; Thomas, Shawna; Ekenna, Chinwe; Amato, Nancy M.

    2012-01-01

    Modeling large-scale protein motions, such as those involved in folding and binding interactions, is crucial to better understanding not only how proteins move and interact with other molecules but also how proteins misfold, thus causing many devastating diseases. Robotic motion planning algorithms, such as Rapidly Exploring Random Trees (RRTs), have been successful in simulating protein folding pathways. Here, we propose a new multi-directional Rapidly Exploring Random Graph (mRRG) specifically tailored for proteins. Unlike traditional RRGs which only expand a parent conformation in a single direction, our strategy expands the parent conformation in multiple directions to generate new samples. Resulting samples are connected to the parent conformation and its nearest neighbors. By leveraging multiple directions, mRRG can model the protein motion landscape with reduced computational time compared to several other robotics-based methods for small to moderate-sized proteins. Our results on several proteins agree with experimental hydrogen out-exchange, pulse-labeling, and F-value analysis. We also show that mRRG covers the conformation space better as compared to the other computation methods. Copyright © 2012 ACM.

  9. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  10. [A new method of fabricating photoelastic model by rapid prototyping].

    Science.gov (United States)

    Fan, Li; Huang, Qing-feng; Zhang, Fu-qiang; Xia, Yin-pei

    2011-10-01

    To explore a novel method of fabricating the photoelastic model using rapid prototyping technique. A mandible model was made by rapid prototyping with computerized three-dimensional reconstruction, then the photoelastic model with teeth was fabricated by traditional impression duplicating and mould casting. The photoelastic model of mandible with teeth, which was fabricated indirectly by rapid prototyping, was very similar to the prototype in geometry and physical parameters. The model was of high optical sensibility and met the experimental requirements. Photoelastic model of mandible with teeth indirectly fabricated by rapid prototyping meets the photoelastic experimental requirements well.

  11. Novel Random Mutagenesis Method for Directed Evolution.

    Science.gov (United States)

    Feng, Hong; Wang, Hai-Yan; Zhao, Hong-Yan

    2017-01-01

    Directed evolution is a powerful strategy for gene mutagenesis, and has been used for protein engineering both in scientific research and in the biotechnology industry. The routine method for directed evolution was developed by Stemmer in 1994 (Stemmer, Proc Natl Acad Sci USA 91, 10747-10751, 1994; Stemmer, Nature 370, 389-391, 1994). Since then, various methods have been introduced, each of which has advantages and limitations depending upon the targeted genes and procedure. In this chapter, a novel alternative directed evolution method which combines mutagenesis PCR with dITP and fragmentation by endonuclease V is described. The kanamycin resistance gene is used as a reporter gene to verify the novel method for directed evolution. This method for directed evolution has been demonstrated to be efficient, reproducible, and easy to manipulate in practice.

  12. Enhancing Scalability of Sparse Direct Methods

    International Nuclear Information System (INIS)

    Li, Xiaoye S.; Demmel, James; Grigori, Laura; Gu, Ming; Xia, Jianlin; Jardin, Steve; Sovinec, Carl; Lee, Lie-Quan

    2007-01-01

    TOPS is providing high-performance, scalable sparse direct solvers, which have had significant impacts on the SciDAC applications, including fusion simulation (CEMM), accelerator modeling (COMPASS), as well as many other mission-critical applications in DOE and elsewhere. Our recent developments have been focusing on new techniques to overcome scalability bottleneck of direct methods, in both time and memory. These include parallelizing symbolic analysis phase and developing linear-complexity sparse factorization methods. The new techniques will make sparse direct methods more widely usable in large 3D simulations on highly-parallel petascale computers

  13. Mobile Image Ratiometry: A New Method for Instantaneous Analysis of Rapid Test Strips

    OpenAIRE

    Donald C. Cooper; Bryan Callahan; Phil Callahan; Lee Burnett

    2012-01-01

    Here we describe Mobile Image Ratiometry (MIR), a new method for the automated quantification of standardized rapid immunoassay strips using consumer-based mobile smartphone and tablet cameras. To demonstrate MIR we developed a standardized method using rapid immunotest strips directed against cocaine (COC) and its major metabolite, benzoylecgonine (BE). We performed image analysis of three brands of commercially available dye-conjugated anti-COC/BE antibody test strips in response to three d...

  14. Rapid and robust detection methods for poison and microbial contamination.

    Science.gov (United States)

    Hoehl, Melanie M; Lu, Peter J; Sims, Peter A; Slocum, Alexander H

    2012-06-27

    Real-time on-site monitoring of analytes is currently in high demand for food contamination, water, medicines, and ingestible household products that were never tested appropriately. Here we introduce chemical methods for the rapid quantification of a wide range of chemical and microbial contaminations using a simple instrument. Within the testing procedure, we used a multichannel, multisample, UV-vis spectrophotometer/fluorometer that employs two frequencies of light simultaneously to interrogate the sample. We present new enzyme- and dye-based methods to detect (di)ethylene glycol in consumables above 0.1 wt % without interference and alcohols above 1 ppb. Using DNA intercalating dyes, we can detect a range of pathogens ( E. coli , Salmonella , V. Cholera, and a model for Malaria) in water, foods, and blood without background signal. We achieved universal scaling independent of pathogen size above 10(4) CFU/mL by taking advantage of the simultaneous measurement at multiple wavelengths. We can detect contaminants directly, without separation, purification, concentration, or incubation. Our chemistry is stable to ± 1% for >3 weeks without refrigeration, and measurements require <5 min.

  15. Motion Planning for a Direct Metal Deposition Rapid Prototyping System

    Energy Technology Data Exchange (ETDEWEB)

    AMES,ARLO L.; HENSINGER,DAVID M.; KUHLMANN,JOEL L.

    1999-10-18

    A motion planning strategy was developed and implemented to generate motion control instructions from solid model data for controlling a robotically driven solid free-form fabrication process. The planning strategy was tested using a PUMA type robot arm integrated into a LENS{trademark} (Laser Engineered Net Shape) system. Previous systems relied on a series of x, y, and z stages, to provide a minimal coordinated motion control capability. This limited the complexity of geometries that could be constructed. With the coordinated motion provided by a robotic arm, the system can produce three dimensional parts by ''writing'' material onto any face of existing material. The motion planning strategy relied on solid model geometry evaluation and exploited robotic positioning flexibility to allow the construction of geometrically complex parts. The integration of the robotic manipulator into the LENS{trademark} system was tested by producing metal parts directly from CAD models.

  16. Methods of conditioning direct methanol fuel cells

    Science.gov (United States)

    Rice, Cynthia; Ren, Xiaoming; Gottesfeld, Shimshon

    2005-11-08

    Methods for conditioning the membrane electrode assembly of a direct methanol fuel cell ("DMFC") are disclosed. In a first method, an electrical current of polarity opposite to that used in a functioning direct methanol fuel cell is passed through the anode surface of the membrane electrode assembly. In a second method, methanol is supplied to an anode surface of the membrane electrode assembly, allowed to cross over the polymer electrolyte membrane of the membrane electrode assembly to a cathode surface of the membrane electrode assembly, and an electrical current of polarity opposite to that in a functioning direct methanol fuel cell is drawn through the membrane electrode assembly, wherein methanol is oxidized at the cathode surface of the membrane electrode assembly while the catalyst on the anode surface is reduced. Surface oxides on the direct methanol fuel cell anode catalyst of the membrane electrode assembly are thereby reduced.

  17. A simple and rapid method to estimate radiocesium in man

    International Nuclear Information System (INIS)

    Kindl, P.; Steger, F.

    1990-09-01

    A simple and rapid method for monitoring internal contamination of radiocesium in man was developed. This method is based on measurements of the γ-rays emitted from the muscular parts between the thights by a simple NaJ(Tl)-system. The experimental procedure, the calibration, the estimation of the body activity and results are explained and discussed. (Authors)

  18. Rapid Detection and Identification of Candidemia by Direct Blood Culturing on Solid Medium by Use of Lysis-Centrifugation Method Combined with Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry (MALDI-TOF MS)

    Science.gov (United States)

    Idelevich, Evgeny A.; Grünastel, Barbara

    2016-01-01

    ABSTRACT Candida sepsis is a life-threatening condition with increasing prevalence. In this study, direct blood culturing on solid medium using a lysis-centrifugation procedure enabled successful Candida species identification by matrix-assisted laser desorption–ionization time of flight mass spectrometry on average 3.8 h (Sabouraud agar) or 7.4 h (chocolate agar) before the positivity signal for control samples in Bactec mycosis-IC/F or Bactec Plus aerobic/F bottles, respectively. Direct culturing on solid medium accelerated candidemia diagnostics compared to that with automated broth-based systems. PMID:27795344

  19. Rapid Detection and Identification of Candidemia by Direct Blood Culturing on Solid Medium by Use of Lysis-Centrifugation Method Combined with Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS).

    Science.gov (United States)

    Idelevich, Evgeny A; Grünastel, Barbara; Becker, Karsten

    2017-01-01

    Candida sepsis is a life-threatening condition with increasing prevalence. In this study, direct blood culturing on solid medium using a lysis-centrifugation procedure enabled successful Candida species identification by matrix-assisted laser desorption-ionization time of flight mass spectrometry on average 3.8 h (Sabouraud agar) or 7.4 h (chocolate agar) before the positivity signal for control samples in Bactec mycosis-IC/F or Bactec Plus aerobic/F bottles, respectively. Direct culturing on solid medium accelerated candidemia diagnostics compared to that with automated broth-based systems. Copyright © 2016 American Society for Microbiology.

  20. Rapid screening method for plutonium in mixed waste samples

    International Nuclear Information System (INIS)

    Somers, W.; Culp, T.; Miller, R.

    1987-01-01

    A waste stream sampling program was undertaken to determine those waste streams which contained hazardous constituents, and would therefore be regulated as a hazardous waste under the Resource Conservation and Recovery Act. The waste streams also had the potential of containing radioactive material, either plutonium, americium, or depleted uranium. Because of the potential for contamination with radioactive material, a method of rapidly screening the liquid samples for radioactive material was required. A counting technique was devised to count a small aliquot of a sample, determine plutonium concentration, and allow the sample to be shipped the same day they were collected. This technique utilized the low energy photons (x-rays) that accompany α decay. This direct, non-destructive x-ray analysis was applied to quantitatively determine Pu-239 concentrations in industrial samples. Samples contained a Pu-239, Am-241 mixture; the ratio and/or concentrations of these two radionuclides was not constant. A computer program was designed and implemented to calculate Pu-239 activity and concentration (g/ml) using the 59.5 keV Am-241 peak to determine Am-241's contribution to the 17 keV region. Am's contribution was subtracted, yielding net counts in the 17 keV region due to Pu. 2 figs., 1 tab

  1. Methods for Rapid Screening in Woody Plant Herbicide Development

    Directory of Open Access Journals (Sweden)

    William Stanley

    2014-07-01

    Full Text Available Methods for woody plant herbicide screening were assayed with the goal of reducing resources and time required to conduct preliminary screenings for new products. Rapid screening methods tested included greenhouse seedling screening, germinal screening, and seed screening. Triclopyr and eight experimental herbicides from Dow AgroSciences (DAS 313, 402, 534, 548, 602, 729, 779, and 896 were tested on black locust, loblolly pine, red maple, sweetgum, and water oak. Screening results detected differences in herbicide and species in all experiments in much less time (days to weeks than traditional field screenings and consumed significantly less resources (<500 mg acid equivalent per herbicide per screening. Using regression analysis, various rapid screening methods were linked into a system capable of rapidly and inexpensively assessing herbicide efficacy and spectrum of activity. Implementation of such a system could streamline early-stage herbicide development leading to field trials, potentially freeing resources for use in development of beneficial new herbicide products.

  2. Rapid spectrographic method for determining microcomponents in solutions

    International Nuclear Information System (INIS)

    Karpenko, L.I.; Fadeeva, L.A.; Gordeeva, A.N.; Ermakova, N.V.

    1984-01-01

    Rapid spectrographic method foe determining microcomponents (Cd, V, Mo, Ni, rare earths and other elements) in industrial and natural solutions has been developed. The analyses were conducted in argon medium and in the air. Calibration charts for determining individual rare earths in solutions are presented. The accuracy of analysis (Sr) was detection limit was 10 -3 -10 -4 mg/ml, that for rare earths - 1.10 -2 mg/ml. The developed method enables to rapidly analyze solutions (sewages and industrialllwaters, wine products) for 20 elements including 6 rare earths, using strandard equipment

  3. Direct Discrete Method for Neutronic Calculations

    International Nuclear Information System (INIS)

    Vosoughi, Naser; Akbar Salehi, Ali; Shahriari, Majid

    2002-01-01

    The objective of this paper is to introduce a new direct method for neutronic calculations. This method which is named Direct Discrete Method, is simpler than the neutron Transport equation and also more compatible with physical meaning of problems. This method is based on physic of problem and with meshing of the desired geometry, writing the balance equation for each mesh intervals and with notice to the conjunction between these mesh intervals, produce the final discrete equations series without production of neutron transport differential equation and mandatory passing from differential equation bridge. We have produced neutron discrete equations for a cylindrical shape with two boundary conditions in one group energy. The correction of the results from this method are tested with MCNP-4B code execution. (authors)

  4. Antigen detection of rabies virus in brain smear using direct Rapid Immunohistochemistry Test

    Directory of Open Access Journals (Sweden)

    Damayanti R

    2014-03-01

    Full Text Available Rabies is zoonotic disease caused by a fatal, neurotropic virus. Rabies virus is classified into the Genus of Lyssavirus under the yang family of Rhabdoviridae. Rabies affecting hot- blooded animals, as well as human. Dogs, cats, monkeys are the vectors or reservoirs for rabies and the virus was transmitted through the saliva after infected animal’s bites. The aim of this study was to conduct rapid diagnosis to detect rabies viral antigen in brain smear using immunohistochemical (IHC method namely direct Rapid Immunohistochemical Test (dRIT. A total number of 119 brain samples were achieved from Bukittinggi Veterinary Laboratory, West Sumatra. Standardisation and validation of the method were compared to Fluorescent Antibody Test (FAT as a golden standard for rabies diagnosis. Results show that dRIT was a very good method, it can be performed within two hours without the need of fluorescent microscope. The samples were tested using FAT and from 119 samples tested, 80 (67.23% samples were positive for rabies and 39 (32.77% samples were negative for rabies whereas using dRIT showed that 78 (65.54% samples were positive for rabies and 41 (34.45% samples were negative for rabies. The dRIT results were validated by comparing them with FAT results as a golden standard for rabies. The relative sensitivity of dRIT to FAT was 97.5% and the relative specificity to FAT was 100% (with Kappa value of 0.976, stated as excellent. The achievement showed that dRIT is very potential diagnostic tool and is highly recommended to be used widely as a rapid diagnosis tool for rabies.

  5. Rapid directed evolution of stabilized proteins with cellular high-throughput encapsulation solubilization and screening (CHESS).

    Science.gov (United States)

    Yong, K J; Scott, D J

    2015-03-01

    Directed evolution is a powerful method for engineering proteins towards user-defined goals and has been used to generate novel proteins for industrial processes, biological research and drug discovery. Typical directed evolution techniques include cellular display, phage display, ribosome display and water-in-oil compartmentalization, all of which physically link individual members of diverse gene libraries to their translated proteins. This allows the screening or selection for a desired protein function and subsequent isolation of the encoding gene from diverse populations. For biotechnological and industrial applications there is a need to engineer proteins that are functional under conditions that are not compatible with these techniques, such as high temperatures and harsh detergents. Cellular High-throughput Encapsulation Solubilization and Screening (CHESS), is a directed evolution method originally developed to engineer detergent-stable G proteins-coupled receptors (GPCRs) for structural biology. With CHESS, library-transformed bacterial cells are encapsulated in detergent-resistant polymers to form capsules, which serve to contain mutant genes and their encoded proteins upon detergent mediated solubilization of cell membranes. Populations of capsules can be screened like single cells to enable rapid isolation of genes encoding detergent-stable protein mutants. To demonstrate the general applicability of CHESS to other proteins, we have characterized the stability and permeability of CHESS microcapsules and employed CHESS to generate thermostable, sodium dodecyl sulfate (SDS) resistant green fluorescent protein (GFP) mutants, the first soluble proteins to be engineered using CHESS. © 2014 Wiley Periodicals, Inc.

  6. A Direct Method of Hamiltonian Structure

    International Nuclear Information System (INIS)

    Li Qi; Chen Dengyuan; Su Shuhua

    2011-01-01

    A direct method of constructing the Hamiltonian structure of the soliton hierarchy with self-consistent sources is proposed through computing the functional derivative under some constraints. The Hamiltonian functional is related with the conservation densities of the corresponding hierarchy. Three examples and their two reductions are given. (general)

  7. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  8. Direct methods for determining internal contamination

    International Nuclear Information System (INIS)

    Melandri, C.

    1985-01-01

    The direct methods of investigation on body content of radionuclides emitting gamma rays with energies higher than 100 KeV are described. After a short review of the earlier methods, the main technical charateristics of the present used whole body counters and counting geometries are described together with the calibration methods. Qualitative and quantitative data interpretation are also briefly discussed. The minimum detectable activity and the Derived Investigation Levels at different times from the intake both by ingestion or by inhalation as aerosol are finally compared for some radionuclides of great importance in the health physic survey

  9. Study of a large rapid ashing apparatus and a rapid dry ashing method for biological samples and its application

    International Nuclear Information System (INIS)

    Jin Meisun; Wang Benli; Liu Wencang

    1988-04-01

    A large rapid-dry-ashing apparatus and a rapid ashing method for biological samples are described. The apparatus consists of specially made ashing furnace, gas supply system and temperature-programming control cabinet. The following adventages have been showed by ashing experiment with the above apparatus: (1) high speed of ashing and saving of electric energy; (2) The apparatus can ash a large amount of samples at a time; (3) The ashed sample is pure white (or spotless), loose and easily soluble with few content of residual char; (4) The fresh sample can also be ashed directly. The apparatus is suitable for ashing a large amount of the environmental samples containing low level radioactivity trace elements and the medical, food and agricultural research samples

  10. Development of rapid urine analysis method for uranium

    Energy Technology Data Exchange (ETDEWEB)

    Kuwabara, J.; Noguchi, H. [Japan Atomic Energy Research Institute, Tokai, Ibaraki (Japan)

    2000-05-01

    ICP-MS has begun to spread in the field of individual monitoring for internal exposure as a very effective machine for uranium analysis. Although the ICP-MS has very high sensitivity, it requires longer time than conventional analysis, such as fluorescence analysis, because it is necessary to remove matrix from a urine sample sufficiently. To shorten time required for the urine bioassay by ICP-MS, a rapid uranium analysis method using the ICP-MS connected with a flow injection system was developed. Since this method does not involve chemical separation steps, the time required is equivalent to the conventional analysis. A measurement test was carried out using 10 urine solutions prepared from a urine sample. Required volume of urine solution is 5 ml. Main chemical treatment is only the digestion with 5 ml of nitric acid using a microwave oven to decompose organic matter and to dissolve suspended or precipitated matter. The microwave oven can digest 10 samples at once within an hour. Volume of digested sample solution was adjusted to 10 ml. The prepared sample solutions were directly introduced to the ICP-MS without any chemical separation procedure. The ICP-MS was connected with a flow injection system and an auto sampler. The flow injection system can minimize the matrix effects caused from salt dissolved in high matrix solution, such as non chemical separated urine sample, because it can introduce micro volume of sample solution into the ICP-MS. The ICP-MS detected uranium within 2 min/sample using the auto sampler. The 10 solutions prepared from a urine sample showed an average of 7.5 ng/l of uranium concentration in urine with 10 % standard deviation. A detection limit is about 1 ng/l. The total time required was less than 4 hours for 10 sample analysis. In the series of measurement, any memory effect was not observed. The present analysis method using the ICP-MS equipped with the flow injection system demonstrated that the shortening of time required on high

  11. Development of rapid urine analysis method for uranium

    International Nuclear Information System (INIS)

    Kuwabara, J.; Noguchi, H.

    2000-01-01

    ICP-MS has begun to spread in the field of individual monitoring for internal exposure as a very effective machine for uranium analysis. Although the ICP-MS has very high sensitivity, it requires longer time than conventional analysis, such as fluorescence analysis, because it is necessary to remove matrix from a urine sample sufficiently. To shorten time required for the urine bioassay by ICP-MS, a rapid uranium analysis method using the ICP-MS connected with a flow injection system was developed. Since this method does not involve chemical separation steps, the time required is equivalent to the conventional analysis. A measurement test was carried out using 10 urine solutions prepared from a urine sample. Required volume of urine solution is 5 ml. Main chemical treatment is only the digestion with 5 ml of nitric acid using a microwave oven to decompose organic matter and to dissolve suspended or precipitated matter. The microwave oven can digest 10 samples at once within an hour. Volume of digested sample solution was adjusted to 10 ml. The prepared sample solutions were directly introduced to the ICP-MS without any chemical separation procedure. The ICP-MS was connected with a flow injection system and an auto sampler. The flow injection system can minimize the matrix effects caused from salt dissolved in high matrix solution, such as non chemical separated urine sample, because it can introduce micro volume of sample solution into the ICP-MS. The ICP-MS detected uranium within 2 min/sample using the auto sampler. The 10 solutions prepared from a urine sample showed an average of 7.5 ng/l of uranium concentration in urine with 10 % standard deviation. A detection limit is about 1 ng/l. The total time required was less than 4 hours for 10 sample analysis. In the series of measurement, any memory effect was not observed. The present analysis method using the ICP-MS equipped with the flow injection system demonstrated that the shortening of time required on high

  12. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Hongbin; Wang Chunyan; Qi Yao [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); University of Chinese Academy of Sciences, Beijing 100039 (China); Song Fengrui, E-mail: songfr@ciac.jl.cn [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Liu Zhiqiang; Liu Shuying [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

    2012-11-08

    Highlights: Black-Right-Pointing-Pointer DART MS combined with PCA and HCA was used to rapidly identify markers of Radix Aconiti. Black-Right-Pointing-Pointer The DART MS behavior of six aconitine-type alkaloids was investigated. Black-Right-Pointing-Pointer Chemical markers were recognized between the qualified and unqualified samples. Black-Right-Pointing-Pointer DART MS was shown to be an effective tool for quality control of Radix Aconiti Preparata. - Abstract: This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in

  13. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry

    International Nuclear Information System (INIS)

    Zhu Hongbin; Wang Chunyan; Qi Yao; Song Fengrui; Liu Zhiqiang; Liu Shuying

    2012-01-01

    Highlights: ► DART MS combined with PCA and HCA was used to rapidly identify markers of Radix Aconiti. ► The DART MS behavior of six aconitine-type alkaloids was investigated. ► Chemical markers were recognized between the qualified and unqualified samples. ► DART MS was shown to be an effective tool for quality control of Radix Aconiti Preparata. - Abstract: This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in combination with multivariate data analysis provides a very flexible and reliable method for quality

  14. Rapid quantification of free cholesterol in tears using direct insertion/electron ionization-mass spectrometry.

    Science.gov (United States)

    Wei, Xiaojia Eric; Korth, John; Brown, Simon H J; Mitchell, Todd W; Truscott, Roger J W; Blanksby, Stephen J; Willcox, Mark D P; Zhao, Zhenjun

    2013-12-09

    To establish a simple and rapid analytical method, based on direct insertion/electron ionization-mass spectrometry (DI/EI-MS), for measuring free cholesterol in tears from humans and rabbits. A stable-isotope dilution protocol employing DI/EI-MS in selected ion monitoring mode was developed and validated. It was used to quantify the free cholesterol content in human and rabbit tear extracts. Tears were collected from adult humans (n = 15) and rabbits (n = 10) and lipids extracted. Screening, full-scan (m/z 40-600) DI/EI-MS analysis of crude tear extracts showed that diagnostic ions located in the mass range m/z 350 to 400 were those derived from free cholesterol, with no contribution from cholesterol esters. DI/EI-MS data acquired using selected ion monitoring (SIM) were analyzed for the abundance ratios of diagnostic ions with their stable isotope-labeled analogues arising from the D6-cholesterol internal standard. Standard curves of good linearity were produced and an on-probe limit of detection of 3 ng (at 3:1 signal to noise) and limit of quantification of 8 ng (at 10:1 signal to noise). The concentration of free cholesterol in human tears was 15 ± 6 μg/g, which was higher than in rabbit tears (10 ± 5 μg/g). A stable-isotope dilution DI/EI-SIM method for free cholesterol quantification without prior chromatographic separation was established. Using this method demonstrated that humans have higher free cholesterol levels in their tears than rabbits. This is in agreement with previous reports. This paper provides a rapid and reliable method to measure free cholesterol in small-volume clinical samples.

  15. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Zhu, Hongbin; Wang, Chunyan; Qi, Yao; Song, Fengrui; Liu, Zhiqiang; Liu, Shuying

    2012-11-08

    This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in combination with multivariate data analysis provides a very flexible and reliable method for quality assessment of toxic herbal medicine. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. A rapid method for determining chlorobenzenes in dam water systems

    African Journals Online (AJOL)

    A method using direct immersion solid phase microextraction (DI-SPME) coupled to gas chromatography equipped with a flame ionisation detector (GC-FID) was developed for the analysis of 7 chlorinated benzenes in dam water. The main parameters affecting the DI-SPME process were optimised. The optimised method ...

  17. Rapid Enzymatic Method for Pectin Methyl Esters Determination

    Directory of Open Access Journals (Sweden)

    Lucyna Łękawska-Andrinopoulou

    2013-01-01

    Full Text Available Pectin is a natural polysaccharide used in food and pharma industries. Pectin degree of methylation is an important parameter having significant influence on pectin applications. A rapid, fully automated, kinetic flow method for determination of pectin methyl esters has been developed. The method is based on a lab-made analyzer using the reverse flow-injection/stopped flow principle. Methanol is released from pectin by pectin methylesterase in the first mixing coil. Enzyme working solution is injected further downstream and it is mixed with pectin/pectin methylesterase stream in the second mixing coil. Methanol is oxidized by alcohol oxidase releasing formaldehyde and hydrogen peroxide. This reaction is coupled to horse radish peroxidase catalyzed reaction, which gives the colored product 4-N-(p-benzoquinoneimine-antipyrine. Reaction rate is proportional to methanol concentration and it is followed using Ocean Optics USB 2000+ spectrophotometer. The analyzer is fully regulated by a lab written LabVIEW program. The detection limit was 1.47 mM with an analysis rate of 7 samples h−1. A paired t-test with results from manual method showed that the automated method results are equivalent to the manual method at the 95% confidence interval. The developed method is rapid and sustainable and it is the first application of flow analysis in pectin analysis.

  18. A rapid, simple method for obtaining radiochemically pure hepatic heme

    International Nuclear Information System (INIS)

    Bonkowski, H.L.; Bement, W.J.; Erny, R.

    1978-01-01

    Radioactively-labelled heme has usually been isolated from liver to which unlabelled carrier has been added by long, laborious techniques involving organic solvent extraction followed by crystallization. A simpler, rapid method is devised for obtaining radiochemically-pure heme synthesized in vivo in rat liver from delta-amino[4- 14 C]levulinate. This method, in which the heme is extracted into ethyl acetate/glacial acetic acid and in which porphyrins are removed from the heme-containing organic phase with HCl washes, does not require addition of carrier heme. The new method gives better heme recoveries than and heme specific activities identical to, those obtained using the crystallization method. In this new method heme must be synthesized from delta-amino[4- 14 C]levulinate; it is not satisfactory to use [2- 14 C]glycine substrate because non-heme counts are isolated in the heme fraction. (Auth.)

  19. Rapid methods for jugular bleeding of dogs requiring one technician.

    Science.gov (United States)

    Frisk, C S; Richardson, M R

    1979-06-01

    Two methods were used to collect blood from the jugular vein of dogs. In both techniques, only one technician was required. A rope with a slip knot was placed around the base of the neck to assist in restraint and act as a tourniquet for the vein. The technician used one hand to restrain the dog by the muzzle and position the head. The other hand was used for collecting the sample. One of the methods could be accomplished with the dog in its cage. The bleeding techniques were rapid, requiring approximately 1 minute per dog.

  20. Rapid surface enhanced Raman scattering detection method for chloramphenicol residues

    Science.gov (United States)

    Ji, Wei; Yao, Weirong

    2015-06-01

    Chloramphenicol (CAP) is a widely used amide alcohol antibiotics, which has been banned from using in food producing animals in many countries. In this study, surface enhanced Raman scattering (SERS) coupled with gold colloidal nanoparticles was used for the rapid analysis of CAP. Density functional theory (DFT) calculations were conducted with Gaussian 03 at the B3LYP level using the 3-21G(d) and 6-31G(d) basis sets to analyze the assignment of vibrations. Affirmatively, the theoretical Raman spectrum of CAP was in complete agreement with the experimental spectrum. They both exhibited three strong peaks characteristic of CAP at 1104 cm-1, 1344 cm-1, 1596 cm-1, which were used for rapid qualitative analysis of CAP residues in food samples. The use of SERS as a method for the measurements of CAP was explored by comparing use of different solvents, gold colloidal nanoparticles concentration and absorption time. The method of the detection limit was determined as 0.1 μg/mL using optimum conditions. The Raman peak at 1344 cm-1 was used as the index for quantitative analysis of CAP in food samples, with a linear correlation of R2 = 0.9802. Quantitative analysis of CAP residues in foods revealed that the SERS technique with gold colloidal nanoparticles was sensitive and of a good stability and linear correlation, and suited for rapid analysis of CAP residue in a variety of food samples.

  1. A novel method for rapid in vitro radiobioassay

    Science.gov (United States)

    Crawford, Evan Bogert

    Rapid and accurate analysis of internal human exposure to radionuclides is essential to the effective triage and treatment of citizens who have possibly been exposed to radioactive materials in the environment. The two most likely scenarios in which a large number of citizens would be exposed are the detonation of a radiation dispersal device (RDD, "dirty bomb") or the accidental release of an isotope from an industrial source such as a radioisotopic thermal generator (RTG). In the event of the release and dispersion of radioactive materials into the environment in a large city, the entire population of the city -- including all commuting workers and tourists -- would have to be rapidly tested, both to satisfy the psychological needs of the citizens who were exposed to the mental trauma of a possible radiation dose, and to satisfy the immediate medical needs of those who received the highest doses and greatest levels of internal contamination -- those who would best benefit from rapid, intensive medical care. In this research a prototype rapid screening method to screen urine samples for the presence of up to five isotopes, both individually and in a mixture, has been developed. The isotopes used to develop this method are Co-60, Sr-90, Cs-137, Pu-238, and Am-241. This method avoids time-intensive chemical separations via the preparation and counting of a single sample on multiple detectors, and analyzing the spectra for isotope-specific markers. A rapid liquid-liquid separation using an organic extractive scintillator can be used to help quantify the activity of the alpha-emitting isotopes. The method provides quantifiable results in less than five minutes for the activity of beta/gamma-emitting isotopes when present in the sample at the intervention level as defined by the Centers for Disease Control and Prevention (CDC), and quantifiable results for the activity levels of alpha-emitting isotopes present at their respective intervention levels in approximately 30

  2. Rapid, accurate, and direct determination of total lycopene content in tomato paste

    Science.gov (United States)

    Bicanic, D.; Anese, M.; Luterotti, S.; Dadarlat, D.; Gibkes, J.; Lubbers, M.

    2003-01-01

    Lycopene that imparts red color to the tomato fruit is the most potent antioxidant among carotenes, an important nutrient and also used as a color ingredient in many food formulations. Since cooked and processed foods derived from tomatoes were shown to provide optimal lycopene boost, products such as paste, puree, juice, etc. are nowadays gaining popularity as dietary sources. The analysis of lycopene in tomato paste (partially dehydrated product prepared by vacuum concentrating tomato juice) is carried out using either high pressure liquid chromatography (HPLC), spectrophotometry, or by evaluating the color. The instability of lycopene during processes of extraction, etc., handling, and disposal of organic solvents makes the preparation of a sample for the analysis a delicate task. Despite a recognized need for accurate and rapid assessment of lycopene in tomato products no such method is available at present. The study described here focuses on a direct determination of a total lycopene content in different tomato pastes by means of the laser optothermal window (LOW) method at 502 nm. The concentration of lycopene in tomato paste ranged between 25 and 150 mg per 100 g product; the results are in excellent agreement with those obtained by spectrophotometry. The time needed to complete LOW analysis is very short, so that decomposition of pigment and the formation of artifacts are minimized. Preliminary results indicate a good degree of reproducibility making the LOW method suitable for routine assays of lycopene content in tomato paste.

  3. Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

    Science.gov (United States)

    V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

    2016-12-01

    Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

  4. Rapid assessment methods in eye care: An overview

    Directory of Open Access Journals (Sweden)

    Srinivas Marmamula

    2012-01-01

    Full Text Available Reliable information is required for the planning and management of eye care services. While classical research methods provide reliable estimates, they are prohibitively expensive and resource intensive. Rapid assessment (RA methods are indispensable tools in situations where data are needed quickly and where time- or cost-related factors prohibit the use of classical epidemiological surveys. These methods have been developed and field tested, and can be applied across almost the entire gamut of health care. The 1990s witnessed the emergence of RA methods in eye care for cataract, onchocerciasis, and trachoma and, more recently, the main causes of avoidable blindness and visual impairment. The important features of RA methods include the use of local resources, simplified sampling methodology, and a simple examination protocol/data collection method that can be performed by locally available personnel. The analysis is quick and easy to interpret. The entire process is inexpensive, so the survey may be repeated once every 5-10 years to assess the changing trends in disease burden. RA survey methods are typically linked with an intervention. This article provides an overview of the RA methods commonly used in eye care, and emphasizes the selection of appropriate methods based on the local need and context.

  5. EDM 1.0: electron direct methods.

    Science.gov (United States)

    Kilaas, R; Marks, L D; Own, C S

    2005-02-01

    A computer program designed to provide a number of quantitative analysis tools for high-resolution imaging and electron diffraction data is described. The program includes basic image manipulation, both real space and reciprocal space image processing, Wiener-filtering, symmetry averaging, methods for quantification of electron diffraction patterns and two-dimensional direct methods. The program consists of a number of sub-programs written in a combination of C++, C and Fortran. It can be downloaded either as GNU source code or as binaries and has been compiled and verified on a wide range of platforms, both Unix based and PC's. Elements of the design philosophy as well as future possible extensions are described.

  6. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  7. Method for producing rapid pH changes

    Science.gov (United States)

    Clark, J.H.; Campillo, A.J.; Shapiro, S.L.; Winn, K.R.

    A method of initiating a rapid pH change in a solution comprises irradiating the solution with an intense flux of electromagnetic radiation of a frequency which produces a substantial pK change to a compound in solution. To optimize the resulting pH change, the compound being irradiated in solution should have an excited state lifetime substantially longer than the time required to establish an excited state acid-base equilibrium in the solution. Desired pH changes can be accomplished in nanoseconds or less by means of picosecond pulses of laser radiation.

  8. Radiometric method for the rapid detection of Leptospira organisms

    International Nuclear Information System (INIS)

    Manca, N.; Verardi, R.; Colombrita, D.; Ravizzola, G.; Savoldi, E.; Turano, A.

    1986-01-01

    A rapid and sensitive radiometric method for detection of Leptospira interrogans serovar pomona and Leptospira interrogans serovar copenhageni is described. Stuart's medium and Middlebrook TB (12A) medium supplemented with bovine serum albumin, catalase, and casein hydrolysate and labeled with 14 C-fatty acids were used. The radioactivity was measured in a BACTEC 460. With this system, Leptospira organisms were detected in human blood in 2 to 5 days, a notably shorter time period than that required for the majority of detection techniques

  9. Radiometric method for the rapid detection of Leptospira organisms

    Energy Technology Data Exchange (ETDEWEB)

    Manca, N.; Verardi, R.; Colombrita, D.; Ravizzola, G.; Savoldi, E.; Turano, A.

    1986-02-01

    A rapid and sensitive radiometric method for detection of Leptospira interrogans serovar pomona and Leptospira interrogans serovar copenhageni is described. Stuart's medium and Middlebrook TB (12A) medium supplemented with bovine serum albumin, catalase, and casein hydrolysate and labeled with /sup 14/C-fatty acids were used. The radioactivity was measured in a BACTEC 460. With this system, Leptospira organisms were detected in human blood in 2 to 5 days, a notably shorter time period than that required for the majority of detection techniques.

  10. Direct, Specific and Rapid Detection of Staphylococcal Proteins and Exotoxins Using a Multiplex Antibody Microarray.

    Directory of Open Access Journals (Sweden)

    Bettina Stieber

    Full Text Available S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins.In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays.110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate.The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers.

  11. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  12. Developing rapid methods for analyzing upland riparian functions and values.

    Science.gov (United States)

    Hruby, Thomas

    2009-06-01

    Regulators protecting riparian areas need to understand the integrity, health, beneficial uses, functions, and values of this resource. Up to now most methods providing information about riparian areas are based on analyzing condition or integrity. These methods, however, provide little information about functions and values. Different methods are needed that specifically address this aspect of riparian areas. In addition to information on functions and values, regulators have very specific needs that include: an analysis at the site scale, low cost, usability, and inclusion of policy interpretations. To meet these needs a rapid method has been developed that uses a multi-criteria decision matrix to categorize riparian areas in Washington State, USA. Indicators are used to identify the potential of the site to provide a function, the potential of the landscape to support the function, and the value the function provides to society. To meet legal needs fixed boundaries for assessment units are established based on geomorphology, the distance from "Ordinary High Water Mark" and different categories of land uses. Assessment units are first classified based on ecoregions, geomorphic characteristics, and land uses. This simplifies the data that need to be collected at a site, but it requires developing and calibrating a separate model for each "class." The approach to developing methods is adaptable to other locations as its basic structure is not dependent on local conditions.

  13. Direct Analysis in Real-time Mass Spectrometry for Rapid Identification of Traditional Chinese Medicines with Coumarins as Primary Characteristics.

    Science.gov (United States)

    Chen, Zhiyong; Yang, Yuanyuan; Tao, Hongxun; Liao, Liping; Li, Ye; Zhang, Zijia

    2017-05-01

    The increasing popularity of traditional Chinese medicines (TCMs) necessitates rapid and reliable methods for controlling their quality. Direct analysis in real-time mass spectrometry (DART-MS) represents a novel approach to analysing TCMs. To develop a quick and reliable method of identifying TCMs with coumarins as primary characteristics. DART-MS coupled with ion trap mass spectrometry was employed to rapidly identify TCMs with coumarins as primary characteristics and to explore the ionisation mechanisms of simple coumarins, furocoumarins and pyranocoumarins in detail. With minimal sample pretreatment, mass spectra of Fraxini Cortex, Angelicae Pubescentis Radix, Peucedani Radix and Psoraleae Fructus samples were obtained within seconds. The operating parameters of the DART ion source (e.g. grid electrode voltage and ionisation gas temperature) were carefully investigated to obtain high-quality mass spectra. The mass spectra of samples and DART-MS/MS spectra of marker compounds were used to identify sample materials. Successful authentication was achieved by analysing the same materials of different origins. Some simple coumarins, furocoumarins and pyranocoumarins can be directly detected by DART-MS as marker compounds. Our results demonstrated that DART-MS can provide a rapid and reliable method for the identification of TCMs containing different configurations of coumarins; the method may also be applicable to other plants. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  14. A rapid method for the determination of some antihypertensive and antipyretic drugs by thermometric titrimetry.

    Science.gov (United States)

    Abbasi, U M; Chand, F; Bhanger, M I; Memon, S A

    1986-02-01

    A simple and rapid method is described for the direct thermometric determination of milligram amounts of methyl dopa, propranolol hydrochloride, 1-phenyl-3-methylpyrazolone (MPP) and 2,3-dimethyl-1-phenylpyrazol-5-one (phenazone) in the presence of excipients. The compounds are reacted with N'-bromosuccinimide and the heat of reaction is used to determine the end-point of the titration. The time required is approximately 2 min, and the accuracy is analytically acceptable.

  15. A Rapid Method for the Determination of Fucoxanthin in Diatom

    Directory of Open Access Journals (Sweden)

    Li-Juan Wang

    2018-01-01

    Full Text Available Fucoxanthin is a natural pigment found in microalgae, especially diatoms and Chrysophyta. Recently, it has been shown to have anti-inflammatory, anti-tumor, and anti-obesityactivity in humans. Phaeodactylum tricornutum is a diatom with high economic potential due to its high content of fucoxanthin and eicosapentaenoic acid. In order to improve fucoxanthin production, physical and chemical mutagenesis could be applied to generate mutants. An accurate and rapid method to assess the fucoxanthin content is a prerequisite for a high-throughput screen of mutants. In this work, the content of fucoxanthin in P. tricornutum was determined using spectrophotometry instead of high performance liquid chromatography (HPLC. This spectrophotometric method is easier and faster than liquid chromatography and the standard error was less than 5% when compared to the HPLC results. Also, this method can be applied to other diatoms, with standard errors of 3–14.6%. It provides a high throughput screening method for microalgae strains producing fucoxanthin.

  16. A rapid method for titration of ascovirus infectivity.

    Science.gov (United States)

    Han, Ningning; Chen, Zishu; Wan, Hu; Huang, Guohua; Li, Jianhong; Jin, Byung Rae

    2018-05-01

    Ascoviruses are a recently described family and the traditional plaque assay and end-point PCR assay have been used for their titration. However, these two methods are time-consuming and inaccurate to titrate ascoviruses. In the present study, a quick method for the determination of the titer of ascovirus stocks was developed based on ascovirus-induced apoptosis in infected insect cells. Briefly, cells infected with serial dilutions of virus (10 -2 -10 -10 ) for 24 h were stained with trypan blue. The stained cells were counted, and the percentage of nonviable cells was calculated. The stained cell rate was compared between virus-infected and control cells. The minimum-dilution group that had a significant difference compared with control and the maximum-dilution group that had no significant difference were selected and then compared each well of the two groups with the average stained cell rate of control. The well was marked as positive well if the stained cell rate was higher than the average stained cell rate of control wells; otherwise, the well was marked as negative wells. The percentage of positive wells were calculated according to the number of positive. Subsequently, the virus titer was calculated through the method of Reed and Muench. This novel method is rapid, simple, reproducible, accurate, and less material-consuming and eliminates the subjectivity of the other procedures for titrating ascoviruses. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. direct method of analysis of an isotropic rectangular plate direct

    African Journals Online (AJOL)

    eobe

    This work evaluates the static analysis of an isotropic rectangular plate with various the static analysis ... method according to Ritz is used to obtain the total potential energy of the plate by employing the used to ..... for rectangular plates analysis, as the behavior of the ... results obtained by previous research work that used.

  18. A rapid protection switching method in carrier ethernet ring networks

    Science.gov (United States)

    Yuan, Liang; Ji, Meng

    2008-11-01

    Abstract: Ethernet is the most important Local Area Network (LAN) technology since more than 90% data traffic in access layer is carried on Ethernet. From 10M to 10G, the improving Ethernet technology can be not only used in LAN, but also a good choice for MAN even WAN. MAN are always constructed in ring topology because the ring network could provide resilient path protection by using less resource (fibre or cable) than other network topologies. In layer 2 data networks, spanning tree protocol (STP) is always used to protect transmit link and preventing the formation of logic loop in networks. However, STP cannot guarantee the efficiency of service convergence when link fault happened. In fact, convergent time of networks with STP is about several minutes. Though Rapid Spanning Tree Protocol (RSTP) and Multi-Spanning Tree Protocol (MSTP) improve the STP technology, they still need a couple of seconds to achieve convergence, and can not provide sub-50ms protection switching. This paper presents a novel rapid ring protection method (RRPM) for carrier Ethernet. Unlike other link-fault detection method, it adopts distributed algorithm to detect link fault rapidly (sub-50ms). When networks restore from link fault, it can revert to the original working state. RRPM can provide single ring protection and interconnected ring protection without the formation of super loop. In normal operation, the master node blocks the secondary port for all non-RRPM Ethernet frames belonging to the given RRPM Ring, thereby avoiding a loop in the ring. When link fault happens, the node on which the failure happens moves from the "ring normal" state to the "ring fault" state. It also sends "link down" frame immediately to other nodes and blocks broken port and flushes its forwarding database. Those who receive "link down" frame will flush forwarding database and master node should unblock its secondary port. When the failure restores, the whole ring will revert to the normal state. That is

  19. Rapid clonal analysis of recurrent tuberculosis by direct MIRU-VNTR typing on stored isolates

    Directory of Open Access Journals (Sweden)

    de Viedma Darío

    2007-07-01

    Full Text Available Abstract Background The application of molecular tools to the analysis of tuberculosis has revealed examples of clonal complexity, such as exogenous reinfection, coinfection, microevolution or compartmentalization. The detection of clonal heterogeneity by standard genotyping approaches is laborious and often requires expertise. This restricts the rapid availability of Mycobacterium tuberculosis (MTB genotypes for clinical or therapeutic decision-making. A new PCR-based technique, MIRU-VNTR, has made it possible to genotype MTB in a time frame close to real-time fingerprinting. Our purpose was to evaluate the capacity of this technique to provide clinicians with a rapid discrimination between reactivation and exogenous reinfection and whether MIRU-VNTR makes it possible to obtain data directly from stored MTB isolates from recurrent episodes. Results We detected differences, between the MIRUtypes of recurrent isolates in 38.5% (5/13 of the cases studied. These included cases of i exogenous reinfection, often with more resistant strains, ii likely examples of microevolution, leading to the appearance of new clonal variants and iii a combination of microevolution, coinfection and competition. Conclusion MIRU-VNTR rapidly obtained clinically useful genotyping data in a challenging situation, directly from stored MTB isolates without subculturing them or purifying their DNA. Our results also mean that MIRU-VNTR could be applied for easy, rapid and affordable massive screening of collections of stored MTB isolates, which could establish the real dimension of clonal heterogeneity in MTB infection.

  20. An Extended Multilocus Sequence Typing (MLST) Scheme for Rapid Direct Typing of Leptospira from Clinical Samples

    OpenAIRE

    Weiss, Sabrina; Menezes, Angela; Woods, Kate; Chanthongthip, Anisone; Dittrich, Sabine; Opoku-Boateng, Agatha; Kimuli, Maimuna; Chalker, Victoria

    2016-01-01

    Background Rapid typing of Leptospira is currently impaired by requiring time consuming culture of leptospires. The objective of this study was to develop an assay that provides multilocus sequence typing (MLST) data direct from patient specimens while minimising costs for subsequent sequencing. Methodology and Findings An existing PCR based MLST scheme was modified by designing nested primers including anchors for facilitated subsequent sequencing. The assay was applied to various specimen t...

  1. Rapid method for Detection of Irradiation Mango Fruits

    International Nuclear Information System (INIS)

    El Salhy, F.T.

    2011-01-01

    To detect mango fruits which have been exposed to low doses of gamma rays (0.5-3.0 kGy), three recommended methods by European Committee for Standardization (EN 1784:1996, EN 1785:1996 and EN 1787:2000) were used to study the possibility for identification of irradiated mango fruits (Ewais variety). Fresh mangoes were irradiated to different doses (0.5, 0.75, 1.0 and 3.0 kGy). The first method for determining the volatile hydrocarbons (VHC) was carried out by using florisil column then identified by gas chromatography and mass spectrometry (GC-MS). The major VHCs were C14:1, C15:0 and C17:1 at different doses which increased linearly with increasing doses either at low or high doses. The second one for determining the 2-alkyl cyclobutanone (2-DCB) was carried out using florisil chromatography method activated with 20% for separation and identified by GC-MS. 2-DCB bio marker specific for irradiated food proved its presence at the applied doses from 0.75-3.0 kGy but not at 0.5 kGy. All the mentioned compounds could not detected in non-irradiated samples, which mean that these radiolytic products (VHC and 2-DCB) can be used as a detection markers for irradiated mangoes even at low doses. The third one (EN 1787:2000) was conducted by electron spin resonance (ESR) on dried petioles of mangoes. The results proved that ESR was more sensitive for all applied doses.It could be concluded that using the three methods can be succeeded for detection of irradiated mangoes but the rapid one even at low doses with high accuracy was ESR.

  2. Electrochemical method for rapid synthesis of Zinc Pentacyanonitrosylferrate Nanotubes

    Directory of Open Access Journals (Sweden)

    Rogaieh Bargeshadi

    2014-10-01

    Full Text Available In this paper, a rapid and simple approach was developed for the preparation of zinc pentacyanonitrosylferrate nanotubes (ZnPCNF NTs within the cylindrical pores of anodic aluminum oxide (AAO template by electrochemical method. The AAO was fabricated in two steps anodizing from aluminum foil. The first anodization of aluminum foil was performed in 0.2 mol L-1 H2C2O4 followed by removal of the formed porous oxide film by a solution of 6 wt% of phosphoric acid. The second anodization step was then performed using the same conditions as the previous step. Scanning electron microscope (SEM and X-ray diffraction (XRD method were employed to characterize the resulting highly oriented uniform hollow tube array which its diameter was in the range of 25-75 nm depending on the applied voltage and the length of nanotubes was equal to the thickness of AAO which was about 2 m. The growth properties of the ZnPCNF NTs array film can be achieved by controlling the structure of the template and applied potential across the cell.

  3. Rapid simulation of spatial epidemics: a spectral method.

    Science.gov (United States)

    Brand, Samuel P C; Tildesley, Michael J; Keeling, Matthew J

    2015-04-07

    Spatial structure and hence the spatial position of host populations plays a vital role in the spread of infection. In the majority of situations, it is only possible to predict the spatial spread of infection using simulation models, which can be computationally demanding especially for large population sizes. Here we develop an approximation method that vastly reduces this computational burden. We assume that the transmission rates between individuals or sub-populations are determined by a spatial transmission kernel. This kernel is assumed to be isotropic, such that the transmission rate is simply a function of the distance between susceptible and infectious individuals; as such this provides the ideal mechanism for modelling localised transmission in a spatial environment. We show that the spatial force of infection acting on all susceptibles can be represented as a spatial convolution between the transmission kernel and a spatially extended 'image' of the infection state. This representation allows the rapid calculation of stochastic rates of infection using fast-Fourier transform (FFT) routines, which greatly improves the computational efficiency of spatial simulations. We demonstrate the efficiency and accuracy of this fast spectral rate recalculation (FSR) method with two examples: an idealised scenario simulating an SIR-type epidemic outbreak amongst N habitats distributed across a two-dimensional plane; the spread of infection between US cattle farms, illustrating that the FSR method makes continental-scale outbreak forecasting feasible with desktop processing power. The latter model demonstrates which areas of the US are at consistently high risk for cattle-infections, although predictions of epidemic size are highly dependent on assumptions about the tail of the transmission kernel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Study on tube rupture strength evaluation method for rapid overheating

    International Nuclear Information System (INIS)

    Komine, Ryuji; Wada, Yusaku

    1998-08-01

    A sodium-water reaction derived from the single tube break in steam generator might overheat neighbor tubes rapidly under internal pressure loadings. If the temperature of tube wall becomes too high, it has to be evaluated that the stress of tube does not exceed the material strength limit to prevent the propagation of tube rupture. In the present study this phenomenon was recognized as the fracture of cylindrical tube with the large deformation due to overheating, and the evaluation method was investigated based on both of experimental and analytical approaches. The results obtained are as follows. (1) As for the nominal stress estimation, it was clarified through the experimental data and the detailed FEM elasto-plastic large deformation analysis that the formula used in conventional designs can be applied. (2) Within the overheating temperature limits of tubes, the creep effect is dominant, even if the loading time is too short. So the strain rate on the basis of JIS elevated temperature tensile test method for steels and heat-resisting alloys is too late and almost of total strain is composed by creep one. As a result the time dependent effect cannot be evaluated under JIS strain rate condition. (3) Creep tests in shorter time condition than a few minutes and tensile tests in higher strain rate condition than 10%/min of JIS are carried out for 2 1/4Cr-1Mo(NT) steel, and the standard values for tube rupture strength evaluation are formulated. (4) The above evaluation method based on both of the stress estimation and the strength standard values application is justified by using the tube burst test data under internal pressure. (5) The strength standard values on Type 321 ss is formulated in accordance with the procedure applied for 2 1/4Cr-1Mo(NT) steel. (author)

  5. Rapid preparation method for technetium-99m bicisate

    Energy Technology Data Exchange (ETDEWEB)

    Hung, J.C. [Nuclear Medicine, Department of Diagnostic Radiology, Mayo Clinic, Rochester, Minnesota (United States); Chowdhury, S. [Nuclear Medicine, Department of Diagnostic Radiology, Mayo Clinic, Rochester, Minnesota (United States); Redfern, M.G. [Nuclear Medicine, Department of Diagnostic Radiology, Mayo Clinic, Rochester, Minnesota (United States); Mahoney, D.W. [Section of Biostatistics, Department of Health Sciences Research, Mayo Clinic, Rochester, Minnesota (United States)

    1997-06-10

    The method currently recommended for the preparation of technetium-99m bicisate ({sup 99m}Tc-bicisate) requires a lengthy 30-min incubation at room temperature. The purpose of this study was to evaluate an alternative method to shorten the preparation time. {sup 99m}Tc-bicisate was prepared with 3.7 GBq (100 mCi) {sup 99m}Tc according to the manufacturer`s instructions, except for the final incubation step, which was replaced with the microwave heating procedure. A standard thin-layer chromatography (TLC) method (i.e., Baker-Flex silica gel IB-F TLC plate with ethyl acetate as mobile phase) was used for the determination of the radiochemical purity (RCP) of {sup 99m}Tc-bicisate. Our evaluation with different microwave heating processes (300 W with different heating times) demonstrated that as the microwave heating temperature was increased (i.e., 44 -71 C), an increased percentage of samples reached 95% within 5 min post preparation (n=58). The highest RCP value (i.e., 97.4%{+-}0.5%, n=10) could be obtained immediately after an 8-s microwave heating time at 300 W (microwave temperature at 69 C), and an average RCP value of 96.4%{+-}1.3% (n=90) was maintained throughout the 24-h evaluation period. However, the trend seemed to reverse at higher microwave temperatures (i.e., 76 -90 C), which reconfirmed our initial findings that overheating had no benefit for the preparation of {sup 99m}Tc-bicisate. To ensure that temperature was the only determining factor, a hot water incubator set at 69 C was used (n=6). Similar RCP results were achieved. In conclusion, the use of a microwave oven at a low heat cycle provides a rapid and efficient way to prepare {sup 99m}Tc-bicisate. (orig.). With 3 figs., 1 tab.

  6. Note: Non-invasive optical method for rapid determination of alignment degree of oriented nanofibrous layers

    Energy Technology Data Exchange (ETDEWEB)

    Pokorny, M.; Rebicek, J. [R& D Department, Contipro Biotech s.r.o., 561 02 Dolni Dobrouc (Czech Republic); Klemes, J. [R& D Department, Contipro Pharma a.s., 561 02 Dolni Dobrouc (Czech Republic); Kotzianova, A. [R& D Department, Contipro Pharma a.s., 561 02 Dolni Dobrouc (Czech Republic); Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5, CZ-62500 Brno (Czech Republic); Velebny, V. [R& D Department, Contipro Biotech s.r.o., 561 02 Dolni Dobrouc (Czech Republic); R& D Department, Contipro Pharma a.s., 561 02 Dolni Dobrouc (Czech Republic)

    2015-10-15

    This paper presents a rapid non-destructive method that provides information on the anisotropic internal structure of nanofibrous layers. A laser beam of a wavelength of 632.8 nm is directed at and passes through a nanofibrous layer prepared by electrostatic spinning. Information about the structural arrangement of nanofibers in the layer is directly visible in the form of a diffraction image formed on a projection screen or obtained from measured intensities of the laser beam passing through the sample which are determined by the dependency of the angle of the main direction of polarization of the laser beam on the axis of alignment of nanofibers in the sample. Both optical methods were verified on Polyvinyl alcohol (PVA) nanofibrous layers (fiber diameter of 470 nm) with random, single-axis aligned and crossed structures. The obtained results match the results of commonly used methods which apply the analysis of electron microscope images. The presented simple method not only allows samples to be analysed much more rapidly and without damaging them but it also makes possible the analysis of much larger areas, up to several square millimetres, at the same time.

  7. Note: Non-invasive optical method for rapid determination of alignment degree of oriented nanofibrous layers

    International Nuclear Information System (INIS)

    Pokorny, M.; Rebicek, J.; Klemes, J.; Kotzianova, A.; Velebny, V.

    2015-01-01

    This paper presents a rapid non-destructive method that provides information on the anisotropic internal structure of nanofibrous layers. A laser beam of a wavelength of 632.8 nm is directed at and passes through a nanofibrous layer prepared by electrostatic spinning. Information about the structural arrangement of nanofibers in the layer is directly visible in the form of a diffraction image formed on a projection screen or obtained from measured intensities of the laser beam passing through the sample which are determined by the dependency of the angle of the main direction of polarization of the laser beam on the axis of alignment of nanofibers in the sample. Both optical methods were verified on Polyvinyl alcohol (PVA) nanofibrous layers (fiber diameter of 470 nm) with random, single-axis aligned and crossed structures. The obtained results match the results of commonly used methods which apply the analysis of electron microscope images. The presented simple method not only allows samples to be analysed much more rapidly and without damaging them but it also makes possible the analysis of much larger areas, up to several square millimetres, at the same time

  8. Limit State of Materials and Structures Direct Methods 2

    CERN Document Server

    Oueslati, Abdelbacet; Charkaluk, Eric; Tritsch, Jean-Bernard

    2013-01-01

    To determine the carrying capacity of a structure or a structural element susceptible to operate beyond the elastic limit is an important task in many situations of both mechanical and civil engineering. The so-called “direct methods” play an increasing role due to the fact that they allow rapid access to the request information in mathematically constructive manners. They embrace Limit Analysis, the most developed approach now widely used, and Shakedown Analysis, a powerful extension to the variable repeated loads potentially more economical than step-by-step inelastic analysis. This book is the outcome of a workshop held at the University of Sciences and Technology of Lille. The individual contributions stem from the areas of new numerical developments rendering these methods more attractive for industrial design, extension of the general methodology to new horizons, probabilistic approaches and concrete technological applications.

  9. Direct measurement of tritium in urine by liquid scintillation method

    International Nuclear Information System (INIS)

    Zhang Caihong; Wen Qinghua; Chen Kefei; Li Huaixin

    1999-01-01

    The author introduces the method for direct measurement of tritium concentration in urine using liquid scintillation. Effects of sampling containers, store patterns and storage time are studied. Meanwhile, results of two methods are compared with direct measurement method and oxidation distillation method. The results shows that direct measurement method is a economic and simple method, which can meet the need of determination of urine tritium for NPP workers. There is no significant difference compared with the data obtained by oxidation distillation method

  10. Rapid Methods for the Laboratory Identification of Pathogenic Microorganisms.

    Science.gov (United States)

    1982-09-01

    coli Hemophilus influenzae Bacillus anthracis Bacillus circulans Bacillus coagulans Bacillus cereus T Candida albicans Cryptococcus neoformans Legionel...reveree aide If neceeeary and Identify by block number) Lectins: Rapid Identification, Bacillus anthracisjCryptococcus " neoformans. Neisseria...field-type kit for the rapid identification of Bacillus anthracis. We have shown that certain lectins will selectively interact with B. anthracis

  11. Rapid, directed transport of DC-SIGN clusters in the plasma membrane.

    Science.gov (United States)

    Liu, Ping; Weinreb, Violetta; Ridilla, Marc; Betts, Laurie; Patel, Pratik; de Silva, Aravinda M; Thompson, Nancy L; Jacobson, Ken

    2017-11-01

    C-type lectins, including dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin (DC-SIGN), are all-purpose pathogen receptors that exist in nanoclusters in plasma membranes of dendritic cells. A small fraction of these clusters, obvious from the videos, can undergo rapid, directed transport in the plane of the plasma membrane at average speeds of more than 1 μm/s in both dendritic cells and MX DC-SIGN murine fibroblasts ectopically expressing DC-SIGN. Surprisingly, instantaneous speeds can be considerably greater. In MX DC-SIGN cells, many cluster trajectories are colinear with microtubules that reside close to the ventral membrane, and the microtubule-depolymerizing drug, nocodazole, markedly reduced the areal density of directed movement trajectories, suggesting a microtubule motor-driven transport mechanism; by contrast, latrunculin A, which affects the actin network, did not depress this movement. Rapid, retrograde movement of DC-SIGN may be an efficient mechanism for bringing bound pathogen on the leading edge and projections of dendritic cells to the perinuclear region for internalization and processing. Dengue virus bound to DC-SIGN on dendritic projections was rapidly transported toward the cell center. The existence of this movement within the plasma membrane points to an unexpected lateral transport mechanism in mammalian cells and challenges our current concepts of cortex-membrane interactions.

  12. Stability by Liapunov's direct methods with applications

    CERN Document Server

    Salle, Joseph La

    1961-01-01

    In this book, we study theoretical and practical aspects of computing methods for mathematical modelling of nonlinear systems. A number of computing techniques are considered, such as methods of operator approximation with any given accuracy; operator interpolation techniques including a non-Lagrange interpolation; methods of system representation subject to constraints associated with concepts of causality, memory and stationarity; methods of system representation with an accuracy that is the best within a given class of models; methods of covariance matrix estimation;methods for low-rank mat

  13. Monitoring of radioiodine and methods for rapid measurement, 2

    International Nuclear Information System (INIS)

    Kamada, Hiroshi

    1979-01-01

    Milk is selected as an indicator or critical food in the environmental monitoring samples, and radioactive iodine as a specific critical radionuclide. Rapid determination of Iodine-131 in the milk has been developed as a standard procedure for the network of environmental radioactivity monitoring in a state of emergency. Outline of the procedure is gamma-ray spectrometry using a heavily shielded 3''diameter x 3'' sodium iodide (thallium-activated) crystal as a detector, 2 liter of Marinelli Beaker for a raw milk and a multi channel pulse height analyzer for quantitative analysis of gamma spectra through the utilization of simultaneous equations. The analysis is what we call ''Milk Matrix Method'' introducing calibration data from the standard samples of Iodine-131, Cesium-137 and Potassium-40. They were selected experimentally, and counting data from the sample were taken into the elements of matrix of set up three simultaneous equations. Most recently detected concentration of Iodine-131 in milk was 81 pCi per liter in 20 May 1978, originated from the nuclear explosion test carried out by the People's Republic of China in 15 May 1978. (author)

  14. A rapid method of evaluating fluoroscopic system performance

    International Nuclear Information System (INIS)

    Sprawls, P.

    1989-01-01

    This paper presents a study to develop a method for the rapid evaluation and documentation of fluoroscopic image quality. All objects contained within a conventional contrast-detail test phantom (Leeds TO-10) are displayed in an array format according to their contrast and size. A copy of the display is used as the data collection form and a permanent record of system performance. A fluoroscope is evaluated by viewing the test phantom and marking the visible objects on the display. A line drawn through the objects with minimum visibility in each size group forms a contrast-detail curve for the system. This is compared with a standard or reference line, which is in the display.Deviations in curve position are useful indicators of specific image quality problems, such as excessive noise or blurring. The use of a special object-visibility array format display makes it possible to collect data, analyze the results, and create a record of fluoroscopic performance in less than 2 minutes for each viewing mode

  15. Collaborative validation of a rapid method for efficient virus concentration in bottled water

    DEFF Research Database (Denmark)

    Schultz, Anna Charlotte; Perelle, Sylvie; Di Pasquale, Simona

    2011-01-01

    . Three newly developed methods, A, B and C, for virus concentration in bottled water were compared against the reference method D: (A) Convective Interaction Media (CIM) monolithic chromatography; filtration of viruses followed by (B) direct lysis of viruses on membrane; (C) concentration of viruses......Enteric viruses, including norovirus (NoV) and hepatitis A virus (HAV), have emerged as a major cause of waterborne outbreaks worldwide. Due to their low infectious doses and low concentrations in water samples, an efficient and rapid virus concentration method is required for routine control...... by ultracentrifugation; and (D) concentration of viruses by ultrafiltration, for each methods' (A, B and C) efficacy to recover 10-fold dilutions of HAV and feline calicivirus (FCV) spiked in bottles of 1.5L of mineral water. Within the tested characteristics, all the new methods showed better performance than method D...

  16. Application of Rapid Prototyping Methods to High-Speed Wind Tunnel Testing

    Science.gov (United States)

    Springer, A. M.

    1998-01-01

    This study was undertaken in MSFC's 14-Inch Trisonic Wind Tunnel to determine if rapid prototyping methods could be used in the design and manufacturing of high speed wind tunnel models in direct testing applications, and if these methods would reduce model design/fabrication time and cost while providing models of high enough fidelity to provide adequate aerodynamic data, and of sufficient strength to survive the test environment. Rapid prototyping methods utilized to construct wind tunnel models in a wing-body-tail configuration were: fused deposition method using both ABS plastic and PEEK as building materials, stereolithography using the photopolymer SL-5170, selective laser sintering using glass reinforced nylon, and laminated object manufacturing using plastic reinforced with glass and 'paper'. This study revealed good agreement between the SLA model, the metal model with an FDM-ABS nose, an SLA nose, and the metal model for most operating conditions, while the FDM-ABS data diverged at higher loading conditions. Data from the initial SLS model showed poor agreement due to problems in post-processing, resulting in a different configuration. A second SLS model was tested and showed relatively good agreement. It can be concluded that rapid prototyping models show promise in preliminary aerodynamic development studies at subsonic, transonic, and supersonic speeds.

  17. Direct current power delivery system and method

    Science.gov (United States)

    Zhang, Di; Garces, Luis Jose; Dai, Jian; Lai, Rixin

    2016-09-06

    A power transmission system includes a first unit for carrying out the steps of receiving high voltage direct current (HVDC) power from an HVDC power line, generating an alternating current (AC) component indicative of a status of the first unit, and adding the AC component to the HVDC power line. Further, the power transmission system includes a second unit for carrying out the steps of generating a direct current (DC) voltage to transfer the HVDC power on the HVDC power line, wherein the HVDC power line is coupled between the first unit and the second unit, detecting a presence or an absence of the added AC component in the HVDC power line, and determining the status of the first unit based on the added AC component.

  18. Benchmarking electrical methods for rapid estimation of root biomass.

    Science.gov (United States)

    Postic, François; Doussan, Claude

    2016-01-01

    To face climate change and subsequent rainfall instabilities, crop breeding strategies now include root traits phenotyping. Rapid estimation of root traits in controlled conditions can be achieved by using parallel electrical capacitance and its linear correlation with root dry mass. The aim of the present study was to improve robustness and efficiency of methods based on capacitance and other electrical variables, such as serial/parallel resistance, conductance, impedance or reactance. Using different electrode configurations and stem contact electrodes, we have measured the electrical impedance spectra of wheat plants grown in pots filled with three types of soil. For each configuration, parallel capacitance and other linearly independent electrical variables were computed and their quality as root dry mass estimator was evaluated by a 'sensitivity score' that we derived from Pearson's correlation coefficient r and linear regression parameters. The highest sensitivity score was obtained by parallel capacitance at an alternating current frequency of 116 Hz in three-terminal configuration. Using a clamp, instead of a needle, as a stem electrode did not significantly affect the capacitance measurements. Finally, in handheld LCR meter equivalent conditions, capacitance had the highest sensitivity score and determination coefficient (r (2) = 0.52) at 10 kHz frequency. Our benchmarking of linear correlations between different electrical variables and root dry mass enables to determine more coherent practices for ensuring a sensitive and robust root dry mass estimation, including in handheld LCR meter conditions. This would enhance the value of electrical capacitance as a tool for screening crops in relation with root systems in breeding programs.

  19. A new rapid method for rockfall energies and distances estimation

    Science.gov (United States)

    Giacomini, Anna; Ferrari, Federica; Thoeni, Klaus; Lambert, Cedric

    2016-04-01

    and distances at the base to block and slope features. The validation of the proposed approach was conducted by comparing predictions to experimental data collected in the field and gathered from the scientific literature. The method can be used for both natural and constructed slopes and easily extended to more complicated and articulated slope geometries. The study shows its great potential for a quick qualitative hazard assessment providing indication about impact energy and horizontal distance of the first impact at the base of a rock cliff. Nevertheless, its application cannot substitute a more detailed quantitative analysis required for site-specific design of mitigation measures. Acknowledgements The authors gratefully acknowledge the financial support of the Australian Coal Association Research Program (ACARP). References Dorren, L.K.A. (2003) A review of rockfall mechanics and modelling approaches, Progress in Physical Geography 27(1), 69-87. Agliardi, F., Crosta, G.B., Frattini, P. (2009) Integrating rockfall risk assessment and countermeasure design by 3D modelling techniques. Natural Hazards and Earth System Sciences 9(4), 1059-1073. Ferrari, F., Thoeni, K., Giacomini, A., Lambert, C. (2016) A rapid approach to estimate the rockfall energies and distances at the base of rock cliffs. Georisk, DOI: 10.1080/17499518.2016.1139729.

  20. Numerical Methods Application for Reinforced Concrete Elements-Theoretical Approach for Direct Stiffness Matrix Method

    Directory of Open Access Journals (Sweden)

    Sergiu Ciprian Catinas

    2015-07-01

    Full Text Available A detailed theoretical and practical investigation of the reinforced concrete elements is due to recent techniques and method that are implemented in the construction market. More over a theoretical study is a demand for a better and faster approach nowadays due to rapid development of the calculus technique. The paper above will present a study for implementing in a static calculus the direct stiffness matrix method in order capable to address phenomena related to different stages of loading, rapid change of cross section area and physical properties. The method is a demand due to the fact that in our days the FEM (Finite Element Method is the only alternative to such a calculus and FEM are considered as expensive methods from the time and calculus resources point of view. The main goal in such a method is to create the moment-curvature diagram in the cross section that is analyzed. The paper above will express some of the most important techniques and new ideas as well in order to create the moment curvature graphic in the cross sections considered.

  1. Future directions in shielding methods and analysis

    International Nuclear Information System (INIS)

    Goldstein, H.

    1987-01-01

    Over the nearly half century history of shielding against reactor radiation, there has been a see-saw battle between theory and measurement. During that period the capability and accuracy of calculational methods have been enormously improved. The microscopic cross sections needed as input to the theoretical computations are now also known to adequate accuracy (with certain exceptions). Nonetheless, there remain substantial classes of shielding problems not yet accessible to satisfactory computational methods, particularly where three-dimensional geometries are involved. This paper discusses promising avenues to approach such problems, especially in the light of recent and expected advances in supercomputers. In particular, it seems that Monte Carlo methods should be much more advantageous in the new computer environment than they have been in the past

  2. Direct methods for seismic profiling. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Bleistein, N.; Cohen, J.K.; Hagin, F.G.

    1979-12-12

    A coordinated research program in inverse problems was concluded. The program evolved from formulation to analytical solution to implemented computer algorithms. There were two main lines of research in this program: a velocity inversion method, with application to seismic exploration, and a physical optics inverse scattering method for reflector mapping, with application to nondestructive evaluation. In each case, computer algorithms based on the theoretical results were tested on real or testbed data from the area of the cited application. Research goals of both a theoretical and practical nature were achieved. 34 figures.

  3. Rapid method for identification of transgenic fish zygosity

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-07-01

    Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

  4. Rapid determination of ginkgolic acids in Ginkgo biloba kernels and leaves by direct analysis in real time-mass spectrometry.

    Science.gov (United States)

    Huang, Zhongping; Xu, Yueting; Huang, Yilei; Liu, Charles; Jiang, Kezhi; Wang, Lili

    2017-12-01

    A novel method based on direct analysis in real time integrated with mass spectrometry was established and applied into rapid determination of ginkgolic acids in Ginkgo biloba kernels and leaves. Instrument parameter settings were optimized to obtain the sensitive and accurate determination of ginkgolic acids. At the sample introduction speed of 0.2 mm/s, high intensity of [M-H] - ions for ginkgolic acids were observed in the negative ion mode by utilization of high-purity helium gas at 450°C. Two microliters of methanol extract of G. biloba kernels or leaves dropped on the surface of Quick-Strip module was analyzed after solvent evaporated to dryness. A series of standard solutions of ginkgolic acid 13:0 in the range of 2-50 mg/L were analyzed with a correlation coefficient r = 0.9981 and relative standard deviation (n = 5) from 12.5 to 13.7%. The limit of detection was 0.5 mg/L. The results of direct analysis in real time-mass spectrometry were in agreement with those observed by thermochemolysis gas chromatography. The proposed method demonstrated significant potential in the application of the high-throughput screening and rapid analysis for ginkgolic acids in dietary supplements. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Petrifilm rapid S. aureus Count Plate method for rapid enumeration of Staphylococcus aureus in selected foods: collaborative study.

    Science.gov (United States)

    Silbernagel, K M; Lindberg, K G

    2001-01-01

    A rehydratable dry-film plating method for Staphylococcus aureus in foods, the 3M Petrifilm Rapid S. aureus Count Plate method, was compared with AOAC Official Method 975.55 (Staphylococcus aureus in Foods). Nine foods-instant nonfat dried milk, dry seasoned vegetable coating, frozen hash browns, frozen cooked chicken patty, frozen ground raw pork, shredded cheddar cheese, fresh green beans, pasta filled with beef and cheese, and egg custard-were analyzed for S. aureus by 13 collaborating laboratories. For each food tested, the collaborators received 8 blind test samples consisting of a control sample and 3 levels of inoculated test sample, each in duplicate. The mean log counts for the methods were comparable for pasta filled with beef and cheese; frozen hash browns; cooked chicken patty; egg custard; frozen ground raw pork; and instant nonfat dried milk. The repeatability and reproducibility variances of the Petrifilm Rapid S. aureus Count Plate method were similar to those of the standard method.

  6. Rapid methods for measuring radionuclides in food and environmental samples

    International Nuclear Information System (INIS)

    Perkins, Richard W.

    1995-01-01

    The application of ICP/mass spectrometry for the isotopic analysis of environmental samples, the use of drum assayers for measuring radionuclides in food and a rapid procedure for the measurement of the transuranic elements and thorium, performed at the Pacific Northwest Laboratory are discussed

  7. Rapid filling of pipelines with the SPH particle method

    NARCIS (Netherlands)

    Hou, Q.; Zhang, L.X.; Tijsseling, A.S.; Kruisbrink, A.C.H.

    2011-01-01

    The paper reports the development and application of a SPH (smoothed particle hydrodynamics) based simulation of rapid filling of pipelines, for which the rigid-column model is commonly used. In this paper the water-hammer equations with a moving boundary are used to model the pipe filling process,

  8. Rapid filling of pipelines with the SPH particle method

    NARCIS (Netherlands)

    Hou, Q.; Zhang, L.X.; Tijsseling, A.S.; Kruisbrink, A.C.H.

    2012-01-01

    The paper reports the development and application of a SPH (smoothed particle hydrodynamics) based simulation of rapid filling of pipelines, for which the rigid-column model is commonly used. In this paper the water-hammer equations with a moving boundary are used to model the pipe filling process,

  9. Resistivity measurements using a direct current induction method (1963)

    International Nuclear Information System (INIS)

    Delaplace, J.; Hillairet, J.

    1964-01-01

    The conventional methods for measuring electrical resistivities necessitate the fixing of electrical contacts on the sample either mechanically or by soldering. Furthermore it is also necessary to carry,out the measurements on low cross-section samples which are not always easy to obtain. Our direct-current induction method on the other hand requires no contacts and can easily be applied to samples of large cross-section. The sample is placed in a uniform magnetic field; at the moment when the current is cut, eddy currents appear in the sample which tend to oppose the disappearance of the field. The way in which the magnetic flux decreases in the sample makes it possible to determine the resistivity of the material. This method has been applied to samples having diameters of between 1 and 30 mm in the case of metals which are good conductors. It gives a value for the local resistivity and makes it possible to detect any variation along a sample. The measurements can be carried out at all temperature from a few degrees absolute to 500 deg. C. We have used the induction method to follow the purification of beryllium by zone-melting; it is in effect possible to estimate the purity of a material by resistivity measurements. We have measured the resistivity along each bar treated by the zone-melting technique and have thus, localised the purest section. High temperature measurements have been carried out on uranium carbide and on iron-aluminium alloys. This method constitutes an interesting means of investigation the resistivity of solid materials. Its accuracy and rapidity make it particularly adapted both to fundamental research and to production control. (authors) [fr

  10. Rapid Determination of Clenbuterol in Pork by Direct Immersion Solid-Phase Microextraction Coupled with Gas Chromatography-Mass Spectrometry.

    Science.gov (United States)

    Ye, Diru; Wu, Susu; Xu, Jianqiao; Jiang, Ruifen; Zhu, Fang; Ouyang, Gangfeng

    2016-02-01

    Direct immersion solid-phase microextraction (DI-SPME) coupled with gas chromatography-mass spectrometry (GC-MS) was developed for rapid analysis of clenbuterol in pork for the first time. In this work, a low-cost homemade 44 µm polydimethylsiloxane (PDMS) SPME fiber was employed to extract clenbuterol in pork. After extraction, derivatization was performed by suspending the fiber in the headspace of the 2 mL sample vial saturated with a vapor of 100 µL hexamethyldisilazane. Lastly, the fiber was directly introduced to GC-MS for analysis. All parameters that influenced absorption (extraction time), derivatization (derivatization reagent, time and temperature) and desorption (desorption time) were optimized. Under optimized conditions, the method offered a wide linear range (10-1000 ng g(-1)) and a low detection limit (3.6 ng g(-1)). Finally, the method was successfully applied in the analysis of pork from the market, and recoveries of the method for spiked pork were 97.4-105.7%. Compared with the traditional solvent extraction method, the proposed method was much cheaper and fast. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Rapid changes in gene expression direct rapid shifts in intestinal form and function in the Burmese python after feeding

    OpenAIRE

    Andrew, Audra L.; Card, Daren C.; Ruggiero, Robert P.; Schield, Drew R.; Adams, Richard H.; Pollock, David D.; Secor, Stephen M.; Castoe, Todd A.

    2015-01-01

    Snakes provide a unique and valuable model system for studying the extremes of physiological remodeling because of the ability of some species to rapidly upregulate organ form and function upon feeding. The predominant model species used to study such extreme responses has been the Burmese python because of the extreme nature of postfeeding response in this species. We analyzed the Burmese python intestine across a time series, before, during, and after feeding to understand the patterns and ...

  12. Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

    OpenAIRE

    Foltz, LP; Clegg, DO

    2017-01-01

    We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing a detailed and thorough protocol is to clearly demonstrate each step and to make this readily available to researchers in the field. This protocol results in a homogenous layer of RPE with minimal or no manual dissection needed. The method presented here has been shown to be effective for induced pluripotent stem cells (iPSC) and human embry...

  13. Rapid monitoring of soil, smears, and air dusts by direct large-area alpha spectrometry

    International Nuclear Information System (INIS)

    Sill, C.W.

    1992-01-01

    Experimental conditions to permit rapid monitoring of soils, smears, and air dusts for transuranic (TRU) radionuclides under field conditions are described. The monitoring technique involves direct measurement of alpha emitters by alpha spectrometry using a large-area detector to identify and quantify the radionuclides present. The direct alpha spectrometry employs a circular gridded ionization chamber 35 cm in diameter which accommodates either a circular sample holder 25 cm in diameter or a rectangular one 20 by 25 cm (8 by 10 in.). Soils or settled dusts are finely ground, suspended in 30% ethanol, and sprayed onto a 25-cm stainless steel dish. Air dusts are collected with a high-volume sampler onto 20- by 25-cm membrane filters. Removable contamination is collected from surfaces onto a 20- by 25-cm filter using an 18-cm (7-in.) paint roller to hold the large filter in contact with the surface during sample collection. All three types of samples are then counted directly in the alpha spectrometer and no other sample preparation is necessary. Some results obtained are described

  14. Rapid process development of chromatographic process using direct analysis in real time mass spectrometry as a process analytical technology tool.

    Science.gov (United States)

    Yan, Binjun; Chen, Teng; Xu, Zhilin; Qu, Haibin

    2014-06-01

    The concept of quality by design (QbD) is widely applied in the process development of pharmaceuticals. However, the additional cost and time have caused some resistance about QbD implementation. To show a possible solution, this work proposed a rapid process development method, which used direct analysis in real time mass spectrometry (DART-MS) as a process analytical technology (PAT) tool for studying the chromatographic process of Ginkgo biloba L., as an example. The breakthrough curves were fast determined by DART-MS at-line. A high correlation coefficient of 0.9520 was found between the concentrations of ginkgolide A determined by DART-MS and HPLC. Based on the PAT tool, the impacts of process parameters on the adsorption capacity were discovered rapidly, which showed a decreased adsorption capacity with the increase of the flow rate. This work has shown the feasibility and advantages of integrating PAT into QbD implementation for rapid process development. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Development of a new protocol for rapid bacterial identification and susceptibility testing directly from urine samples.

    Science.gov (United States)

    Zboromyrska, Y; Rubio, E; Alejo, I; Vergara, A; Mons, A; Campo, I; Bosch, J; Marco, F; Vila, J

    2016-06-01

    The current gold standard method for the diagnosis of urinary tract infections (UTI) is urine culture that requires 18-48 h for the identification of the causative microorganisms and an additional 24 h until the results of antimicrobial susceptibility testing (AST) are available. The aim of this study was to shorten the time of urine sample processing by a combination of flow cytometry for screening and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) for bacterial identification followed by AST directly from urine. The study was divided into two parts. During the first part, 675 urine samples were processed by a flow cytometry device and a cut-off value of bacterial count was determined to select samples for direct identification by MALDI-TOF-MS at ≥5 × 10(6) bacteria/mL. During the second part, 163 of 1029 processed samples reached the cut-off value. The sample preparation protocol for direct identification included two centrifugation and two washing steps. Direct AST was performed by the disc diffusion method if a reliable direct identification was obtained. Direct MALDI-TOF-MS identification was performed in 140 urine samples; 125 of the samples were positive by urine culture, 12 were contaminated and 3 were negative. Reliable direct identification was obtained in 108 (86.4%) of the 125 positive samples. AST was performed in 102 identified samples, and the results were fully concordant with the routine method among 83 monomicrobial infections. In conclusion, the turnaround time of the protocol described to diagnose UTI was about 1 h for microbial identification and 18-24 h for AST. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  16. Rapid bioassay method for estimation of 90Sr in urine samples by liquid scintillation counting

    International Nuclear Information System (INIS)

    Wankhede, Sonal; Chaudhary, Seema; Sawant, Pramilla D.

    2018-01-01

    Radiostrontium (Sr) is a by-product of the nuclear fission of uranium and plutonium in nuclear reactors and is an important radionuclide in spent nuclear fuel and radioactive waste. Rapid bioassay methods are required for estimating Sr in urine following internal contamination. Decision regarding medical intervention, if any can be based upon the results of urinalysis. The present method used at Bioassay Laboratory, Trombay is by Solid Extraction Chromatography (SEC) technique. The Sr separated from urine sample is precipitated as SrCO 3 and analyzed gravimetrically. However, gravimetric procedure is time consuming and therefore, in the present study, feasibility of Liquid Scintillation Counting for direct detection of radiostrontium in effluent was explored. The results obtained in the present study were compared with those obtained using gravimetric method

  17. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  18. An automated robotic platform for rapid profiling oligosaccharide analysis of monoclonal antibodies directly from cell culture.

    Science.gov (United States)

    Doherty, Margaret; Bones, Jonathan; McLoughlin, Niaobh; Telford, Jayne E; Harmon, Bryan; DeFelippis, Michael R; Rudd, Pauline M

    2013-11-01

    Oligosaccharides attached to Asn297 in each of the CH2 domains of monoclonal antibodies play an important role in antibody effector functions by modulating the affinity of interaction with Fc receptors displayed on cells of the innate immune system. Rapid, detailed, and quantitative N-glycan analysis is required at all stages of bioprocess development to ensure the safety and efficacy of the therapeutic. The high sample numbers generated during quality by design (QbD) and process analytical technology (PAT) create a demand for high-performance, high-throughput analytical technologies for comprehensive oligosaccharide analysis. We have developed an automated 96-well plate-based sample preparation platform for high-throughput N-glycan analysis using a liquid handling robotic system. Complete process automation includes monoclonal antibody (mAb) purification directly from bioreactor media, glycan release, fluorescent labeling, purification, and subsequent ultra-performance liquid chromatography (UPLC) analysis. The entire sample preparation and commencement of analysis is achieved within a 5-h timeframe. The automated sample preparation platform can easily be interfaced with other downstream analytical technologies, including mass spectrometry (MS) and capillary electrophoresis (CE), for rapid characterization of oligosaccharides present on therapeutic antibodies. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Efficient 3D frequency response modeling with spectral accuracy by the rapid expansion method

    KAUST Repository

    Chu, Chunlei

    2012-07-01

    Frequency responses of seismic wave propagation can be obtained either by directly solving the frequency domain wave equations or by transforming the time domain wavefields using the Fourier transform. The former approach requires solving systems of linear equations, which becomes progressively difficult to tackle for larger scale models and for higher frequency components. On the contrary, the latter approach can be efficiently implemented using explicit time integration methods in conjunction with running summations as the computation progresses. Commonly used explicit time integration methods correspond to the truncated Taylor series approximations that can cause significant errors for large time steps. The rapid expansion method (REM) uses the Chebyshev expansion and offers an optimal solution to the second-order-in-time wave equations. When applying the Fourier transform to the time domain wavefield solution computed by the REM, we can derive a frequency response modeling formula that has the same form as the original time domain REM equation but with different summation coefficients. In particular, the summation coefficients for the frequency response modeling formula corresponds to the Fourier transform of those for the time domain modeling equation. As a result, we can directly compute frequency responses from the Chebyshev expansion polynomials rather than the time domain wavefield snapshots as do other time domain frequency response modeling methods. When combined with the pseudospectral method in space, this new frequency response modeling method can produce spectrally accurate results with high efficiency. © 2012 Society of Exploration Geophysicists.

  20. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    Science.gov (United States)

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  1. An Extended Multilocus Sequence Typing (MLST Scheme for Rapid Direct Typing of Leptospira from Clinical Samples.

    Directory of Open Access Journals (Sweden)

    Sabrina Weiss

    2016-09-01

    Full Text Available Rapid typing of Leptospira is currently impaired by requiring time consuming culture of leptospires. The objective of this study was to develop an assay that provides multilocus sequence typing (MLST data direct from patient specimens while minimising costs for subsequent sequencing.An existing PCR based MLST scheme was modified by designing nested primers including anchors for facilitated subsequent sequencing. The assay was applied to various specimen types from patients diagnosed with leptospirosis between 2014 and 2015 in the United Kingdom (UK and the Lao Peoples Democratic Republic (Lao PDR. Of 44 clinical samples (23 serum, 6 whole blood, 3 buffy coat, 12 urine PCR positive for pathogenic Leptospira spp. at least one allele was amplified in 22 samples (50% and used for phylogenetic inference. Full allelic profiles were obtained from ten specimens, representing all sample types (23%. No nonspecific amplicons were observed in any of the samples. Of twelve PCR positive urine specimens three gave full allelic profiles (25% and two a partial profile. Phylogenetic analysis allowed for species assignment. The predominant species detected was L. interrogans (10/14 and 7/8 from UK and Lao PDR, respectively. All other species were detected in samples from only one country (Lao PDR: L. borgpetersenii [1/8]; UK: L. kirschneri [1/14], L. santarosai [1/14], L. weilii [2/14].Typing information of pathogenic Leptospira spp. was obtained directly from a variety of clinical samples using a modified MLST assay. This assay negates the need for time-consuming culture of Leptospira prior to typing and will be of use both in surveillance, as single alleles enable species determination, and outbreaks for the rapid identification of clusters.

  2. [Laboratory diagnosis of genital herpes--direct immunofluorescence method].

    Science.gov (United States)

    Majewska, Anna; Romejko-Wolniewicz, Ewa; Zareba-Szczudlik, Julia; Kilijańczyk, Marek; Gajewska, Małgorzata; Młynarczyk, Grazyna

    2013-07-01

    Aim of the study was to determine clinical usefulness of direct immunofluorescence method in the laboratory diagnosis of genital herpes in women. Overall 187 anogenital swabs were collected from 120 women. Using a dacron-tipped applicator 83 swabs were collected from women suspected of genital herpes and 104 from patients with no signs of genital infection. All samples were tested using cell culture (Vero cell line) and then direct immunofluorescence method (DIF) for the identification of antigens of herpes simplex viruses: HSV-1 and HSV-2. Characteristic cytopathic effect (CPE), indicative of alphaherpesvirus infection, was observed in 43.4% of cultures with clinical specimens collected from women with suspected genital herpes and in 29.8% of cultures of clinical specimens taken from patients with no clinical symptoms of genital herpes. Herpes simplex viruses were determined in 73 samples by direct immunofluorescence method after amplification of the virus in cell culture. The DIF test confirmed the diagnosis based on the microscopic CPE observation in 85%. In 15% of samples (taken from pregnant women without clinical signs of infection) we reported positive immunofluorescence in the absence of CPE. The frequency of antigen detection was statistically significantly higher in samples that were positive by culture study (chi-square test with Yates's correction, p genital herpes in swabs taken from the vestibule of the vagina and the vulva. However, there was no statistically significant difference in the frequency of detection of Herpes Simplex Virus antigens in specimens from different parts of the genital tract in both groups of women (chi-square test, p > 0.05). In our study HHV-1 was the main causative agent of genital herpes. The growing worldwide prevalence of genital herpes, challenges with the clinical diagnosis, and availability of effective antiviral therapy are the main reasons for a growing interest in rapid, proper laboratory diagnosis of infected

  3. Adult subependymal neural precursors, but not differentiated cells, undergo rapid cathodal migration in the presence of direct current electric fields.

    Directory of Open Access Journals (Sweden)

    Robart Babona-Pilipos

    Full Text Available BACKGROUND: The existence of neural stem and progenitor cells (together termed neural precursor cells in the adult mammalian brain has sparked great interest in utilizing these cells for regenerative medicine strategies. Endogenous neural precursors within the adult forebrain subependyma can be activated following injury, resulting in their proliferation and migration toward lesion sites where they differentiate into neural cells. The administration of growth factors and immunomodulatory agents following injury augments this activation and has been shown to result in behavioural functional recovery following stroke. METHODS AND FINDINGS: With the goal of enhancing neural precursor migration to facilitate the repair process we report that externally applied direct current electric fields induce rapid and directed cathodal migration of pure populations of undifferentiated adult subependyma-derived neural precursors. Using time-lapse imaging microscopy in vitro we performed an extensive single-cell kinematic analysis demonstrating that this galvanotactic phenomenon is a feature of undifferentiated precursors, and not differentiated phenotypes. Moreover, we have shown that the migratory response of the neural precursors is a direct effect of the electric field and not due to chemotactic gradients. We also identified that epidermal growth factor receptor (EGFR signaling plays a role in the galvanotactic response as blocking EGFR significantly attenuates the migratory behaviour. CONCLUSIONS: These findings suggest direct current electric fields may be implemented in endogenous repair paradigms to promote migration and tissue repair following neurotrauma.

  4. A two-step method for rapid characterization of electroosmotic flows in capillary electrophoresis.

    Science.gov (United States)

    Zhang, Wenjing; He, Muyi; Yuan, Tao; Xu, Wei

    2017-12-01

    The measurement of electroosmotic flow (EOF) is important in a capillary electrophoresis (CE) experiment in terms of performance optimization and stability improvement. Although several methods exist, there are demanding needs to accurately characterize ultra-low electroosmotic flow rates (EOF rates), such as in coated capillaries used in protein separations. In this work, a new method, called the two-step method, was developed to accurately and rapidly measure EOF rates in a capillary, especially for measuring the ultra-low EOF rates in coated capillaries. In this two-step method, the EOF rates were calculated by measuring the migration time difference of a neutral marker in two consecutive experiments, in which a pressure driven was introduced to accelerate the migration and the DC voltage was reversed to switch the EOF direction. Uncoated capillaries were first characterized by both this two-step method and a conventional method to confirm the validity of this new method. Then this new method was applied in the study of coated capillaries. Results show that this new method is not only fast in speed, but also better in accuracy. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Rapid determination of cholesterol in milk and milk products by direct saponification and capillary gas chromatography.

    Science.gov (United States)

    Fletouris, D J; Botsoglou, N A; Psomas, I E; Mantis, A I

    1998-11-01

    A simple method is described for the determination of cholesterol in milk and milk products. Samples (0.2 g) are saponified in capped tubes with 0.5 M methanolic KOH solution by heating for 15 min at 80 degrees C. Water is added to the mixtures, and the unsaponifiable fractions are extracted with hexane to be further analyzed by capillary gas chromatography. Because of the rapid sample preparation and gas chromatographic procedures, a single sample can be analyzed in 30 min. Overall recovery was 98.6%, and the linearity was excellent for the fortification range examined. Precision data that were based on the variation within and between days suggested an overall relative standard deviation value of 1.4%. The method has been successfully applied to quantitate cholesterol in a variety of milk products.

  6. Rapid radiometric method for detection of Salmonella in foods

    International Nuclear Information System (INIS)

    Stewart, B.J.; Eyles, M.J.; Murrell, W.G.

    1980-01-01

    A radiometric method for the detection of Salmonella in foods has been developed which is based on Salmonella poly H agglutinating serum preventing Salmonella from producing 14CO2 from [14C] dulcitol. The method will detect the presence or absence of Salmonella in a product within 30 h compared to 4 to 5 days by routine culture methods. The method has been evaluated against a routine culture method using 58 samples of food. The overall agreement was 91%. Five samples negative for Salmonella by the routine method were positive by the radiometric method. These may have been false positives. However, the routine method may have failed to detect Salmonella due to the presence of large numbers of lactose-fermenting bacteria which hindered isolation of Salmonella colonies on the selective agar plates

  7. A rapid method to estimate Westergren sedimentation rates.

    Science.gov (United States)

    Alexy, Tamas; Pais, Eszter; Meiselman, Herbert J

    2009-09-01

    The erythrocyte sedimentation rate (ESR) is a nonspecific but simple and inexpensive test that was introduced into medical practice in 1897. Although it is commonly utilized in the diagnosis and follow-up of various clinical conditions, ESR has several limitations including the required 60 min settling time for the test. Herein we introduce a novel use for a commercially available computerized tube viscometer that allows the accurate prediction of human Westergren ESR rates in as little as 4 min. Owing to an initial pressure gradient, blood moves between two vertical tubes through a horizontal small-bore tube and the top of the red blood cell (RBC) column in each vertical tube is monitored continuously with an accuracy of 0.083 mm. Using data from the final minute of a blood viscosity measurement, a sedimentation index (SI) was calculated and correlated with results from the conventional Westergren ESR test. To date, samples from 119 human subjects have been studied and our results indicate a strong correlation between SI and ESR values (R(2)=0.92). In addition, we found a close association between SI and RBC aggregation indices as determined by an automated RBC aggregometer (R(2)=0.71). Determining SI on human blood is rapid, requires no special training and has minimal biohazard risk, thus allowing physicians to rapidly screen for individuals with elevated ESR and to monitor therapeutic responses.

  8. Rapid, Time-Division Multiplexed, Direct Absorption- and Wavelength Modulation-Spectroscopy

    Directory of Open Access Journals (Sweden)

    Alexander Klein

    2014-11-01

    Full Text Available We present a tunable diode laser spectrometer with a novel, rapid time multiplexed direct absorption- and wavelength modulation-spectroscopy operation mode. The new technique allows enhancing the precision and dynamic range of a tunable diode laser absorption spectrometer without sacrificing accuracy. The spectroscopic technique combines the benefits of absolute concentration measurements using calibration-free direct tunable diode laser absorption spectroscopy (dTDLAS with the enhanced noise rejection of wavelength modulation spectroscopy (WMS. In this work we demonstrate for the first time a 125 Hz time division multiplexed (TDM-dTDLAS-WMS spectroscopic scheme by alternating the modulation of a DFB-laser between a triangle-ramp (dTDLAS and an additional 20 kHz sinusoidal modulation (WMS. The absolute concentration measurement via the dTDLAS-technique allows one to simultaneously calibrate the normalized 2f/1f-signal of the WMS-technique. A dTDLAS/WMS-spectrometer at 1.37 µm for H2O detection was built for experimental validation of the multiplexing scheme over a concentration range from 50 to 3000 ppmV (0.1 MPa, 293 K. A precision of 190 ppbV was achieved with an absorption length of 12.7 cm and an averaging time of two seconds. Our results show a five-fold improvement in precision over the entire concentration range and a significantly decreased averaging time of the spectrometer.

  9. Digital Direct-to-Consumer Advertising: A Perfect Storm of Rapid Evolution and Stagnant Regulation

    Science.gov (United States)

    Mackey, Tim K.

    2016-01-01

    The adoption and use of digital forms of direct-to-consumer advertising (also known as "eDTCA") is on the rise. At the same time, the universe of eDTCA is expanding, as technology on Internet-based platforms continues to evolve, from static websites, to social media, and nearly ubiquitous use of mobile devices. However, little is known about how this unique form of pharmaceutical marketing impacts consumer behavior, public health, and overall healthcare utilization. The study by Kim analyzing US Food and Drug Administration (FDA) notices of violations (NOVs) and warning letters regarding online promotional activities takes us in the right direction, but study results raise as many questions as it does answers. Chief among these are unanswered concerns about the unique regulatory challenges posed by the "disruptive" qualities of eDTCA, and whether regulators have sufficient resources and oversight powers to proactively address potential violations. Further, the globalization of eDTCA via borderless Internet-based technologies raises larger concerns about the potential global impact of this form of health marketing unique to only the United States and New Zealand. Collectively, these challenges make it unlikely that regulatory science will be able to keep apace with the continued rapid evolution of eDTCA unless more creative policy solutions are explored. PMID:27239871

  10. Advanced Methods for Direct Ink Write Additive Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Compel, W. S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Lewicki, J. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-24

    Lawrence Livermore National Laboratory is one of the world’s premier labs for research and development of additive manufacturing processes. Out of these many processes, direct ink write (DIW) is arguably one of the most relevant for the manufacture of architected polymeric materials, components and hardware. However, a bottleneck in this pipeline that has largely been ignored to date is the lack of advanced software implementation with respect to toolpath execution. There remains to be a convenient, automated method to design and produce complex parts that is user-friendly and enabling for the realization of next generation designs and structures. For a material to be suitable as a DIW ink it must possess the appropriate rheological properties for this process. Most importantly, the material must exhibit shear-thinning in order to extrude through a print head and have a rapid recovery of its static shear modulus. This makes it possible for the extrudate to be self-supporting upon exiting the print head. While this and other prerequisites narrow the scope of ‘offthe- shelf’ printable materials directly amenable to DIW, the process still tolerates a wide range of potential feedstock materials. These include metallic alloys, inorganic solvent borne dispersions, polymeric melts, filler stabilized monomer compositions, pre-elastomeric feedstocks and thermoset resins each of which requires custom print conditions tailored to the individual ink. As such, an ink perfectly suited for DIW may be prematurely determined to be undesirable for the process if printed under the wrong conditions. Defining appropriate print conditions such as extrusion rate, layer height, and maximum bridge length is a vital first step in validating an ink’s DIW capability.

  11. Rapid changes in gene expression direct rapid shifts in intestinal form and function in the Burmese python after feeding.

    Science.gov (United States)

    Andrew, Audra L; Card, Daren C; Ruggiero, Robert P; Schield, Drew R; Adams, Richard H; Pollock, David D; Secor, Stephen M; Castoe, Todd A

    2015-05-01

    Snakes provide a unique and valuable model system for studying the extremes of physiological remodeling because of the ability of some species to rapidly upregulate organ form and function upon feeding. The predominant model species used to study such extreme responses has been the Burmese python because of the extreme nature of postfeeding response in this species. We analyzed the Burmese python intestine across a time series, before, during, and after feeding to understand the patterns and timing of changes in gene expression and their relationship to changes in intestinal form and function upon feeding. Our results indicate that >2,000 genes show significant changes in expression in the small intestine following feeding, including genes involved in intestinal morphology and function (e.g., hydrolases, microvillus proteins, trafficking and transport proteins), as well as genes involved in cell division and apoptosis. Extensive changes in gene expression occur surprisingly rapidly, within the first 6 h of feeding, coincide with changes in intestinal morphology, and effectively return to prefeeding levels within 10 days. Collectively, our results provide an unprecedented portrait of parallel changes in gene expression and intestinal morphology and physiology on a scale that is extreme both in the magnitude of changes, as well as in the incredibly short time frame of these changes, with up- and downregulation of expression and function occurring in the span of 10 days. Our results also identify conserved vertebrate signaling pathways that modulate these responses, which may suggest pathways for therapeutic modulation of intestinal function in humans. Copyright © 2015 the American Physiological Society.

  12. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  13. Comparing models of rapidly rotating relativistic stars constructed by two numerical methods

    Science.gov (United States)

    Stergioulas, Nikolaos; Friedman, John L.

    1995-05-01

    We present the first direct comparison of codes based on two different numerical methods for constructing rapidly rotating relativistic stars. A code based on the Komatsu-Eriguchi-Hachisu (KEH) method (Komatsu et al. 1989), written by Stergioulas, is compared to the Butterworth-Ipser code (BI), as modified by Friedman, Ipser, & Parker. We compare models obtained by each method and evaluate the accuracy and efficiency of the two codes. The agreement is surprisingly good, and error bars in the published numbers for maximum frequencies based on BI are dominated not by the code inaccuracy but by the number of models used to approximate a continuous sequence of stars. The BI code is faster per iteration, and it converges more rapidly at low density, while KEH converges more rapidly at high density; KEH also converges in regions where BI does not, allowing one to compute some models unstable against collapse that are inaccessible to the BI code. A relatively large discrepancy recently reported (Eriguchi et al. 1994) for models based on Friedman-Pandharipande equation of state is found to arise from the use of two different versions of the equation of state. For two representative equations of state, the two-dimensional space of equilibrium configurations is displayed as a surface in a three-dimensional space of angular momentum, mass, and central density. We find, for a given equation of state, that equilibrium models with maximum values of mass, baryon mass, and angular momentum are (generically) either all unstable to collapse or are all stable. In the first case, the stable model with maximum angular velocity is also the model with maximum mass, baryon mass, and angular momentum. In the second case, the stable models with maximum values of these quantities are all distinct. Our implementation of the KEH method will be available as a public domain program for interested users.

  14. Simplified Method for Rapid Purification of Soluble Histones

    Directory of Open Access Journals (Sweden)

    Nives Ivić

    2016-06-01

    Full Text Available Functional and structural studies of histone-chaperone complexes, nucleosome modifications, their interactions with remodelers and regulatory proteins rely on obtaining recombinant histones from bacteria. In the present study, we show that co-expression of Xenopus laevis histone pairs leads to production of soluble H2AH2B heterodimer and (H3H42 heterotetramer. The soluble histone complexes are purified by simple chromatographic techniques. Obtained H2AH2B dimer and H3H4 tetramer are proficient in histone chaperone binding and histone octamer and nucleosome formation. Our optimized protocol enables rapid purification of multiple soluble histone variants with a remarkable high yield and simplifies histone octamer preparation. We expect that this simple approach will contribute to the histone chaperone and chromatin research. This work is licensed under a Creative Commons Attribution 4.0 International License.

  15. Rapid Identification of Staphylococcus aureus Directly from Blood Cultures by Fluorescence In Situ Hybridization with Peptide Nucleic Acid Probes

    Science.gov (United States)

    Oliveira, Kenneth; Procop, Gary W.; Wilson, Deborah; Coull, James; Stender, Henrik

    2002-01-01

    A new fluorescence in situ hybridization (FISH) method with peptide nucleic acid (PNA) probes for identification of Staphylococcus aureus directly from positive blood culture bottles that contain gram-positive cocci in clusters (GPCC) is described. The test (the S. aureus PNA FISH assay) is based on a fluorescein-labeled PNA probe that targets a species-specific sequence of the 16S rRNA of S. aureus. Evaluations with 17 reference strains and 48 clinical isolates, including methicillin-resistant and methicillin-susceptible S. aureus species, coagulase-negative Staphylococcus species, and other clinically relevant and phylogenetically related bacteria and yeast species, showed that the assay had 100% sensitivity and 96% specificity. Clinical trials with 87 blood cultures positive for GPCC correctly identified 36 of 37 (97%) of the S. aureus-positive cultures identified by standard microbiological methods. The positive and negative predictive values were 100 and 98%, respectively. It is concluded that this rapid method (2.5 h) for identification of S. aureus directly from blood culture bottles that contain GPCC offers important information for optimal antibiotic therapy. PMID:11773123

  16. Extremely rapid directional change during Matuyama-Brunhes geomagnetic polarity reversal

    Science.gov (United States)

    Sagnotti, Leonardo; Scardia, Giancarlo; Giaccio, Biagio; Liddicoat, Joseph C.; Nomade, Sebastien; Renne, Paul R.; Sprain, Courtney J.

    2014-11-01

    We report a palaeomagnetic investigation of the last full geomagnetic field reversal, the Matuyama-Brunhes (M-B) transition, as preserved in a continuous sequence of exposed lacustrine sediments in the Apennines of Central Italy. The palaeomagnetic record provides the most direct evidence for the tempo of transitional field behaviour yet obtained for the M-B transition. 40Ar/39Ar dating of tephra layers bracketing the M-B transition provides high-accuracy age constraints and indicates a mean sediment accumulation rate of about 0.2 mm yr-1 during the transition. Two relative palaeointensity (RPI) minima are present in the M-B transition. During the terminus of the upper RPI minimum, a directional change of about 180 ° occurred at an extremely fast rate, estimated to be less than 2 ° per year, with no intermediate virtual geomagnetic poles (VGPs) documented during the transit from the southern to northern hemisphere. Thus, the entry into the Brunhes Normal Chron as represented by the palaeomagnetic directions and VGPs developed in a time interval comparable to the duration of an average human life, which is an order of magnitude more rapid than suggested by current models. The reported investigation therefore provides high-resolution integrated palaeomagnetic and radioisotopic data that document the fine details of the anatomy and tempo of the M-B transition in Central Italy that in turn are crucial for a better understanding of Earth's magnetic field, and for the development of more sophisticated models that are able to describe its global structure and behaviour.

  17. Fruit bats (Pteropodidae) fuel their metabolism rapidly and directly with exogenous sugars.

    Science.gov (United States)

    Amitai, O; Holtze, S; Barkan, S; Amichai, E; Korine, C; Pinshow, B; Voigt, C C

    2010-08-01

    Previous studies reported that fed bats and birds mostly use recently acquired exogenous nutrients as fuel for flight, rather than endogenous fuels, such as lipids or glycogen. However, this pattern of fuel use may be a simple size-related phenomenon because, to date, only small birds and bats have been studied with respect to the origin of metabolized fuel, and because small animals carry relatively small energy reserves, considering their high mass-specific metabolic rate. We hypothesized that approximately 150 g Egyptian fruit bats (Rousettus aegyptiacus Pteropodidae), which are more than an order of magnitude heavier than previously studied bats, also catabolize dietary sugars directly and exclusively to fuel both rest and flight metabolism. We based our expectation on the observation that these animals rapidly transport ingested dietary sugars, which are absorbed via passive paracellular pathways in the intestine, to organs of high energy demand. We used the stable carbon isotope ratio in exhaled CO(2) (delta(13)C(breath)) to assess the origin of metabolized substrates in 16 Egyptian fruit bats that were maintained on a diet of C3 plants before experiments. First, we predicted that in resting bats delta(13)C(breath) remains constant when bats ingest C3 sucrose, but increases and converges on the dietary isotopic signature when C4 sucrose and C4 glucose are ingested. Second, if flying fruit bats use exogenous nutrients exclusively to fuel flight, we predicted that delta(13)C(breath) of flying bats would converge on the isotopic signature of the C4 sucrose they were fed. Both resting and flying Egyptian fruit bats, indeed, directly fuelled their metabolism with freshly ingested exogenous substrates. The rate at which the fruit bats oxidized dietary sugars was as fast as in 10 g nectar-feeding bats and 5 g hummingbirds. Our results support the notion that flying bats, irrespective of their size, catabolize dietary sugars directly, and possibly exclusively, to

  18. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  19. Rapid expansion method (REM) for time‐stepping in reverse time migration (RTM)

    KAUST Repository

    Pestana, Reynam C.

    2009-01-01

    We show that the wave equation solution using a conventional finite‐difference scheme, derived commonly by the Taylor series approach, can be derived directly from the rapid expansion method (REM). After some mathematical manipulation we consider an analytical approximation for the Bessel function where we assume that the time step is sufficiently small. From this derivation we find that if we consider only the first two Chebyshev polynomials terms in the rapid expansion method we can obtain the second order time finite‐difference scheme that is frequently used in more conventional finite‐difference implementations. We then show that if we use more terms from the REM we can obtain a more accurate time integration of the wave field. Consequently, we have demonstrated that the REM is more accurate than the usual finite‐difference schemes and it provides a wave equation solution which allows us to march in large time steps without numerical dispersion and is numerically stable. We illustrate the method with post and pre stack migration results.

  20. Direct methods for radionuclides measurement in water environment

    International Nuclear Information System (INIS)

    Chernyaev, A.; Gaponov, I.; Kazennov, A.

    2004-01-01

    The paper is devoted to the direct method of anthropogenic radionuclide measurement in the water environment. Opportunities of application of submersible gamma-spectrometers for in situ underwater measurements of gamma-radiating nuclides and also the direct method for 90 Sr detection are considered

  1. Evaluating an alternative method for rapid urinary creatinine determination

    Science.gov (United States)

    Creatinine (CR) is an endogenously-produced chemical routinely assayed in urine specimens to assess kidney function, sample dilution. The industry-standard method for CR determination, known as the kinetic Jaffe (KJ) method, relies on an exponential rate of a colorimetric change,...

  2. Rapid and Reliable HPLC Method for the Determination of Vitamin ...

    African Journals Online (AJOL)

    Purpose: To develop and validate an accurate, sensitive and reproducible high performance liquid chromatographic (HPLC) method for the quantitation of vitamin C in pharmaceutical samples. Method: The drug and the standard were eluted from Superspher RP-18 (250 mm x 4.6 mm, 10ìm particle size) at 20 0C.

  3. RESEARCH NOTE A Universal, rapid, and inexpensive method for ...

    Indian Academy of Sciences (India)

    Navya

    success of the extracted gDNA to be submitted into post-PCR analysis. ... The application of the universal method for DNA extraction not restricted into routine ... On the other hand, the universal method has proven its feasibility to be utilized.

  4. A Rapid Method for Determining the Concentration of Recombinant Protein Secreted from Pichia pastoris

    International Nuclear Information System (INIS)

    Sun, L W; Zhao, Y; Jiang, R; Song, Y; Feng, H; Feng, K; Niu, L P; Qi, C

    2011-01-01

    Pichia secretive expression system is one of powerful eukaryotic expression systems in genetic engineering, which is especially suitable for industrial utilization. Because of the low concentration of the target protein in initial experiment, the methods and conditions for expression of the target protein should be optimized according to the protein yield repetitively. It is necessary to set up a rapid, simple and convenient analysis method for protein expression levels instead of the generally used method such as ultrafiltration, purification, dialysis, lyophilization and so on. In this paper, acetone precipitation method was chosen to concentrate the recombinant protein firstly after comparing with four different protein precipitation methods systematically, and then the protein was analyzed by SDS-Polyacrylamide Gel Electrophoresis. The recombinant protein was determined with the feature of protein band by the Automated Image Capture and 1-D Analysis Software directly. With this method, the optimized expression conditions of basic fibroblast growth factor secreted from pichia were obtained, which is as the same as using traditional methods. Hence, a convenient tool to determine the optimized conditions for the expression of recombinant proteins in Pichia was established.

  5. Rapid separation method for {sup 237}Np and Pu isotopes in large soil samples

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod L., E-mail: sherrod.maxwell@srs.go [Savannah River Nuclear Solutions, LLC, Building 735-B, Aiken, SC 29808 (United States); Culligan, Brian K.; Noyes, Gary W. [Savannah River Nuclear Solutions, LLC, Building 735-B, Aiken, SC 29808 (United States)

    2011-07-15

    A new rapid method for the determination of {sup 237}Np and Pu isotopes in soil and sediment samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for large soil samples. The new soil method utilizes an acid leaching method, iron/titanium hydroxide precipitation, a lanthanum fluoride soil matrix removal step, and a rapid column separation process with TEVA Resin. The large soil matrix is removed easily and rapidly using these two simple precipitations with high chemical recoveries and effective removal of interferences. Vacuum box technology and rapid flow rates are used to reduce analytical time.

  6. A simple and rapid molecular method for Leptospira species identification

    NARCIS (Netherlands)

    Ahmed, Ahmed; Anthony, Richard M.; Hartskeerl, Rudy A.

    2010-01-01

    Serological and DNA-based classification systems only have little correlation. Currently serological and molecular methods for characterizing Leptospira are complex and costly restricting their world-wide distribution and use. Ligation mediated amplification combined with microarray analysis

  7. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  8. Rapid Detection of Thrombin and Other Protease Activity Directly in Whole Blood

    Science.gov (United States)

    Yu, Johnson Chung Sing

    Thrombin is a serine protease that plays a key role in the clotting cascade to promote hemostasis following injury to the endothelium. From a clinical diagnostic perspective, in-vivo thrombin activity is linked to various blood clotting disorders, as well as cardiovascular disease (DVT, arteriosclerosis, etc). Thus, the ability to rapidly measure protease activity directly in whole blood will provide important new diagnostics, and clinical researchers with a powerful tool to further elucidate the relationship between circulating protease levels and disease. The ultimate goal is to design novel point of care (POC) diagnostic devices that are capable of monitoring protease activities directly in whole blood and biological sample. A charge-changing substrate specific to the thrombin enzyme was engineered and its functionality was confirmed by a series of experiments. This led to the preliminary design, construction, and testing of two device platforms deemed fully functional for the electrophoretic separation and focusing of charged peptide fragments. The concept of using the existing charge-changing substrate platform for bacterial protease detection was also investigated. Certain strains of E coli are associated with severe symptoms such as abdominal cramps, bloody diarrhea, and vomiting. The OmpT protease is expressed on the outer membrane of E coli and plays a role in the cleavage of antimicrobial peptides, the degradation of recombinant heterologous proteins, and the activation of plasminogen in the host. Thus, a synthetic peptide substrate specific to the OmpT protease was designed and modeled for the purpose of detecting E coli in biological sample.

  9. Multi-frequency direct sampling method in inverse scattering problem

    Science.gov (United States)

    Kang, Sangwoo; Lambert, Marc; Park, Won-Kwang

    2017-10-01

    We consider the direct sampling method (DSM) for the two-dimensional inverse scattering problem. Although DSM is fast, stable, and effective, some phenomena remain unexplained by the existing results. We show that the imaging function of the direct sampling method can be expressed by a Bessel function of order zero. We also clarify the previously unexplained imaging phenomena and suggest multi-frequency DSM to overcome traditional DSM. Our method is evaluated in simulation studies using both single and multiple frequencies.

  10. MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD

    Science.gov (United States)

    2017-06-01

    MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD ECBC-TR...TITLE AND SUBTITLE Mass Spectrometry Proteomics Method as a Rapid Screening Tool for Bacterial Contamination of Food 5a. CONTRACT NUMBER 5b...the MSPM to correctly classify whether or not food samples were contaminated with Salmonella enterica serotype Newport in this blinded pilot study

  11. High resolution melting analysis: a rapid and accurate method to detect CALR mutations.

    Directory of Open Access Journals (Sweden)

    Cristina Bilbao-Sieyro

    Full Text Available The recent discovery of CALR mutations in essential thrombocythemia (ET and primary myelofibrosis (PMF patients without JAK2/MPL mutations has emerged as a relevant finding for the molecular diagnosis of these myeloproliferative neoplasms (MPN. We tested the feasibility of high-resolution melting (HRM as a screening method for rapid detection of CALR mutations.CALR was studied in wild-type JAK2/MPL patients including 34 ET, 21 persistent thrombocytosis suggestive of MPN and 98 suspected secondary thrombocytosis. CALR mutation analysis was performed through HRM and Sanger sequencing. We compared clinical features of CALR-mutated versus 45 JAK2/MPL-mutated subjects in ET.Nineteen samples showed distinct HRM patterns from wild-type. Of them, 18 were mutations and one a polymorphism as confirmed by direct sequencing. CALR mutations were present in 44% of ET (15/34, 14% of persistent thrombocytosis suggestive of MPN (3/21 and none of the secondary thrombocytosis (0/98. Of the 18 mutants, 9 were 52 bp deletions, 8 were 5 bp insertions and other was a complex mutation with insertion/deletion. No mutations were found after sequencing analysis of 45 samples displaying wild-type HRM curves. HRM technique was reproducible, no false positive or negative were detected and the limit of detection was of 3%.This study establishes a sensitive, reliable and rapid HRM method to screen for the presence of CALR mutations.

  12. Infrared spectrophotometry, a rapid and effective tool for characterization of direct distillation naphthas

    International Nuclear Information System (INIS)

    Baldrich Ferrer, Carlos A; Novoa Mantilla, Luz Angela

    2005-01-01

    The characterization of naphtha obtained by direct distillation of medium and heavy crude oils is often limited by the low yield of these fractions. Gas chromatography is a technique that allows a complete determination of the chemical composition of this fraction. However, the prediction of properties such as octane rating and RVP from chromatographic data is a difficult task because there are not adequate models to predict the interaction of the different components, and particularly in the case of heavier fractions, there are some problems for the complete separation of components under the gas chromatographic conditions. The IR technology constitutes a rapid and effective tool to predict several properties of naphtha from the correlation of the spectrum in the infrared area and the properties. In this study, prediction models were developed in a Petrospec Cetane 2000 analyzer, in order to predict in a fast and simple way, the density, the antiknock index and the aromatic content of straight run naphtha obtained in a standard crude oil distillation unit. The equipment used was designed in the factory for the exclusive characterization of medium distillation and not for lighter fractions therefore this work constitutes an innovation given the extensive applications of this type of analyzers

  13. Incorporating Direct Rapid Immunohistochemical Testing into Large-Scale Wildlife Rabies Surveillance

    Directory of Open Access Journals (Sweden)

    Kevin Middel

    2017-06-01

    Full Text Available Following an incursion of the mid-Atlantic raccoon variant of the rabies virus into southern Ontario, Canada, in late 2015, the direct rapid immunohistochemical test for rabies (dRIT was employed on a large scale to establish the outbreak perimeter and to diagnose specific cases to inform rabies control management actions. In a 17-month period, 5800 wildlife carcasses were tested using the dRIT, of which 307 were identified as rabid. When compared with the gold standard fluorescent antibody test (FAT, the dRIT was found to have a sensitivity of 100% and a specificity of 98.2%. Positive and negative test agreement was shown to be 98.3% and 99.1%, respectively, with an overall test agreement of 98.8%. The average cost to test a sample was $3.13 CAD for materials, and hands-on technical time to complete the test is estimated at 0.55 h. The dRIT procedure was found to be accurate, fast, inexpensive, easy to learn and perform, and an excellent tool for monitoring the progression of a wildlife rabies incursion.

  14. A microfluidic chip for direct and rapid trapping of white blood cells from whole blood

    Science.gov (United States)

    Chen, Jingdong; Chen, Di; Yuan, Tao; Xie, Yao; Chen, Xiang

    2013-01-01

    Blood analysis plays a major role in medical and science applications and white blood cells (WBCs) are an important target of analysis. We proposed an integrated microfluidic chip for direct and rapid trapping WBCs from whole blood. The microfluidic chip consists of two basic functional units: a winding channel to mix and arrays of two-layer trapping structures to trap WBCs. Red blood cells (RBCs) were eliminated through moving the winding channel and then WBCs were trapped by the arrays of trapping structures. We fabricated the PDMS (polydimethylsiloxane) chip using soft lithography and determined the critical flow velocities of tartrazine and brilliant blue water mixing and whole blood and red blood cell lysis buffer mixing in the winding channel. They are 0.25 μl/min and 0.05 μl/min, respectively. The critical flow velocity of the whole blood and red blood cell lysis buffer is lower due to larger volume of the RBCs and higher kinematic viscosity of the whole blood. The time taken for complete lysis of whole blood was about 85 s under the flow velocity 0.05 μl/min. The RBCs were lysed completely by mixing and the WBCs were trapped by the trapping structures. The chip trapped about 2.0 × 103 from 3.3 × 103 WBCs. PMID:24404026

  15. Rapid, cost-effective liquid chromatograghic method for the ...

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... The method was validated and used for pharmacokinetic studies. Key words: Metronidazole ... by the intrinsic analytical properties of the drug molecule ... In addition, such factors as sample size ... account, since these affect the reliability of the quantitation. ... phase and ion-pair high–performance liquid.

  16. Rapid multi-residue method for the determination of pesticide ...

    African Journals Online (AJOL)

    Exposure to pesticides can represent a potential risk to humans. Agricultural workers are at risk of chronic toxicity. Hence, the evaluation of pesticide residues in their blood gives an indication about the extent of exposure and help in assessing adverse health effects. The aim of our study was to develop analytical method for ...

  17. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  18. Rapid prototyping methods for the manufacture of fuel cells

    Directory of Open Access Journals (Sweden)

    Dudek Piotr

    2016-01-01

    The potential for the application of this method for the manufacture of metallic bipolar plates (BPP for use in proton exchange membrane fuel cells (PEMFCs is presented and discussed. Special attention is paid to the fabrication of light elements for the construction of PEMFC stacks designed for mobile applications such as aviation technology and unmanned aerial vehicles (UAVs.

  19. Rapid Stencil Mask Fabrication Enabled One-Step Polymer-Free Graphene Patterning and Direct Transfer for Flexible Graphene Devices.

    Science.gov (United States)

    Yong, Keong; Ashraf, Ali; Kang, Pilgyu; Nam, SungWoo

    2016-04-27

    We report a one-step polymer-free approach to patterning graphene using a stencil mask and oxygen plasma reactive-ion etching, with a subsequent polymer-free direct transfer for flexible graphene devices. Our stencil mask is fabricated via a subtractive, laser cutting manufacturing technique, followed by lamination of stencil mask onto graphene grown on Cu foil for patterning. Subsequently, micro-sized graphene features of various shapes are patterned via reactive-ion etching. The integrity of our graphene after patterning is confirmed by Raman spectroscopy. We further demonstrate the rapid prototyping capability of a stretchable, crumpled graphene strain sensor and patterned graphene condensation channels for potential applications in sensing and heat transfer, respectively. We further demonstrate that the polymer-free approach for both patterning and transfer to flexible substrates allows the realization of cleaner graphene features as confirmed by water contact angle measurements. We believe that our new method promotes rapid, facile fabrication of cleaner graphene devices, and can be extended to other two dimensional materials in the future.

  20. Rapid detection of sugar alcohol precursors and corresponding nitrate ester explosives using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Sisco, Edward; Forbes, Thomas P

    2015-04-21

    This work highlights the rapid detection of nitrate ester explosives and their sugar alcohol precursors by direct analysis in real time mass spectrometry (DART-MS) using an off-axis geometry. Demonstration of the effect of various parameters, such as ion polarity and in-source collision induced dissociation (CID) on the detection of these compounds is presented. Sensitivity of sugar alcohols and nitrate ester explosives was found to be greatest in negative ion mode with sensitivities ranging from hundreds of picograms to hundreds of nanograms, depending on the characteristics of the particular molecule. Altering the in-source CID potential allowed for acquisition of characteristic molecular ion spectra as well as fragmentation spectra. Additional studies were completed to identify the role of different experimental parameters on the sensitivity for these compounds. Variables that were examined included the DART gas stream temperature, the presence of a related compound (i.e., the effect of a precursor on the detection of a nitrate ester explosive), incorporation of dopant species and the role of the analysis surface. It was determined that each variable affected the response and detection of both sugar alcohols and the corresponding nitrate ester explosives. From this work, a rapid and sensitive method for the detection of individual sugar alcohols and corresponding nitrate ester explosives, or mixtures of the two, has been developed, providing a useful tool in the real-world identification of homemade explosives.

  1. The Most Probable Limit of Detection (MPL) for rapid microbiological methods

    NARCIS (Netherlands)

    Verdonk, G.P.H.T.; Willemse, M.J.; Hoefs, S.G.G.; Cremers, G.; Heuvel, E.R. van den

    Classical microbiological methods have nowadays unacceptably long cycle times. Rapid methods, available on the market for decades, are already applied within the clinical and food industry, but the implementation in pharmaceutical industry is hampered by for instance stringent regulations on

  2. The most probable limit of detection (MPL) for rapid microbiological methods

    NARCIS (Netherlands)

    Verdonk, G.P.H.T.; Willemse, M.J.; Hoefs, S.G.G.; Cremers, G.; Heuvel, van den E.R.

    2010-01-01

    Classical microbiological methods have nowadays unacceptably long cycle times. Rapid methods, available on the market for decades, are already applied within the clinical and food industry, but the implementation in pharmaceutical industry is hampered by for instance stringent regulations on

  3. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

    Science.gov (United States)

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

  4. Optimal control methods for rapidly time-varying Hamiltonians

    International Nuclear Information System (INIS)

    Motzoi, F.; Merkel, S. T.; Wilhelm, F. K.; Gambetta, J. M.

    2011-01-01

    In this article, we develop a numerical method to find optimal control pulses that accounts for the separation of timescales between the variation of the input control fields and the applied Hamiltonian. In traditional numerical optimization methods, these timescales are treated as being the same. While this approximation has had much success, in applications where the input controls are filtered substantially or mixed with a fast carrier, the resulting optimized pulses have little relation to the applied physical fields. Our technique remains numerically efficient in that the dimension of our search space is only dependent on the variation of the input control fields, while our simulation of the quantum evolution is accurate on the timescale of the fast variation in the applied Hamiltonian.

  5. Time evolution of the wave equation using rapid expansion method

    KAUST Repository

    Pestana, Reynam C.; Stoffa, Paul L.

    2010-01-01

    Forward modeling of seismic data and reverse time migration are based on the time evolution of wavefields. For the case of spatially varying velocity, we have worked on two approaches to evaluate the time evolution of seismic wavefields. An exact solution for the constant-velocity acoustic wave equation can be used to simulate the pressure response at any time. For a spatially varying velocity, a one-step method can be developed where no intermediate time responses are required. Using this approach, we have solved for the pressure response at intermediate times and have developed a recursive solution. The solution has a very high degree of accuracy and can be reduced to various finite-difference time-derivative methods, depending on the approximations used. Although the two approaches are closely related, each has advantages, depending on the problem being solved. © 2010 Society of Exploration Geophysicists.

  6. Time evolution of the wave equation using rapid expansion method

    KAUST Repository

    Pestana, Reynam C.

    2010-07-01

    Forward modeling of seismic data and reverse time migration are based on the time evolution of wavefields. For the case of spatially varying velocity, we have worked on two approaches to evaluate the time evolution of seismic wavefields. An exact solution for the constant-velocity acoustic wave equation can be used to simulate the pressure response at any time. For a spatially varying velocity, a one-step method can be developed where no intermediate time responses are required. Using this approach, we have solved for the pressure response at intermediate times and have developed a recursive solution. The solution has a very high degree of accuracy and can be reduced to various finite-difference time-derivative methods, depending on the approximations used. Although the two approaches are closely related, each has advantages, depending on the problem being solved. © 2010 Society of Exploration Geophysicists.

  7. A rapid cleanup method for the isolation and concentration of pyrrolizidine alkaloids in comfrey root.

    Science.gov (United States)

    Gray, Dean E; Porter, Andrew; O'Neill, Terry; Harris, Roger K; Rottinghaus, George E

    2004-01-01

    Preparations from comfrey (Symphytum officinale and S. x uplandicum) root and leaf contain varying levels of the hepatotoxic pyrrolizidine alkaloids (PAs). Reference compounds for comfrey are not commercially available, and there is currently no rapid extraction or analytical method capable of determining low levels in raw materials or as adulterants in commercially available extracts. A solid-phase extraction (SPE) method was developed using an Ergosil cleanup column that specifically binds the PAs. With this method, powdered comfrey root was extracted by sonication and shaking with basic chloroform. The extract was applied to the cleanup column under vacuum, washed with 2 mL acetone-chloroform (8 + 2, v/v) followed by 2 mL petroleum ether to remove excess chloroform. The column was dried under vacuum, and the PAs were eluted with 2 successive 1 mL aliquots methanol. Percent recoveries of the PAs following Ergosil SPE had an overall average of 96.8%, with RSD of 3.8% over a range of 1.0 to 25.0 g extracted in 100 mL. Average precision of the method (n = 3 over 4 extraction concentrations) gave an overall RSD of 6.0% for the 5 alkaloids, with a range of 0.8% (5 g in 100 mL) to 11.2% (25 g in 100 mL). Recovery optimization testing showed that 1.0 g comfrey root extracted in 100 mL yielded the greatest recovery (% dry weight) of the PAs, with an extraction efficiency and accuracy of 94.2%, and RSD of 1.7% (n = 9). The unique properties of the Ergosil cleanup column provide rapid sample cleanup, volume reduction, and concentration of PAs from comfrey extracts, and allow the eluant to be analyzed directly by traditional chromatographic methods.

  8. A Modified Alternating Direction Method for Variational Inequality Problems

    International Nuclear Information System (INIS)

    Han, D.

    2002-01-01

    The alternating direction method is an attractive method for solving large-scale variational inequality problems whenever the subproblems can be solved efficiently. However, the subproblems are still variational inequality problems, which are as structurally difficult to solve as the original one. To overcome this disadvantage, in this paper we propose a new alternating direction method for solving a class of nonlinear monotone variational inequality problems. In each iteration the method just makes an orthogonal projection to a simple set and some function evaluations. We report some preliminary computational results to illustrate the efficiency of the method

  9. A rapid method for whole mount preparations of mammalian oocytes and early embryos.

    Science.gov (United States)

    Moses, R M; Masui, Y

    1994-05-01

    Whole mounts of mouse oocytes and embryos are useful for observing intracellular structures while preserving morphological integrity. This method is inconvenient for rapid processing of a large number of specimens because washing each specimen in a protein-free solution is required prior to transfer into the fixative. We have developed a new fixative which does not cause protein precipitation which can be added directly to the culture medium. Specimens can be preserved in culture dishes for at least one month, and processed for cytological observation at a convenient time. When stained with hematoxylin, details of cellular structures such as nuclei, nucleoli, chromosomes and spindle microtubules can be observed while maintaining the organization of the organelles.

  10. Evaluation of rapid radiometric method for drug susceptibility testing of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Siddiqi, S.H.; Libonati, J.P.; Middlebrook, G.

    1981-01-01

    A total of 106 isolates of Mycobacterium tuberculosis were tested for drug susceptibility by the conventional 7H11 plate method and by a new rapid radiometric method using special 7H12 liquid medium with 14 C-labeled substrate. Results obtained by the two methods were compared for rapidity, sensitivity, and specificity of the new test method. There was 98% overall agreement between the results obtained by the two methods. Of a total of 424 drug tests, only 8 drug results did not agree, mostly in the case of streptomycin. This new procedure was found to be rapid, with 87% of the tests results reportable within 4 days and 98% reportable within 5 days as compared to the usual 3 weeks required with the conventional indirect susceptibility test method. The results of this preliminary study indicate that the rapid radiometric method seems to have the potential for routine laboratory use and merits further investigations

  11. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  12. Development of a micropulverized extraction method for rapid toxicological analysis of methamphetamine in hair.

    Science.gov (United States)

    Miyaguchi, Hajime; Kakuta, Masaya; Iwata, Yuko T; Matsuda, Hideaki; Tazawa, Hidekatsu; Kimura, Hiroko; Inoue, Hiroyuki

    2007-09-07

    We developed a rapid sample preparation method for the toxicological analysis of methamphetamine and amphetamine (the major metabolite of methamphetamine) in human hair by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS), to facilitate fast screening and quantitation. Two milligrams of hair were mechanically micropulverized for 5 min in a 2-ml plastic tube together with 100 microl of an aqueous solvent containing 10% acetonitrile, 100 mM trifluoroacetic acid and the corresponding deuterium analogues as internal standards. The pulverizing highly disintegrated the hair components, simultaneously allowing the extraction of any drugs present in the hair. After filtering the suspension with a membrane-filter unit, the clear filtrate was directly analyzed by HPLC-MS/MS. No evaporation processes were required for sample preparation. Method optimization and validation study were carried out using real-case specimens and fortified samples in which the drugs had been artificially absorbed, respectively. Concentration ranges for quantitation were 0.040-125 and 0.040-25 ng/mg for methamphetamine and amphetamine, respectively. Real-case specimens were analyzed by the method presented here and by conventional ones to verify the applicability of our method to real-world analysis. Our method took less than 30 min for a set of chromatograms to be obtained from a washed hair sample.

  13. Aligned carbon nanotube, graphene and graphite oxide thin films via substrate-directed rapid interfacial deposition

    Science.gov (United States)

    D'Arcy, Julio M.; Tran, Henry D.; Stieg, Adam Z.; Gimzewski, James K.; Kaner, Richard B.

    2012-05-01

    A procedure for depositing thin films of carbon nanostructures is described that overcomes the limitations typically associated with solution based methods. Transparent and conductively continuous carbon coatings can be grown on virtually any type of substrate within seconds. Interfacial surface tension gradients result in directional fluid flow and film spreading at the water/oil interface. Transparent films of carbon nanostructures are produced including aligned ropes of single-walled carbon nanotubes and assemblies of single sheets of chemically converted graphene and graphite oxide. Process scale-up, layer-by-layer deposition, and a simple method for coating non-activated hydrophobic surfaces are demonstrated.A procedure for depositing thin films of carbon nanostructures is described that overcomes the limitations typically associated with solution based methods. Transparent and conductively continuous carbon coatings can be grown on virtually any type of substrate within seconds. Interfacial surface tension gradients result in directional fluid flow and film spreading at the water/oil interface. Transparent films of carbon nanostructures are produced including aligned ropes of single-walled carbon nanotubes and assemblies of single sheets of chemically converted graphene and graphite oxide. Process scale-up, layer-by-layer deposition, and a simple method for coating non-activated hydrophobic surfaces are demonstrated. Electronic supplementary information (ESI) available: Droplet coalescence, catenoid formation, mechanism of film growth, scanning electron micrographs showing carbon nanotube alignment, flexible transparent films of SWCNTs, AFM images of a chemically converted graphene film, and SEM images of SWCNT free-standing thin films. See DOI: 10.1039/c2nr00010e

  14. Scalable force directed graph layout algorithms using fast multipole methods

    KAUST Repository

    Yunis, Enas Abdulrahman; Yokota, Rio; Ahmadia, Aron

    2012-01-01

    We present an extension to ExaFMM, a Fast Multipole Method library, as a generalized approach for fast and scalable execution of the Force-Directed Graph Layout algorithm. The Force-Directed Graph Layout algorithm is a physics-based approach

  15. Markov chain Monte Carlo methods in directed graphical models

    DEFF Research Database (Denmark)

    Højbjerre, Malene

    Directed graphical models present data possessing a complex dependence structure, and MCMC methods are computer-intensive simulation techniques to approximate high-dimensional intractable integrals, which emerge in such models with incomplete data. MCMC computations in directed graphical models h...

  16. Comparison of the direct enzyme assay method with the membrane ...

    African Journals Online (AJOL)

    Comparison of the direct enzyme assay method with the membrane filtration technique in the quantification and monitoring of microbial indicator organisms – seasonal variations in the activities of coliforms and E. coli, temperature and pH.

  17. A direct sampling method to an inverse medium scattering problem

    KAUST Repository

    Ito, Kazufumi; Jin, Bangti; Zou, Jun

    2012-01-01

    In this work we present a novel sampling method for time harmonic inverse medium scattering problems. It provides a simple tool to directly estimate the shape of the unknown scatterers (inhomogeneous media), and it is applicable even when

  18. A direct sampling method for inverse electromagnetic medium scattering

    KAUST Repository

    Ito, Kazufumi; Jin, Bangti; Zou, Jun

    2013-01-01

    In this paper, we study the inverse electromagnetic medium scattering problem of estimating the support and shape of medium scatterers from scattered electric/magnetic near-field data. We shall develop a novel direct sampling method based

  19. Direct Linear Transformation Method for Three-Dimensional Cinematography

    Science.gov (United States)

    Shapiro, Robert

    1978-01-01

    The ability of Direct Linear Transformation Method for three-dimensional cinematography to locate points in space was shown to meet the accuracy requirements associated with research on human movement. (JD)

  20. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

  1. The Use of Rapid Review Methods for the U.S. Preventive Services Task Force.

    Science.gov (United States)

    Patnode, Carrie D; Eder, Michelle L; Walsh, Emily S; Viswanathan, Meera; Lin, Jennifer S

    2018-01-01

    Rapid review products are intended to synthesize available evidence in a timely fashion while still meeting the needs of healthcare decision makers. Various methods and products have been applied for rapid evidence syntheses, but no single approach has been uniformly adopted. Methods to gain efficiency and compress the review time period include focusing on a narrow clinical topic and key questions; limiting the literature search; performing single (versus dual) screening of abstracts and full-text articles for relevance; and limiting the analysis and synthesis. In order to maintain the scientific integrity, including transparency, of rapid evidence syntheses, it is imperative that procedures used to streamline standard systematic review methods are prespecified, based on sound review principles and empiric evidence when possible, and provide the end user with an accurate and comprehensive synthesis. The collection of clinical preventive service recommendations maintained by the U.S. Preventive Services Task Force, along with its commitment to rigorous methods development, provide a unique opportunity to refine, implement, and evaluate rapid evidence synthesis methods and add to an emerging evidence base on rapid review methods. This paper summarizes the U.S. Preventive Services Task Force's use of rapid review methodology, its criteria for selecting topics for rapid evidence syntheses, and proposed methods to streamline the review process. Copyright © 2018 American Journal of Preventive Medicine. All rights reserved.

  2. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  3. A rapid method combining Golgi and Nissl staining to study neuronal morphology and cytoarchitecture.

    Science.gov (United States)

    Pilati, Nadia; Barker, Matthew; Panteleimonitis, Sofoklis; Donga, Revers; Hamann, Martine

    2008-06-01

    The Golgi silver impregnation technique gives detailed information on neuronal morphology of the few neurons it labels, whereas the majority remain unstained. In contrast, the Nissl staining technique allows for consistent labeling of the whole neuronal population but gives very limited information on neuronal morphology. Most studies characterizing neuronal cell types in the context of their distribution within the tissue slice tend to use the Golgi silver impregnation technique for neuronal morphology followed by deimpregnation as a prerequisite for showing that neuron's histological location by subsequent Nissl staining. Here, we describe a rapid method combining Golgi silver impregnation with cresyl violet staining that provides a useful and simple approach to combining cellular morphology with cytoarchitecture without the need for deimpregnating the tissue. Our method allowed us to identify neurons of the facial nucleus and the supratrigeminal nucleus, as well as assessing cellular distribution within layers of the dorsal cochlear nucleus. With this method, we also have been able to directly compare morphological characteristics of neuronal somata at the dorsal cochlear nucleus when labeled with cresyl violet with those obtained with the Golgi method, and we found that cresyl violet-labeled cell bodies appear smaller at high cellular densities. Our observation suggests that cresyl violet staining is inadequate to quantify differences in soma sizes.

  4. Electron beam directed energy device and methods of using same

    Science.gov (United States)

    Retsky, Michael W.

    2007-10-16

    A method and apparatus is disclosed for an electron beam directed energy device. The device consists of an electron gun with one or more electron beams. The device includes one or more accelerating plates with holes aligned for beam passage. The plates may be flat or preferably shaped to direct each electron beam to exit the electron gun at a predetermined orientation. In one preferred application, the device is located in outer space with individual beams that are directed to focus at a distant target to be used to impact and destroy missiles. The aimings of the separate beams are designed to overcome Coulomb repulsion. A method is also presented for directing the beams to a target considering the variable terrestrial magnetic field. In another preferred application, the electron beam is directed into the ground to produce a subsurface x-ray source to locate and/or destroy buried or otherwise hidden objects including explosive devices.

  5. A direct simulation method for flows with suspended paramagnetic particles

    NARCIS (Netherlands)

    Kang, T.G.; Hulsen, M.A.; Toonder, den J.M.J.; Anderson, P.D.; Meijer, H.E.H.

    2008-01-01

    A direct numerical simulation method based on the Maxwell stress tensor and a fictitious domain method has been developed to solve flows with suspended paramagnetic particles. The numerical scheme enables us to take into account both hydrodynamic and magnetic interactions between particles in a

  6. Comparison of direct and precipitation methods for the estimation of ...

    African Journals Online (AJOL)

    Background: There is increase in use of direct assays for analysis of high and low density lipoprotein cholesterol by clinical laboratories despite differences in performance characteristics with conventional precipitation methods. Calculation of low density lipoprotein cholesterol in precipitation methods is based on total ...

  7. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  8. A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

    Science.gov (United States)

    Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

    2000-01-01

    Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

  9. Methods and Magnitudes of Rapid Weight Loss in Judo Athletes Over Pre-Competition Periods

    Directory of Open Access Journals (Sweden)

    Kons Rafael Lima

    2017-06-01

    Full Text Available Purpose. The study aimed to analyse the methods and magnitudes of rapid weight loss (RWL in judo team members in distinct periods before the biggest state competition in Southern Brazil.

  10. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  11. Unmanned aerial vehicle trajectory planning with direct methods

    Science.gov (United States)

    Geiger, Brian

    A real-time method for trajectory optimization to maximize surveillance time of a fixed or moving ground target by one or more unmanned aerial vehicles (UAVs) is presented. The method accounts for performance limits of the aircraft, intrinsic properties of the camera, and external disturbances such as wind. Direct collocation with nonlinear programming is used to implement the method in simulation and onboard the Penn State/Applied Research Lab's testbed UAV. Flight test results compare well with simulation. Both stationary targets and moving targets, such as a low flying UAV, were successfully tracked in flight test. In addition, a new method using a neural network approximation is presented that removes the need for collocation and numerical derivative calculation. Neural networks are used to approximate the objective and dynamics functions in the optimization problem which allows for reduced computation requirements. The approximation reduces the size of the resulting nonlinear programming problem compared to direct collocation or pseudospectral methods. This method is shown to be faster than direct collocation and psuedospectral methods using numerical or automatic derivative techniques. The neural network approximation is also shown to be faster than analytical derivatives but by a lesser factor. Comparative results are presented showing similar accuracy for all methods. The method is modular and enables application to problems of the same class without network retraining.

  12. [Rapid methods for the genus Salmonella bacteria detection in food and raw materials].

    Science.gov (United States)

    Sokolov, D M; Sokolov, M S

    2013-01-01

    The article considers sanitary and epidemiological aspects and the impact of Salmonella food poisoning in Russia and abroad. The main characteristics of the agent (Salmonella enterica subsp. Enteritidis) are summarized. The main sources of human Salmonella infection are products of poultry and livestock (poultry, eggs, dairy products, meat products, etc.). Standard methods of identifying the causative agent, rapid (alternative) methods of analysis of Salmonella using differential diagnostic medium (MSRV, Salmosyst, XLT4-agar, agar-Rambach et al.), rapid tests Singlepath-Salmonella and PCR (food proof Salmonella) in real time were stated. Rapid tests provide is a substantial (at 24-48 h) reducing the time to identify Salmonella.

  13. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    Science.gov (United States)

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Rapid selective metal patterning on polydimethylsiloxane (PDMS) fabricated by capillarity-assisted laser direct write

    KAUST Repository

    Lee, Ming-Tsang; Lee, Daeho; Sherry, Alexander; Grigoropoulos, Costas P

    2011-01-01

    direct write (LDW) technology. To achieve good metal film quality, a capillarity-assisted laser direct writing (CALDW) of nanoparticle suspensions on a low surface energy material (PDMS) was utilized. Experimental results showed controllable electrical

  15. Stem cell monitoring with a direct or indirect labeling method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Min Hwan; Lee, Yong Jin [Molecular Imaging Research Center, Korea Institute of Radiological and Medical Sciences (KIRAMS), Seoul (Korea, Republic of)

    2016-12-15

    The molecular imaging techniques allow monitoring of the transplanted cells in the same individuals over time, from early localization to the survival, migration, and differentiation. Generally, there are two methods of stem cell labeling: direct and indirect labeling methods. The direct labeling method introduces a labeling agent into the cell, which is stably incorporated or attached to the cells prior to transplantation. Direct labeling of cells with radionuclides is a simple method with relatively fewer adverse events related to genetic responses. However, it can only allow short-term distribution of transplanted cells because of the decreasing imaging signal with radiodecay, according to the physical half-lives, or the signal becomes more diffuse with cell division and dispersion. The indirect labeling method is based on the expression of a reporter gene transduced into the cell before transplantation, which is then visualized upon the injection of an appropriate probe or substrate. In this review, various imaging strategies to monitor the survival and behavior change of transplanted stem cells are covered. Taking these new approaches together, the direct and indirect labeling methods may provide new insights on the roles of in vivo stem cell monitoring, from bench to bedside.

  16. Development of a rapid and simplified protocol for direct bacterial identification from positive blood cultures by using matrix assisted laser desorption ionization time-of- flight mass spectrometry.

    Science.gov (United States)

    Jakovljev, Aleksandra; Bergh, Kåre

    2015-11-06

    Bloodstream infections represent serious conditions carrying a high mortality and morbidity rate. Rapid identification of microorganisms and prompt institution of adequate antimicrobial therapy is of utmost importance for a successful outcome. Aiming at the development of a rapid, simplified and efficient protocol, we developed and compared two in-house preparatory methods for the direct identification of bacteria from positive blood culture flasks (BD BACTEC FX system) by using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI TOF MS). Both methods employed saponin and distilled water for erythrocyte lysis. In method A the cellular pellet was overlaid with formic acid on the MALDI TOF target plate for protein extraction, whereas in method B the pellet was exposed to formic acid followed by acetonitrile prior to placing on the target plate. Best results were obtained by method A. Direct identification was achieved for 81.9 % and 65.8 % (50.3 % and 26.2 % with scores >2.0) of organisms by method A and method B, respectively. Overall concordance with final identification was 100 % to genus and 97.9 % to species level. By applying a lower cut-off score value, the levels of identification obtained by method A and method B increased to 89.3 % and 77.8 % of organisms (81.9 % and 65.8 % identified with scores >1.7), respectively. Using the lowered score criteria, concordance with final results was obtained for 99.3 % of genus and 96.6 % of species identifications. The reliability of results, rapid performance (approximately 25 min) and applicability of in-house method A have contributed to implementation of this robust and cost-effective method in our laboratory.

  17. The determination of Sr-90 in environmental material using an improved rapid method

    International Nuclear Information System (INIS)

    Ghods, A.; Veselsky, J.C.; Zhu, S.; Mirna, A.; Schelenz, R.

    1989-01-01

    A short report on strontium 90, its occurrence in the biosphere and its rapid determination methods is given. Classification of determination methods suitable for various environmental and biological materials is established. Interference due to Y-91 and a method to eliminate the activity of Y-90 and Y-91 is discussed. Tabs

  18. Rapid identification of salmonella serotypes with stereo and hyperspectral microscope imaging Methods

    Science.gov (United States)

    The hyperspectral microscope imaging (HMI) method can reduce detection time within 8 hours including incubation process. The early and rapid detection with this method in conjunction with the high throughput capabilities makes HMI method a prime candidate for implementation for the food industry. Th...

  19. Additive manufacturing technologies 3D printing, rapid prototyping, and direct digital manufacturing

    CERN Document Server

    Gibson, Ian; Stucker, Brent

    2015-01-01

    This book covers in detail the various aspects of joining materials to form parts. A conceptual overview of rapid prototyping and layered manufacturing is given,  beginning with the fundamentals so that readers can get up to speed quickly. Unusual and emerging applications such as micro-scale manufacturing, medical applications, aerospace, and rapid manufacturing are also discussed. This book provides a comprehensive overview of rapid prototyping technologies as well as support technologies such as software systems, vacuum casting, investment casting, plating, infiltration and other systems. This book also: Reflects recent developments and trends and adheres to the ASTM, SI, and other standards Includes chapters on automotive technology, aerospace technology and low-cost AM technologies Provides a broad range of technical questions to ensure comprehensive understanding of the concepts covered  

  20. A direct sampling method to an inverse medium scattering problem

    KAUST Repository

    Ito, Kazufumi

    2012-01-10

    In this work we present a novel sampling method for time harmonic inverse medium scattering problems. It provides a simple tool to directly estimate the shape of the unknown scatterers (inhomogeneous media), and it is applicable even when the measured data are only available for one or two incident directions. A mathematical derivation is provided for its validation. Two- and three-dimensional numerical simulations are presented, which show that the method is accurate even with a few sets of scattered field data, computationally efficient, and very robust with respect to noises in the data. © 2012 IOP Publishing Ltd.

  1. Direct sampling methods for inverse elastic scattering problems

    Science.gov (United States)

    Ji, Xia; Liu, Xiaodong; Xi, Yingxia

    2018-03-01

    We consider the inverse elastic scattering of incident plane compressional and shear waves from the knowledge of the far field patterns. Specifically, three direct sampling methods for location and shape reconstruction are proposed using the different component of the far field patterns. Only inner products are involved in the computation, thus the novel sampling methods are very simple and fast to be implemented. With the help of the factorization of the far field operator, we give a lower bound of the proposed indicator functionals for sampling points inside the scatterers. While for the sampling points outside the scatterers, we show that the indicator functionals decay like the Bessel functions as the sampling point goes away from the boundary of the scatterers. We also show that the proposed indicator functionals continuously dependent on the far field patterns, which further implies that the novel sampling methods are extremely stable with respect to data error. For the case when the observation directions are restricted into the limited aperture, we firstly introduce some data retrieval techniques to obtain those data that can not be measured directly and then use the proposed direct sampling methods for location and shape reconstructions. Finally, some numerical simulations in two dimensions are conducted with noisy data, and the results further verify the effectiveness and robustness of the proposed sampling methods, even for multiple multiscale cases and limited-aperture problems.

  2. Direct observation of characteristic dissociation behaviors of hydrate-bearing cores by rapid-scanning X-ray CT imaging

    Energy Technology Data Exchange (ETDEWEB)

    Ebinuma, T.; Oyama, H.; Utiumi, T.; Nagao, J.; Narita, H. [National Inst. of Advanced Industrial Science and Technology, Toyohiraku, Sapporo (Japan)

    2008-07-01

    Methane hydrate has significant potential as a new source of energy. Major considerations in developing production methods of methane from hydrates are the fundamental properties of hydrate-bearing sediments, and the dissociation behavior of methane hydrate and the gas and water flow generated by its dissociation in sediments. Marine methane hydrates occur several hundred meters below the sea floor, in a variety of forms. The pore-space filling-type is considered to be the most suited to exploitation, as it is contained within the pore spaces of sandy sediments, and has relatively larger gas permeability compared to other forms. However, shallow sandy sediments are not usually consolidated, and methane hydrate is unstable at normal pressure and temperature. Therefore, common methods are not suitable, and new experimental methods have been developed to study the properties of hydrate-bearing sediment and its dissociation process. This paper presented the results of an experimental study involving the dissociation of artificial methane-hydrate-bearing sediments. The experiment was performed using X-ray computed tomography in order to directly observe dissociation behavior in the sediments and the gas and water flows generated by dissociation. The paper described the depressurization process and presented a schematic diagram of rapid scanning X-ray computed tomography scanner and core holder with tri-axial structure. The experimental apparatus for dissociation of methane hydrate was also illustrated. The thermal stimulation process and hot water injection process were explained. It was concluded that dissociation by depressurization demonstrated that the temperature reduction induced by depressurization depended on the phase equilibrium state of methane hydrate, and that dissociation preferentially occurred at the periphery of the core. This behavior was due to the heat flux from the outside of the core, where the heat flux controlled the dissociation rate. 10 refs

  3. A comparative study of wire feeding and powder feeding in direct diode laser deposition for rapid prototyping

    Energy Technology Data Exchange (ETDEWEB)

    Syed, Waheed Ul Haq [Laser Processing Research Centre, School of Mechanical Aerospace and Civil Engineering, Sackville Street Building, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom)]. E-mail: w.syed@postgrad.manchester.ac.uk; Pinkerton, Andrew J. [Laser Processing Research Centre, School of Mechanical Aerospace and Civil Engineering, Sackville Street Building, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom); Li Lin [Laser Processing Research Centre, School of Mechanical Aerospace and Civil Engineering, Sackville Street Building, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom)

    2005-07-15

    Metal powder feeding has been used widely in various rapid prototyping and tooling processes such as direct laser deposition (DLD) and layered engineered net shaping (LENS) to achieve near net shape accuracy. Although powder recycling has been practiced, the material usage efficiency has been very low (normally below 30%). This study compares the process characteristics, advantages and disadvantages of wire- and powder-feed DLD. A 1.5 kW diode laser is used to build multiple layer parts, which are compared and analysed in terms of surface finish, microstructure and deposition efficiency. Scanning electron microscopy (SEM), X-ray diffraction and optical microscopy are used for the material characterisation. The microstructure of samples from both the methods is similar, with some porosity found in powder-feed components, but the surface finish and material usage efficiency is better for wire-feed samples. The deposition angle is found to be critical in the case of wire feeding and the characteristics of different feed angles are explored. Possible reasons for the different characteristics of the two deposition techniques are discussed.

  4. Rapid and simple purification of elastin-like polypeptides directly from whole cells and cell lysates by organic solvent extraction.

    Science.gov (United States)

    VerHeul, Ross; Sweet, Craig; Thompson, David H

    2018-03-26

    Elastin-like polypeptides (ELP) are a well-known class of proteins that are being increasingly utilized in a variety of biomedical applications, due to their beneficial physicochemical properties. A unifying feature of ELP is their demonstration of a sequence tunable inverse transition temperature (Tt) that enables purification using a simple, straightforward process called inverse transition cycling (ITC). Despite the utility of ITC, the process is inherently limited to ELP with an experimentally accessible Tt. Since the underlying basis for the ELP Tt is related to its high overall hydrophobicity, we anticipated that ELP would be excellent candidates for purification by organic extraction. We report the first method for rapidly purifying ELP directly from whole E. coli cells or clarified lysates using pure organic solvents and solvent mixtures, followed by aqueous back extraction. Our results show that small ELP and a large ELP-fusion protein can be isolated in high yield from whole cells or cell lysates with greater than 95% purity in less than 30 min and with very low levels of LPS and DNA contamination.

  5. Direct rapid analysis of trace bioavailable soil macronutrients by chemometrics-assisted energy dispersive X-ray fluorescence and scattering spectrometry

    International Nuclear Information System (INIS)

    Kaniu, M.I.; Angeyo, K.H.; Mwala, A.K.; Mangala, M.J.

    2012-01-01

    Highlights: ► Chemometrics-assisted EDXRFS spectroscopy realizes direct, rapid and accurate analysis of trace bioavailable macronutrients in soils. ► The method is minimally invasive, involves little sample preparation, short analysis times and is relatively insensitive to matrix effects. ► This opens up the ability to rapidly characterize large number of samples/matrices with this method. - Abstract: Precision agriculture depends on the knowledge and management of soil quality (SQ), which calls for affordable, simple and rapid but accurate analysis of bioavailable soil nutrients. Conventional SQ analysis methods are tedious and expensive. We demonstrate the utility of a new chemometrics-assisted energy dispersive X-ray fluorescence and scattering (EDXRFS) spectroscopy method we have developed for direct rapid analysis of trace ‘bioavailable’ macronutrients (i.e. C, N, Na, Mg, P) in soils. The method exploits, in addition to X-ray fluorescence, the scatter peaks detected from soil pellets to develop a model for SQ analysis. Spectra were acquired from soil samples held in a Teflon holder analyzed using 109 Cd isotope source EDXRF spectrometer for 200 s. Chemometric techniques namely principal component analysis (PCA), partial least squares (PLS) and artificial neural networks (ANNs) were utilized for pattern recognition based on fluorescence and Compton scatter peaks regions, and to develop multivariate quantitative calibration models based on Compton scatter peak respectively. SQ analyses were realized with high CMD (R 2 > 0.9) and low SEP (0.01% for N and Na, 0.05% for C, 0.08% for Mg and 1.98 μg g −1 for P). Comparison of predicted macronutrients with reference standards using a one-way ANOVA test showed no statistical difference at 95% confidence level. To the best of the authors’ knowledge, this is the first time that an XRF method has demonstrated utility in trace analysis of macronutrients in soil or related matrices.

  6. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  7. Sleep can eliminate list-method directed forgetting.

    Science.gov (United States)

    Abel, Magdalena; Bäuml, Karl-Heinz T

    2013-05-01

    Recent work suggests a link between sleep and memory consolidation, indicating that sleep in comparison to wakefulness stabilizes memories. However, relatively little is known about how sleep affects forgetting. Here we examined whether sleep influences directed forgetting, the finding that people can intentionally forget obsolete memories when cued to do so. We applied the list-method directed forgetting task and assessed memory performance after 3 delay intervals. Directed forgetting was present after a short 20-min delay and after a 12-hr delay filled with diurnal wakefulness; in contrast, the forgetting was absent after a 12-hr delay that included regular nocturnal sleep. Successful directed forgetting after a delay thus can depend on whether sleep or wakefulness follows upon encoding: When wakefulness follows upon encoding, the forgetting can be successful; when sleep follows upon encoding, no forgetting may arise. Connections of the results to recent studies on the interplay between forgetting and sleep are discussed.

  8. Directed forgetting of complex pictures in an item method paradigm.

    Science.gov (United States)

    Hauswald, Anne; Kissler, Johanna

    2008-11-01

    An item-cued directed forgetting paradigm was used to investigate the ability to control episodic memory and selectively encode complex coloured pictures. A series of photographs was presented to 21 participants who were instructed to either remember or forget each picture after it was presented. Memory performance was later tested with a recognition task where all presented items had to be retrieved, regardless of the initial instructions. A directed forgetting effect--that is, better recognition of "to-be-remembered" than of "to-be-forgotten" pictures--was observed, although its size was smaller than previously reported for words or line drawings. The magnitude of the directed forgetting effect correlated negatively with participants' depression and dissociation scores. The results indicate that, at least in an item method, directed forgetting occurs for complex pictures as well as words and simple line drawings. Furthermore, people with higher levels of dissociative or depressive symptoms exhibit altered memory encoding patterns.

  9. A Sequential Quadratically Constrained Quadratic Programming Method of Feasible Directions

    International Nuclear Information System (INIS)

    Jian Jinbao; Hu Qingjie; Tang Chunming; Zheng Haiyan

    2007-01-01

    In this paper, a sequential quadratically constrained quadratic programming method of feasible directions is proposed for the optimization problems with nonlinear inequality constraints. At each iteration of the proposed algorithm, a feasible direction of descent is obtained by solving only one subproblem which consist of a convex quadratic objective function and simple quadratic inequality constraints without the second derivatives of the functions of the discussed problems, and such a subproblem can be formulated as a second-order cone programming which can be solved by interior point methods. To overcome the Maratos effect, an efficient higher-order correction direction is obtained by only one explicit computation formula. The algorithm is proved to be globally convergent and superlinearly convergent under some mild conditions without the strict complementarity. Finally, some preliminary numerical results are reported

  10. One directional polarized neutron reflectometry with optimized reference layer method

    International Nuclear Information System (INIS)

    Masoudi, S. Farhad; Jahromi, Saeed S.

    2012-01-01

    In the past decade, several neutron reflectometry methods for determining the modulus and phase of the complex reflection coefficient of an unknown multilayer thin film have been worked out among which the method of variation of surroundings and reference layers are of highest interest. These methods were later modified for measurement of the polarization of the reflected beam instead of the measurement of the intensities. In their new architecture, these methods not only suffered from the necessity of change of experimental setup but also another difficulty was added to their experimental implementations. This deficiency was related to the limitations of the technology of the neutron reflectometers that could only measure the polarization of the reflected neutrons in the same direction as the polarization of the incident beam. As the instruments are limited, the theory has to be optimized so that the experiment could be performed. In a recent work, we developed the method of variation of surroundings for one directional polarization analysis. In this new work, the method of reference layer with polarization analysis has been optimized to determine the phase and modulus of the unknown film with measurement of the polarization of the reflected neutrons in the same direction as the polarization of the incident beam.

  11. Direct methods for surface X-ray diffraction

    International Nuclear Information System (INIS)

    Saldin, D. K.; Harder, R.; Shneerson, V. L.; Vogler, H.; Moritz, W.

    2000-01-01

    We develop of a direct method for surface X-ray diffraction that exploits the holographic feature of a known reference wave from the substrate. A Bayesian analysis of the optimal inference to be made from an incomplete data set suggests a maximum entropy algorithm that balances agreement with the data and other statistical considerations

  12. The linogram algorithm and direct fourier method with linograms

    International Nuclear Information System (INIS)

    Edholm, P.R.

    1990-01-01

    This text is an attempt to describe the linogram algorithm based on a somewhat simplified mathematical description of the algorithm which is also more similar to the actual digital implementation. Another algorithm with linograms, which may be called a direct fourier method is also presented. (K.A.E.)

  13. Calibration method for direct conversion receiver front-ends

    Directory of Open Access Journals (Sweden)

    R. Müller

    2008-05-01

    Full Text Available Technology induced process tolerances in analog circuits cause device characteristics different from specification. For direct conversion receiver front-ends a system level calibration method is presented. The malfunctions of the devices are compensated by tuning dominant circuit parameters. Thereto optimization techniques are applied which use measurement values and special evaluation functions.

  14. Rapid instrumental and separation methods for monitoring radionuclides in food and environmental samples. Progress report

    International Nuclear Information System (INIS)

    Bhat, I.S.; Shukla, V.K.; Singh, A.N.; Nair, C.K.G.; Hingorani, S.B.; Dey, N.N.; Jha, S.K.; Rao, D.D.

    1995-01-01

    surface barrier detector, in close agreement. Presently the liquid scintillation counter is used with discriminator settling adjusted to count Pu alpha pulses and also the output from the liquid scintillator is connected to a 2K MCA to see the alpha spectrum. The unit at present does not have the Pulse Shape Analyser (PSA) unit which is being planned to be incorporated in the system to improve the resolution. The work is in progress for direct extraction to a liquid scintillation cocktail containing extracting reagents like high mol. amine (TIOA) and Di2 ethyl hexyl phosphoric acid and then count by liquid scintillation counting. Solvent extraction using specific reagent and then direct liquid scintillation counting is being investigated as a general rapid method for beta and alpha emitters in environmental samples

  15. Rapid determination of benzodiazepines, zolpidem and their metabolites in urine using direct injection liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Jeong, Yu-Dong; Kim, Min Kyung; Suh, Sung Ill; In, Moon Kyo; Kim, Jin Young; Paeng, Ki-Jung

    2015-12-01

    Benzodiazepines and zolpidem are generally prescribed as sedative, hypnotics, anxiolytics or anticonvulsants. These drugs, however, are frequently misused in drug-facilitated crime. Therefore, a rapid and simple liquid chromatography-tandem mass spectrometric (LC-MS/MS) method was developed for identification and quantification of benzodiazepines, zolpidem and their metabolites in urine using deuterium labeled internal standards (IS). Urine samples (120 μL) mixed with 80 μL of the IS solution were centrifuged. An aliquot (5 μL) of the sample solution was directly injected into the LC-MS/MS system for analysis. The mobile phases consisted of water and acetonitrile containing 2mM ammonium trifluoroacetate and 0.2% acetic acid. The analytical column was a Zorbax SB-C18 (100 mm × 2.1 mm i.d., 3.5 μm, Agilent). The separation and detection of 18 analytes were achieved within 10 min. Calibration curves were linear over the concentration ranges of 0.5-20 ng/mL (zolpidem), 1.0-40 ng/mL (flurazepam and temazepam), 2.5-100 ng/mL (7-aminoclonazepam, 1-hydroxymidazolam, midazolam, flunitrazepam and alprazolam), 5.0-200 ng/mL (zolpidem phenyl-4-carboxylic acid, α-hydroxyalprazolam, oxazepam, nordiazepam, triazolam, diazepam and α-hydroxytriazolam), 10-400 ng/mL (lorazepam and desalkylflurazepam) and 10-100 ng/mL (N-desmethylflunitrazepam) with the coefficients of determination (r(2)) above 0.9971. The dilution integrity of the analytes was examined for supplementation of short linear range. Dilution precision and accuracy were tested using two, four and ten-folds dilutions and they ranged from 3.7 to 14.4% and -12.8 to 12.5%, respectively. The process efficiency for this method was 63.0-104.6%. Intra- and inter-day precisions were less than 11.8% and 9.1%, while intra- and inter-day accuracies were less than -10.0 to 8.2%, respectively. The lower limits of quantification were lower than 10 ng/mL for each analyte. The applicability of the developed method was successfully

  16. The scope of application of incremental rapid prototyping methods in foundry engineering

    Directory of Open Access Journals (Sweden)

    M. Stankiewicz

    2010-01-01

    Full Text Available The article presents the scope of application of selected incremental Rapid Prototyping methods in the process of manufacturing casting models, casting moulds and casts. The Rapid Prototyping methods (SL, SLA, FDM, 3DP, JS are predominantly used for the production of models and model sets for casting moulds. The Rapid Tooling methods, such as: ZCast-3DP, ProMetalRCT and VoxelJet, enable the fabrication of casting moulds in the incremental process. The application of the RP methods in cast production makes it possible to speed up the prototype preparation process. This is particularly vital to elements of complex shapes. The time required for the manufacture of the model, the mould and the cast proper may vary from a few to several dozen hours.

  17. Comparing Methods for Estimating Direct Costs of Adverse Drug Events.

    Science.gov (United States)

    Gyllensten, Hanna; Jönsson, Anna K; Hakkarainen, Katja M; Svensson, Staffan; Hägg, Staffan; Rehnberg, Clas

    2017-12-01

    To estimate how direct health care costs resulting from adverse drug events (ADEs) and cost distribution are affected by methodological decisions regarding identification of ADEs, assigning relevant resource use to ADEs, and estimating costs for the assigned resources. ADEs were identified from medical records and diagnostic codes for a random sample of 4970 Swedish adults during a 3-month study period in 2008 and were assessed for causality. Results were compared for five cost evaluation methods, including different methods for identifying ADEs, assigning resource use to ADEs, and for estimating costs for the assigned resources (resource use method, proportion of registered cost method, unit cost method, diagnostic code method, and main diagnosis method). Different levels of causality for ADEs and ADEs' contribution to health care resource use were considered. Using the five methods, the maximum estimated overall direct health care costs resulting from ADEs ranged from Sk10,000 (Sk = Swedish krona; ~€1,500 in 2016 values) using the diagnostic code method to more than Sk3,000,000 (~€414,000) using the unit cost method in our study population. The most conservative definitions for ADEs' contribution to health care resource use and the causality of ADEs resulted in average costs per patient ranging from Sk0 using the diagnostic code method to Sk4066 (~€500) using the unit cost method. The estimated costs resulting from ADEs varied considerably depending on the methodological choices. The results indicate that costs for ADEs need to be identified through medical record review and by using detailed unit cost data. Copyright © 2017 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  18. Scalable force directed graph layout algorithms using fast multipole methods

    KAUST Repository

    Yunis, Enas Abdulrahman

    2012-06-01

    We present an extension to ExaFMM, a Fast Multipole Method library, as a generalized approach for fast and scalable execution of the Force-Directed Graph Layout algorithm. The Force-Directed Graph Layout algorithm is a physics-based approach to graph layout that treats the vertices V as repelling charged particles with the edges E connecting them acting as springs. Traditionally, the amount of work required in applying the Force-Directed Graph Layout algorithm is O(|V|2 + |E|) using direct calculations and O(|V| log |V| + |E|) using truncation, filtering, and/or multi-level techniques. Correct application of the Fast Multipole Method allows us to maintain a lower complexity of O(|V| + |E|) while regaining most of the precision lost in other techniques. Solving layout problems for truly large graphs with millions of vertices still requires a scalable algorithm and implementation. We have been able to leverage the scalability and architectural adaptability of the ExaFMM library to create a Force-Directed Graph Layout implementation that runs efficiently on distributed multicore and multi-GPU architectures. © 2012 IEEE.

  19. The Direct Lighting Computation in Global Illumination Methods

    Science.gov (United States)

    Wang, Changyaw Allen

    1994-01-01

    Creating realistic images is a computationally expensive process, but it is very important for applications such as interior design, product design, education, virtual reality, and movie special effects. To generate realistic images, state-of-art rendering techniques are employed to simulate global illumination, which accounts for the interreflection of light among objects. In this document, we formalize the global illumination problem into a eight -dimensional integral and discuss various methods that can accelerate the process of approximating this integral. We focus on the direct lighting computation, which accounts for the light reaching the viewer from the emitting sources after exactly one reflection, Monte Carlo sampling methods, and light source simplification. Results include a new sample generation method, a framework for the prediction of the total number of samples used in a solution, and a generalized Monte Carlo approach for computing the direct lighting from an environment which for the first time makes ray tracing feasible for highly complex environments.

  20. A direction of developing a mining method and mining complexes

    Energy Technology Data Exchange (ETDEWEB)

    Gabov, V.V.; Efimov, I.A. [St. Petersburg State Mining Institute, St. Petersburg (Russian Federation). Vorkuta Branch

    1996-12-31

    The analyses of a mining method as a main factor determining the development stages of mining units is presented. The paper suggests a perspective mining method which differs from the known ones by following peculiarities: the direction selectivity of cuts with regard to coal seams structure; the cutting speed, thickness and succession of dusts. This method may be done by modulate complexes (a shield carrying a cutting head for coal mining), their mining devices being supplied with hydraulic drive. An experimental model of the module complex has been developed. 2 refs.

  1. Direct methods for limit and shakedown analysis of structures advanced computational algorithms and material modelling

    CERN Document Server

    Pisano, Aurora; Weichert, Dieter

    2015-01-01

    Articles in this book examine various materials and how to determine directly the limit state of a structure, in the sense of limit analysis and shakedown analysis. Apart from classical applications in mechanical and civil engineering contexts, the book reports on the emerging field of material design beyond the elastic limit, which has further industrial design and technological applications. Readers will discover that “Direct Methods” and the techniques presented here can in fact be used to numerically estimate the strength of structured materials such as composites or nano-materials, which represent fruitful fields of future applications.   Leading researchers outline the latest computational tools and optimization techniques and explore the possibility of obtaining information on the limit state of a structure whose post-elastic loading path and constitutive behavior are not well defined or well known. Readers will discover how Direct Methods allow rapid and direct access to requested information in...

  2. [Rapid screening the alkaloids of poppy shell in hot pot condiment, beef noodle soup and seasoning by direct analysis in real time-tandem mass spectrometry].

    Science.gov (United States)

    Zhang, Baile; Gao, Lihong; Xie, Yingshuang; Zhou, Wei; Chen, Xiaofeng; Lei, Chunni; Zhang, Huan

    2017-07-08

    A direct analysis in real time tandem mass spectrometry (DART-MS/MS) method was established for quickly screening five illegally added alkaloids of poppy shell from the hot pot condiment, beef noodle soup and seasoning. The samples were extracted and purified by acetonitrile, and then injected under the conditions of ionization temperature of 300℃, grid electrode voltage of 150 V and sampling rate of 0.8 mm/s using DART in the positive ion mode. The determination was conducted by tandem mass spectrometry in positive ESI mode under multiple reaction monitoring (MRM) mode. The method is simple and rapid, and can meet the requirement of rapid screening and analysis of large quantities of samples.

  3. A rapid and robust method for simultaneously measuring changes in the phytohormones ABA, JA and SA in plants following biotic and abiotic stress

    Directory of Open Access Journals (Sweden)

    Mansfield John W

    2008-06-01

    Full Text Available Abstract We describe an efficient method for the rapid quantitative determination of the abundance of three acidic plant hormones from a single crude extract directly by LC/MS/MS. The method exploits the sensitivity of MS and uses multiple reaction monitoring and isotopically labelled samples to quantify the phytohormones abscisic acid, jasmonic acid and salicylic acid in Arabidopsis leaf tissue.

  4. HPLC method for rapidly following biodiesel fuel transesterification reaction progress using a core-shell column.

    Science.gov (United States)

    Allen, Samuel J; Ott, Lisa S

    2012-07-01

    There are a wide and growing variety of feedstocks for biodiesel fuel. Most commonly, these feedstocks contain triglycerides which are transesterified into the fatty acid alkyl esters (FAAEs) which comprise biodiesel fuel. While the tranesterification reaction itself is simple, monitoring the reaction progress and reaction products is not. Gas chromatography-mass spectrometry is useful for assessing the FAAE products, but does not directly address either the tri-, di-, or monoglycerides present from incomplete transesterification or the free fatty acids which may also be present. Analysis of the biodiesel reaction mixture is complicated by the solubility and physical property differences among the components of the tranesterification reaction mixture. In this contribution, we present a simple, rapid HPLC method which allows for monitoring all of the main components in a biodiesel fuel transesterification reaction, with specific emphasis on the ability to monitor the reaction as a function of time. The utilization of a relatively new, core-shell stationary phase for the HPLC column allows for efficient separation of peaks with short elution times, saving both time and solvent.

  5. Mutant fatty acid desaturase and methods for directed mutagenesis

    Science.gov (United States)

    Shanklin, John [Shoreham, NY; Whittle, Edward J [Greenport, NY

    2008-01-29

    The present invention relates to methods for producing fatty acid desaturase mutants having a substantially increased activity towards substrates with fewer than 18 carbon atom chains relative to an unmutagenized precursor desaturase having an 18 carbon chain length specificity, the sequences encoding the desaturases and to the desaturases that are produced by the methods. The present invention further relates to a method for altering a function of a protein, including a fatty acid desaturase, through directed mutagenesis involving identifying candidate amino acid residues, producing a library of mutants of the protein by simultaneously randomizing all amino acid candidates, and selecting for mutants which exhibit the desired alteration of function. Candidate amino acids are identified by a combination of methods. Enzymatic, binding, structural and other functions of proteins can be altered by the method.

  6. Method for observing phase objects without halos and directional shadows

    Science.gov (United States)

    Suzuki, Yoshimasa; Kajitani, Kazuo; Ohde, Hisashi

    2015-03-01

    A new microscopy method for observing phase objects without halos and directional shadows is proposed. The key optical element is an annular aperture at the front focal plane of a condenser with a larger diameter than those used in standard phase contrast microscopy. The light flux passing through the annular aperture is changed by the specimen's surface profile and then passes through an objective and contributes to image formation. This paper presents essential conditions for realizing the method. In this paper, images of colonies formed by induced pluripotent stem (iPS) cells using this method are compared with the conventional phase contrast method and the bright-field method when the NA of the illumination is small to identify differences among these techniques. The outlines of the iPS cells are clearly visible with this method, whereas they are not clearly visible due to halos when using the phase contrast method or due to weak contrast when using the bright-field method. Other images using this method are also presented to demonstrate a capacity of this method: a mouse ovum and superimposition of several different images of mouse iPS cells.

  7. Right to privacy and some methods of direct marketing

    Directory of Open Access Journals (Sweden)

    Hana Kelblová

    2013-01-01

    Full Text Available Promotion constitutes part of the marketing mix which consists of advertising, sales support, public relations, personal sale and direct marketing. It may be stated that the law delimits boundaries to all these elements of the communication mix. In the following contribution I will only focus on some methods of direct marketing and I intend to investigate the “purposeful appeal to purchase and consumer behaviour of clients” as viewed by the present Czech law. These communications often disturb the privacy of individuals, harass in an inappropriate time, marketing companies often illegally collect and share customers’ personal information. My target is to list legal limits instituted in the sphere of direct marketing for the individual marketing practices by the Czech law.

  8. A gradient activation method for direct methanol fuel cells

    International Nuclear Information System (INIS)

    Liu, Guicheng; Yang, Zhaoyi; Halim, Martin; Li, Xinyang; Wang, Manxiang; Kim, Ji Young; Mei, Qiwen; Wang, Xindong; Lee, Joong Kee

    2017-01-01

    Highlights: • A gradient activation method was reported firstly for direct methanol fuel cells. • The activity recovery of Pt-based catalyst was introduced into the novel activation process. • The new activation method led to prominent enhancement of DMFC performance. • DMFC performance was improved with the novel activation step by step within 7.5 h. - Abstract: To realize gradient activation effect and recover catalytic activity of catalyst in a short time, a gradient activation method has firstly been proposed for enhancing discharge performance and perfecting activation mechanism of the direct methanol fuel cell (DMFC). This method includes four steps, i.e. proton activation, activity recovery activation, H_2-O_2 mode activation and forced discharging activation. The results prove that the proposed method has gradually realized replenishment of water and protons, recovery of catalytic activity of catalyst, establishment of transfer channels for electrons, protons, and oxygen, and optimization of anode catalyst layer for methanol transfer in turn. Along with the novel activation process going on, the DMFC discharge performance has been improved, step by step, to more than 1.9 times higher than that of the original one within 7.5 h. This method provides a practicable activation way for the real application of single DMFCs and stacks.

  9. A rapid and simple chemiluminescence method for screening levels of inosine and hypoxanthine in non-traumatic chest pain patients.

    Science.gov (United States)

    Farthing, Don E; Sica, Domenic; Hindle, Michael; Edinboro, Les; Xi, Lei; Gehr, Todd W B; Gehr, Lynne; Farthing, Christine A; Larus, Terri L; Fakhry, Itaf; Karnes, H Thomas

    2011-01-01

    A rapid and simple chemiluminescence method was developed for detection of inosine and hypoxanthine in human plasma. The method utilized a microplate luminometer with direct injectors to automatically dispense reagents during sample analysis. Enzymatic conversions of inosine to hypoxanthine, followed by hypoxanthine to xanthine to uric acid, generated superoxide anion radicals as a useful metabolic by-product. The free radicals react with Pholasin(®) , a sensitive photoprotein used for chemiluminescence detection, to produce measurable blue-green light. The use of Pholasin(®) and a chemiluminescence signal enhancer, Adjuvant-K™, eliminated the need for plasma clean-up steps prior to analysis. The method used 20 μL of heparinized plasma, with complete analysis of total hypoxanthine levels (inosine is metabolized to hypoxanthine using purine nucleoside phosphorylase) in approximately 3.7 min. The rapid chemiluminescence method demonstrated the capability of differentiating total hypoxanthine levels between healthy individuals, and patients presenting with non-traumatic chest pain and potential acute cardiac ischemia. The results support the potential use of chemiluminescence methodology as a diagnostic tool to rapidly screen for elevated levels of inosine and hypoxanthine in human plasma, potential biomarkers of acute cardiac ischemia. Copyright © 2009 John Wiley & Sons, Ltd.

  10. Application of Patterson-function direct methods to materials characterization.

    Science.gov (United States)

    Rius, Jordi

    2014-09-01

    The aim of this article is a general description of the so-called Patterson-function direct methods (PFDM), from their origin to their present state. It covers a 20-year period of methodological contributions to crystal structure solution, most of them published in Acta Crystallographica Section A. The common feature of these variants of direct methods is the introduction of the experimental intensities in the form of the Fourier coefficients of origin-free Patterson-type functions, which allows the active use of both strong and weak reflections. The different optimization algorithms are discussed and their performances compared. This review focuses not only on those PFDM applications related to powder diffraction data but also on some recent results obtained with electron diffraction tomography data.

  11. Application of Patterson-function direct methods to materials characterization

    Directory of Open Access Journals (Sweden)

    Jordi Rius

    2014-09-01

    Full Text Available The aim of this article is a general description of the so-called Patterson-function direct methods (PFDM, from their origin to their present state. It covers a 20-year period of methodological contributions to crystal structure solution, most of them published in Acta Crystallographica Section A. The common feature of these variants of direct methods is the introduction of the experimental intensities in the form of the Fourier coefficients of origin-free Patterson-type functions, which allows the active use of both strong and weak reflections. The different optimization algorithms are discussed and their performances compared. This review focuses not only on those PFDM applications related to powder diffraction data but also on some recent results obtained with electron diffraction tomography data.

  12. Direct methods for limit states in structures and materials

    CERN Document Server

    Weichert, Dieter

    2014-01-01

    Knowing the safety factor for limit states such as plastic collapse, low cycle fatigue or ratcheting is always a major design consideration for civil and mechanical engineering structures that are subjected to loads. Direct methods of limit or shakedown analysis that proceed to directly find the limit states offer a better alternative than exact time-stepping calculations as, on one hand, an exact loading history is scarcely known, and on the other they are much less time-consuming. This book presents the state of the art on various topics concerning these methods, such as theoretical advances in limit and shakedown analysis, the development of relevant algorithms and computational procedures, sophisticated modeling of inelastic material behavior like hardening, non-associated flow rules, material damage and fatigue, contact and friction, homogenization and composites.

  13. Rapid high temperature field test method for evaluation of geothermal calcite scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1982-08-01

    A test method is described which allows the rapid field testing of calcite scale inhibitors in high- temperature geothermal brines. Five commercial formulations, chosen on the basis of laboratory screening tests, were tested in brines with low total dissolved solids at ca 500 F. Four were found to be effective; of these, 2 were found to be capable of removing recently deposited scale. One chemical was tested in the full-flow brine line for 6 wks. It was shown to stop a severe surface scaling problem at the well's control valve, thus proving the viability of the rapid test method. (12 refs.)

  14. The present state and future directions of PDF methods

    Science.gov (United States)

    Pope, S. B.

    1992-01-01

    The objectives of the workshop are presented in viewgraph format, as is this entire article. The objectives are to discuss the present status and the future direction of various levels of engineering turbulence modeling related to Computational Fluid Dynamics (CFD) computations for propulsion; to assure that combustion is an essential part of propulsion; and to discuss Probability Density Function (PDF) methods for turbulent combustion. Essential to the integration of turbulent combustion models is the development of turbulent model, chemical kinetics, and numerical method. Some turbulent combustion models typically used in industry are the k-epsilon turbulent model, the equilibrium/mixing limited combustion, and the finite volume codes.

  15. A rapid method for monitoring the hydrodeoxygenation of coal-derived naphtha

    Energy Technology Data Exchange (ETDEWEB)

    Farnand, B.A.; Coulombe, S.; Smiley, G.T.; Fairbridge, C.

    1988-01-01

    A bonded polar poly(ethylene glycol) capillary column has been used for the identification and quantification of the phenolic components in synthetic crude naphthas. This provides a rapid and routine method for the determination of phenolic oxygen content with results comparable to combustion and neutron activation methods. The method is most useful in monitoring the removal of phenolic oxygen by hydroprocessing. 11 refs., 1 fig. 1 tab.

  16. Rapid low dose electron tomography using a direct electron detection camera

    NARCIS (Netherlands)

    V. Migunov (Vadim); H. Ryll; X. Zhuge (Jason); M. Simson; L. Strüder; K.J. Batenburg (Joost); L. Houben; R.E. Dunin-Borkowski (Rafal)

    2015-01-01

    htmlabstractWe demonstrate the ability to record a tomographic tilt series containing 3487 images in only 3.5 s by using a direct electron detector in a transmission electron microscope. The electron dose is lower by at least one order of magnitude when compared with that used to record a

  17. Rapid whole genome sequencing for the detection and characterization of microorganisms directly from clinical samples

    DEFF Research Database (Denmark)

    Hasman, Henrik; Saputra, Dhany; Sicheritz-Pontén, Thomas

    2014-01-01

    Whole genome sequencing (WGS) is becoming available as a routine tool for clinical microbiology. If applied directly on clinical samples this could further reduce diagnostic time and thereby improve control and treatment. A major bottle-neck is the availability of fast and reliable bioinformatics...

  18. Rapid analysis method for the determination of 14C specific activity in irradiated graphite.

    Directory of Open Access Journals (Sweden)

    Vidmantas Remeikis

    Full Text Available 14C is one of the limiting radionuclides used in the categorization of radioactive graphite waste; this categorization is crucial in selecting the appropriate graphite treatment/disposal method. We propose a rapid analysis method for 14C specific activity determination in small graphite samples in the 1-100 μg range. The method applies an oxidation procedure to the sample, which extracts 14C from the different carbonaceous matrices in a controlled manner. Because this method enables fast online measurement and 14C specific activity evaluation, it can be especially useful for characterizing 14C in irradiated graphite when dismantling graphite moderator and reflector parts, or when sorting radioactive graphite waste from decommissioned nuclear power plants. The proposed rapid method is based on graphite combustion and the subsequent measurement of both CO2 and 14C, using a commercial elemental analyser and the semiconductor detector, respectively. The method was verified using the liquid scintillation counting (LSC technique. The uncertainty of this rapid method is within the acceptable range for radioactive waste characterization purposes. The 14C specific activity determination procedure proposed in this study takes approximately ten minutes, comparing favorably to the more complicated and time consuming LSC method. This method can be potentially used to radiologically characterize radioactive waste or used in biomedical applications when dealing with the specific activity determination of 14C in the sample.

  19. Rapid analysis method for the determination of 14C specific activity in irradiated graphite.

    Science.gov (United States)

    Remeikis, Vidmantas; Lagzdina, Elena; Garbaras, Andrius; Gudelis, Arūnas; Garankin, Jevgenij; Plukienė, Rita; Juodis, Laurynas; Duškesas, Grigorijus; Lingis, Danielius; Abdulajev, Vladimir; Plukis, Artūras

    2018-01-01

    14C is one of the limiting radionuclides used in the categorization of radioactive graphite waste; this categorization is crucial in selecting the appropriate graphite treatment/disposal method. We propose a rapid analysis method for 14C specific activity determination in small graphite samples in the 1-100 μg range. The method applies an oxidation procedure to the sample, which extracts 14C from the different carbonaceous matrices in a controlled manner. Because this method enables fast online measurement and 14C specific activity evaluation, it can be especially useful for characterizing 14C in irradiated graphite when dismantling graphite moderator and reflector parts, or when sorting radioactive graphite waste from decommissioned nuclear power plants. The proposed rapid method is based on graphite combustion and the subsequent measurement of both CO2 and 14C, using a commercial elemental analyser and the semiconductor detector, respectively. The method was verified using the liquid scintillation counting (LSC) technique. The uncertainty of this rapid method is within the acceptable range for radioactive waste characterization purposes. The 14C specific activity determination procedure proposed in this study takes approximately ten minutes, comparing favorably to the more complicated and time consuming LSC method. This method can be potentially used to radiologically characterize radioactive waste or used in biomedical applications when dealing with the specific activity determination of 14C in the sample.

  20. A rapid screening with direct sequencing from blood samples for the diagnosis of Leigh syndrome

    Directory of Open Access Journals (Sweden)

    Hiroko Shimbo

    2014-01-01

    Full Text Available Large numbers of genes are responsible for Leigh syndrome (LS, making genetic confirmation of LS difficult. We screened our patients with LS using a limited set of 21 primers encompassing the frequently reported gene for the respiratory chain complexes I (ND1–ND6, and ND4L, IV(SURF1, and V(ATP6 and the pyruvate dehydrogenase E1α-subunit. Of 18 LS patients, we identified mutations in 11 patients, including 7 in mDNA (two with ATP6, 4 in nuclear (three with SURF1. Overall, we identified mutations in 61% of LS patients (11/18 individuals in this cohort. Sanger sequencing with our limited set of primers allowed us a rapid genetic confirmation of more than half of the LS patients and it appears to be efficient as a primary genetic screening in this cohort.

  1. A novel method of rapidly modeling optical properties of actual photonic crystal fibres

    International Nuclear Information System (INIS)

    Li-Wen, Wang; Shu-Qin, Lou; Wei-Guo, Chen; Hong-Lei, Li

    2010-01-01

    The flexible structure of photonic crystal fibre not only offers novel optical properties but also brings some difficulties in keeping the fibre structure in the fabrication process which inevitably cause the optical properties of the resulting fibre to deviate from the designed properties. Therefore, a method of evaluating the optical properties of the actual fibre is necessary for the purpose of application. Up to now, the methods employed to measure the properties of the actual photonic crystal fibre often require long fibre samples or complex expensive equipments. To our knowledge, there are few studies of modeling an actual photonic crystal fibre and evaluating its properties rapidly. In this paper, a novel method, based on the combination model of digital image processing and the finite element method, is proposed to rapidly model the optical properties of the actual photonic crystal fibre. Two kinds of photonic crystal fibres made by Crystal Fiber A/S are modeled. It is confirmed from numerical results that the proposed method is simple, rapid and accurate for evaluating the optical properties of the actual photonic crystal fibre without requiring complex equipment. (rapid communication)

  2. [Experimental rationale for the parameters of a rapid method for oxidase activity determination].

    Science.gov (United States)

    Butorina, N N

    2010-01-01

    Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.

  3. Synthesise of Zn O nano wires by direct oxidation method

    International Nuclear Information System (INIS)

    Farbod, M.; Ahangarpour, A.

    2007-01-01

    Zn O is a semiconductor which has a direct and wide energy band which is about 3.37 eV at room temperature. It has various applications from UV lasers, sensitive sensors, solar cells to photo catalysis applications. Zn O has different nano structures such as nanoparticles, nano wires, nano rods, nano tubes and nano belts. The one dimensional Zn O nano structures such as nano wires are very important because of their applications in nano electronics and nano photonics so different methods have been proposed to synthesize them. In this work large scale of Zn O nano wires are produced by direct oxidation a Zn substrate (which was cleaned by chemical methods) in air or oxygen atmosphere at 400 d eg C . Nano wires were investigated by scanning electron microscopy and energy dispersive x-ray measurements. Their diameter is about 30-150 nanometer and their length is about several micrometer. This method which acts without any catalyst is a convenient method to synthesis semiconductor nano wires.

  4. The method of modular characteristic direction probabilities in MPACT

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Z. [School of Nuclear Science and Technology, Xi' an Jiaotong University, No. 28 Xianning west road, Xi' an, Shaanxi 710049 (China); Kochunas, B.; Collins, B.; Downar, T. [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, 2200 Bonisteel, Ann Arbor, MI 48109 (United States); Wu, H. [School of Nuclear Science and Technology, Xi' an Jiaotong University, No. 28 Xianning west road, Xi' an, Shaanxi 710049 (China)

    2013-07-01

    The method of characteristic direction probabilities (CDP) is based on a modular ray tracing technique which combines the benefits of the collision probability method (CPM) and the method of characteristics (MOC). This past year CDP was implemented in the transport code MPACT for 2-D and 3-D transport calculations. By only coupling the fine mesh regions passed by the characteristic rays in the particular direction, the scale of the probabilities matrix is much smaller compared to the CPM. At the same time, the CDP has the same capacity of dealing with the complicated geometries with the MOC, because the same modular ray tracing techniques are used. Results from the C5G7 benchmark problems are given for different cases to show the accuracy and efficiency of the CDP compared to MOC. For the cases examined, the CDP and MOC methods were seen to differ in k{sub eff} by about 1-20 pcm, and the computational efficiency of the CDP appears to be better than the MOC for some problems. However, in other problems, particularly when the CDP matrices have to be recomputed from changing cross sections, the CDP does not perform as well. This indicates an area of future work. (authors)

  5. Alternating direction transport sweeps for linear discontinuous SN method

    International Nuclear Information System (INIS)

    Yavuz, M.; Aykanat, C.

    1993-01-01

    The performance of Alternating Direction Transport Sweep (ADTS) method is investigated for spatially differenced Linear Discontinuous S N (LD-S N ) problems on a MIMD multicomputer, Intel IPSC/2. The method consists of dividing a transport problem spatially into sub-problems, assigning each sub-problem to a separate processor. Then, the problem is solved by performing transport sweeps iterating on the scattering source and interface fluxes between the sub-problems. In each processor, the order of transport sweeps is scheduled such that a processor completing its computation in a quadrant of a transport sweep is able to use the most recent information (exiting fluxes of neighboring processor) as its incoming fluxes to start the next quadrant calculation. Implementation of this method on the Intel IPSC/2 multicomputer displays significant speedups over the one-processor method. Also, the performance of the method is compared with those reported previously for the Diamond Differenced S N (DD-S N ) method. Our experimental experience illustrates that the parallel performance of both the ADTS LD- and DD-S N methods is the same. (orig.)

  6. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  7. Fuel coolant interaction experiment by direct electrical heating method

    International Nuclear Information System (INIS)

    Takeda, Tsuneo; Hirano, Kenmei

    1979-01-01

    In the PCM (Power Cooling Mismatch) experiments, the FCI (Fuel Coolant Interaction) test is one of necessary tests in order to predict various phenomena that occur during PCM in the core. A direct electrical heating method is used for the FCI tests for fuel pellet temperature of over 1000 0 C. Therefore, preheating is required before initiating the direct electrical heating. The fuel pin used in the FCI tests is typical LWR fuel element, which is surrounded by coolant water. It is undersirable to heat up the coolant water during preheating of the fuel pin. Therefore, a zirconia (ZrO 2 ) pellet which is similar to a UO 2 pellet in physical and chemical properties is used. Electric property (electric conductivity) of ZrO 2 is particularly suitable for direct electrical heating as in the case of UO 2 . In this experiment, ZrO 2 pellet (melting point 2500 0 C) melting was achieved by use of both preheating and direct electrical heating. Temperature changes of coolant and fuel surface, as well as the pressure change of coolant water, were measured. The molten fuel interacted with the coolant and generated shock waves. A portion of this molten fuel fragmented into small particles during this interaction. The peak pressure of the observed shock wave was about 35 bars. The damaged fuel pin was photographed after disassembly. This report shows the measured coolant pressure changes and the coolant temperature changes, as well as photographs of damaged fuel pin and fuel fragments. (author)

  8. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors......Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... are applied for the graphical validation and comparisons. This allows similar comparisons and is applicable to single-block evaluation designs such as Napping. The partial Napping allows repetitions on multiple sensory modalities, e.g. appearance, taste and mouthfeel, and shows the average...

  9. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  10. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-01-01

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  11. Comparison of Rice Direct Seeding Methods (Mechanical and Manual with Transplanting Method

    Directory of Open Access Journals (Sweden)

    A Eyvani

    2014-04-01

    Full Text Available The main method of rice planting in Iran is transplanting. Due to poor mechanization of rice production, this method is laborious and costly. The other method is direct seeding in wet lands which is performed in the one third of rice cultivation area of the world. The most important problem in this method is high labor requirement of weed control. In order to compare the different rice planting methods (direct drilling, transplanting, and seed broadcasting a manually operated rice direct seeder (drum seeder was designed and fabricated. The research was conducted using a randomized complete block design with three treatments and three replications. Required draft force, field efficiency, effective field capacity, yield, and yield components were measured and the treatments were compared economically. Results showed that there were significant differences among the treatments from the view point of rice yield at the confidence level of 95% i.e. the transplanting method had the maximum yield. A higher rice yield was obtained from the direct seeder compared to the manual broadcasting method but, the difference between these two methods for crop yield was not significant even at the confidence level of the 95%. The coefficient of variation of seed distribution with direct seeding was more than 20%. The labor and time requirements per hectare reduced to 7 and 20 times, respectively when comparing the newly designed direct seeder with the transplanting method. The direct seeding method had the highest benefit to cost ratio in spite of its lower yield. Therefore, this method could be recommended in the rice growing regions.

  12. NEW COMPLETENESS METHODS FOR ESTIMATING EXOPLANET DISCOVERIES BY DIRECT DETECTION

    International Nuclear Information System (INIS)

    Brown, Robert A.; Soummer, Remi

    2010-01-01

    We report on new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list and stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission and its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization) and an estimate of the occurrence rate of planets (η). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, and we prove the accuracy of this new approach. Our methods provide tools to define a mission for a particular science goal; for example, a mission can be defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built and how successive observations can be selected. Our approach also provides other critical mission attributes, such as the number of stars expected to be searched and the probability of zero discoveries. Because these attributes depend strongly on the mission scale (telescope diameter, observing capabilities and constraints, mission lifetime, etc.), our methods are directly applicable to the design of such future missions and provide guidance to the mission and instrument design based on scientific performance. We illustrate our new methods with practical calculations and exploratory design reference missions for the James Webb Space Telescope (JWST) operating with a distant starshade to reduce scattered and diffracted starlight on the focal plane. We estimate that five habitable Earth-mass planets would be discovered and characterized with spectroscopy, with a probability of zero discoveries of 0.004, assuming a small fraction of JWST observing time (7%), η = 0.3, and 70 observing visits, limited by starshade fuel.

  13. Considerations for Task Analysis Methods and Rapid E-Learning Development Techniques

    Directory of Open Access Journals (Sweden)

    Dr. Ismail Ipek

    2014-02-01

    Full Text Available The purpose of this paper is to provide basic dimensions for rapid training development in e-learning courses in education and business. Principally, it starts with defining task analysis and how to select tasks for analysis and task analysis methods for instructional design. To do this, first, learning and instructional technologies as visions of the future were discussed. Second, the importance of task analysis methods in rapid e-learning was considered, with learning technologies as asynchronous and synchronous e-learning development. Finally, rapid instructional design concepts and e-learning design strategies were defined and clarified with examples, that is, all steps for effective task analysis and rapid training development techniques based on learning and instructional design approaches were discussed, such as m-learning and other delivery systems. As a result, the concept of task analysis, rapid e-learning development strategies and the essentials of online course design were discussed, alongside learner interface design features for learners and designers.

  14. Rapid expansion method (REM) for time‐stepping in reverse time migration (RTM)

    KAUST Repository

    Pestana, Reynam C.; Stoffa, Paul L.

    2009-01-01

    an analytical approximation for the Bessel function where we assume that the time step is sufficiently small. From this derivation we find that if we consider only the first two Chebyshev polynomials terms in the rapid expansion method we can obtain the second

  15. Rapid in vivo screening method for the evaluation of new anti ...

    African Journals Online (AJOL)

    Rapid in vivo screening method for the evaluation of new anti helicobacter ... Six to eight week-old mice pre-treated (7 days) with Amoxicillin/Metronidazole (25 ... These findings were used as a mouse model of Helicobacter pylori infection to ...

  16. Simple rapid methods for freezing hybridomas in 96-well microculture plates.

    Science.gov (United States)

    Wells, D E; Price, P J

    1983-04-15

    Macroscopic hybridoma colonies were frozen and recovered in a good state of viability in 96-well microculture plates using 2 freezing procedures. These methods offer convenient and rapid means of preserving hybridomas and will permit laboratories developing monoclonal antibodies to distribute workloads to more manageable levels without discarding possibly valuable hybridomas.

  17. A critical analysis of methods for rapid and nondestructive determination of wood density in standing trees

    Science.gov (United States)

    Shan Gao; Xiping Wang; Michael C. Wiemann; Brian K. Brashaw; Robert J. Ross; Lihai Wang

    2017-01-01

    Key message Field methods for rapid determination of wood density in trees have evolved from increment borer, torsiometer, Pilodyn, and nail withdrawal into sophisticated electronic tools of resistance drilling measurement. A partial resistance drilling approach coupled with knowledge of internal tree density distribution may...

  18. Flow cytometry as a rapid test for detection of penicillin resistance directly in bacterial cells in Enterococcus faecalis and Staphylococcus aureus.

    Science.gov (United States)

    Jarzembowski, T; Wiśniewska, K; Józwik, A; Bryl, E; Witkowski, J

    2008-08-01

    We studied the usefulness of flow cytometry for detection of penicillin resistance in E. faecalis and S. aureus by direct binding of commercially available fluorescent penicillin, Bocillin FL, to cells obtained from culture. There were significantly lower percentages of fluorescent cells and median and mean fluorescence values per particle in penicillin-resistant than in penicillin-sensitive strains of both species observed. The method allows rapid detection of penicillin resistance in S. aureus and E. faecalis. The results encourage further investigations on the detection of antibiotic resistance in bacteria using flow cytometry.

  19. A Rapid Method for Measuring Strontium-90 Activity in Crops in China

    Science.gov (United States)

    Pan, Lingjing Pan; Yu, Guobing; Wen, Deyun; Chen, Zhi; Sheng, Liusi; Liu, Chung-King; Xu, X. George

    2017-09-01

    A rapid method for measuring Sr-90 activity in crop ashes is presented. Liquid scintillation counting, combined with ion exchange columns 4`, 4"(5")-di-t-butylcyclohexane-18-crown-6, is used to determine the activity of Sr-90 in crops. The yields of chemical procedure are quantified using gravimetric analysis. The conventional method that uses ion-exchange resin with HDEHP could not completely remove all the bismuth when comparatively large lead and bismuth exist in the samples. This is overcome by the rapid method. The chemical yield of this method is about 60% and the MDA for Sr-90 is found to be 2:32 Bq/kg. The whole procedure together with using spectrum analysis to determine the activity only takes about one day, which is really a large improvement compared with the conventional method. A modified conventional method is also described here to verify the value of the rapid one. These two methods can meet di_erent needs of daily monitoring and emergency situation.

  20. Rapid and Direct VHH and Target Identification by Staphylococcal Surface Display Libraries

    Directory of Open Access Journals (Sweden)

    Marco Cavallari

    2017-07-01

    Full Text Available Unbiased and simultaneous identification of a specific antibody and its target antigen has been difficult without prior knowledge of at least one interaction partner. Immunization with complex mixtures of antigens such as whole organisms and tissue extracts including tumoral ones evokes a highly diverse immune response. During such a response, antibodies are generated against a variety of epitopes in the mixture. Here, we propose a surface display design that is suited to simultaneously identify camelid single domain antibodies and their targets. Immune libraries of single-domain antigen recognition fragments from camelid heavy chain-only antibodies (VHH were attached to the peptidoglycan of Gram-positive Staphylococcus aureus employing its endogenous housekeeping sortase enzyme. The sortase transpeptidation reaction covalently attached the VHH to the bacterial peptidoglycan. The reversible nature of the reaction allowed the recovery of the VHH from the bacterial surface and the use of the VHH in downstream applications. These staphylococcal surface display libraries were used to rapidly identify VHH as well as their targets by immunoprecipitation (IP. Our novel bacterial surface display platform was stable under harsh screening conditions, allowed fast target identification, and readily permitted the recovery of the displayed VHH for downstream analysis.

  1. Smokefree cars in New Zealand: rapid research among stakeholders on attitudes and future directions.

    Science.gov (United States)

    Tapp, Dylan; Thomson, George

    2009-09-25

    To conduct a rapid appraisal of the attitudes of New Zealand decision makers and tobacco control stakeholders on enacting a smokefree cars law. A media and document search was made for relevant official and other statements. In early 2008, nine semi-structured interviews were carried out involving three MPs, two officials of government health agencies and four members of NGOs with a stake in tobacco control. Interviews were audiotaped, transcribed, and analysed for themes. In official statements, and amongst the interview sample, there was general opposition to giving smokefree car legislation a current high priority. Reasons given for opposition to such a law included the suboptimal use of advocacy capital compared with other initiatives (e.g. tobacco display bans), the perceived success of relevant health marketing campaigns, and concerns over the current political will to enact legislation that targets smoker freedoms. More information on the extent of current child exposure to tobacco smoke in New Zealand cars, and on the reach and effectiveness of the New Zealand smokefree cars media campaign would help advocates and policymakers. Wider dissemination to policymakers of New Zealand public and smoker support for banning smoking in cars, and of the progress overseas on smokefree car laws, appears to be essential.

  2. A direct sampling method for inverse electromagnetic medium scattering

    KAUST Repository

    Ito, Kazufumi

    2013-09-01

    In this paper, we study the inverse electromagnetic medium scattering problem of estimating the support and shape of medium scatterers from scattered electric/magnetic near-field data. We shall develop a novel direct sampling method based on an analysis of electromagnetic scattering and the behavior of the fundamental solution. It is applicable to a few incident fields and needs only to compute inner products of the measured scattered field with the fundamental solutions located at sampling points. Hence, it is strictly direct, computationally very efficient and highly robust to the presence of data noise. Two- and three-dimensional numerical experiments indicate that it can provide reliable support estimates for multiple scatterers in the case of both exact and highly noisy data. © 2013 IOP Publishing Ltd.

  3. Improvements in fast-neutron spectroscopy methods (1961); Amelioration des methodes de spectrometrie des neutrons rapides (1961)

    Energy Technology Data Exchange (ETDEWEB)

    Cambou, F [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1961-02-15

    This research aimed at improving fast-neutron electronic detectors based on n-p elastic scattering. The first part concerns proportional counters; careful constructional methods have made it possible to plot mono-energetic neutron spectra in the range 700 keV - 3 MeV with a resolution of 7 per cent. The second part concerns scintillation counters: an organic scintillator and an inorganic scintillator covered with a thin layer of a scattering agent. An exact study of the types of scintillation has made it possible to develop efficient discriminator circuits. Different neutron spectra plotted in the presence of a strong gamma background are presented. The last part deals with the development of form discrimination methods for the study, in the actual beam, of the elastic scattering of 14.58 MeV electrons. With hydrogen, the distribution f ({phi}) of the recoil protons is f({phi}) = 1 + 0.034 cos {phi} + 0.042 cos{sup 2} {phi}. With tritium the scattering is strongly anisotropic; the curve representing the variation of the differential cross-section for the elastic scattering in the centre of mass system is obtained with a target containing 1 cm{sup 3} of tritium. (author) [French] Le travail a porte sur l'amelioration des detecteurs electroniques de neutrons rapides bases sur la diffusion elastique n-p. La premiere partie est relative aux compteurs proportionnels; des methodes soignees de fabrication ont permis des traces de spectres de neutrons monoenergetiques dans le domaine 700 keV - 3 MeV avec une resolution de 7 pour cent. La deuxieme partie est relative au compteur a scintillations; scintillateur organique et scintillateur mineral recouvert d'un diffuseur mince. Une etude precise des formes de scintillations a permis la mise au point de circuits discriminateurs efficaces. Differents spectres de neutrons traces en presence d'un fond gamma intense sont presentes. La derniere partie est relative a la mise en oeuvre des methodes de discrimination de forme pour l

  4. Direct and rapid effects of 3,5-diiodo-L-thyronine (T2).

    Science.gov (United States)

    Moreno, Maria; Giacco, Antonia; Di Munno, Celia; Goglia, Fernando

    2017-12-15

    A growing number of researchers are focusing their attention on the possibility that thyroid hormone metabolites, particularly 3,5-diiodothyronine (T2), may actively regulate energy metabolism at the cellular, rather than the nuclear, level. Due to their biochemical features, mitochondria have been the focus of research on the thermogenic effects of thyroid hormones. Indeed, mitochondrial activities have been shown to be regulated both directly and indirectly by T2-specific pathways. Herein, we describe the effects of T2 on energy metabolism. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A rapid radiobioassay method for strontium estimation in nuclear/radiological emergencies

    International Nuclear Information System (INIS)

    Wankhede, Sonal; Sawant, Pramilla D.; Rao, D.D.; Pradeepkumar, K.S.

    2014-01-01

    During a nuclear/radiological emergency, workers as well as members of the public (MOP) may get internally contaminated with the radionuclides like Sr and Cs. In such situations, a truly rapid radiobioassay method is required to screen a large number of people in order to assess internal contamination and also to decide on subsequent medical intervention. The current precipitation method used at Bioassay Lab., Trombay is quite lengthy and laborious. Efforts are being made to optimize bioassay methods at Bhabha Atomic Research Centre using Solid Extraction Chromatography (SEC) technique for emergency response. The present work reports standardization of SEC technique for rapid estimation of Sr in urine samples. The method standardized using Sr spec is simpler, shorter, result in higher recoveries and reproducible results. It is most suitable for quick dose assessment of 90 Sr in bioassay samples in case of emergency

  6. Rapid HPLC-MS method for the simultaneous determination of tea catechins and folates.

    Science.gov (United States)

    Araya-Farias, Monica; Gaudreau, Alain; Rozoy, Elodie; Bazinet, Laurent

    2014-05-14

    An effective and rapid HPLC-MS method for the simultaneous separation of the eight most abundant tea catechins, gallic acid, and caffeine was developed. These compounds were rapidly separated within 9 min by a linear gradient elution using a Zorbax SB-C18 packed with sub 2 μm particles. This methodology did not require preparative and semipreparative HPLC steps. In fact, diluted tea samples can be easily analyzed using HPLC-MS as described in this study. The use of mass spectrometry detection for quantification of catechins ensured a higher specificity of the method. The percent relative standard deviation was generally lower than 4 and 7% for most of the compounds tested in tea drinks and tea extracts, respectively. Furthermore, the method provided excellent resolution for folate determination alone or in combination with catechins. To date, no HPLC method able to discriminate catechins and folates in a quick analysis has been reported in the literature.

  7. A rapid method for soil cement design : Louisiana slope value method.

    Science.gov (United States)

    1964-03-01

    The current procedure used by the Louisiana Department of Highways for laboratory design of cement stabilized soil base and subbase courses is taken from standard AASHO test methods, patterned after Portland Cement Association criteria. These methods...

  8. Direct, Label-Free, and Rapid Transistor-Based Immunodetection in Whole Serum.

    Science.gov (United States)

    Gutiérrez-Sanz, Óscar; Andoy, Nesha M; Filipiak, Marcin S; Haustein, Natalie; Tarasov, Alexey

    2017-09-22

    Transistor-based biosensors fulfill many requirements posed upon transducers for future point-of-care diagnostic devices such as scalable fabrication and label-free and real-time quantification of chemical and biological species with high sensitivity. However, the short Debye screening length in physiological samples (<1 nm) has been a major drawback so far, preventing direct measurements in serum. In this work, we demonstrate how tailoring the sensing surface with short specific biological receptors and a polymer polyethylene glycol (PEG) can strongly enhance the sensor response. In addition, the sensor performance can be dramatically improved if the measurements are performed at elevated temperatures (37 °C instead of 21 °C). With this novel approach, highly sensitive and selective detection of a representative immunosensing parameter-human thyroid-stimulating hormone-is shown over a wide measuring range with subpicomolar detection limits in whole serum. To the best of our knowledge, this is the first demonstration of direct immunodetection in whole serum using transistor-based biosensors, without the need for sample pretreatment, labeling, or washing steps. The presented sensor is low-cost, can be easily integrated into portable diagnostics devices, and offers a competitive performance compared to state-of-the-art central laboratory analyzers.

  9. Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

    OpenAIRE

    Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

    2011-01-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real...

  10. Apparatus and method for rapid separation and detection of hydrocarbon fractions in a fluid stream

    Science.gov (United States)

    Sluder, Charles S.; Storey, John M.; Lewis, Sr., Samuel A.

    2013-01-22

    An apparatus and method for rapid fractionation of hydrocarbon phases in a sample fluid stream are disclosed. Examples of the disclosed apparatus and method include an assembly of elements in fluid communication with one another including one or more valves and at least one sorbent chamber for removing certain classifications of hydrocarbons and detecting the remaining fractions using a detector. The respective ratios of hydrocarbons are determined by comparison with a non separated fluid stream.

  11. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  12. Rapid qualitative research methods during complex health emergencies: A systematic review of the literature.

    Science.gov (United States)

    Johnson, Ginger A; Vindrola-Padros, Cecilia

    2017-09-01

    The 2013-2016 Ebola outbreak in West Africa highlighted both the successes and limitations of social science contributions to emergency response operations. An important limitation was the rapid and effective communication of study findings. A systematic review was carried out to explore how rapid qualitative methods have been used during global heath emergencies to understand which methods are commonly used, how they are applied, and the difficulties faced by social science researchers in the field. We also asses their value and benefit for health emergencies. The review findings are used to propose recommendations for qualitative research in this context. Peer-reviewed articles and grey literature were identified through six online databases. An initial search was carried out in July 2016 and updated in February 2017. The PRISMA checklist was used to guide the reporting of methods and findings. The articles were assessed for quality using the MMAT and AACODS checklist. From an initial search yielding 1444 articles, 22 articles met the criteria for inclusion. Thirteen of the articles were qualitative studies and nine used a mixed-methods design. The purpose of the rapid studies included: the identification of causes of the outbreak, and assessment of infrastructure, control strategies, health needs and health facility use. The studies varied in duration (from 4 days to 1 month). The main limitations identified by the authors were: the low quality of the collected data, small sample sizes, and little time for cross-checking facts with other data sources to reduce bias. Rapid qualitative methods were seen as beneficial in highlighting context-specific issues that need to be addressed locally, population-level behaviors influencing health service use, and organizational challenges in response planning and implementation. Recommendations for carrying out rapid qualitative research in this context included the early designation of community leaders as a point of

  13. Direct estimation of diffuse gaseous emissions from coal fires: current methods and future directions

    Science.gov (United States)

    Engle, Mark A.; Olea, Ricardo A.; O'Keefe, Jennifer M. K.; Hower, James C.; Geboy, Nicholas J.

    2013-01-01

    Coal fires occur in nature spontaneously, contribute to increases in greenhouse gases, and emit atmospheric toxicants. Increasing interest in quantifying coal fire emissions has resulted in the adaptation and development of specialized approaches and adoption of numerical modeling techniques. Overview of these methods for direct estimation of diffuse gas emissions from coal fires is presented in this paper. Here we take advantage of stochastic Gaussian simulation to interpolate CO2 fluxes measured using a dynamic closed chamber at the Ruth Mullins coal fire in Perry County, Kentucky. This approach allows for preparing a map of diffuse gas emissions, one of the two primary ways that gases emanate from coal fires, and establishing the reliability of the study both locally and for the entire fire. Future research directions include continuous and automated sampling to improve quantification of gaseous coal fire emissions.

  14. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  15. Rapid method to determine actinides and 89/90Sr in limestone and marble samples

    International Nuclear Information System (INIS)

    Maxwell, S.L.; Culligan, Brian; Hutchison, J.B.; Utsey, R.C.; Sudowe, Ralf; McAlister, D.R.

    2016-01-01

    A new method for the determination of actinides and radiostrontium in limestone and marble samples has been developed that utilizes a rapid sodium hydroxide fusion to digest the sample. Following rapid pre-concentration steps to remove sample matrix interferences, the actinides and 89 / 90 Sr are separated using extraction chromatographic resins and measured radiometrically. The advantages of sodium hydroxide fusion versus other fusion techniques will be discussed. This approach has a sample preparation time for limestone and marble samples of <4 h. (author)

  16. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Mancini-Filho, J.; Delincee, H.

    2000-01-01

    Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionising radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enabled a rapid identification of the radiation treatment

  17. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  18. Alternating direction methods for classical and ptychographic phase retrieval

    International Nuclear Information System (INIS)

    Wen, Zaiwen; Yang, Chao; Liu, Xin; Marchesini, Stefano

    2012-01-01

    In this paper, we show how the augmented Lagrangian alternating direction method (ADM) can be used to solve both the classical and ptychographic phase retrieval problems. We point out the connection between ADM and projection algorithms such as the hybrid input–output algorithm, and compare its performance against standard algorithms for phase retrieval on a number of test images. Our computational experiments show that ADM appears to be less sensitive to the choice of relaxation parameters, and it usually outperforms the existing techniques for both the classical and ptychographic phase retrieval problems. (paper)

  19. Dynamic fracture testing of ferritic steels using direct current potential drop method

    International Nuclear Information System (INIS)

    Oh, Y. J.; Kim, J. H.; Hwang, I. S.; Park, Y. W.

    2000-01-01

    To apply leak-before-break (LBB) concept to nuclear pipes, the dynamic strain aging of low carbon steel materials has to be considered. For this goal, the J-R tests are needed over a range of temperatures and loading rates, including rapid dynamic loading conditions. In dynamic J-R tests, the unloading compliance method can not be applied and usually the direct current potential drop (DCPD) method has been used. But, even the DCPD method was known to have the problem in defining the crack initiation point due to a potential peak arising in early part of loading of ferromagnetic materials. In this study, potential peaks characteristics were investigated for SA106Gr.C piping steels, and the definition of crack initiation point was made by back tracking from final physical crack length, and it was proposed that this technique could be applied to DCPD method in dynamic loading J-R test

  20. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Delincee, H.

    1998-01-01

    Complete text of publication follows. Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionizing radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In fact, DNA fragmentation measured in single cells by agarose gel electrophoresis - DNA Comet Assay - has shown to offer great potential as a rapid tool to detect whether a wide variety of foodstuffs has been radiation processed. However, more work is needed to exploit the full potential of this promising technique. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma-rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enable a rapid identification of the radiation treatment

  1. Direct numerical methods of mathematical modeling in mechanical structural design

    International Nuclear Information System (INIS)

    Sahili, Jihad; Verchery, Georges; Ghaddar, Ahmad; Zoaeter, Mohamed

    2002-01-01

    Full text.Structural design and numerical methods are generally interactive; requiring optimization procedures as the structure is analyzed. This analysis leads to define some mathematical terms, as the stiffness matrix, which are resulting from the modeling and then used in numerical techniques during the dimensioning procedure. These techniques and many others involve the calculation of the generalized inverse of the stiffness matrix, called also the 'compliance matrix'. The aim of this paper is to introduce first, some different existing mathematical procedures, used to calculate the compliance matrix from the stiffness matrix, then apply direct numerical methods to solve the obtained system with the lowest computational time, and to compare the obtained results. The results show a big difference of the computational time between the different procedures

  2. Effectiveness of Rapid Cooling as a Method of Euthanasia for Young Zebrafish (Danio rerio).

    Science.gov (United States)

    Wallace, Chelsea K; Bright, Lauren A; Marx, James O; Andersen, Robert P; Mullins, Mary C; Carty, Anthony J

    2018-01-01

    Despite increased use of zebrafish (Danio rerio) in biomedical research, consistent information regarding appropriate euthanasia methods, particularly for embryos, is sparse. Current literature indicates that rapid cooling is an effective method of euthanasia for adult zebrafish, yet consistent guidelines regarding zebrafish younger than 6 mo are unavailable. This study was performed to distinguish the age at which rapid cooling is an effective method of euthanasia for zebrafish and the exposure times necessary to reliably euthanize zebrafish using this method. Zebrafish at 3, 4, 7, 14, 16, 19, 21, 28, 60, and 90 d postfertilization (dpf) were placed into an ice water bath for 5, 10, 30, 45, or 60 min (n = 12 to 40 per group). In addition, zebrafish were placed in ice water for 12 h (age ≤14 dpf) or 30 s (age ≥14 dpf). After rapid cooling, fish were transferred to a recovery tank and the number of fish alive at 1, 4, and 12-24 h after removal from ice water was documented. Euthanasia was defined as a failure when evidence of recovery was observed at any point after removal from ice water. Results showed that younger fish required prolonged exposure to rapid cooling for effective euthanasia, with the required exposure time decreasing as fish age. Although younger fish required long exposure times, animals became immobilized immediately upon exposure to the cold water, and behavioral indicators of pain or distress rarely occurred. We conclude that zebrafish 14 dpf and younger require as long as 12 h, those 16 to 28 dpf of age require 5 min, and those older than 28 dpf require 30 s minimal exposure to rapid cooling for reliable euthanasia.

  3. A simple, rapid, cost-effective and sensitive method for detection of Salmonella in environmental and pecan samples.

    Science.gov (United States)

    Dobhal, S; Zhang, G; Rohla, C; Smith, M W; Ma, L M

    2014-10-01

    PCR is widely used in the routine detection of foodborne human pathogens; however, challenges remain in overcoming PCR inhibitors present in some sample matrices. The objective of this study was to develop a simple, sensitive, cost-effective and rapid method for processing large numbers of environmental and pecan samples for Salmonella detection. This study was also aimed at validation of a new protocol for the detection of Salmonella from in-shell pecans. Different DNA template preparation methods, including direct boiling, prespin, multiple washing and commercial DNA extraction kits, were evaluated with pure cultures of Salmonella Typhimurium and with enriched soil, cattle feces and in-shell pecan each spiked individually with Salmonella Typhimurium. PCR detection of Salmonella was conducted using invA and 16S rRNA gene (internal amplification control) specific primers. The effect of amplification facilitators, including bovine serum albumin (BSA), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) and gelatin on PCR sensitivity, was also evaluated. Conducting a prespin of sample matrices in combination with the addition of 0·4% (w/v) BSA and 1% (w/v) PVP in PCR mix was the simplest, most rapid, cost-effective and sensitive method for PCR detection of Salmonella, with up to 40 CFU Salmonella per reaction detectable in the presence of over 10(9 ) CFU ml(-1) of background micro-organisms from enriched feces soil or pecan samples. The developed method is rapid, cost-effective and sensitive for detection of Salmonella from different matrices. This study provides a method with broad applicability for PCR detection of Salmonella in complex sample matrices. This method has a potential for its application in different research arenas and diagnostic laboratories. © 2014 The Society for Applied Microbiology.

  4. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

    OpenAIRE

    Luo, Guizhen; Mitchell, Thomas G.

    2002-01-01

    A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

  5. Method and apparatus for high-efficiency direct contact condensation

    Science.gov (United States)

    Bharathan, Desikan; Parent, Yves; Hassani, A. Vahab

    1999-01-01

    A direct contact condenser having a downward vapor flow chamber and an upward vapor flow chamber, wherein each of the vapor flow chambers includes a plurality of cooling liquid supplying pipes and a vapor-liquid contact medium disposed thereunder to facilitate contact and direct heat exchange between the vapor and cooling liquid. The contact medium includes a plurality of sheets arranged to form vertical interleaved channels or passageways for the vapor and cooling liquid streams. The upward vapor flow chamber also includes a second set of cooling liquid supplying pipes disposed beneath the vapor-liquid contact medium which operate intermittently in response to a pressure differential within the upward vapor flow chamber. The condenser further includes separate wells for collecting condensate and cooling liquid from each of the vapor flow chambers. In alternate embodiments, the condenser includes a cross-current flow chamber and an upward flow chamber, a plurality of upward flow chambers, or a single upward flow chamber. The method of use of the direct contact condenser of this invention includes passing a vapor stream sequentially through the downward and upward vapor flow chambers, where the vapor is condensed as a result of heat exchange with the cooling liquid in the contact medium. The concentration of noncondensable gases in the resulting condensate-liquid mixtures can be minimized by controlling the partial pressure of the vapor, which depends in part upon the geometry of the vapor-liquid contact medium. In another aspect of this invention, the physical and chemical performance of a direct contact condenser can be predicted based on the vapor and coolant compositions, the condensation conditions. and the geometric properties of the contact medium.

  6. Developing a rapid method for the determination of uranium in pure phosphoric acid and D2 EHPA

    International Nuclear Information System (INIS)

    Koudsi, Y.; Stas, J.; Al-Merey, R.; shaddoud, G.

    1996-02-01

    Arsenazo (III) used in titrate uranium spectrophotometrically in phosphoric acid after its extraction into organic phase. In this work we used arsenazo(III) to complex uranyl ion in pure phosphoric acid and in the aqueous phase. The spectrum of the complex shows that λ max is at 650 nm. The linearity of the method is corelated with acid molarity, it is (1 -4, 10 - 30, 10 - 40) ppm uranium for (0.2, 1, 2) M of phosphoric acid respectively. Uranium in D 2 EHPA stripped by phosphoric acid and then determined by this method. Also it has been applied to determine uranium in pure perchloric acid. The method is direct, rapid, very cheap and relatively accurate. (author)

  7. Visual and colorimetric methods for rapid determination of total tannins in vegetable raw materials

    Directory of Open Access Journals (Sweden)

    S. P. Kalinkina

    2016-01-01

    Full Text Available The article is dedicated to the development of rapid colorimetric method for determining the amount of tannins in aqueous extracts of vegetable raw materials. The sorption-based colorimetric test is determining sorption tannins polyurethane foam, impregnated of FeCl3, receiving on its surface painted in black and green color of the reaction products and the determination of their in sorbent matrix. Selectivity is achieved by determining the tannins specific interaction of polyphenols with iron ions (III. The conditions of sorption-colorimetric method: the concentration of ferric chloride (III, impregnated in the polyurethane foam; sorbent mass in the analytical cartridge; degree of loading his agent; the contact time of the phases. color scales have been developed for the visual determination of the amount of tannins in terms of gallic acid. Spend a digitized image obtained scales using computer program “Sorbfil TLC”, excluding a subjective assessment of the intensity of the color scale of the test. The results obtained determine the amount of tannins in aqueous extracts of vegetable raw rapid method using tablets and analytical cartridges. The results of the test determination of tannins with visual and densitometric analytical signal registration are compared to known methods. Spend a metrological evaluation of the results of determining the amount of tannins sorption rapid colorimetric methods. Time visual and densitometric rapid determination of tannins, taking into account the sample preparation is 25–30 minutes, the relative error does not exceed 28 %. The developed test methods for quantifying the content of tannins allow to exclude the use of sophisticated analytical equipment, carry out the analysis in non-laboratory conditions do not require highly skilled personnel.

  8. Sensitivity assessment of direct method for diagnosis of Trichomonas vaginalis in comparison with Dorset Culture media

    Directory of Open Access Journals (Sweden)

    ebrahim badparva

    2010-04-01

    Full Text Available Trichomonas vaginalis is a flagellate protozoan that lives in the genital tract and causes trichomoniasis in women. About 200 million people all over the world are infected with T. vaginalis. There are various methods with different sensitivity and specificity for detection of this parasite, that one of them is direct smear of vaginal secretions which is simpler, rapid and cheaper than other diagnostic methods. Materials and Methods: Demographic data was gathered by a questionnaire which contained different variables. Vaginal secretions samples were taken by spicolum and two swaps that maintained in glucose solution in separate tubes from 160 women referred to health centers of Khorramabad. One of the vaginal samples was examined by direct smear in saline solution and the other was cultured in Dorse medium. Results: Of 160 women suspected of trichomoniasis, 11.8% and 18.75% were positive by direct smear and culture respectively. The sensitivity of the direct method was 63.3%. Our findings indicated that 30% of the infected women belonged to the 31 – 35 age group, which had the most relative frequency of positive cases. Most of the patients (43% were illiterate or had elementary educational level. Conclussion: The sensivity of direct method is 63% in compare to culture ( as a Gold standard , which is ralatively low . Although the efficacy of this test could be imporved by shortening the elapsed time between sampling and examination , use of skilled microscopists , and different samples , but we recommend that more sensitive methods such as culture and PCR should be used .

  9. Cherenkov imaging method for rapid optimization of clinical treatment geometry in total skin electron beam therapy

    Energy Technology Data Exchange (ETDEWEB)

    Andreozzi, Jacqueline M., E-mail: Jacqueline.M.Andreozzi.th@dartmouth.edu, E-mail: Lesley.A.Jarvis@hitchcock.org; Glaser, Adam K. [Thayer School of Engineering, Dartmouth College, Hanover, New Hampshire 03755 (United States); Zhang, Rongxiao [Department of Physics and Astronomy, Dartmouth College, Hanover, New Hampshire 03755 (United States); Gladstone, David J.; Williams, Benjamin B.; Jarvis, Lesley A., E-mail: Jacqueline.M.Andreozzi.th@dartmouth.edu, E-mail: Lesley.A.Jarvis@hitchcock.org [Norris Cotton Cancer Center, Dartmouth-Hitchcock Medical Center, Lebanon, New Hampshire 03766 (United States); Pogue, Brian W. [Thayer School of Engineering and Department of Physics and Astronomy, Dartmouth College, Hanover, New Hampshire 03755 (United States)

    2016-02-15

    Purpose: A method was developed utilizing Cherenkov imaging for rapid and thorough determination of the two gantry angles that produce the most uniform treatment plane during dual-field total skin electron beam therapy (TSET). Methods: Cherenkov imaging was implemented to gather 2D measurements of relative surface dose from 6 MeV electron beams on a white polyethylene sheet. An intensified charge-coupled device camera time-gated to the Linac was used for Cherenkov emission imaging at sixty-two different gantry angles (1° increments, from 239.5° to 300.5°). Following a modified Stanford TSET technique, which uses two fields per patient position for full body coverage, composite images were created as the sum of two beam images on the sheet; each angle pair was evaluated for minimum variation across the patient region of interest. Cherenkov versus dose correlation was verified with ionization chamber measurements. The process was repeated at source to surface distance (SSD) = 441, 370.5, and 300 cm to determine optimal angle spread for varying room geometries. In addition, three patients receiving TSET using a modified Stanford six-dual field technique with 6 MeV electron beams at SSD = 441 cm were imaged during treatment. Results: As in previous studies, Cherenkov intensity was shown to directly correlate with dose for homogenous flat phantoms (R{sup 2} = 0.93), making Cherenkov imaging an appropriate candidate to assess and optimize TSET setup geometry. This method provided dense 2D images allowing 1891 possible treatment geometries to be comprehensively analyzed from one data set of 62 single images. Gantry angles historically used for TSET at their institution were 255.5° and 284.5° at SSD = 441 cm; however, the angles optimized for maximum homogeneity were found to be 252.5° and 287.5° (+6° increase in angle spread). Ionization chamber measurements confirmed improvement in dose homogeneity across the treatment field from a range of 24.4% at the initial

  10. Direct rapid analysis of trace bioavailable soil macronutrients by chemometrics-assisted energy dispersive X-ray fluorescence and scattering spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kaniu, M.I., E-mail: ikaniu@uonbi.ac.ke [Institute of Nuclear Science and Technology, University of Nairobi, P.O. Box 30197-00100 Nairobi (Kenya); Angeyo, K.H. [Department of Physics, University of Nairobi, P.O. Box 30197-00100 Nairobi (Kenya); Mwala, A.K. [Department of Land Resource Management and Agricultural Technology, University of Nairobi, P.O. Box 30197-00100 Nairobi (Kenya); Mangala, M.J. [Institute of Nuclear Science and Technology, University of Nairobi, P.O. Box 30197-00100 Nairobi (Kenya)

    2012-06-04

    Highlights: Black-Right-Pointing-Pointer Chemometrics-assisted EDXRFS spectroscopy realizes direct, rapid and accurate analysis of trace bioavailable macronutrients in soils. Black-Right-Pointing-Pointer The method is minimally invasive, involves little sample preparation, short analysis times and is relatively insensitive to matrix effects. Black-Right-Pointing-Pointer This opens up the ability to rapidly characterize large number of samples/matrices with this method. - Abstract: Precision agriculture depends on the knowledge and management of soil quality (SQ), which calls for affordable, simple and rapid but accurate analysis of bioavailable soil nutrients. Conventional SQ analysis methods are tedious and expensive. We demonstrate the utility of a new chemometrics-assisted energy dispersive X-ray fluorescence and scattering (EDXRFS) spectroscopy method we have developed for direct rapid analysis of trace 'bioavailable' macronutrients (i.e. C, N, Na, Mg, P) in soils. The method exploits, in addition to X-ray fluorescence, the scatter peaks detected from soil pellets to develop a model for SQ analysis. Spectra were acquired from soil samples held in a Teflon holder analyzed using {sup 109}Cd isotope source EDXRF spectrometer for 200 s. Chemometric techniques namely principal component analysis (PCA), partial least squares (PLS) and artificial neural networks (ANNs) were utilized for pattern recognition based on fluorescence and Compton scatter peaks regions, and to develop multivariate quantitative calibration models based on Compton scatter peak respectively. SQ analyses were realized with high CMD (R{sup 2} > 0.9) and low SEP (0.01% for N and Na, 0.05% for C, 0.08% for Mg and 1.98 {mu}g g{sup -1} for P). Comparison of predicted macronutrients with reference standards using a one-way ANOVA test showed no statistical difference at 95% confidence level. To the best of the authors' knowledge, this is the first time that an XRF method has demonstrated

  11. Direct osmosis method of purification and desalination of drinking water

    International Nuclear Information System (INIS)

    Khaydarov, R.A.; Khaydarov, R.R.

    2005-01-01

    Full text: Drinking water quality is one of the general factors influencing people's health. The human activity in industry and agriculture has led to pollution of the environment: soil, air, both surface and ground waters that are polluted with chemical substances. It has a disastrous effect on the health of the population, especially of children. At present, the known equipment, based on ion exchange, electrodialysis and reverse osmosis, require great expense, energy expenditures, and highly qualified personnel that are inaccessible to the population especially living in remote regions. Methods, which are usually used in water supplying plants, cannot remove spore forms of bacteria and many types of chemical substances. The purpose of this Project is to create an absolutely new method for purification of drinking water from chemical and biological agents. The method is based on using direct osmosis process that removes all contaminants except one and removing last contaminant. This method will be used for making new low energy-consuming and cheap mini-systems for individual and collective use for desalination of drinking water and purification from bacteria, radionuclides, heavy metal ions, and organic contaminants. Preliminary experiments and calculations conducted in Uzbekistan show that the energy consumption is 0.8 MW per 1 m 3 of water. Advantage of the method is low energy consumption, potentially purifying water without pretreatment and removing different types of bacteria including spore forms, radionuclides, heavy metal ions, organic contaminants. Devices can be powered by solar units in remote locations. The purpose of this work is further elaboration of this technology creation of new method and its accommodation to conditions of different countries. Test models will be made and tested in laboratories of interested countries

  12. 3D virtual human rapid modeling method based on top-down modeling mechanism

    Directory of Open Access Journals (Sweden)

    LI Taotao

    2017-01-01

    Full Text Available Aiming to satisfy the vast custom-made character demand of 3D virtual human and the rapid modeling in the field of 3D virtual reality, a new virtual human top-down rapid modeling method is put for-ward in this paper based on the systematic analysis of the current situation and shortage of the virtual hu-man modeling technology. After the top-level realization of virtual human hierarchical structure frame de-sign, modular expression of the virtual human and parameter design for each module is achieved gradu-al-level downwards. While the relationship of connectors and mapping restraints among different modules is established, the definition of the size and texture parameter is also completed. Standardized process is meanwhile produced to support and adapt the virtual human top-down rapid modeling practice operation. Finally, the modeling application, which takes a Chinese captain character as an example, is carried out to validate the virtual human rapid modeling method based on top-down modeling mechanism. The result demonstrates high modelling efficiency and provides one new concept for 3D virtual human geometric mod-eling and texture modeling.

  13. Rapid determination of tannins in tanning baths by adaptation of BSA method.

    Science.gov (United States)

    Molinari, R; Buonomenna, M G; Cassano, A; Drioli, E

    2001-01-01

    A rapid and reproducible method for the determination of tannins in vegetable tanning baths is proposed as a modification of the BSA method for grain tannins existing in literature. The protein BSA was used instead of leather powder employed in the Filter Method, which is adopted in Italy and various others countries of Central Europe. In this rapid method the tannin contents is determined by means a spectrophotometric reading and not by means a gravimetric analysis of the Filter Method. The BSA method, which belongs to mixed methods (which use both precipitation and complexation of tannins), consists of selective precipitation of tannin from a solution containing also non tannins by BSA, the dissolution of precipitate and the quantification of free tannin amount by its complexation with Fe(III) in hydrochloric solutions. The absorbance values, read at 522 nm, have been expressed in terms of tannic acid concentration by using a calibration curve made with standard solutions of tannic acid; these have been correlated with the results obtained by using the Filter Method.

  14. Simple Sample Preparation Method for Direct Microbial Identification and Susceptibility Testing From Positive Blood Cultures

    Directory of Open Access Journals (Sweden)

    Hong-wei Pan

    2018-03-01

    Full Text Available Rapid identification and determination of the antibiotic susceptibility profiles of the infectious agents in patients with bloodstream infections are critical steps in choosing an effective targeted antibiotic for treatment. However, there has been minimal effort focused on developing combined methods for the simultaneous direct identification and antibiotic susceptibility determination of bacteria in positive blood cultures. In this study, we constructed a lysis-centrifugation-wash procedure to prepare a bacterial pellet from positive blood cultures, which can be used directly for identification by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS and antibiotic susceptibility testing by the Vitek 2 system. The method was evaluated using a total of 129 clinical bacteria-positive blood cultures. The whole sample preparation process could be completed in <15 min. The correct rate of direct MALDI-TOF MS identification was 96.49% for gram-negative bacteria and 97.22% for gram-positive bacteria. Vitek 2 antimicrobial susceptibility testing of gram-negative bacteria showed an agreement rate of antimicrobial categories of 96.89% with a minor error, major error, and very major error rate of 2.63, 0.24, and 0.24%, respectively. Category agreement of antimicrobials against gram-positive bacteria was 92.81%, with a minor error, major error, and very major error rate of 4.51, 1.22, and 1.46%, respectively. These results indicated that our direct antibiotic susceptibility analysis method worked well compared to the conventional culture-dependent laboratory method. Overall, this fast, easy, and accurate method can facilitate the direct identification and antibiotic susceptibility testing of bacteria in positive blood cultures.

  15. Fuji apple storage time rapid determination method using Vis/NIR spectroscopy

    Science.gov (United States)

    Liu, Fuqi; Tang, Xuxiang

    2015-01-01

    Fuji apple storage time rapid determination method using visible/near-infrared (Vis/NIR) spectroscopy was studied in this paper. Vis/NIR diffuse reflection spectroscopy responses to samples were measured for 6 days. Spectroscopy data were processed by stochastic resonance (SR). Principal component analysis (PCA) was utilized to analyze original spectroscopy data and SNR eigen value. Results demonstrated that PCA could not totally discriminate Fuji apples using original spectroscopy data. Signal-to-noise ratio (SNR) spectrum clearly classified all apple samples. PCA using SNR spectrum successfully discriminated apple samples. Therefore, Vis/NIR spectroscopy was effective for Fuji apple storage time rapid discrimination. The proposed method is also promising in condition safety control and management for food and environmental laboratories. PMID:25874818

  16. Solvent extraction method for rapid separation of strontium-90 in milk and food samples

    International Nuclear Information System (INIS)

    Hingorani, S.B.; Sathe, A.P.

    1991-01-01

    A solvent extraction method, using tributyl phosphate, for rapid separation of strontium-90 in milk and other food samples has been presented in this report in view of large number of samples recieved after Chernobyl accident for checking radioactive contamination. The earlier nitration method in use for the determination of 90 Sr through its daughter 90 Y takes over two weeks for analysis of a sample. While by this extraction method it takes only 4 to 5 hours for sample analysis. Complete estimation including initial counting can be done in a single day. The chemical recovery varies between 80-90% compared to nitration method which is 65-80%. The purity of the method has been established by following the decay of yttrium-90 separated. Some of the results obtained by adopting this chemical method for food analysis are included. The method is, thus, found to be rapid and convenient for accurate estimation of strontium-90 in milk and food samples. (author). 2 tabs., 1 fig

  17. A copula method for modeling directional dependence of genes

    Directory of Open Access Journals (Sweden)

    Park Changyi

    2008-05-01

    Full Text Available Abstract Background Genes interact with each other as basic building blocks of life, forming a complicated network. The relationship between groups of genes with different functions can be represented as gene networks. With the deposition of huge microarray data sets in public domains, study on gene networking is now possible. In recent years, there has been an increasing interest in the reconstruction of gene networks from gene expression data. Recent work includes linear models, Boolean network models, and Bayesian networks. Among them, Bayesian networks seem to be the most effective in constructing gene networks. A major problem with the Bayesian network approach is the excessive computational time. This problem is due to the interactive feature of the method that requires large search space. Since fitting a model by using the copulas does not require iterations, elicitation of the priors, and complicated calculations of posterior distributions, the need for reference to extensive search spaces can be eliminated leading to manageable computational affords. Bayesian network approach produces a discretely expression of conditional probabilities. Discreteness of the characteristics is not required in the copula approach which involves use of uniform representation of the continuous random variables. Our method is able to overcome the limitation of Bayesian network method for gene-gene interaction, i.e. information loss due to binary transformation. Results We analyzed the gene interactions for two gene data sets (one group is eight histone genes and the other group is 19 genes which include DNA polymerases, DNA helicase, type B cyclin genes, DNA primases, radiation sensitive genes, repaire related genes, replication protein A encoding gene, DNA replication initiation factor, securin gene, nucleosome assembly factor, and a subunit of the cohesin complex by adopting a measure of directional dependence based on a copula function. We have compared

  18. New methods for rapid data acquisition of contaminated land cover after NPP accident

    International Nuclear Information System (INIS)

    Hulka, J.; Cespirova, I.

    2008-01-01

    Aim of the research project is the analysis of the modem and rapid reliable data acquisition methods for agricultural countermeasures, feed-stuff restrictions and clean-up of large contaminated areas after NPP accident. Acquiring agricultural reliable data especially based on satellite technology and analysis of landscape contamination (based on computer code vs. in situ measurements, airborne and/or terrestrial mapping of contamination) are discussed. (authors)

  19. A rapid method for establishment of a reverse genetics system for canine parvovirus.

    Science.gov (United States)

    Yu, Yongle; Su, Jun; Wang, Jigui; Xi, Ji; Mao, Yaping; Hou, Qiang; Zhang, Xiaomei; Liu, Weiquan

    2017-12-01

    Canine parvovirus (CPV) is an important and highly prevalent pathogen of dogs that causes acute hemorrhagic enteritis disease. Here, we describe a rapid method for the construction and characterization of a full-length infectious clone (rCPV) of CPV. Feline kidney (F81) cells were transfected with rCPV incorporating an engineered EcoR I site that served as a genetic marker. The rescued virus was indistinguishable from that of wild-type virus in its biological properties.

  20. New methods for rapid data acquisition of contaminated land cover after NPP accident

    International Nuclear Information System (INIS)

    Hulka, J.; Cespirova, I.

    2009-01-01

    Aim of the research project is the analysis of the modem and rapid reliable data acquisition methods for agricultural countermeasures, feed-stuff restrictions and clean-up of large contaminated areas after NPP accident. Acquiring agricultural reliable data especially based on satellite technology and analysis of landscape contamination (based on computer code vs. in situ measurements, airborne and/or terrestrial mapping of contamination) are discussed. (authors)

  1. A simple, rapid and inexpensive screening method for the identification of Pythium insidiosum.

    Science.gov (United States)

    Tondolo, Juliana Simoni Moraes; Loreto, Erico Silva; Denardi, Laura Bedin; Mario, Débora Alves Nunes; Alves, Sydney Hartz; Santurio, Janio Morais

    2013-04-01

    Growth of Pythium insidiosum mycelia around minocycline disks (30μg) did not occur within 7days of incubation at 35°C when the isolates were grown on Sabouraud, corn meal, Muller-Hinton or RPMI agar. This technique offers a simple and rapid method for the differentiation of P. insidiosum from true filamentous fungi. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  3. A novel sample preparation method using rapid nonheated saponification method for the determination of cholesterol in emulsified foods.

    Science.gov (United States)

    Jeong, In-Seek; Kwak, Byung-Man; Ahn, Jang-Hyuk; Leem, Donggil; Yoon, Taehyung; Yoon, Changyong; Jeong, Jayoung; Park, Jung-Min; Kim, Jin-Man

    2012-10-01

    In this study, nonheated saponification was employed as a novel, rapid, and easy sample preparation method for the determination of cholesterol in emulsified foods. Cholesterol content was analyzed using gas chromatography with a flame ionization detector (GC-FID). The cholesterol extraction method was optimized for maximum recovery from baby food and infant formula. Under these conditions, the optimum extraction solvent was 10 mL ethyl ether per 1 to 2 g sample, and the saponification solution was 0.2 mL KOH in methanol. The cholesterol content in the products was determined to be within the certified range of certified reference materials (CRMs), NIST SRM 1544 and SRM 1849. The results of the recovery test performed using spiked materials were in the range of 98.24% to 99.45% with an relative standard devitation (RSD) between 0.83% and 1.61%. This method could be used to reduce sample pretreatment time and is expected to provide an accurate determination of cholesterol in emulsified food matrices such as infant formula and baby food. A novel, rapid, and easy sample preparation method using nonheated saponification was developed for cholesterol detection in emulsified foods. Recovery tests of CRMs were satisfactory, and the recoveries of spiked materials were accurate and precise. This method was effective and decreased the time required for analysis by 5-fold compared to the official method. © 2012 Institute of Food Technologists®

  4. Rapid column extraction method for actinides and strontium in fish and other animal tissue samples

    International Nuclear Information System (INIS)

    Maxwell III, S.L.; Faison, D.M.

    2008-01-01

    The analysis of actinides and radiostrontium in animal tissue samples is very important for environmental monitoring. There is a need to measure actinide isotopes and strontium with very low detection limits in animal tissue samples, including fish, deer, hogs, beef and shellfish. A new, rapid separation method has been developed that allows the measurement of plutonium, neptunium, uranium, americium, curium and strontium isotopes in large animal tissue samples (100-200 g) with high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin R , TRU Resin R and DGA Resin R cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), and curium (Cm) using a single multi-stage column combined with alphaspectrometry. Strontium is collected on Sr Resin R from Eichrom Technologies (Darien, IL, USA). After acid digestion and furnace heating of the animal tissue samples, the actinides and 89/90 Sr are separated using column extraction chromatography. This method has been shown to be effective over a wide range of animal tissue matrices. Vacuum box cartridge technology with rapid flow rates is used to minimize sample preparation time. (author)

  5. GSMA: Gene Set Matrix Analysis, An Automated Method for Rapid Hypothesis Testing of Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Chris Cheadle

    2007-01-01

    Full Text Available Background: Microarray technology has become highly valuable for identifying complex global changes in gene expression patterns. The assignment of functional information to these complex patterns remains a challenging task in effectively interpreting data and correlating results from across experiments, projects and laboratories. Methods which allow the rapid and robust evaluation of multiple functional hypotheses increase the power of individual researchers to data mine gene expression data more efficiently.Results: We have developed (gene set matrix analysis GSMA as a useful method for the rapid testing of group-wise up- or downregulation of gene expression simultaneously for multiple lists of genes (gene sets against entire distributions of gene expression changes (datasets for single or multiple experiments. The utility of GSMA lies in its flexibility to rapidly poll gene sets related by known biological function or as designated solely by the end-user against large numbers of datasets simultaneously.Conclusions: GSMA provides a simple and straightforward method for hypothesis testing in which genes are tested by groups across multiple datasets for patterns of expression enrichment.

  6. Application of pulse spectro- zonal luminescent method for the rapid method of material analysis

    International Nuclear Information System (INIS)

    Lisitsin, V.M.; Oleshko, V.I.; Yakovlev, A.N.

    2004-01-01

    Full text: The scope of luminescent methods of the analysis covers enough a big around of substances as the luminescence can be excited in overwhelming majority of nonmetals. Analytical opportunities of luminescent methods can be essentially expanded by use of pulse excitation and registration of spectra of a luminescence with the time resolved methods. The most perspective method is to use pulses of high-current electron beams with the nanosecond duration for excitation from the following reasons: excitation is carried out ionizing, deeply enough by a penetrating radiation; the pulse of radiation has high capacity, up to 10 8 W, but energy no more than 1 J; the pulse of radiation has the nanosecond duration. Electrons with energy in 300-400 keV will penetrate on depth into some tenth shares of mm, i.e. they create volumetric excitation of a sample. Therefore the luminescence raised by an electronic beam has the information about volumetric properties of substance. High density of excitation allow to find out and study the centers (defects) having a small yield of a luminescence, to analyze the weakly luminescent objects. Occurrence of the new effects is possible useful to analyze of materials. There is an opportunity of reception of the information from change of spectral structure of a luminescence during the time after the ending of a pulse of excitation and kinetic characteristics of attenuation of luminescence. The matter is the energy of radiation is absorbed mainly by a matrix, then electronic excitations one is transferred the centers of a luminescence (defects) of a lattice. Therefore during the time after creation electronic excitations the spectrum of a luminescence can repeatedly change, transferring the information on the centers (defects) which are the most effective radiators at present time. Hence, the study of change of spectra of radiation during the time allows providing an additional way of discrimination of the information on the centers of a

  7. Interactive Rapid Dose Assessment Model (IRDAM): reactor-accident assessment methods. Vol.2

    International Nuclear Information System (INIS)

    Poeton, R.W.; Moeller, M.P.; Laughlin, G.J.; Desrosiers, A.E.

    1983-05-01

    As part of the continuing emphasis on emergency preparedness, the US Nuclear Regulatory Commission (NRC) sponsored the development of a rapid dose assessment system by Pacific Northwest Laboratory (PNL). This system, the Interactive Rapid Dose Assessment Model (IRDAM) is a micro-computer based program for rapidly assessing the radiological impact of accidents at nuclear power plants. This document describes the technical bases for IRDAM including methods, models and assumptions used in calculations. IRDAM calculates whole body (5-cm depth) and infant thyroid doses at six fixed downwind distances between 500 and 20,000 meters. Radionuclides considered primarily consist of noble gases and radioiodines. In order to provide a rapid assessment capability consistent with the capacity of the Osborne-1 computer, certain simplifying approximations and assumptions are made. These are described, along with default values (assumptions used in the absence of specific input) in the text of this document. Two companion volumes to this one provide additional information on IRDAM. The user's Guide (NUREG/CR-3012, Volume 1) describes the setup and operation of equipment necessary to run IRDAM. Scenarios for Comparing Dose Assessment Models (NUREG/CR-3012, Volume 3) provides the results of calculations made by IRDAM and other models for specific accident scenarios

  8. Three rapid methods for determination 90Sr in milk samples using liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    Abbasisiara, F.; Attarilar, N.; Afshar, N.

    2006-01-01

    Strontium radionuclide 90 Sr is one of the main long-lived components of the radioactive fallout which occurred as a result of previous atmospheric nuclear tests and also nuclear accidents such as Chernobyl accident. Due to chemical and biochemical similarities between strontium and calcium, more than 99% of strontium is efficiently incorporated into bone tissue and teeth and Characterized by along physical and biological half-life, it may cause damage to bone marrow. Since determination of this radionuclide often is a time consuming process, rapid determination methods specially in emergency situations is always desirable. In this work, three rapid methods for determination of this radionuclide in milk samples will be evaluated. All of the methods include two major steps: 1- strontium separation from fats and proteins which can be performed by drying (in case of the fresh milk samples), ashing and leaching by nitric acids or by using exchange or chelating resins which have strong affinity for alkaline earth cations such as Dowex 50W-X8. And 2- Separation of Sr-90 or its daughter product, Y-90. In two methods separation of 90 Sr is performed by extraction of the daughter nuclide, 90 Y, by aid of organic extracting agent, Tributylphosphate or T.B.P., and then Cherenkov counting of the Y-90 extracted. The third method is based on separation of this radionuclide using Crown Ether or Sr -Spec resin. The detailed radiochemical procedures and evaluation of each method advantages or disadvantages will explained in full text paper. (authors)

  9. Rapid identification and susceptibility testing of Candida spp. from positive blood cultures by combination of direct MALDI-TOF mass spectrometry and direct inoculation of Vitek 2.

    Science.gov (United States)

    Idelevich, Evgeny A; Grunewald, Camilla M; Wüllenweber, Jörg; Becker, Karsten

    2014-01-01

    Fungaemia is associated with high mortality rates and early appropriate antifungal therapy is essential for patient management. However, classical diagnostic workflow takes up to several days due to the slow growth of yeasts. Therefore, an approach for direct species identification and direct antifungal susceptibility testing (AFST) without prior time-consuming sub-culturing of yeasts from positive blood cultures (BCs) is urgently needed. Yeast cell pellets prepared using Sepsityper kit were used for direct identification by MALDI-TOF mass spectrometry (MS) and for direct inoculation of Vitek 2 AST-YS07 card for AFST. For comparison, MALDI-TOF MS and Vitek 2 testing were performed from yeast subculture. A total of twenty four positive BCs including twelve C. glabrata, nine C. albicans, two C. dubliniensis and one C. krusei isolate were processed. Applying modified thresholds for species identification (score ≥ 1.5 with two identical consecutive propositions), 62.5% of BCs were identified by direct MALDI-TOF MS. AFST results were generated for 72.7% of BCs directly tested by Vitek 2 and for 100% of standardized suspensions from 24 h cultures. Thus, AFST comparison was possible for 70 isolate-antifungal combinations. Essential agreement (minimum inhibitory concentration difference ≤ 1 double dilution step) was 88.6%. Very major errors (VMEs) (false-susceptibility), major errors (false-resistance) and minor errors (false categorization involving intermediate result) amounted to 33.3% (of resistant isolates), 1.9% (of susceptible isolates) and 1.4% providing 90.0% categorical agreement. All VMEs were due to fluconazole or voriconazole. This direct method saved on average 23.5 h for identification and 15.1 h for AFST, compared to routine procedures. However, performance for azole susceptibility testing was suboptimal and testing from subculture remains indispensable to validate the direct finding.

  10. Rapid identification and susceptibility testing of Candida spp. from positive blood cultures by combination of direct MALDI-TOF mass spectrometry and direct inoculation of Vitek 2.

    Directory of Open Access Journals (Sweden)

    Evgeny A Idelevich

    Full Text Available Fungaemia is associated with high mortality rates and early appropriate antifungal therapy is essential for patient management. However, classical diagnostic workflow takes up to several days due to the slow growth of yeasts. Therefore, an approach for direct species identification and direct antifungal susceptibility testing (AFST without prior time-consuming sub-culturing of yeasts from positive blood cultures (BCs is urgently needed. Yeast cell pellets prepared using Sepsityper kit were used for direct identification by MALDI-TOF mass spectrometry (MS and for direct inoculation of Vitek 2 AST-YS07 card for AFST. For comparison, MALDI-TOF MS and Vitek 2 testing were performed from yeast subculture. A total of twenty four positive BCs including twelve C. glabrata, nine C. albicans, two C. dubliniensis and one C. krusei isolate were processed. Applying modified thresholds for species identification (score ≥ 1.5 with two identical consecutive propositions, 62.5% of BCs were identified by direct MALDI-TOF MS. AFST results were generated for 72.7% of BCs directly tested by Vitek 2 and for 100% of standardized suspensions from 24 h cultures. Thus, AFST comparison was possible for 70 isolate-antifungal combinations. Essential agreement (minimum inhibitory concentration difference ≤ 1 double dilution step was 88.6%. Very major errors (VMEs (false-susceptibility, major errors (false-resistance and minor errors (false categorization involving intermediate result amounted to 33.3% (of resistant isolates, 1.9% (of susceptible isolates and 1.4% providing 90.0% categorical agreement. All VMEs were due to fluconazole or voriconazole. This direct method saved on average 23.5 h for identification and 15.1 h for AFST, compared to routine procedures. However, performance for azole susceptibility testing was suboptimal and testing from subculture remains indispensable to validate the direct finding.

  11. A Microfluidic Channel Method for Rapid Drug-Susceptibility Testing of Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Yoshimi Matsumoto

    Full Text Available The recent global increase in the prevalence of antibiotic-resistant bacteria and lack of development of new therapeutic agents emphasize the importance of selecting appropriate antimicrobials for the treatment of infections. However, to date, the development of completely accelerated drug susceptibility testing methods has not been achieved despite the availability of a rapid identification method. We proposed an innovative rapid method for drug susceptibility testing for Pseudomonas aeruginosa that provides results within 3 h. The drug susceptibility testing microfluidic (DSTM device was prepared using soft lithography. It consisted of five sets of four microfluidic channels sharing one inlet slot, and the four channels are gathered in a small area, permitting simultaneous microscopic observation. Antimicrobials were pre-introduced into each channel and dried before use. Bacterial suspensions in cation-adjusted Mueller-Hinton broth were introduced from the inlet slot and incubated for 3 h. Susceptibilities were microscopically evaluated on the basis of differences in cell numbers and shapes between drug-treated and control cells, using dedicated software. The results of 101 clinically isolated strains of P. aeruginosa obtained using the DSTM method strongly correlated with results obtained using the ordinary microbroth dilution method. Ciprofloxacin, meropenem, ceftazidime, and piperacillin caused elongation in susceptible cells, while meropenem also induced spheroplast and bulge formation. Morphological observation could alternatively be used to determine the susceptibility of P. aeruginosa to these drugs, although amikacin had little effect on cell shape. The rapid determination of bacterial drug susceptibility using the DSTM method could also be applicable to other pathogenic species, and it could easily be introduced into clinical laboratories without the need for expensive instrumentation.

  12. Evaluation of three sample preparation methods for the direct identification of bacteria in positive blood cultures by MALDI-TOF

    OpenAIRE

    Tanner, Hannah; Evans, Jason T.; Gossain, Savita; Hussain, Abid

    2017-01-01

    Background Patient mortality is significantly reduced by rapid identification of bacteria from sterile sites. MALDI-TOF can identify bacteria directly from positive blood cultures and multiple sample preparation methods are available. We evaluated three sample preparation methods and two MALDI-TOF score cut-off values. Positive blood culture bottles with organisms present in Gram stains were prospectively analysed by MALDI-TOF. Three lysis reagents (Saponin, SDS, and SepsiTyper lysis bufer) w...

  13. Identification of new biomarker of radiation exposure for establishing rapid, simplified biodosimetric method

    International Nuclear Information System (INIS)

    Iizuka, Daisuke; Kawai, Hidehiko; Kamiya, Kenji; Suzuki, Fumio; Izumi, Shunsuke

    2014-01-01

    Until now, counting chromosome aberration is the most accurate method for evaluating radiation doses. However, this method is time consuming and requires skills for evaluating chromosome aberrations. It could be difficult to apply this method to majority of people who are expected to be exposed to ionizing radiation. In this viewpoint, establishment of rapid, simplified biodosimetric methods for triage will be anticipated. Due to the development of mass spectrometry method and the identification of new molecules such as microRNA (miRNA), it is conceivable that new molecular biomarker of radiation exposure using some newly developed mass spectrometry. In this review article, the part of our results including the changes of protein (including the changes of glycosylation), peptide, metabolite, miRNA after radiation exposure will be shown. (author)

  14. Rapid Determination of Isomeric Benzoylpaeoniflorin and Benzoylalbiflorin in Rat Plasma by LC-MS/MS Method

    Directory of Open Access Journals (Sweden)

    Chuanqi Zhou

    2017-01-01

    Full Text Available Benzoylpaeoniflorin (BP is a potential therapeutic agent against oxidative stress related Alzheimer’s disease. In this study, a more rapid, selective, and sensitive liquid chromatography-tandem mass spectrometric (LC-MS/MS method was developed to determine BP in rat plasma distinguishing with a monoterpene isomer, benzoylalbiflorin (BA. The method showed a linear response from 1 to 1000 ng/mL (r>0.9950. The precision of the interday and intraday ranged from 2.03 to 12.48% and the accuracy values ranged from −8.00 to 10.33%. Each running of the method could be finished in 4 minutes. The LC-MS/MS method was validated for specificity, linearity, precision, accuracy, recovery, and stability and was found to be acceptable for bioanalytical application. Finally, this fully validated method was successfully applied to a pharmacokinetic study in rats following oral administration.

  15. Multifrequency Excitation Method for Rapid and Accurate Dynamic Test of Micromachined Gyroscope Chips

    Directory of Open Access Journals (Sweden)

    Yan Deng

    2014-10-01

    Full Text Available A novel multifrequency excitation (MFE method is proposed to realize rapid and accurate dynamic testing of micromachined gyroscope chips. Compared with the traditional sweep-frequency excitation (SFE method, the computational time for testing one chip under four modes at a 1-Hz frequency resolution and 600-Hz bandwidth was dramatically reduced from 10 min to 6 s. A multifrequency signal with an equal amplitude and initial linear-phase-difference distribution was generated to ensure test repeatability and accuracy. The current test system based on LabVIEW using the SFE method was modified to use the MFE method without any hardware changes. The experimental results verified that the MFE method can be an ideal solution for large-scale dynamic testing of gyroscope chips and gyroscopes.

  16. Rapid resolution of chronic shoulder pain classified as derangement using the McKenzie method: a case series

    Science.gov (United States)

    Aytona, Maria Corazon; Dudley, Karlene

    2013-01-01

    The McKenzie method, also known as Mechanical Diagnosis and Therapy (MDT), is primarily recognized as an evaluation and treatment method for the spine. However, McKenzie suggested that this method could also be applied to the extremities. Derangement is an MDT classification defined as an anatomical disturbance in the normal resting position of the joint, and McKenzie proposed that repeated movements could be applied to reduce internal joint displacement and rapidly reduce derangement symptoms. However, the current literature on MDT application to shoulder disorders is limited. Here, we present a case series involving four patients with chronic shoulder pain from a duration of 2–18 months classified as derangement and treated using MDT principles. Each patient underwent mechanical assessment and was treated with repeated movements based on their directional preference. All patients demonstrated rapid and clinically significant improvement in baseline measures and the disabilities of the arm, shoulder, and hand (QuickDASH) scores from an average of 38% at initial evaluation to 5% at discharge within 3–5 visits. Our findings suggest that MDT may be an effective treatment approach for shoulder pain. PMID:24421633

  17. Total reflection X-ray spectroscopy as a rapid analytical method for uranium determination in drainage water

    International Nuclear Information System (INIS)

    Matsuyama, Tsugufumi; Sakai, Yasuhiro; Izumoto, Yukie; Imaseki, Hitoshi; Hamano, Tsuyoshi; Yoshii, Hiroshi

    2017-01-01

    Uranium concentrations in drainage water are typically determined by α-spectrometry. However, due to the low specific radioactivity of uranium, the evaporation of large volumes of drainage water, followed by several hours of measurements, is required. Thus, the development of a rapid and simple detection method for uranium in drainage water would enhance the operation efficiency of radiation control workers. We herein propose a novel methodology based on total reflection X-ray fluorescence (TXRF) for the measurement of uranium in contaminated water. TXRF is a particularly desirable method for the rapid and simple evaluation of uranium in contaminated water, as chemical pretreatment of the sample solution is not necessary, measurement times are typically several seconds, and the required sample volume is low. We herein employed sample solutions containing several different concentrations of uranyl acetate with yttrium as an internal standard. The solutions were placed onto sample holders, and were dried prior to TXRF measurements. The relative intensity, otherwise defined as the net intensity ratio of the Lα peak of uranium to the Kα peak of yttrium, was directly proportional to the uranium concentration. Using this method, a TXRF detection limit for uranium in contaminated water of 0.30 μg/g was achieved. (author)

  18. DQM: Decentralized Quadratically Approximated Alternating Direction Method of Multipliers

    Science.gov (United States)

    Mokhtari, Aryan; Shi, Wei; Ling, Qing; Ribeiro, Alejandro

    2016-10-01

    This paper considers decentralized consensus optimization problems where nodes of a network have access to different summands of a global objective function. Nodes cooperate to minimize the global objective by exchanging information with neighbors only. A decentralized version of the alternating directions method of multipliers (DADMM) is a common method for solving this category of problems. DADMM exhibits linear convergence rate to the optimal objective but its implementation requires solving a convex optimization problem at each iteration. This can be computationally costly and may result in large overall convergence times. The decentralized quadratically approximated ADMM algorithm (DQM), which minimizes a quadratic approximation of the objective function that DADMM minimizes at each iteration, is proposed here. The consequent reduction in computational time is shown to have minimal effect on convergence properties. Convergence still proceeds at a linear rate with a guaranteed constant that is asymptotically equivalent to the DADMM linear convergence rate constant. Numerical results demonstrate advantages of DQM relative to DADMM and other alternatives in a logistic regression problem.

  19. Adjustment of a rapid method for quantification of Fusarium spp. spore suspensions in plant pathology.

    Science.gov (United States)

    Caligiore-Gei, Pablo F; Valdez, Jorge G

    2015-01-01

    The use of a Neubauer chamber is a broadly employed method when cell suspensions need to be quantified. However, this technique may take a long time and needs trained personnel. Spectrophotometry has proved to be a rapid, simple and accurate method to estimate the concentration of spore suspensions of isolates of the genus Fusarium. In this work we present a linear formula to relate absorbance measurements at 530nm with the number of microconidia/ml in a suspension. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. A simple and rapid method of purification of impure plutonium oxide

    International Nuclear Information System (INIS)

    Michael, K.M.; Rakshe, P.R.; Dharmpurikar, G.R.; Thite, B.S.; Lokhande, Manisha; Sinalkar, Nitin; Dakshinamoorthy, A.; Munshi, S.K.; Dey, P.K.

    2007-01-01

    Impure plutonium oxides are conventionally purified by dissolution in HNO 3 in presence of HF followed by ion exchange separation and oxalate precipitation. The method is tedious and use of HF enhances corrosion of the plant equipment's. A simple and rapid method has been developed for the purification of the oxide by leaching with various reagents like DM water, NaOH and oxalic acid. A combination of DM water followed by hot leaching with 0.4 M oxalic acid could bring down the impurity levels in the oxide to the desired level required for fuel fabrication. (author)

  1. Rapid method for protein quantitation by Bradford assay after elimination of the interference of polysorbate 80.

    Science.gov (United States)

    Cheng, Yongfeng; Wei, Haiming; Sun, Rui; Tian, Zhigang; Zheng, Xiaodong

    2016-02-01

    Bradford assay is one of the most common methods for measuring protein concentrations. However, some pharmaceutical excipients, such as detergents, interfere with Bradford assay even at low concentrations. Protein precipitation can be used to overcome sample incompatibility with protein quantitation. But the rate of protein recovery caused by acetone precipitation is only about 70%. In this study, we found that sucrose not only could increase the rate of protein recovery after 1 h acetone precipitation, but also did not interfere with Bradford assay. So we developed a method for rapid protein quantitation in protein drugs even if they contained interfering substances. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. A rapid method of reprocessing for electronic microscopy of cut histological in paraffin

    International Nuclear Information System (INIS)

    Hernandez Chavarri, F.; Vargas Montero, M.; Rivera, P.; Carranza, A.

    2000-01-01

    A simple and rapid method is described for re-processing of light microscopy paraffin sections to observe they under transmission electron microscopy (TEM) and scanning electron microscopy (SEM) The paraffin-embedded tissue is sectioned and deparaffinized in toluene; then exposed to osmium vapor under microwave irradiation using a domestic microwave oven. The tissues were embedded in epoxy resin, polymerized and ultrathin sectioned. The method requires a relatively short time (about 30 minutes for TEM and 15 for SEM), and produces a reasonable quality of the ultrastructure for diagnostic purposes. (Author) [es

  3. A rapid method for the computation of equilibrium chemical composition of air to 15000 K

    Science.gov (United States)

    Prabhu, Ramadas K.; Erickson, Wayne D.

    1988-01-01

    A rapid computational method has been developed to determine the chemical composition of equilibrium air to 15000 K. Eleven chemically reacting species, i.e., O2, N2, O, NO, N, NO+, e-, N+, O+, Ar, and Ar+ are included. The method involves combining algebraically seven nonlinear equilibrium equations and four linear elemental mass balance and charge neutrality equations. Computational speeds for determining the equilibrium chemical composition are significantly faster than the often used free energy minimization procedure. Data are also included from which the thermodynamic properties of air can be computed. A listing of the computer program together with a set of sample results are included.

  4. A rapid alpha spectrometric method for estimation of 233U in bulk of thorium

    International Nuclear Information System (INIS)

    Rao, K.S.; Sankar, R.; Dhami, P.S.; Tripathi, S.C.; Gandhi, P.M.

    2015-01-01

    Analytical methods play important role in entire nuclear fuel cycle. Almost all the methods find applications in some way or the other in nuclear industry. Methods which cannot be directly used owing to selectivity, find application after chemical separation of analyte from interfering components. The analytical techniques used in PUREX process are almost well matured whereas in THOREX process the analytical techniques are constantly evolving as regards to simplicity, accuracy and time of analysis

  5. Dynamics of rapid dopamine release in the nucleus accumbens during goal-directed behaviors for cocaine versus natural rewards.

    Science.gov (United States)

    Cameron, Courtney M; Wightman, R Mark; Carelli, Regina M

    2014-11-01

    Electrophysiological studies show that distinct subsets of nucleus accumbens (NAc) neurons differentially encode information about goal-directed behaviors for intravenous cocaine versus natural (food/water) rewards. Further, NAc rapid dopamine signaling occurs on a timescale similar to phasic cell firing during cocaine and natural reward-seeking behaviors. However, it is not known whether dopamine signaling is reinforcer specific (i.e., is released during responding for only one type of reinforcer) within discrete NAc locations, similar to neural firing dynamics. Here, fast-scan cyclic voltammetry (FSCV) was used to measure rapid dopamine release during multiple schedules involving sucrose reward and cocaine self-administration (n = 8 rats) and, in a separate group of rats (n = 6), during a sucrose/food multiple schedule. During the sucrose/cocaine multiple schedule, dopamine increased within seconds of operant responding for both reinforcers. Although dopamine release was not reinforcer specific, more subtle differences were observed in peak dopamine concentration [DA] across reinforcer conditions. Specifically, peak [DA] was higher during the first phase of the multiple schedule, regardless of reinforcer type. Further, the time to reach peak [DA] was delayed during cocaine-responding compared to sucrose. During the sucrose/food multiple schedule, increases in dopamine release were also observed relative to operant responding for both natural rewards. However, peak [DA] was higher relative to responding for sucrose than food, regardless of reinforcer order. Overall, the results reveal the dynamics of rapid dopamine signaling in discrete locations in the NAc across reward conditions, and provide novel insight into the functional role of this system in reward-seeking behaviors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Method Development for Rapid Analysis of Natural Radioactive Nuclides Using Sector Field Inductively Coupled Plasma Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Lim, J.M.; Ji, Y.Y.; Lee, H.; Park, J.H.; Jang, M.; Chung, K.H.; Kang, M.J.; Choi, G.S. [Korea Atomic Energy Research Institute (Korea, Republic of)

    2014-07-01

    As an attempt to reduce the social costs and apprehension arising from radioactivity in the environment, an accurate and rapid assessment of radioactivity is highly desirable. Naturally occurring radioactive materials (NORM) are widely spread throughout the environment. The concern with radioactivity from these materials has therefore been growing for the last decade. In particular, radiation exposure in the industry when handling raw materials (e.g., coal mining and combustion, oil and gas production, metal mining and smelting, mineral sands (REE, Ti, Zr), fertilizer (phosphate), and building materials) has been brought to the public's attention. To decide the proper handling options, a rapid and accurate analytical method that can be used to evaluate the radioactivity of radionuclides (e.g., {sup 238}U, {sup 235}U, {sup 232}Th, {sup 226}Ra, and {sup 40}K) should be developed and validated. Direct measuring methods such as alpha spectrometry, a liquid scintillation counter (LSC), and mass-spectrometry are usually used for the measurement of radioactivity in NORM samples, and they encounter the most significant difficulties during pretreatment (e.g., purification, speciation, and dilution/enrichment). Since the pretreatment process consequently plays an important role in the measurement uncertainty, method development and validation should be performed. Furthermore, a-spectrometry has a major disadvantage of a long counting time, while it has a prominent measurement capability at a very low activity level of {sup 238}U, {sup 235}U, {sup 232}Th, and {sup 226}Ra. Contrary to the α-spectrometry method, a measurement technique using ICP-MS allow radioactivity in many samples to be measured in a short time period with a high degree of accuracy and precision. In this study, a method was developed for a rapid analysis of natural radioactive nuclides using ICP-MS. A sample digestion process was established using LiBO{sub 2} fusion and Fe co-precipitation. A magnetic

  7. N-nitrosodimethylamine in drinking water using a rapid, solid-phase extraction method

    Energy Technology Data Exchange (ETDEWEB)

    Jenkins, S W.D. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Koester, C J [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Taguchi, V Y [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Wang, D T [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Palmentier, J P.F.P. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Hong, K P [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch

    1995-12-01

    A simple, rapid method for the extraction of N-nitrosodimethylamine (NDMA) from drinking and surface waters was developed using Ambersorb 572. Development of an alternative method to classical liquid-liquid extraction techniques was necessary to handle the workload presented by implementation of a provincial guideline of 9 ppt for drinking water and a regulatory level of 200 ppt for effluents. A granular absorbent, Ambersorb 572, was used to extract the NDMA from the water in the sample bottle. The NDMA was extracted from the Ambersorb 572 with dichloromethane in the autosampler vial. Method characteristics include a precision of 4% for replicate analyses, and accuracy of 6% at 10 ppt and a detection limit of 1.0 ppt NDMA in water. Comparative data between the Ambersorb 572 method and liquid-liquid extraction showed excellent agreement (average difference of 12%). With the Ambersorb 572 method, dichloromethane use has been reduced by a factor of 1,000 and productivity has been increased by a factor of 3-4. Monitoring of a drinking water supply showed rapidly changing concentrations of NDMA from day to day. (orig.)

  8. An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.

    Science.gov (United States)

    Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin

    2017-12-19

    Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.

  9. Linogram and other direct Fourier methods for tomographic reconstruction

    International Nuclear Information System (INIS)

    Magnusson, M.

    1993-01-01

    Computed tomography (CT) is an outstanding break-through in technology as well as in medical diagnostics. The aim in CT is to produce an image with good image quality as fast as possible. The two most well-known methods for CT-reconstruction are the Direct Fourier Method (DFM) and the Filtered Backprojection Method (FBM). This thesis is divided in four parts. In part 1 we give an introduction to the principles of CT as well as a basic treatise of the DFM and the FBM. We also present a short CT history as well as brief descriptions of techniques related to X-ray CT such as SPECT, PET and MRI. Part 2 is devoted to the Linogram Method (LM). The method is presented both intuitively and rigorously and a complete algorithm is given for the discrete case. The implementation has been done using the SNARK subroutine package with various parameters and phantom images. For comparison, the FBM has been applied to the same input projection data. The experiments show that the LM gives almost the same image quality, pixel for pixel, as the FBM. In part 3 we show that the LM is a close relative to the common DFM. We give a new extended explanation of artifacts in DFMs. The source of the problem is twofold: interpolation errors and circular convolution. By identifying the second effect as distinct from the first one, we are able to suggest and verify remedies for the DFM which brings the image quality on par with FBM. One of these remedies is the LM. A slight difficulty with both LM and ordinary DFM techniques is that they require a special projection geometry, whereas most commercial CT-scanners provides fan beam projection data. However, the wanted linogram projection data can be interpolated from fan beam projection data. In part 4, we show that it is possible to obtain good image quality with both LM and DFM techniques using fan beam projection indata. The thesis concludes that the computation cost can be essentially decreased by using LM or other DFMs instead of FBM

  10. A rapid Salmonella detection method involving thermophilic helicase-dependent amplification and a lateral flow assay.

    Science.gov (United States)

    Du, Xin-Jun; Zhou, Tian-Jiao; Li, Ping; Wang, Shuo

    2017-08-01

    Salmonella is a major foodborne pathogen that is widespread in the environment and can cause serious human and animal disease. Since conventional culture methods to detect Salmonella are time-consuming and laborious, rapid and accurate techniques to detect this pathogen are critically important for food safety and diagnosing foodborne illness. In this study, we developed a rapid, simple and portable Salmonella detection strategy that combines thermophilic helicase-dependent amplification (tHDA) with a lateral flow assay to provide a detection result based on visual signals within 90 min. Performance analyses indicated that the method had detection limits for DNA and pure cultured bacteria of 73.4-80.7 fg and 35-40 CFU, respectively. Specificity analyses showed no cross reactions with Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Enterobacter aerogenes, Shigella and Campylobacter jejuni. The results for detection in real food samples showed that 1.3-1.9 CFU/g or 1.3-1.9 CFU/mL of Salmonella in contaminated chicken products and infant nutritional cereal could be detected after 2 h of enrichment. The same amount of Salmonella in contaminated milk could be detected after 4 h of enrichment. This tHDA-strip can be used for the rapid detection of Salmonella in food samples and is particularly suitable for use in areas with limited equipment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Simple Sample Preparation Method for Direct Microbial Identification and Susceptibility Testing From Positive Blood Cultures.

    Science.gov (United States)

    Pan, Hong-Wei; Li, Wei; Li, Rong-Guo; Li, Yong; Zhang, Yi; Sun, En-Hua

    2018-01-01

    Rapid identification and determination of the antibiotic susceptibility profiles of the infectious agents in patients with bloodstream infections are critical steps in choosing an effective targeted antibiotic for treatment. However, there has been minimal effort focused on developing combined methods for the simultaneous direct identification and antibiotic susceptibility determination of bacteria in positive blood cultures. In this study, we constructed a lysis-centrifugation-wash procedure to prepare a bacterial pellet from positive blood cultures, which can be used directly for identification by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) and antibiotic susceptibility testing by the Vitek 2 system. The method was evaluated using a total of 129 clinical bacteria-positive blood cultures. The whole sample preparation process could be completed in identification was 96.49% for gram-negative bacteria and 97.22% for gram-positive bacteria. Vitek 2 antimicrobial susceptibility testing of gram-negative bacteria showed an agreement rate of antimicrobial categories of 96.89% with a minor error, major error, and very major error rate of 2.63, 0.24, and 0.24%, respectively. Category agreement of antimicrobials against gram-positive bacteria was 92.81%, with a minor error, major error, and very major error rate of 4.51, 1.22, and 1.46%, respectively. These results indicated that our direct antibiotic susceptibility analysis method worked well compared to the conventional culture-dependent laboratory method. Overall, this fast, easy, and accurate method can facilitate the direct identification and antibiotic susceptibility testing of bacteria in positive blood cultures.

  12. The performance studies of DKDP crystals grown by a rapid horizontal growth method

    Science.gov (United States)

    Xie, Xiaoyi; Qi, Hongji; Wang, Bin; Wang, Hu; Chen, Duanyang; Shao, Jianda

    2018-04-01

    A deuterated potassium dihydrogen phosphate (DKDP) crystal with about 70% deuterium level was grown by a rapid horizontal growth method with independent design equipment, which includes a continuous filtration system. The cooling program during crystal growth was designed according to a self-developed software to catch the size of growing crystal in real time. The crystal structure, optical performance and laser induced damage threshold (LIDT) of this DKDP crystal were investigated in this paper. The deuterium concentration of the crystal was confirmed by the neutron diffraction technique, which was effective and available in determining a complete range of deuteration level. The dielectric property was measured to evaluate the perfection of the lattice. The transmittance and LIDT were carried out further to evaluate the optical and functional properties of this DKDP crystal grown in the rapid horizontal growth technique. All of the detailed characterization for DKDP figured out that the 70% deuterated KDP crystal grown in this way had relatively good qualities.

  13. A rapid method for counting nucleated erythrocytes on stained blood smears by digital image analysis

    Science.gov (United States)

    Gering, E.; Atkinson, C.T.

    2004-01-01

    Measures of parasitemia by intraerythrocytic hematozoan parasites are normally expressed as the number of infected erythrocytes per n erythrocytes and are notoriously tedious and time consuming to measure. We describe a protocol for generating rapid counts of nucleated erythrocytes from digital micrographs of thin blood smears that can be used to estimate intensity of hematozoan infections in nonmammalian vertebrate hosts. This method takes advantage of the bold contrast and relatively uniform size and morphology of erythrocyte nuclei on Giemsa-stained blood smears and uses ImageJ, a java-based image analysis program developed at the U.S. National Institutes of Health and available on the internet, to recognize and count these nuclei. This technique makes feasible rapid and accurate counts of total erythrocytes in large numbers of microscope fields, which can be used in the calculation of peripheral parasitemias in low-intensity infections.

  14. Fluorescence In Situ Hybridization with Peptide Nucleic Acid Probes for Rapid Identification of Candida albicans Directly from Blood Culture Bottles

    Science.gov (United States)

    Rigby, Susan; Procop, Gary W.; Haase, Gerhard; Wilson, Deborah; Hall, Geraldine; Kurtzman, Cletus; Oliveira, Kenneth; Von Oy, Sabina; Hyldig-Nielsen, Jens J.; Coull, James; Stender, Henrik

    2002-01-01

    A new fluorescence in situ hybridization (FISH) method that uses peptide nucleic acid (PNA) probes for identification of Candida albicans directly from positive-blood-culture bottles in which yeast was observed by Gram staining (herein referred to as yeast-positive blood culture bottles) is described. The test (the C. albicans PNA FISH method) is based on a fluorescein-labeled PNA probe that targets C. albicans 26S rRNA. The PNA probe is added to smears made directly from the contents of the blood culture bottle and hybridized for 90 min at 55°C. Unhybridized PNA probe is removed by washing of the mixture (30 min), and the smears are examined by fluorescence microscopy. The specificity of the method was confirmed with 23 reference strains representing phylogenetically related yeast species and 148 clinical isolates covering the clinically most significant yeast species, including C. albicans (n = 72), C. dubliniensis (n = 58), C. glabrata (n = 5), C. krusei (n = 2), C. parapsilosis (n = 4), and C. tropicalis (n = 3). The performance of the C. albicans PNA FISH method as a diagnostic test was evaluated with 33 routine and 25 simulated yeast-positive blood culture bottles and showed 100% sensitivity and 100% specificity. It is concluded that this 2.5-h method for the definitive identification of C. albicans directly from yeast-positive blood culture bottles provides important information for optimal antifungal therapy and patient management. PMID:12037084

  15. A rapid and specific titrimetric method for the precise determination of plutonium using redox indicator

    International Nuclear Information System (INIS)

    Chitnis, R.T.; Dubey, S.C.

    1976-01-01

    A simple and rapid method for the determination of plutonium in plutonium nitrate solution and its application to the purex process solutions is discussed. The method involves the oxidation of plutonium to Pu(VI) with the help of argentic oxide followed by the destruction of the excess argentic oxide by means of sulphamic acid. The determination of plutonium is completed by adding ferrous ammonium sulphate solution which reduces Pu(VI) to Pu(IV) and titrating the excess ferrous with standard potassium dichromate solution using sodium diphenylamine sulphonate as the internal indicator. The effect of the various reagents add during the oxidation and reduction of plutonium, on the final titration has been investigated. The method works satisfactorily for the analysis of plutonium in the range of 0.5 to 5 mg. The precision of the method is found to be within 0.1%. (author)

  16. New modelling method for fast reactor neutronic behaviours analysis; Nouvelles methodes de modelisation neutronique des reacteurs rapides de quatrieme Generation

    Energy Technology Data Exchange (ETDEWEB)

    Jacquet, P.

    2011-05-23

    Due to safety rules running on fourth generation reactors' core development, neutronics simulation tools have to be as accurate as never before. First part of this report enumerates every step of fast reactor's neutronics simulation implemented in current reference code: ECCO. Considering the field of fast reactors that meet criteria of fourth generation, ability of models to describe self-shielding phenomenon, to simulate neutrons leakage in a lattice of fuel assemblies and to produce representative macroscopic sections is evaluated. The second part of this thesis is dedicated to the simulation of fast reactors' core with steel reflector. These require the development of advanced methods of condensation and homogenization. Several methods are proposed and compared on a typical case: the ZONA2B core of MASURCA reactor. (author) [French] Les criteres de surete qui regissent le developpement de coeurs de reacteurs de quatrieme generation implique l'usage d'outils de calcul neutronique performants. Une premiere partie de la these reprend toutes les etapes de modelisation neutronique des reacteurs rapides actuellement d'usage dans le code de reference ECCO. La capacite des modeles a decrire le phenomene d'autoprotection, a representer les fuites neutroniques au niveau d'un reseau d'assemblages combustibles et a generer des sections macroscopiques representatives est appreciee sur le domaine des reacteurs rapides innovants respectant les criteres de quatrieme generation. La deuxieme partie de ce memoire se consacre a la modelisation des coeurs rapides avec reflecteur acier. Ces derniers necessitent le developpement de methodes avancees de condensation et d'homogenisation. Plusieurs methodes sont proposees et confrontees sur un probleme de modelisation typique: le coeur ZONA2B du reacteur maquette MASURCA

  17. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

    Science.gov (United States)

    Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

    2011-09-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

  18. Rapid screening and quantification of residual pesticides and illegal adulterants in red wine by direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Guo, Tianyang; Fang, Pingping; Jiang, Juanjuan; Zhang, Feng; Yong, Wei; Liu, Jiahui; Dong, Yiyang

    2016-11-04

    A rapid method to screen and quantify multi-class analytic targets in red wine has been developed by direct analysis in real time (DART) coupled with triple quadruple tandem mass spectrometry (QqQ-MS). A modified QuEChERS (Quick, Easy, Cheap, Effective, Rugged, and Safe) procedure was used for increasing analytical speed and reducing matrix effect, and the multiple reaction monitoring (MRM) in DART-MS/MS ensured accurate analysis. One bottle of wine containing 50 pesticides and 12 adulterants, i.e., preservatives, antioxidant, sweeteners, and azo dyes, could be totally determined less than 12min. This method exhibited proper linearity (R 2 ≥0.99) in the range of 1-1000ng/mL for pesticides and 10-5000ng/mL for adulterants. The limits of detection (LODs) were obtained in a 0.5-50ng/mL range for pesticides and 5-50ng/mL range for adulterants, and the limits of quantification (LOQs) were in a 1-100ng/mL range for pesticides and 10-250ng/mL range for adulterants. Three spiked levels for each analyte in wine were evaluated, and the recoveries were in a scope of 75-120%. The results demonstrated DART-MS/MS was a rapid and simple method, and could be applied to rapid analyze residual pesticides and illegal adulterants in a large quantities of red wine. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. [Accuracy of three methods for the rapid diagnosis of oral candidiasis].

    Science.gov (United States)

    Lyu, X; Zhao, C; Yan, Z M; Hua, H

    2016-10-09

    Objective: To explore a simple, rapid and efficient method for the diagnosis of oral candidiasis in clinical practice. Methods: Totally 124 consecutive patients with suspected oral candidiasis were enrolled from Department of Oral Medicine, Peking University School and Hospital of Stomatology, Beijing, China. Exfoliated cells of oral mucosa and saliva or concentrated oral rinse) obtained from all participants were tested by three rapid smear methods(10% KOH smear, gram-stained smear, Congo red stained smear). The diagnostic efficacy(sensitivity, specificity, Youden's index, likelihood ratio, consistency, predictive value and area under curve(AUC) of each of the above mentioned three methods was assessed by comparing the results with the gold standard(combination of clinical diagnosis, laboratory diagnosis and expert opinion). Results: Gram-stained smear of saliva(or concentrated oral rinse) demonstrated highest sensitivity(82.3%). Test of 10%KOH smear of exfoliated cells showed highest specificity(93.5%). Congo red stained smear of saliva(or concentrated oral rinse) displayed highest diagnostic efficacy(79.0% sensitivity, 80.6% specificity, 0.60 Youden's index, 4.08 positive likelihood ratio, 0.26 negative likelihood ratio, 80% consistency, 80.3% positive predictive value, 79.4% negative predictive value and 0.80 AUC). Conclusions: Test of Congo red stained smear of saliva(or concentrated oral rinse) could be used as a point-of-care tool for the rapid diagnosis of oral candidiasis in clinical practice. Trial registration: Chinese Clinical Trial Registry, ChiCTR-DDD-16008118.

  20. Use of refractometry and colorimetry as field methods to rapidly assess antimalarial drug quality.

    Science.gov (United States)

    Green, Michael D; Nettey, Henry; Villalva Rojas, Ofelia; Pamanivong, Chansapha; Khounsaknalath, Lamphet; Grande Ortiz, Miguel; Newton, Paul N; Fernández, Facundo M; Vongsack, Latsamy; Manolin, Ot

    2007-01-04

    The proliferation of counterfeit and poor-quality drugs is a major public health problem; especially in developing countries lacking adequate resources to effectively monitor their prevalence. Simple and affordable field methods provide a practical means of rapidly monitoring drug quality in circumstances where more advanced techniques are not available. Therefore, we have evaluated refractometry, colorimetry and a technique combining both processes as simple and accurate field assays to rapidly test the quality of the commonly available antimalarial drugs; artesunate, chloroquine, quinine, and sulfadoxine. Method bias, sensitivity, specificity and accuracy relative to high-performance liquid chromatographic (HPLC) analysis of drugs collected in the Lao PDR were assessed for each technique. The HPLC method for each drug was evaluated in terms of assay variability and accuracy. The accuracy of the combined method ranged from 0.96 to 1.00 for artesunate tablets, chloroquine injectables, quinine capsules, and sulfadoxine tablets while the accuracy was 0.78 for enterically coated chloroquine tablets. These techniques provide a generally accurate, yet simple and affordable means to assess drug quality in resource-poor settings.

  1. Design method for marine direct drive volume control ahead actuator

    Directory of Open Access Journals (Sweden)

    WANG Haiyang

    2018-02-01

    Full Text Available [Objectives] In order to reduce the size, weight and auxiliary system configuration of marine ahead actuators, this paper proposes a kind of direct drive volume control electro-hydraulic servo ahead actuator. [Methods] The protruding and indenting control of the servo oil cylinder are realized through the forward and reverse of the bidirectional working gear pump, and the flow matching valve implements the self-locking of the ahead actuator in the target position. The mathematical model of the ahead actuator is established, and an integral separation fuzzy PID controller designed. On this basis, using AMESim software to build a simulation model of the ahead actuator, and combined with testing, this paper completes an analysis of the control strategy research and dynamic and static performance of the ahead actuator. [Results] The experimental results agree well with the simulation results and verify the feasibility of the ahead actuator's design. [Conclusions] The research results of this paper can provide valuable references for the integration and miniaturization design of marine ahead actuators.

  2. Evaluation of rapid methods for in-situ characterization of organic contaminant load and biodegradation rates in winery wastewater.

    Science.gov (United States)

    Carvallo, M J; Vargas, I; Vega, A; Pizarro, G; Pizarr, G; Pastén, P

    2007-01-01

    Rapid methods for the in-situ evaluation of the organic load have recently been developed and successfully implemented in municipal wastewater treatment systems. Their direct application to winery wastewater treatment is questionable due to substantial differences between municipal and winery wastewater. We critically evaluate the use of UV-VIS spectrometry, buffer capacity testing (BCT), and respirometry as rapid methods to determine organic load and biodegradation rates of winery wastewater. We tested three types of samples: actual and treated winery wastewater, synthetic winery wastewater, and samples from a biological batch reactor. Not surprisingly, respirometry gave a good estimation of biodegradation rates for substrate of different complexities, whereas UV-VIS and BCT did not provide a quantitative measure of the easily degradable sugars and ethanol, typically the main components of the COD in the influent. However, our results strongly suggest that UV-VIS and BCT can be used to identify and estimate the concentration of complex substrates in the influent and soluble microbial products (SMP) in biological reactors and their effluent. Furthermore, the integration of UV-VIS spectrometry, BCT, and mathematical modeling was able to differentiate between the two components of SMPs: substrate utilization associated products (UAP) and biomass associated products (BAP). Since the effluent COD in biologically treated wastewaters is composed primarily by SMPs, the quantitative information given by these techniques may be used for plant control and optimization.

  3. Frontal transcranial direct current stimulation (tDCS) abolishes list-method directed forgetting.

    Science.gov (United States)

    Silas, Jonathan; Brandt, Karen R

    2016-03-11

    It is a point of controversy as to whether directed forgetting effects are a result of active inhibition or a change of context initiated by the instruction to forget. In this study we test the causal role of active inhibition in directed forgetting. By applying cathodal transcranial direct current stimulation (tDCS) over the right prefrontal cortex we suppressed cortical activity commonly associated with inhibitory control. Participants who underwent real brain stimulation before completing the directed forgetting paradigm showed no directed forgetting effects. Conversely, those who underwent sham brain stimulation demonstrated classical directed forgetting effects. We argue that these findings suggest that inhibition is the primary mechanism that results in directed forgetting costs and benefits. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Hierarchically rough, mechanically durable and superhydrophobic epoxy coatings through rapid evaporation spray method

    International Nuclear Information System (INIS)

    Simovich, Tomer; Wu, Alex H.; Lamb, Robert N.

    2015-01-01

    A mechanically durable and scalable superhydrophobic coating was fabricated by combining the advantages of both bottom-up and top-down approaches into a one-pot, one-step application method. This is achieved by spray coating a solution consisting of silica nanoparticles, which are embedded within epoxy resin, onto a heated substrate to rapidly drive both solvent evaporation and curing simultaneously. By maintaining a high substrate temperature, the arrival of spray-delivered micrometer-sized droplets are rapidly cured onto the substrate to form surface microroughness, while simultaneously, rapid solvent evaporation within each droplet results in the formation of a nanoporous structure. SEM, dual-beam FIB, and cross-sectional TEM/EDAX elemental mapping were used to confirm both the chemistry and the requisite micro- and nano-porosity within the coating structure requisite for superhydrophobicity. The resultant coatings exhibit contact angles greater than 150° (153.8° ± 0.8°) and roll-off angles of 8° ± 2°, with a coating hardness of 6H on the pencil hardness scale, and a rating of 5 on an ASTM crosshatch test. - Highlights: • A highly superhydrophobic coating was fabricated utilizing epoxy and nanoparticles. • The coating was demonstrated to be very durable and abrasion resistant. • The fabrication involves a novel, scalable one-pot synthesis technique

  5. Hierarchically rough, mechanically durable and superhydrophobic epoxy coatings through rapid evaporation spray method

    Energy Technology Data Exchange (ETDEWEB)

    Simovich, Tomer; Wu, Alex H.; Lamb, Robert N., E-mail: rnlamb@unimelb.edu.au

    2015-08-31

    A mechanically durable and scalable superhydrophobic coating was fabricated by combining the advantages of both bottom-up and top-down approaches into a one-pot, one-step application method. This is achieved by spray coating a solution consisting of silica nanoparticles, which are embedded within epoxy resin, onto a heated substrate to rapidly drive both solvent evaporation and curing simultaneously. By maintaining a high substrate temperature, the arrival of spray-delivered micrometer-sized droplets are rapidly cured onto the substrate to form surface microroughness, while simultaneously, rapid solvent evaporation within each droplet results in the formation of a nanoporous structure. SEM, dual-beam FIB, and cross-sectional TEM/EDAX elemental mapping were used to confirm both the chemistry and the requisite micro- and nano-porosity within the coating structure requisite for superhydrophobicity. The resultant coatings exhibit contact angles greater than 150° (153.8° ± 0.8°) and roll-off angles of 8° ± 2°, with a coating hardness of 6H on the pencil hardness scale, and a rating of 5 on an ASTM crosshatch test. - Highlights: • A highly superhydrophobic coating was fabricated utilizing epoxy and nanoparticles. • The coating was demonstrated to be very durable and abrasion resistant. • The fabrication involves a novel, scalable one-pot synthesis technique.

  6. Pressure-jump induced rapid solidification of melt: a method of preparing amorphous materials

    Science.gov (United States)

    Liu, Xiuru; Jia, Ru; Zhang, Doudou; Yuan, Chaosheng; Shao, Chunguang; Hong, Shiming

    2018-04-01

    By using a self-designed pressure-jump apparatus, we investigated the melt solidification behavior in rapid compression process for several kinds of materials, such as elementary sulfur, polymer polyether-ether-ketone (PEEK) and poly-ethylene-terephthalate, alloy La68Al10Cu20Co2 and Nd60Cu20Ni10Al10. Experimental results clearly show that their melts could be solidified to be amorphous states through the rapid compression process. Bulk amorphous PEEK with 24 mm in diameter and 12 mm in height was prepared, which exceeds the size obtained by melt quenching method. The bulk amorphous sulfur thus obtained exhibited extraordinarily high thermal stability, and an abnormal exothermic transition to liquid sulfur was observed at around 396 K for the first time. Furthermore, it is suggested that the glass transition pressure and critical compression rate exist to form the amorphous phase. This approach of rapid compression is very attractive not only because it is a new technique of make bulk amorphous materials, but also because novel properties are expected in the amorphous materials solidified by the pressure-jump within milliseconds or microseconds.

  7. Direct quantification of fatty acids in wet microalgal and yeast biomass via a rapid in situ fatty acid methyl ester derivatization approach.

    Science.gov (United States)

    Dong, Tao; Yu, Liang; Gao, Difeng; Yu, Xiaochen; Miao, Chao; Zheng, Yubin; Lian, Jieni; Li, Tingting; Chen, Shulin

    2015-12-01

    Accurate determination of fatty acid contents is routinely required in microalgal and yeast biofuel studies. A method of rapid in situ fatty acid methyl ester (FAME) derivatization directly from wet fresh microalgal and yeast biomass was developed in this study. This method does not require prior solvent extraction or dehydration. FAMEs were prepared with a sequential alkaline hydrolysis (15 min at 85 °C) and acidic esterification (15 min at 85 °C) process. The resulting FAMEs were extracted into n-hexane and analyzed using gas chromatography. The effects of each processing parameter (temperature, reaction time, and water content) upon the lipids quantification in the alkaline hydrolysis step were evaluated with a full factorial design. This method could tolerate water content up to 20% (v/v) in total reaction volume, which equaled up to 1.2 mL of water in biomass slurry (with 0.05-25 mg of fatty acid). There were no significant differences in FAME quantification (p>0.05) between the standard AOAC 991.39 method and the proposed wet in situ FAME preparation method. This fatty acid quantification method is applicable to fresh wet biomass of a wide range of microalgae and yeast species.

  8. Assessing direct analysis in real-time-mass spectrometry (DART-MS) for the rapid identification of additives in food packaging.

    Science.gov (United States)

    Ackerman, L K; Noonan, G O; Begley, T H

    2009-12-01

    The ambient ionization technique direct analysis in real time (DART) was characterized and evaluated for the screening of food packaging for the presence of packaging additives using a benchtop mass spectrometer (MS). Approximate optimum conditions were determined for 13 common food-packaging additives, including plasticizers, anti-oxidants, colorants, grease-proofers, and ultraviolet light stabilizers. Method sensitivity and linearity were evaluated using solutions and characterized polymer samples. Additionally, the response of a model additive (di-ethyl-hexyl-phthalate) was examined across a range of sample positions, DART, and MS conditions (temperature, voltage and helium flow). Under optimal conditions, molecular ion (M+H+) was the major ion for most additives. Additive responses were highly sensitive to sample and DART source orientation, as well as to DART flow rates, temperatures, and MS inlet voltages, respectively. DART-MS response was neither consistently linear nor quantitative in this setting, and sensitivity varied by additive. All additives studied were rapidly identified in multiple food-packaging materials by DART-MS/MS, suggesting this technique can be used to screen food packaging rapidly. However, method sensitivity and quantitation requires further study and improvement.

  9. A rapid and sensitive method for measuring N-acetylglucosaminidase activity in cultured cells.

    Directory of Open Access Journals (Sweden)

    Victor Mauri

    Full Text Available A rapid and sensitive method to quantitatively assess N-acetylglucosaminidase (NAG activity in cultured cells is highly desirable for both basic research and clinical studies. NAG activity is deficient in cells from patients with Mucopolysaccharidosis type IIIB (MPS IIIB due to mutations in NAGLU, the gene that encodes NAG. Currently available techniques for measuring NAG activity in patient-derived cell lines include chromogenic and fluorogenic assays and provide a biochemical method for the diagnosis of MPS IIIB. However, standard protocols require large amounts of cells, cell disruption by sonication or freeze-thawing, and normalization to the cellular protein content, resulting in an error-prone procedure that is material- and time-consuming and that produces highly variable results. Here we report a new procedure for measuring NAG activity in cultured cells. This procedure is based on the use of the fluorogenic NAG substrate, 4-Methylumbelliferyl-2-acetamido-2-deoxy-alpha-D-glucopyranoside (MUG, in a one-step cell assay that does not require cell disruption or post-assay normalization and that employs a low number of cells in 96-well plate format. We show that the NAG one-step cell assay greatly discriminates between wild-type and MPS IIIB patient-derived fibroblasts, thus providing a rapid method for the detection of deficiencies in NAG activity. We also show that the assay is sensitive to changes in NAG activity due to increases in NAGLU expression achieved by either overexpressing the transcription factor EB (TFEB, a master regulator of lysosomal function, or by inducing TFEB activation chemically. Because of its small format, rapidity, sensitivity and reproducibility, the NAG one-step cell assay is suitable for multiple procedures, including the high-throughput screening of chemical libraries to identify modulators of NAG expression, folding and activity, and the investigation of candidate molecules and constructs for applications in

  10. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  11. Validation and application of an improved method for the rapid determination of proline in grape berries.

    Science.gov (United States)

    Rienth, Markus; Romieu, Charles; Gregan, Rebecca; Walsh, Caroline; Torregrosa, Laurent; Kelly, Mary T

    2014-04-16

    A rapid and sensitive method is presented for the determination of proline in grape berries. Following acidification with formic acid, proline is derivatized by heating at 100 °C for 15 min with 3% ninhydrin in dimethyl sulfoxide, and the absorbance, which is stable for at least 60 min, is read at 520 nm. The method was statistically validated in the concentration range from 2.5 to 15 mg/L, giving a repeatability and intermediate precision of generally amino acid analyzer. In terms of sample preparation, a simple dilution (5-20-fold) is required, and sugars, primary amino acids, and anthocyanins were demonstrated not to interfere, as the latter are bleached by ninhydrin under the experimental conditions. The method was applied to the study of proline accumulation in the fruits of microvines grown in phytotrons, and it was established that proline accumulation and concentrations closely resemble those of field-grown macrovines.

  12. Rapid synthesis of single-phase bismuth ferrite by microwave-assisted hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Wenqian [College of Materials Science and Engineering, China Jiliang University, 258 Xueyuan Street, Xiasha Higher Education District, Hangzhou 310018, Zhejiang Province (China); Chen, Zhi, E-mail: zchen0@gmail.com [College of Materials Science and Engineering, China Jiliang University, 258 Xueyuan Street, Xiasha Higher Education District, Hangzhou 310018, Zhejiang Province (China); Gao, Tong; Zhou, Dantong; Leng, Xiaonan; Niu, Feng [College of Materials Science and Engineering, China Jiliang University, 258 Xueyuan Street, Xiasha Higher Education District, Hangzhou 310018, Zhejiang Province (China); Zhu, Yuxiang [College of Materials Science and Engineering, China Jiliang University, 258 Xueyuan Street, Xiasha Higher Education District, Hangzhou 310018, Zhejiang Province (China); Tianjin Key Laboratory of Marine Resources and Chemistry, Tianjin University of Science and Technology, Tianjin (China); Qin, Laishun, E-mail: qinlaishun@yeah.net [College of Materials Science and Engineering, China Jiliang University, 258 Xueyuan Street, Xiasha Higher Education District, Hangzhou 310018, Zhejiang Province (China); Wang, Jiangying; Huang, Yuexiang [College of Materials Science and Engineering, China Jiliang University, 258 Xueyuan Street, Xiasha Higher Education District, Hangzhou 310018, Zhejiang Province (China)

    2016-06-01

    This paper describes on the fast synthesis of bismuth ferrite by the simple microwave-assisted hydrothermal method. The phase transformation and the preferred growth facets during the synthetic process have been investigated by X-ray diffraction. Bismuth ferrite can be quickly prepared by microwave hydrothermal method by simply controlling the reaction time, which is further confirmed by Fourier Transform infrared spectroscopy and magnetic measurement. - Graphical abstract: Single-phase BiFeO{sub 3} could be realized at a shortest reaction time of 65 min. The reaction time has strong influences on the phase transformation and the preferred growth facets. - Highlights: • Rapid synthesis (65 min) of BiFeO{sub 3} by microwave-assisted hydrothermal method. • Reaction time has influence on the purity and preferred growth facets. • FTIR and magnetic measurement further confirm the pure phase.

  13. Are rapid population estimates accurate? A field trial of two different assessment methods.

    Science.gov (United States)

    Grais, Rebecca F; Coulombier, Denis; Ampuero, Julia; Lucas, Marcelino E S; Barretto, Avertino T; Jacquier, Guy; Diaz, Francisco; Balandine, Serge; Mahoudeau, Claude; Brown, Vincent

    2006-09-01

    Emergencies resulting in large-scale displacement often lead to populations resettling in areas where basic health services and sanitation are unavailable. To plan relief-related activities quickly, rapid population size estimates are needed. The currently recommended Quadrat method estimates total population by extrapolating the average population size living in square blocks of known area to the total site surface. An alternative approach, the T-Square, provides a population estimate based on analysis of the spatial distribution of housing units taken throughout a site. We field tested both methods and validated the results against a census in Esturro Bairro, Beira, Mozambique. Compared to the census (population: 9,479), the T-Square yielded a better population estimate (9,523) than the Quadrat method (7,681; 95% confidence interval: 6,160-9,201), but was more difficult for field survey teams to implement. Although applicable only to similar sites, several general conclusions can be drawn for emergency planning.

  14. Rapid synthesis of single-phase bismuth ferrite by microwave-assisted hydrothermal method

    International Nuclear Information System (INIS)

    Cao, Wenqian; Chen, Zhi; Gao, Tong; Zhou, Dantong; Leng, Xiaonan; Niu, Feng; Zhu, Yuxiang; Qin, Laishun; Wang, Jiangying; Huang, Yuexiang

    2016-01-01

    This paper describes on the fast synthesis of bismuth ferrite by the simple microwave-assisted hydrothermal method. The phase transformation and the preferred growth facets during the synthetic process have been investigated by X-ray diffraction. Bismuth ferrite can be quickly prepared by microwave hydrothermal method by simply controlling the reaction time, which is further confirmed by Fourier Transform infrared spectroscopy and magnetic measurement. - Graphical abstract: Single-phase BiFeO_3 could be realized at a shortest reaction time of 65 min. The reaction time has strong influences on the phase transformation and the preferred growth facets. - Highlights: • Rapid synthesis (65 min) of BiFeO_3 by microwave-assisted hydrothermal method. • Reaction time has influence on the purity and preferred growth facets. • FTIR and magnetic measurement further confirm the pure phase.

  15. Rapid determination method of radiocesium in sea water by cesium-selective resin

    International Nuclear Information System (INIS)

    Nakaoka, A.; Yokoyama, H.; Fukushima, M.; Takagi, S.

    1980-01-01

    A rapid and precise method of determining radiocesium corresponding to 5 mrem/y (the Japan AEC's guideline) was proposed. The development and practical performance of cesium-selective resin and the determination method are described in this paper. The resin was prepared by the formation of ammonium molybdophosphate in the structure of Amberlite XAD-7 resin. It took only 3 hours to carry out all the procedures the authors proposed. This value represents 1/10 to 1/2 of the time of the conventional method. The concentration of 137 Cs and 134 Cs in sea water was determined to be 0.13 to 0.16 pCi/l and less than 7.1x10 -2 pCi/l, respectively. (author)

  16. An evaluation of rapid methods for monitoring vegetation characteristics of wetland bird habitat

    Science.gov (United States)

    Tavernia, Brian G.; Lyons, James E.; Loges, Brian W.; Wilson, Andrew; Collazo, Jaime A.; Runge, Michael C.

    2016-01-01

    Wetland managers benefit from monitoring data of sufficient precision and accuracy to assess wildlife habitat conditions and to evaluate and learn from past management decisions. For large-scale monitoring programs focused on waterbirds (waterfowl, wading birds, secretive marsh birds, and shorebirds), precision and accuracy of habitat measurements must be balanced with fiscal and logistic constraints. We evaluated a set of protocols for rapid, visual estimates of key waterbird habitat characteristics made from the wetland perimeter against estimates from (1) plots sampled within wetlands, and (2) cover maps made from aerial photographs. Estimated percent cover of annuals and perennials using a perimeter-based protocol fell within 10 percent of plot-based estimates, and percent cover estimates for seven vegetation height classes were within 20 % of plot-based estimates. Perimeter-based estimates of total emergent vegetation cover did not differ significantly from cover map estimates. Post-hoc analyses revealed evidence for observer effects in estimates of annual and perennial covers and vegetation height. Median time required to complete perimeter-based methods was less than 7 percent of the time needed for intensive plot-based methods. Our results show that rapid, perimeter-based assessments, which increase sample size and efficiency, provide vegetation estimates comparable to more intensive methods.

  17. A Method to Represent Heterogeneous Materials for Rapid Prototyping: The Matryoshka Approach.

    Science.gov (United States)

    Lei, Shuangyan; Frank, Matthew C; Anderson, Donald D; Brown, Thomas D

    The purpose of this paper is to present a new method for representing heterogeneous materials using nested STL shells, based, in particular, on the density distributions of human bones. Nested STL shells, called Matryoshka models, are described, based on their namesake Russian nesting dolls. In this approach, polygonal models, such as STL shells, are "stacked" inside one another to represent different material regions. The Matryoshka model addresses the challenge of representing different densities and different types of bone when reverse engineering from medical images. The Matryoshka model is generated via an iterative process of thresholding the Hounsfield Unit (HU) data using computed tomography (CT), thereby delineating regions of progressively increasing bone density. These nested shells can represent regions starting with the medullary (bone marrow) canal, up through and including the outer surface of the bone. The Matryoshka approach introduced can be used to generate accurate models of heterogeneous materials in an automated fashion, avoiding the challenge of hand-creating an assembly model for input to multi-material additive or subtractive manufacturing. This paper presents a new method for describing heterogeneous materials: in this case, the density distribution in a human bone. The authors show how the Matryoshka model can be used to plan harvesting locations for creating custom rapid allograft bone implants from donor bone. An implementation of a proposed harvesting method is demonstrated, followed by a case study using subtractive rapid prototyping to harvest a bone implant from a human tibia surrogate.

  18. A method for the rapid generation of nonsequential light-response curves of chlorophyll fluorescence.

    Science.gov (United States)

    Serôdio, João; Ezequiel, João; Frommlet, Jörg; Laviale, Martin; Lavaud, Johann

    2013-11-01

    Light-response curves (LCs) of chlorophyll fluorescence are widely used in plant physiology. Most commonly, LCs are generated sequentially, exposing the same sample to a sequence of distinct actinic light intensities. These measurements are not independent, as the response to each new light level is affected by the light exposure history experienced during previous steps of the LC, an issue particularly relevant in the case of the popular rapid light curves. In this work, we demonstrate the proof of concept of a new method for the rapid generation of LCs from nonsequential, temporally independent fluorescence measurements. The method is based on the combined use of sample illumination with digitally controlled, spatially separated beams of actinic light and a fluorescence imaging system. It allows the generation of a whole LC, including a large number of actinic light steps and adequate replication, within the time required for a single measurement (and therefore named "single-pulse light curve"). This method is illustrated for the generation of LCs of photosystem II quantum yield, relative electron transport rate, and nonphotochemical quenching on intact plant leaves exhibiting distinct light responses. This approach makes it also possible to easily characterize the integrated dynamic light response of a sample by combining the measurement of LCs (actinic light intensity is varied while measuring time is fixed) with induction/relaxation kinetics (actinic light intensity is fixed and the response is followed over time), describing both how the response to light varies with time and how the response kinetics varies with light intensity.

  19. A method of rapidly evaluating image quality of NED optical system

    Science.gov (United States)

    Sun, Qi; Qiu, Chuankai; Yang, Huan

    2014-11-01

    In recent years, with the development of technology of micro-display, advanced optics and the software and hardware, near-to-eye display ( NED) optical system will have a wide range of potential applications in the fields of amusement and virtual reality. However, research on the evaluating image quality of this kind optical system is comparatively lagging behind. Although now there are some methods and equipment for evaluation, they can't be applied in commercial production because of their complex operation and inaccuracy. In this paper, an academic method is proposed and a Rapid Evaluation System (RES) is designed to evaluate the image of optical system rapidly and exactly. Firstly, a set of parameters that eyes are sensitive to and also express the quality of system should be extracted and quantized to be criterion, so the evaluation standards can be established. Then, some parameters can be detected by RES consisted of micro-display, CCD camera and computer and so on. By process of scaling, the measuring results of the RES are exact and creditable, relationship between object measurement, subjective evaluation and the RES will be established. After that, image quality of optical system can be evaluated just by detecting parameters of that. The RES is simple and the results of evaluation are exact and keeping with human vision. So the method can be used not only for optimizing design of optical system, but also for evaluation in commercial production.

  20. A rapid method for measuring soil water content in the field with a areometer

    Directory of Open Access Journals (Sweden)

    Calbo Adonai Gimenez

    2002-01-01

    Full Text Available The availability of a rapid method to evaluate the soil water content (U can be an important tool to determine the moment to irrigate. The soil areometer consists of an elongated hydrostatic balance with a weighing pan, a graduated neck, a float and a pynometric flask. In this work an areometer was adapted to rapidly measure soil water content without the need of drying the soil. The expression U = (M A - M AD/(M M -M A was used to calculate the soil water content. In this equation M M is the mass to level the areometer with the pycnometric flask filled with water, M A the mass to level the areometer with a mass M M of soil in the pycnometer, the volume being completed with water, and similarly M AD the mass added to the pan to level the areometer with a mass M M of dried soil in the pycnometric flask. The convenience of this method is that the values M M and M AD are known. Consequently, the decision on irrigation can be made after a measurement that takes, about, ten minutes. The procedure involves only stirring the soil with water for at least 2 minutes to remove the adhered air. The soil water content data obtained with the areometric method were similar to those obtained weighing the soil before and after drying to constant weight, in an oven at 105º C.

  1. A novel rapid direct haemagglutination-inhibition assay for measurements of humoral immune response against non-haemagglutinating Fowlpox virus strains in vaccinated chickens.

    Science.gov (United States)

    Wambura, Philemon N; Mzula, Alexanda

    2017-10-01

    Fowlpox (FP) is a serious disease in chickens caused by Fowlpox virus (FPV). One method currently used to control FPV is vaccination followed by confirmation that antibody titres are protective using the indirect haemagglutination assay (IHA). The direct haemagglutination inhibition (HI) assay is not done because most FPV strains do not agglutinate chicken red blood cells (RBCs). A novel FPV strain TPV-1 which agglutinates chicken RBCs was discovered recently and enabled a direct HI assay to be conducted using homologous sera. This study is therefore aimed at assessing the direct HI assay using a recently discovered novel haemagglutinating FPV strain TPV-1 in chickens vaccinated with a commercial vaccine containing a non-haemagglutinating FPV.Chicks vaccinated with FPV at 1 day-old had antibody geometric mean titres (GMT) of log 2 3.7 at 7 days after vaccination and log 2 8.0 at 28 days after vaccination when tested in the direct HI. Chickens vaccinated at 6 weeks-old had antibody geometric mean titres (GMT) of log 2 5.0 at 7 days after vaccination and log 2 8.4 at 28 days after vaccination when tested in the direct HI. The GMT recorded 28 days after vaccination was slightly higher in chickens vaccinated at 6-week-old than in chicks vaccinated at one-day-old. However, this difference was not significant (P > 0.05). All vaccinated chickens showed "takes". No antibody response to FPV and "takes" were detected in unvaccinated chickens (GMT 0.05). These findings indicate that a simple and rapid direct HI assay using the FPV TPV-1 strain as antigen may be used to measure antibody levels in chickens vaccinated with non-haemagglutinating strains of FPV, and that the titres are comparable to those obtained by indirect IHA.

  2. A rapid method for the determination on fluoride in geological samples

    International Nuclear Information System (INIS)

    Josephson, M.; Cook, E.B.T.; Dixon, K.

    1977-01-01

    An account is given of a rapid procedure for the determination by use of the specific-ion electrode of fluoride in geological samples. The sample is fused with sodium hydroxide in a nickel crucible in a muffle furnace. The melt is leached with water, a buffer solution of ammonium citrate is added, and the fluoride activity is measured with a specific-ion electrode. All operations are carried out in the crucible, making possible approximately 100 determinations a day. The precision of the method is approximately 10 per cent at a fluoride concentration of 500 p.p.m., which is acceptable for geological-survey work [af

  3. Justification of the averaging method for parabolic equations containing rapidly oscillating terms with large amplitudes

    International Nuclear Information System (INIS)

    Levenshtam, V B

    2006-01-01

    We justify the averaging method for abstract parabolic equations with stationary principal part that contain non-linearities (subordinate to the principal part) some of whose terms are rapidly oscillating in time with zero mean and are proportional to the square root of the frequency of oscillation. Our interest in the exponent 1/2 is motivated by the fact that terms proportional to lower powers of the frequency have no influence on the average. For linear equations of the same type, we justify an algorithm for the study of the stability of solutions in the case when the stationary averaged problem has eigenvalues on the imaginary axis (the critical case)

  4. Flow method for rapid production of Batio3 nanoparticles in supercritical water

    International Nuclear Information System (INIS)

    Atashfaraz, M.; Shariati-Niassar, M.; Ohara, Satoshi; Takami, S.; Umetsu, M.; Naka, T.; Adschiri, T.

    2006-01-01

    Fine BaTiO 3 nanoparticles were obtained by hydrothermal synthesis under supercritical conditions with batch and flow type experimental methods. Mixture of barium hydroxide and titanium oxide starting solution was treated in the supercritical wafer at 400 d eg C and 30 MPa. The size of nanoparticles synthesized in the flow type experiment was smaller than that in the batch type. Rapid heating in a flow, reactor is effective to synthesize smaller size and narrower particle size distribution for the BaTiO 3 , nanoparticles. The mechanism for this result was discussed based on the solubility of titanium oxide

  5. Rapid and accurate processing method for amide proton exchange rate measurement in proteins

    International Nuclear Information System (INIS)

    Koskela, Harri; Heikkinen, Outi; Kilpelaeinen, Ilkka; Heikkinen, Sami

    2007-01-01

    Exchange between protein backbone amide hydrogen and water gives relevant information about solvent accessibility and protein secondary structure stability. NMR spectroscopy provides a convenient tool to study these dynamic processes with saturation transfer experiments. Processing of this type of NMR spectra has traditionally required peak integration followed by exponential fitting, which can be tedious with large data sets. We propose here a computer-aided method that applies inverse Laplace transform in the exchange rate measurement. With this approach, the determination of exchange rates can be automated, and reliable results can be acquired rapidly without a need for manual processing

  6. Ultra trace determination of 31 pesticides in water samples by direct injection-rapid resolution liquid chromatography-electrospray tandem mass spectrometry.

    Science.gov (United States)

    Díaz, Laura; Llorca-Pórcel, Julio; Valor, Ignacio

    2008-08-22

    A liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based method for the detection of pesticides in tap and treated wastewater was developed and validated according to the ISO/IEC 17025:1999. Key features of this method include direct injection of 100 microL of sample, an 11 min separation by means of a rapid resolution liquid chromatography system with a 4.6 mm x 50 mm, 1.8 microm particle size reverse phase column and detection by electrospray ionization (ESI) MS-MS. The limits of detection were below 15 ng L(-1) and correlation coefficients for the calibration curves in the range of 30-2000 ng L(-1) were higher than 0.99. Precision was always below 20% and accuracy was confirmed by external evaluation. The main advantages of this method are direct injection of sample without preparative procedures and low limits of detection that fulfill the requirements established by the current European regulations governing pesticide detection.

  7. Three rapid methods for determination {sup 90}Sr in milk samples using liquid scintillation spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Abbasisiara, F.; Attarilar, N. [Iranian Nuclear Regulatory Authority (INRA), Atomic Energy Organization of Iran (AEOI), Environmental Radiation Protection Div., National Radiation Protection Dept. (Iran, Islamic Republic of); Afshar, N. [Tarbiat Modarres Univ. (Iran, Islamic Republic of)

    2006-07-01

    Strontium radionuclide {sup 90}Sr is one of the main long-lived components of the radioactive fallout which occurred as a result of previous atmospheric nuclear tests and also nuclear accidents such as Chernobyl accident. Due to chemical and biochemical similarities between strontium and calcium, more than 99% of strontium is efficiently incorporated into bone tissue and teeth and Characterized by along physical and biological half-life, it may cause damage to bone marrow. Since determination of this radionuclide often is a time consuming process, rapid determination methods specially in emergency situations is always desirable. In this work, three rapid methods for determination of this radionuclide in milk samples will be evaluated. All of the methods include two major steps: 1- strontium separation from fats and proteins which can be performed by drying (in case of the fresh milk samples), ashing and leaching by nitric acids or by using exchange or chelating resins which have strong affinity for alkaline earth cations such as Dowex 50W-X8. And 2- Separation of Sr-90 or its daughter product, Y-90. In two methods separation of {sup 90}Sr is performed by extraction of the daughter nuclide, {sup 90}Y, by aid of organic extracting agent, Tributylphosphate or T.B.P., and then Cherenkov counting of the Y-90 extracted. The third method is based on separation of this radionuclide using Crown Ether or Sr -Spec resin. The detailed radiochemical procedures and evaluation of each method advantages or disadvantages will explained in full text paper. (authors)

  8. A rapid and cost-effective fluorescence detection in tube (FDIT) method to analyze protein phosphorylation.

    Science.gov (United States)

    Jin, Xiao; Gou, Jin-Ying

    2016-01-01

    Protein phosphorylation is one of the most important post-translational modifications catalyzed by protein kinases in living organisms. The advance of genome sequencing provided the information of protein kinase families in many organisms, including both model and non-model plants. The development of proteomics technologies also enabled scientists to efficiently reveal a large number of protein phosphorylations of an organism. However, kinases and phosphorylation targets are still to be connected to illustrate the complicated network in life. Here we adapted Pro-Q ® Diamond (Pro-Q ® Diamond Phosphoprotein Gel Stain), a widely used phosphoprotein gel-staining fluorescence dye, to establish a rapid, economical and non-radioactive fluorescence detection in tube (FDIT) method to analyze phosphorylated proteins. Taking advantages of high sensitivity and specificity of Pro-Q ® diamond, the FDIT method is also demonstrated to be rapid and reliable, with a suitable linear range for in vitro protein phosphorylation. A significant and satisfactory protein kinase reaction was detected as fast as 15 min from Wheat Kinase START 1.1 (WKS1.1) on a thylakoid ascorbate peroxidase (tAPX), an established phosphorylation target in our earlier study. The FDIT method saves up to 95% of the dye consumed in a gel staining method. The FDIT method is remarkably quick, highly reproducible, unambiguous and capable to be scaled up to dozens of samples. The FDIT method could serve as a simple and sensitive alternative procedure to determine protein kinase reactions with zero radiation exposure, as a supplementation to other widely used radioactive and in-gel assays.

  9. A rapid and cost-effective fluorescence detection in tube (FDIT method to analyze protein phosphorylation

    Directory of Open Access Journals (Sweden)

    Xiao Jin

    2016-11-01

    Full Text Available Abstract Background Protein phosphorylation is one of the most important post-translational modifications catalyzed by protein kinases in living organisms. The advance of genome sequencing provided the information of protein kinase families in many organisms, including both model and non-model plants. The development of proteomics technologies also enabled scientists to efficiently reveal a large number of protein phosphorylations of an organism. However, kinases and phosphorylation targets are still to be connected to illustrate the complicated network in life. Results Here we adapted Pro-Q® Diamond (Pro-Q® Diamond Phosphoprotein Gel Stain, a widely used phosphoprotein gel-staining fluorescence dye, to establish a rapid, economical and non-radioactive fluorescence detection in tube (FDIT method to analyze phosphorylated proteins. Taking advantages of high sensitivity and specificity of Pro-Q® diamond, the FDIT method is also demonstrated to be rapid and reliable, with a suitable linear range for in vitro protein phosphorylation. A significant and satisfactory protein kinase reaction was detected as fast as 15 min from Wheat Kinase START 1.1 (WKS1.1 on a thylakoid ascorbate peroxidase (tAPX, an established phosphorylation target in our earlier study. Conclusion The FDIT method saves up to 95% of the dye consumed in a gel staining method. The FDIT method is remarkably quick, highly reproducible, unambiguous and capable to be scaled up to dozens of samples. The FDIT method could serve as a simple and sensitive alternative procedure to determine protein kinase reactions with zero radiation exposure, as a supplementation to other widely used radioactive and in-gel assays.

  10. a Method for Preview Vibration Control of Systems Having Forcing Inputs and Rapidly-Switched Dampers

    Science.gov (United States)

    ElBeheiry, E. M.

    1998-07-01

    In a variety of applications, especially in large scale dynamic systems, the mechanization of different vibration control elements in different locations would be decided by limitations placed on the modal vibration of the system and the inherent dynamic coupling between its modes. Also, the quality of vibration control to the economy of producing the whole system would be another trade-off leading to a mix of passive, active and semi-active vibration control elements in one system. This termactiveis limited to externally powered vibration control inputs and the termsemi-activeis limited to rapidly switched dampers. In this article, an optimal preview control method is developed for application to dynamic systems having active and semi-active vibration control elements mechanized at different locations in one system. The system is then a piecewise (bilinear) controller in which two independent sets of control inputs appear additively and multiplicatively. Calculus of variations along with the Hamiltonian approach are employed for the derivation of this method. In essence, it requires the active elements to be ideal force generators and the switched dampers to have the property of on-line variation of the damping characteristics to pre-determined limits. As the dampers switch during operation the whole system's structure differs, and then values of the active forcing inputs are adapted to match these rapid changes. Strictly speaking, each rapidly switched damper has pre-known upper and lower damping levels and it can take on any in-between value. This in-between value is to be determined by the method as long as the damper tracks a pre-known fully active control demand. In every damping state of each semi-active damper the method provides the optimal matching values of the active forcing inputs. The method is shown to have the feature of solving simple standard matrix equations to obtain closed form solutions. A comprehensive 9-DOF tractor semi-trailer model is used

  11. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue.

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-10

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  12. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-01

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  13. Stress and displacement patterns in the craniofacial skeleton with rapid maxillary expansion—a finite element method study

    Directory of Open Access Journals (Sweden)

    J. Priyadarshini

    2017-07-01

    Full Text Available Abstract Background Rapid maxillary expansion (RME, indicated in the treatment of maxillary deficiency directs high forces to maxillary basal bone and to other adjacent skeletal bones. The aim of this study is to (i evaluate stress distribution along craniofacial sutures and (ii study the displacement of various craniofacial structures with rapid maxillary expansion therapy by using a Finite Element model. Methods An analytical model was developed from a dried human skull of a 12 year old male. CT scan images of the skull were taken in axial direction parallel to the F-H plane at 1 mm interval, processed using Mimics software, required portion of the skull was exported into stereo-lithography model. ANSYS software was used to solve the mathematical equation. Contour plots of the displacement and stresses were obtained from the results of the analysis performed. Results At Node 47005, maximum X-displacement was 5.073 mm corresponding to the incisal edge of the upper central incisor. At Node 3971, maximum negative Y-displacement was -0.86 mm which corresponds to the anterior zygomatic arch, indicating posterior movement of craniofacial complex. At Node 32324, maximum negative Z-displacement was -0.92 mm representing the anterior and deepest convex portion of the nasal septum; indicating downward displacement of structures medial to the area of force application. Conclusions Pyramidal displacement of maxilla was evident. Apex of pyramid faced the nasal bone and base was located on the oral side. Posterosuperior part of nasal cavity moved minimally in lateral direction and width of nasal cavity at the floor of the nose increased, there was downward and forward movement of maxilla with a tendency toward posterior rotation. Maximum von Mises stresses were found along midpalatal, pterygomaxillary, nasomaxillary and frontomaxillary sutures.

  14. Rapid analysis of Δ-9-tetrahydrocannabinol in hair using direct analysis in real time ambient ionization orbitrap mass spectrometry.

    Science.gov (United States)

    Duvivier, Wilco F; van Beek, Teris A; Pennings, Ed J M; Nielen, Michel W F

    2014-04-15

    Forensic hair analysis methods are laborious, time-consuming and provide only a rough retrospective estimate of the time of drug intake. Recently, hair imaging methods using matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) were reported, but these methods require the application of MALDI matrix and are performed under vacuum. Direct analysis of entire locks of hair without any sample pretreatment and with improved spatial resolution would thus address a need. Hair samples were attached to stainless steel mesh screens and scanned in the X-direction using direct analysis in real time (DART) ambient ionization orbitrap MS. The DART gas temperature and the accuracy of the probed hair zone were optimized using Δ-9-tetrahydrocannabinol (THC) as a model compound. Since external contamination is a major issue in forensic hair analysis, sub-samples were measured before and after dichloromethane decontamination. The relative intensity of the THC signal in spiked blank hair versus that of quinine as the internal standard showed good reproducibility (26% RSD) and linearity of the method (R(2)  = 0.991). With the DART hair scan THC could be detected in hair samples from different chronic cannabis users. The presence of THC was confirmed by quantitative liquid chromatography/tandem mass spectrometry. Zones with different THC content could be clearly distinguished, indicating that the method might be used for retrospective timeline assessments. Detection of THC in decontaminated drug user hair showed that the DART hair scan not only probes THC on the surface of hair, but penetrates deeply enough to measure incorporated THC. A new approach in forensic hair analysis has been developed by probing complete locks of hair using DART-MS. Longitudinal scanning enables detection of incorporated compounds and can be used as pre-screening for THC without sample preparation. The method could also be adjusted for the analysis of other drugs of abuse. Copyright

  15. Electrochemical synthesis of nanosized hydroxyapatite by pulsed direct current method

    Energy Technology Data Exchange (ETDEWEB)

    Nur, Adrian; Rahmawati, Alifah; Ilmi, Noor Izzati; Affandi, Samsudin; Widjaja, Arief [Departement of Chemical Engineering, Faculty of Industrial Technology, Sepuluh Nopember Institute of Technology, Kampus ITS Sukolilo, Surabaya 60111 (Indonesia)

    2014-02-24

    Synthesis of nanosized of hydroxyapatite (HA) by electrochemical pulsed direct current (PDC) method has been studied. The aim of this work is to study the influence of various PDC parameters (pH initial, electrode distance, duty cycle, frequency, and amplitude) on particle surface area of HA powders. The electrochemical synthesis was prepared in solution Ca{sup 2+}/EDTA{sup 4−}/PO{sub 4}{sup 3+} at concentration 0.25/0.25/0.15 M for 24 h. The electrochemical cell was consisted of two carbon rectangular electrodes connected to a function generator to produce PDC. There were two treatments for particles after electrosynthesized, namely without aging and aged for 2 days at 40 °C. For both cases, the particles were filtered and washed by demineralized water to eliminate the impurities and unreacted reactants. Then, the particles were dried at 100 °C for 2 days. The dried particles were characterized by X-ray diffraction, surface area analyzer, scanning electron microscopy (SEM), Fourier transform infrared spectra and thermogravimetric and differential thermal analysis. HA particles can be produced when the initial pH > 6. The aging process has significant effect on the produced HA particles. SEM images of HA particles showed that the powders consisted of agglomerates composed of fine crystallites and have morphology plate-like and sphere. The surface area of HA particles is in the range of 25 – 91 m{sup 2}/g. The largest particle surface area of HA was produced at 4 cm electrode distance, 80% cycle duty, frequency 0.1 Hz, amplitude 9 V and with aging process.

  16. A rapid chemical method for lysing Arabidopsis cells for protein analysis

    Directory of Open Access Journals (Sweden)

    Takano Tetsuo

    2011-07-01

    Full Text Available Abstract Background Protein extraction is a frequent procedure in biological research. For preparation of plant cell extracts, plant materials usually have to be ground and homogenized to physically break the robust cell wall, but this step is laborious and time-consuming when a large number of samples are handled at once. Results We developed a chemical method for lysing Arabidopsis cells without grinding. In this method, plants are boiled for just 10 minutes in a solution containing a Ca2+ chelator and detergent. Cell extracts prepared by this method were suitable for SDS-PAGE and immunoblot analysis. This method was also applicable to genomic DNA extraction for PCR analysis. Our method was applied to many other plant species, and worked well for some of them. Conclusions Our method is rapid and economical, and allows many samples to be prepared simultaneously for protein analysis. Our method is useful not only for Arabidopsis research but also research on certain other species.

  17. Direct Survival Analysis: a new stock assessment method

    Directory of Open Access Journals (Sweden)

    Eduardo Ferrandis

    2007-03-01

    Full Text Available In this work, a new stock assessment method, Direct Survival Analysis, is proposed and described. The parameter estimation of the Weibull survival model proposed by Ferrandis (2007 is obtained using trawl survey data. This estimation is used to establish a baseline survival function, which is in turn used to estimate the specific survival functions in the different cohorts considered through an adaptation of the separable model of the fishing mortality rates introduced by Pope and Shepherd (1982. It is thus possible to test hypotheses on the evolution of survival during the period studied and to identify trends in recruitment. A link is established between the preceding analysis of trawl survey data and the commercial catch-at-age data that are generally obtained to evaluate the population using analytical models. The estimated baseline survival, with the proposed versions of the stock and catch equations and the adaptation of the Separable Model, may be applied to commercial catch-at-age data. This makes it possible to estimate the survival corresponding to the landing data, the initial size of the cohort and finally, an effective age of first capture, in order to complete the parameter model estimation and consequently the estimation of the whole survival and mortality, along with the reference parameters that are useful for management purposes. Alternatively, this estimation of an effective age of first capture may be obtained by adapting the demographic structure of trawl survey data to that of the commercial fleet through suitable selectivity models of the commercial gears. The complete model provides the evaluation of the stock at any age. The coherence (and hence the mutual “calibration” between the two kinds of information may be analysed and compared with results obtained by other methods, such as virtual population analysis (VPA, in order to improve the diagnosis of the state of exploitation of the population. The model may be

  18. A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    Directory of Open Access Journals (Sweden)

    Lingxiang Zhu

    Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  19. Rapid Automatic Lighting Control of a Mixed Light Source for Image Acquisition using Derivative Optimum Search Methods

    Directory of Open Access Journals (Sweden)

    Kim HyungTae

    2015-01-01

    Full Text Available Automatic lighting (auto-lighting is a function that maximizes the image quality of a vision inspection system by adjusting the light intensity and color.In most inspection systems, a single color light source is used, and an equal step search is employed to determine the maximum image quality. However, when a mixed light source is used, the number of iterations becomes large, and therefore, a rapid search method must be applied to reduce their number. Derivative optimum search methods follow the tangential direction of a function and are usually faster than other methods. In this study, multi-dimensional forms of derivative optimum search methods are applied to obtain the maximum image quality considering a mixed-light source. The auto-lighting algorithms were derived from the steepest descent and conjugate gradient methods, which have N-size inputs of driving voltage and one output of image quality. Experiments in which the proposed algorithm was applied to semiconductor patterns showed that a reduced number of iterations is required to determine the locally maximized image quality.

  20. Application of a novel automatic disintegration apparatus for the development and evaluation of a direct compression rapidly disintegrating tablet.

    Science.gov (United States)

    Jung, Huijeong Ashley; Augsburger, Larry L

    2012-07-01

    An automatic disintegration tester was developed and used to explore disintegration mechanism and times of rapidly disintegrating tablets. DT50, the time required for a tablet to decrease in its thickness by half, allowed an unbiased determination of disintegration time. Calcium silicate concentration, Explotab® concentration, DiPac®/Xylitab® ratio as fillers, and compression pressure were evaluated using a central composite model design analysis for their DT50, tensile strength, and friability. Tablets that could reasonably be handled (friability disintegrating tablets, originally measured by Caramella et al. using force kinetics, could be determined from axial displacement data measured directly without the need to assume that disintegration force generation was indicative of changes in tablet volume. The n values of tablets containing calcium silicate, Ditab® and/or Xylitab®, magnesium stearate, and Explotab® suggested that the amount of Explotab® was not a significant factor in determining the disintegration mechanism; however, the type of disintegrant used did alter the n value. Primojel® and Explotab®, which are in the same class of disintegrants, exhibited similar DT50, n, and k. Polyplasdone® XL exhibited a much higher n, while yielding faster DT50, suggesting that its performance is more dependent on facilitating the interfacial separation of particles. AcDiSol® showed no apparent moisture sensitivity in regards to disintegration efficiency. The use of the novel apparatus proved to be useful in measuring disintegration efficiency of rapidly disintegrating tablets and in providing valuable information on the disintegration phenomena.

  1. Purification of crude glycerol from transesterification reaction of palm oil using direct method and multistep method

    Science.gov (United States)

    Nasir, N. F.; Mirus, M. F.; Ismail, M.

    2017-09-01

    Crude glycerol which produced from transesterification reaction has limited usage if it does not undergo purification process. It also contains excess methanol, catalyst and soap. Conventionally, purification method of the crude glycerol involves high cost and complex processes. This study aimed to determine the effects of using different purification methods which are direct method (comprises of ion exchange and methanol removal steps) and multistep method (comprises of neutralization, filtration, ion exchange and methanol removal steps). Two crude glycerol samples were investigated; the self-produced sample through the transesterification process of palm oil and the sample obtained from biodiesel plant. Samples were analysed using Fourier Transform Infrared Spectroscopy, Gas Chromatography and High Performance Liquid Chromatography. The results of this study for both samples after purification have showed that the pure glycerol was successfully produced and fatty acid salts were eliminated. Also, the results indicated the absence of methanol in both samples after purification process. In short, the combination of 4 purification steps has contributed to a higher quality of glycerol. Multistep purification method gave a better result compared to the direct method as neutralization and filtration steps helped in removing most excess salt, fatty acid and catalyst.

  2. Optimal estimation and scheduling in aquifer management using the rapid feedback control method

    Science.gov (United States)

    Ghorbanidehno, Hojat; Kokkinaki, Amalia; Kitanidis, Peter K.; Darve, Eric

    2017-12-01

    Management of water resources systems often involves a large number of parameters, as in the case of large, spatially heterogeneous aquifers, and a large number of "noisy" observations, as in the case of pressure observation in wells. Optimizing the operation of such systems requires both searching among many possible solutions and utilizing new information as it becomes available. However, the computational cost of this task increases rapidly with the size of the problem to the extent that textbook optimization methods are practically impossible to apply. In this paper, we present a new computationally efficient technique as a practical alternative for optimally operating large-scale dynamical systems. The proposed method, which we term Rapid Feedback Controller (RFC), provides a practical approach for combined monitoring, parameter estimation, uncertainty quantification, and optimal control for linear and nonlinear systems with a quadratic cost function. For illustration, we consider the case of a weakly nonlinear uncertain dynamical system with a quadratic objective function, specifically a two-dimensional heterogeneous aquifer management problem. To validate our method, we compare our results with the linear quadratic Gaussian (LQG) method, which is the basic approach for feedback control. We show that the computational cost of the RFC scales only linearly with the number of unknowns, a great improvement compared to the basic LQG control with a computational cost that scales quadratically. We demonstrate that the RFC method can obtain the optimal control values at a greatly reduced computational cost compared to the conventional LQG algorithm with small and controllable losses in the accuracy of the state and parameter estimation.

  3. DESI-MS2: a rapid and innovative method for trace analysis of six cytostatic drugs in health care setting.

    Science.gov (United States)

    Fabrizi, Giovanni; Fioretti, Marzia; Rocca, Lucia Mainero; Curini, Roberta

    2012-05-01

    With the aim of establishing exposure levels for hospital personnel preparing and administering cytostatic drugs (CDs), here, we present an innovative screening method based on the use of the desorption electrospray ionization (DESI) interface coupled with a hybrid quadrupole linear ion trap mass spectrometer. A rapid, simple, and sensitive procedure was developed for the simultaneous surface monitoring of cyclophosphamide, dacarbazine, methotrexate, vincristine, gemcitabine, and cytarabine. Since analytes were in the solid state, a novel approach based on the use of passive samplers was combined with the direct analysis of wipes. A PTFE-printed glass slide was used as a passive sampler, while hydrophobic centers of Swiffer® cloths were judged extremely efficient as wipe samplers. After the sampling period, the CD collectors were directly processed with the DESI-MS system without any further treatment. MS/MS confirmatory analysis was conducted using selected reaction monitoring in the positive ion mode and detection limits were evaluated. Values were at the picograms per square millimeter levels on the passive collector and at the picograms per square centimeter levels for the wipe ones. Direct determination on solid-state samples combined with mass spectrometry selectivity provided a powerful tool so far unapplied to occupational hygiene.

  4. Direct RF modulation transmitter, sampling clock frequency setting method for direct RF modulation transmitter

    NARCIS (Netherlands)

    Fukuda, Shuichi; Nauta, Bram

    2013-01-01

    PROBLEM TO BE SOLVED: To provide a direct RF modulation transmitter capable of satisfying a radiation level regulation even without providing a SAW filter. SOLUTION: A direct RF modulation transmitter includes: digital/RF converters 105, 106 to which an I digital baseband signal, a Q digital

  5. Direct RF modulation transmitter, sampling clock frequency setting method for direct RF modulation transmitter

    NARCIS (Netherlands)

    Fukuda, Shuichi; Nauta, Bram

    2014-01-01

    PROBLEM TO BE SOLVED: To provide a direct RF modulation transmitter capable of satisfying a radiation level regulation even without providing a SAW filter. SOLUTION: A direct RF modulation transmitter includes: digital/RF converters 105, 106 to which an I digital baseband signal, a Q digital

  6. Development of rupture process analysis method for great earthquakes using Direct Solution Method

    Science.gov (United States)

    Yoshimoto, M.; Yamanaka, Y.; Takeuchi, N.

    2010-12-01

    Conventional rupture process analysis methods using teleseismic body waves were based on ray theory. Therefore, these methods have the following problems in applying to great earthquakes such as 2004 Sumatra earthquake: (1) difficulty in computing all later phases such as the PP reflection phase, (2) impossibility of computing called “W phase”, the long period phase arriving before S wave, (3) implausibility of hypothesis that the distance is far enough from the observation points to the hypocenter compared to the fault length. To solve above mentioned problems, we have developed a new method which uses the synthetic seismograms computed by the Direct Solution Method (DSM, e.g. Kawai et al. 2006) as Green’s functions. We used the DSM software (http://www.eri.u-tokyo.ac.jp/takeuchi/software/) for computing the Green’s functions up to 1 Hz for the IASP91 (Kennett and Engdahl, 1991) model, and determined the final slip distributions using the waveform inversion method (Kikuchi et al. 2003). First we confirmed whether the Green’s functions computed by DSM were accurate in higher frequencies up to 1 Hz. Next we performed the rupture process analysis of this new method for Mw8.0 (GCMT) large Solomon Islands earthquake on April 1, 2007. We found that this earthquake consisted of two asperities and the rupture propagated across the subducting Sinbo ridge. The obtained slip distribution better correlates to the aftershock distributions than existing method. Furthermore, this new method keep same accuracy of existing method (which has the advantage of calculating) with respect to direct P-wave and reflection phases near the source, and also accurately calculate the later phases such a PP-wave.

  7. Structural reliability calculation method based on the dual neural network and direct integration method.

    Science.gov (United States)

    Li, Haibin; He, Yun; Nie, Xiaobo

    2018-01-01

    Structural reliability analysis under uncertainty is paid wide attention by engineers and scholars due to reflecting the structural characteristics and the bearing actual situation. The direct integration method, started from the definition of reliability theory, is easy to be understood, but there are still mathematics difficulties in the calculation of multiple integrals. Therefore, a dual neural network method is proposed for calculating multiple integrals in this paper. Dual neural network consists of two neural networks. The neural network A is used to learn the integrand function, and the neural network B is used to simulate the original function. According to the derivative relationships between the network output and the network input, the neural network B is derived from the neural network A. On this basis, the performance function of normalization is employed in the proposed method to overcome the difficulty of multiple integrations and to improve the accuracy for reliability calculations. The comparisons between the proposed method and Monte Carlo simulation method, Hasofer-Lind method, the mean value first-order second moment method have demonstrated that the proposed method is an efficient and accurate reliability method for structural reliability problems.

  8. Evaluation of PDA Technical Report No 33. Statistical Testing Recommendations for a Rapid Microbiological Method Case Study.

    Science.gov (United States)

    Murphy, Thomas; Schwedock, Julie; Nguyen, Kham; Mills, Anna; Jones, David

    2015-01-01

    New recommendations for the validation of rapid microbiological methods have been included in the revised Technical Report 33 release from the PDA. The changes include a more comprehensive review of the statistical methods to be used to analyze data obtained during validation. This case study applies those statistical methods to accuracy, precision, ruggedness, and equivalence data obtained using a rapid microbiological methods system being evaluated for water bioburden testing. Results presented demonstrate that the statistical methods described in the PDA Technical Report 33 chapter can all be successfully applied to the rapid microbiological method data sets and gave the same interpretation for equivalence to the standard method. The rapid microbiological method was in general able to pass the requirements of PDA Technical Report 33, though the study shows that there can be occasional outlying results and that caution should be used when applying statistical methods to low average colony-forming unit values. Prior to use in a quality-controlled environment, any new method or technology has to be shown to work as designed by the manufacturer for the purpose required. For new rapid microbiological methods that detect and enumerate contaminating microorganisms, additional recommendations have been provided in the revised PDA Technical Report No. 33. The changes include a more comprehensive review of the statistical methods to be used to analyze data obtained during validation. This paper applies those statistical methods to analyze accuracy, precision, ruggedness, and equivalence data obtained using a rapid microbiological method system being validated for water bioburden testing. The case study demonstrates that the statistical methods described in the PDA Technical Report No. 33 chapter can be successfully applied to rapid microbiological method data sets and give the same comparability results for similarity or difference as the standard method. © PDA, Inc

  9. Rapid direct analysis to discriminate geographic origin of extra virgin olive oils by flash gas chromatography electronic nose and chemometrics.

    Science.gov (United States)

    Melucci, Dora; Bendini, Alessandra; Tesini, Federica; Barbieri, Sara; Zappi, Alessandro; Vichi, Stefania; Conte, Lanfranco; Gallina Toschi, Tullia

    2016-08-01

    At present, the geographical origin of extra virgin olive oils can be ensured by documented traceability, although chemical analysis may add information that is useful for possible confirmation. This preliminary study investigated the effectiveness of flash gas chromatography electronic nose and multivariate data analysis to perform rapid screening of commercial extra virgin olive oils characterized by a different geographical origin declared in the label. A comparison with solid phase micro extraction coupled to gas chromatography mass spectrometry was also performed. The new method is suitable to verify the geographic origin of extra virgin olive oils based on principal components analysis and discriminant analysis applied to the volatile profile of the headspace as a fingerprint. The selected variables were suitable in discriminating between "100% Italian" and "non-100% Italian" oils. Partial least squares discriminant analysis also allowed prediction of the degree of membership of unknown samples to the classes examined. Copyright © 2016. Published by Elsevier Ltd.

  10. Baryon interactions in lattice QCD: the direct method vs. the HAL QCD potential method

    Science.gov (United States)

    Iritani, T.; HAL QCD Collaboration

    We make a detailed comparison between the direct method and the HAL QCD potential method for the baryon-baryon interactions, taking the $\\Xi\\Xi$ system at $m_\\pi= 0.51$ GeV in 2+1 flavor QCD and using both smeared and wall quark sources. The energy shift $\\Delta E_\\mathrm{eff}(t)$ in the direct method shows the strong dependence on the choice of quark source operators, which means that the results with either (or both) source are false. The time-dependent HAL QCD method, on the other hand, gives the quark source independent $\\Xi\\Xi$ potential, thanks to the derivative expansion of the potential, which absorbs the source dependence to the next leading order correction. The HAL QCD potential predicts the absence of the bound state in the $\\Xi\\Xi$($^1$S$_0$) channel at $m_\\pi= 0.51$ GeV, which is also confirmed by the volume dependence of finite volume energy from the potential. We also demonstrate that the origin of the fake plateau in the effective energy shift $\\Delta E_\\mathrm{eff}(t)$ at $t \\sim 1$ fm can be clarified by a few low-lying eigenfunctions and eigenvalues on the finite volume derived from the HAL QCD potential, which implies that the ground state saturation of $\\Xi\\Xi$($^1$S$_0$) requires $t \\sim 10$ fm in the direct method for the smeared source on $(4.3 \\ \\mathrm{fm})^3$ lattice, while the HAL QCD method does not suffer from such a problem.

  11. A rapid colorimetric method for predicting the storage stability of middle distillate fuels

    Energy Technology Data Exchange (ETDEWEB)

    Marshman, S.J. [Defense Research Agency, Surrey (United Kingdom)

    1995-05-01

    Present methods used to predict the storage stability of distillate fuels such as ASTM D2274, ASTM D4625, DEF STAN 05-50 Method 40 and in-house methods are very time consuming, taking a minimum of 16 hours. In addition, some of these methods under- or over-predict the storage stability of the test fuel. A rapid colorimetric test for identifying cracked, straight run or hydrofined fuels was reported at the previous Conference. Further work has shown that while a visual appraisal is acceptable for refinery-fresh fuels, colour development may be masked by other coloured compounds in older fuels. Use of a spectrometric finish to the method has extended the scope of the method to include older fuels. The test can be correlated with total sediment from ASTM D4625 (13 weeks at 43{degrees}C) over a sediment range of 0-60mg/L. A correlation of 0.94 was obtained for 40 fuels.

  12. Developing the RIAM method (rapid impact assessment matrix) in the context of impact significance assessment

    International Nuclear Information System (INIS)

    Ijaes, Asko; Kuitunen, Markku T.; Jalava, Kimmo

    2010-01-01

    In this paper the applicability of the RIAM method (rapid impact assessment matrix) is evaluated in the context of impact significance assessment. The methodological issues considered in the study are: 1) to test the possibilities of enlarging the scoring system used in the method, and 2) to compare the significance classifications of RIAM and unaided decision-making to estimate the consistency between these methods. The data used consisted of projects for which funding had been applied for via the European Union's Regional Development Trust in the area of Central Finland. Cases were evaluated with respect to their environmental, social and economic impacts using an assessment panel. The results showed the scoring framework used in RIAM could be modified according to the problem situation at hand, which enhances its application potential. However the changes made in criteria B did not significantly affect the final ratings of the method, which indicates the high importance of criteria A1 (importance) and A2 (magnitude) to the overall results. The significance classes obtained by the two methods diverged notably. In general the ratings given by RIAM tended to be smaller compared to intuitive judgement implying that the RIAM method may be somewhat conservative in character.

  13. A new method for rapid determination of carbohydrate and total carbon concentrations using UV spectrophotometry.

    Science.gov (United States)

    Albalasmeh, Ammar A; Berhe, Asmeret Asefaw; Ghezzehei, Teamrat A

    2013-09-12

    A new UV spectrophotometry based method for determining the concentration and carbon content of carbohydrate solution was developed. This method depends on the inherent UV absorption potential of hydrolysis byproducts of carbohydrates formed by reaction with concentrated sulfuric acid (furfural derivatives). The proposed method is a major improvement over the widely used Phenol-Sulfuric Acid method developed by DuBois, Gilles, Hamilton, Rebers, and Smith (1956). In the old method, furfural is allowed to develop color by reaction with phenol and its concentration is detected by visible light absorption. Here we present a method that eliminates the coloration step and avoids the health and environmental hazards associated with phenol use. In addition, avoidance of this step was shown to improve measurement accuracy while significantly reducing waiting time prior to light absorption reading. The carbohydrates for which concentrations and carbon content can be reliably estimated with this new rapid Sulfuric Acid-UV technique include: monosaccharides, disaccharides and polysaccharides with very high molecular weight. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Application of two electrical methods for the rapid assessment of freezing resistance in Salix epichloro

    Energy Technology Data Exchange (ETDEWEB)

    Tsarouhas, V.; Kenney, W.A.; Zsuffa, L. [University of Toronto, Ontario (Canada). Faculty of Forestry

    2000-09-01

    The importance of early selection of frost-resistant Salix clones makes it desirable to select a rapid and accurate screening method for assessing freezing resistance among several genotypes. Two electrical methods, stem electrical impedance to 1 and 10 khz alternating current, and electrolyte leakage of leaf tissue, were evaluated for detecting freezing resistance on three North America Salix epichloro Michx., clones after subjecting them to five different freezing temperatures (-1, -2, -3, -4, and -5 deg C). Differences in the electrical impedance to 1 and 10 kHz, and the ratio of the impedance at the two frequencies (low/high) before and after the freezing treatment (DZ{sub low}, DZ{sub high}, and DZ{sub ratio}, respectively) were estimated. Electrolyte leakage was expressed as relative conductivity (RC{sub t}) and index of injury (IDX{sub t}). Results from the two methods, obtained two days after the freezing stress, showed that both electrical methods were able to detect freezing injury in S. eriocephala. However, the electrolyte leakage method detected injury in more levels of freezing stress (-3, -4, and -5 deg C) than the impedance (-4, and -5 deg C), it assessed clonal differences in S. eriocephala freezing resistance, and it was best suited to correlate electrical methods with the visual assessed freezing injury. No significant impedance or leakage changes were found after the -1 and -2 deg C freezing temperatures. (author)

  15. A rapid method for estimation of Pu-isotopes in urine samples using high volume centrifuge.

    Science.gov (United States)

    Kumar, Ranjeet; Rao, D D; Dubla, Rupali; Yadav, J R

    2017-07-01

    The conventional radio-analytical technique used for estimation of Pu-isotopes in urine samples involves anion exchange/TEVA column separation followed by alpha spectrometry. This sequence of analysis consumes nearly 3-4 days for completion. Many a times excreta analysis results are required urgently, particularly under repeat and incidental/emergency situations. Therefore, there is need to reduce the analysis time for the estimation of Pu-isotopes in bioassay samples. This paper gives the details of standardization of a rapid method for estimation of Pu-isotopes in urine samples using multi-purpose centrifuge, TEVA resin followed by alpha spectrometry. The rapid method involves oxidation of urine samples, co-precipitation of plutonium along with calcium phosphate followed by sample preparation using high volume centrifuge and separation of Pu using TEVA resin. Pu-fraction was electrodeposited and activity estimated using 236 Pu tracer recovery by alpha spectrometry. Ten routine urine samples of radiation workers were analyzed and consistent radiochemical tracer recovery was obtained in the range 47-88% with a mean and standard deviation of 64.4% and 11.3% respectively. With this newly standardized technique, the whole analytical procedure is completed within 9h (one working day hour). Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Development of a qPCR method to rapidly assess the function of NKT cells.

    Science.gov (United States)

    Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J

    2014-05-01

    NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Rapid fabrication method of a microneedle mold with controllable needle height and width.

    Science.gov (United States)

    Lin, Yen-Heng; Lee, I-Chi; Hsu, Wei-Chieh; Hsu, Ching-Hong; Chang, Kai-Ping; Gao, Shao-Syuan

    2016-10-01

    The main issue of transdermal drug delivery is that macromolecular drugs cannot diffuse through the stratum corneum of skin. Many studies have pursued micro-sized needles encapsulated with drugs to overcome this problem, as these needles can pierce the stratum corneum and allow drugs to enter the circulatory system of the human body. However, most microneedle fabrication processes are time-consuming and require expensive equipment. In this study, we demonstrate a rapid method for fabricating a microneedle mold using drawing lithography and a UV-cured resin. The mold was filled with a water-soluble material, polyvinylpyrrolidone (PVP), which was then demolded to produce a water-soluble microneedle array. The results of an in vitro skin insertion test using PVP microneedles and pig ear skin demonstrated the feasibility of the microneedle mold. In addition, by controlling the viscosity of the UV-cured resin through various heat treatments, microneedles with different heights and aspect ratios were produced. Compared with other methods, this technology significantly simplifies and accelerates the mold fabrication process. In addition, the required equipment is relatively simple and inexpensive. Through this technology, we can rapidly fabricate microneedle molds with controllable dimensions for various applications.

  18. A rapid method for the preparation of 99Tcm hexametazime-labelled leucocytes

    International Nuclear Information System (INIS)

    Solanki, K.K.; Mather, S.J.; Janabi, M.A.; Britton, K.E.

    1988-01-01

    99 Tc m (±)-hexamethylpropyleneamineoxime (HMPAO) ( 99 Tc m Hexametazime) has been recently reported as an alternative for labelling leucocytes. This technique has been modified to give a simpler routine in-house labelling technique. It has three advantages: only about 20 ml of blood is required, the labelling time is just under 1 h and high yields of labelled leucocytes are obtained (mean of 500 MBq per injection dose). The properties of labelled leucocytes using this modified method are; 80% granulocyte-bound radioactivity, a rapid lung transit and a blood granulocyte recovery of 40% at 30 min similar to those described previously. The viability of the labelled leucocytes was tested and confirmed in vitro using a migration technique and in vivo by showing no lung retention on early imaging and high splenic uptake. A rapid in-process chromatography assessment procedure for regulating the protocol has been developed. Successful abscess imaging by 4 h has been achieved in 21 patients with normal results in another 22 patients without abscesses. This simpler method should encourage a more widespread application of scintigraphy using radiolabelled granulocytes. (author)

  19. A rapid, ensemble and free energy based method for engineering protein stabilities.

    Science.gov (United States)

    Naganathan, Athi N

    2013-05-02

    Engineering the conformational stabilities of proteins through mutations has immense potential in biotechnological applications. It is, however, an inherently challenging problem given the weak noncovalent nature of the stabilizing interactions. In this regard, we present here a robust and fast strategy to engineer protein stabilities through mutations involving charged residues using a structure-based statistical mechanical model that accounts for the ensemble nature of folding. We validate the method by predicting the absolute changes in stability for 138 experimental mutations from 16 different proteins and enzymes with a correlation of 0.65 and importantly with a success rate of 81%. Multiple point mutants are predicted with a higher success rate (90%) that is validated further by comparing meosphile-thermophile protein pairs. In parallel, we devise a methodology to rapidly engineer mutations in silico which we benchmark against experimental mutations of ubiquitin (correlation of 0.95) and check for its feasibility on a larger therapeutic protein DNase I. We expect the method to be of importance as a first and rapid step to screen for protein mutants with specific stability in the biotechnology industry, in the construction of stability maps at the residue level (i.e., hot spots), and as a robust tool to probe for mutations that enhance the stability of protein-based drugs.

  20. Rapid and label-free bioanalytical method of alpha fetoprotein detection using LSPR chip

    Science.gov (United States)

    Kim, Dongjoo; Kim, Jinwoon; Kwak, Cheol Hwan; Heo, Nam Su; Oh, Seo Yeong; Lee, Hoomin; Lee, Go-Woon; Vilian, A. T. Ezhil; Han, Young-Kyu; Kim, Woo-Sik; Kim, Gi-bum; Kwon, Soonjo; Huh, Yun Suk

    2017-07-01

    Alpha fetoprotein (AFP) is a cancer marker, particularly for hepatocellular carcinoma. Normal levels of AFP are less than 20 ng/mL; however, its levels can reach more than 400 ng/mL in patients with HCC. Enzyme linked immunosorbent assay (ELISA) and radioimmunoassay (RIA) have been employed for clinical diagnosis of AFP; however, these methods are time consuming and labor intensive. In this study, we developed a localized surface plasmon resonance (LSPR) based biosensor for simple and rapid detection of AFP. This biosensor consists of a UV-Vis spectrometer, a cuvette cell, and a biosensor chip nanopatterned with gold nanoparticles (AuNPs). In our LSPR biosensor, binding of AFP to the surface of the sensor chip led to an increasing magnitude of the LSPR signals, which was measured by an ultraviolet-visible (UV-Vis) spectrometer. Our LSPR biosensor showed sufficient detectability of AFP at concentrations of 1 ng/mL to 1 μg/mL. Moreover, the overall procedure for detection of AFP was completed within 20 min. This biosensor could also be utilized for a point of care test (POCT) by employing a portable UV-Vis spectrometer. Owing to the simplicity and rapidity of the detection process, our LSPR biosensor is expected to replace traditional diagnostic methods for the early detection of diseases.

  1. Development of a novel and simple method to evaluate disintegration of rapidly disintegrating tablets.

    Science.gov (United States)

    Hoashi, Yohei; Tozuka, Yuichi; Takeuchi, Hirofumi

    2013-01-01

    The purpose of this study was to develop and test a novel and simple method for evaluating the disintegration time of rapidly disintegrating tablets (RDTs) in vitro, since the conventional disintegration test described in the pharmacopoeia produces poor results due to the difference of its environmental conditions from those of an actual oral cavity. Six RDTs prepared in our laboratory and 5 types of commercial RDTs were used as model formulations. Using our original apparatus, a good correlation was observed between in vivo and in vitro disintegration times by adjusting the height from which the solution was dropped to 8 cm and the weight of the load to 10 or 20 g. Properties of RDTs, such as the pattern of their disintegrating process, can be assessed by verifying the load. These findings confirmed that our proposed method for an in vitro disintegration test apparatus is an excellent one for estimating disintegration time and the disintegration profile of RDTs.

  2. Evaluation of two methods of rapid blood-glucose monitoring by unskilled personnel during surgery

    DEFF Research Database (Denmark)

    Madsbad, S; Adelhøj, B; Bigler, Dennis Richard

    1984-01-01

    The accuracy of two rapid methods of blood-glucose monitoring without (Haemo-glucotest 1-44) and with a reflectance meter (Hypocount B) was compared using a laboratory method. The assessment was carried out by personnel with no previous experience in measuring blood glucose. Eighty-five percent...... of the 92 measurements obtained with the hypocount B were within +/- 20% of the laboratory glucose values. Using haemo-glucotest 1-44 strips, 74% of the readings were within +/- 20% of the reference laboratory values. For values below 5.5 mmol/l, there was a tendency for results to be too low, with 77......% of the readings below laboratory values -20%. All situations with severe hypoglycaemia were detected with both strips. The study also demonstrates the ineffectiveness of s.c. insulin regimens during surgery. Only 47% of the measured blood glucose values were within the range of 5.5-10 mmol/l and two of ten...

  3. A Rapid Colorimetric Method Reveals Fraudulent Substitutions in Sea Urchin Roe Marketed in Sardinia (Italy).

    Science.gov (United States)

    Meloni, Domenico; Spina, Antonio; Satta, Gianluca; Chessa, Vittorio

    2016-06-25

    In recent years, besides the consumption of fresh sea urchin specimens, the demand of minimally-processed roe has grown considerably. This product has made frequent consumption in restaurants possible and frauds are becoming widespread with the partial replacement of sea urchin roe with surrogates that are similar in colour. One of the main factors that determines the quality of the roe is its colour and small differences in colour scale cannot be easily discerned by the consumers. In this study we have applied a rapid colorimetric method for reveal the fraudulent partial substitution of semi-solid sea urchin roe with liquid egg yolk. Objective assessment of whiteness (L*), redness (a*), yellowness (b*), hue (h*), and chroma (C*) was carried out with a digital spectrophotometer using the CIE L*a*b* colour measurement system. The colorimetric method highlighted statistically significant differences among sea urchin roe and liquid egg yolk that could be easily discerned quantitatively.

  4. A Rapid Generation Method of Character Doll with Rotatable Limbs Oriented to 3D Printer

    Institute of Scientific and Technical Information of China (English)

    LI Lin; CHU Xiao-li; Nie Wen-chao

    2014-01-01

    Currently, 3D printing of the character dolls is a very practical application for the average person. But the model of doll which can be obtained is static so the posture of the doll is single. On the other hand, the modification of the model is very difficult to non-professions. This paper proposes an rapid generation method of character doll with rotatable limbs, which is through adding the sphere joint to the doll’s model automatically. After the model is segmented by drawing a line interactively, the sphere joint is created based on the segmentation boundary through entity modeling method. Lastly the two models of the doll and the joint are composited and printed. Some doll’s model are tested on the FDM(Fused Deposition Modeling) 3D printer using this process. The results are more interesting and the efficiency has been greatly improved compared with modifying the model manually.

  5. Rapid synthesis of nitrogen doped titania with mixed crystal lattice via microwave-assisted hydrothermal method

    International Nuclear Information System (INIS)

    Zhang Peilin; Liu Bin; Yin Shu; Wang Yuhua; Petrykin, Valery; Kakihana, Masato; Sato, Tsugio

    2009-01-01

    A microwave-assisted hydrothermal method was employed to synthesize nitrogen doped titania nanoparticles. Due to the high heating efficiency of microwave, rapid synthesis could be achieved in comparison with the conventional oven. Mixed crystal lattice was found existing in the obtained product, and the phase transformation behaviour under calcination was studied by XRD measurement together with Raman spectroscopy in details. The obtained nitrogen doped titania showed high specific surface area, about 300 m 2 g -1 . Photocatalytic activity in destructing NO x gas by the prepared sample exceeded that of commercial titania (P 25) or nitrogen doped titania synthesized by conventional hydrothermal method, under both visible-light and ultraviolet-light irradiation.

  6. Directed forgetting of complex pictures in an item method paradigm

    OpenAIRE

    Hauswald, Anne; Kissler, Johanna

    2008-01-01

    An item-cued directed forgetting paradigm was used to investigate the ability to control episodic memory and selectively encode complex coloured pictures. A series of photographs was presented to 21 participants who were instructed to either remember or forget each picture after it was presented. Memory performance was later tested with a recognition task where all presented items had to be retrieved, regardless of the initial instructions. A directed forgetting effect that is, better recogni...

  7. Direct rapid analysis of trace bioavailable soil macronutrients by chemometrics-assisted energy dispersive X-ray fluorescence and scattering spectrometry.

    Science.gov (United States)

    Kaniu, M I; Angeyo, K H; Mwala, A K; Mangala, M J

    2012-06-04

    Precision agriculture depends on the knowledge and management of soil quality (SQ), which calls for affordable, simple and rapid but accurate analysis of bioavailable soil nutrients. Conventional SQ analysis methods are tedious and expensive. We demonstrate the utility of a new chemometrics-assisted energy dispersive X-ray fluorescence and scattering (EDXRFS) spectroscopy method we have developed for direct rapid analysis of trace 'bioavailable' macronutrients (i.e. C, N, Na, Mg, P) in soils. The method exploits, in addition to X-ray fluorescence, the scatter peaks detected from soil pellets to develop a model for SQ analysis. Spectra were acquired from soil samples held in a Teflon holder analyzed using (109)Cd isotope source EDXRF spectrometer for 200 s. Chemometric techniques namely principal component analysis (PCA), partial least squares (PLS) and artificial neural networks (ANNs) were utilized for pattern recognition based on fluorescence and Compton scatter peaks regions, and to develop multivariate quantitative calibration models based on Compton scatter peak respectively. SQ analyses were realized with high CMD (R(2)>0.9) and low SEP (0.01% for N and Na, 0.05% for C, 0.08% for Mg and 1.98 μg g(-1) for P). Comparison of predicted macronutrients with reference standards using a one-way ANOVA test showed no statistical difference at 95% confidence level. To the best of the authors' knowledge, this is the first time that an XRF method has demonstrated utility in trace analysis of macronutrients in soil or related matrices. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Diagnostic Performance of a Rapid Magnetic Resonance Imaging Method of Measuring Hepatic Steatosis

    Science.gov (United States)

    House, Michael J.; Gan, Eng K.; Adams, Leon A.; Ayonrinde, Oyekoya T.; Bangma, Sander J.; Bhathal, Prithi S.; Olynyk, John K.; St. Pierre, Tim G.

    2013-01-01

    Objectives Hepatic steatosis is associated with an increased risk of developing serious liver disease and other clinical sequelae of the metabolic syndrome. However, visual estimates of steatosis from histological sections of biopsy samples are subjective and reliant on an invasive procedure with associated risks. The aim of this study was to test the ability of a rapid, routinely available, magnetic resonance imaging (MRI) method to diagnose clinically relevant grades of hepatic steatosis in a cohort of patients with diverse liver diseases. Materials and Methods Fifty-nine patients with a range of liver diseases underwent liver biopsy and MRI. Hepatic steatosis was quantified firstly using an opposed-phase, in-phase gradient echo, single breath-hold MRI methodology and secondly, using liver biopsy with visual estimation by a histopathologist and by computer-assisted morphometric image analysis. The area under the receiver operating characteristic (ROC) curve was used to assess the diagnostic performance of the MRI method against the biopsy observations. Results The MRI approach had high sensitivity and specificity at all hepatic steatosis thresholds. Areas under ROC curves were 0.962, 0.993, and 0.972 at thresholds of 5%, 33%, and 66% liver fat, respectively. MRI measurements were strongly associated with visual (r2 = 0.83) and computer-assisted morphometric (r2 = 0.84) estimates of hepatic steatosis from histological specimens. Conclusions This MRI approach, using a conventional, rapid, gradient echo method, has high sensitivity and specificity for diagnosing liver fat at all grades of steatosis in a cohort with a range of liver diseases. PMID:23555650

  9. A rapid and highly selective method for the estimation of pyro-, tri- and orthophosphates.

    Science.gov (United States)

    Kamat, D R; Savant, V V; Sathyanarayana, D N

    1995-03-01

    A rapid, highly selective and simple method has been developed for the quantitative determination of pyro-, tri- and orthophosphates. The method is based on the formation of a solid complex of bis(ethylenediamine)cobalt(III) species with pyrophosphate at pH 4.2-4.3, with triphosphate at pH 2.0-2.1 and with orthophosphate at pH 8.2-8.6. The proposed method for pyro- and triphosphates differs from the available method, which is based on the formation of an adduct with tris(ethylenediamine)cobalt(III) species. The complexes have the composition [Co(en)(2)HP(2)O(7)]4H(2)O and [Co(en)(2)H(2)P(3)O(10)]2H(2)O, respectively. The precipitation is instantaneous and quantitative under the recommended optimum conditions giving 99.5% gravimetric yield in both cases. There is no interferences from orthophosphate, trimetaphosphate and pyrophosphate species in the triphosphate estimation up to 5% of each component. The efficacy of the method has been established by determining pyrophosphate and triphosphate contents in various matrices. In the case of orthophosphate, the proposed method differs from the available methods such as ammonium phosphomolybdate, vanadophosphomolybdate and quinoline phosphomolybdate, which are based on the formation of a precipitate, followed by either titrimetry or gravimetry. The precipitation is instantaneous and the method is simple. Under the recommended pH and other reaction conditions, gravimetric yields of 99.6-100% are obtainable. The method is applicable to orthophosphoric acid and a variety of phosphate salts.

  10. Development of rapid methods for relaxation time mapping and motion estimation using magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Gilani, Syed Irtiza Ali

    2008-09-15

    Recent technological developments in the field of magnetic resonance imaging have resulted in advanced techniques that can reduce the total time to acquire images. For applications such as relaxation time mapping, which enables improved visualisation of in vivo structures, rapid imaging techniques are highly desirable. TAPIR is a Look- Locker-based sequence for high-resolution, multislice T{sub 1} relaxation time mapping. Despite the high accuracy and precision of TAPIR, an improvement in the k-space sampling trajectory is desired to acquire data in clinically acceptable times. In this thesis, a new trajectory, termed line-sharing, is introduced for TAPIR that can potentially reduce the acquisition time by 40 %. Additionally, the line-sharing method was compared with the GRAPPA parallel imaging method. These methods were employed to reconstruct time-point images from the data acquired on a 4T high-field MR research scanner. Multislice, multipoint in vivo results obtained using these methods are presented. Despite improvement in acquisition speed, through line-sharing, for example, motion remains a problem and artefact-free data cannot always be obtained. Therefore, in this thesis, a rapid technique is introduced to estimate in-plane motion. The presented technique is based on calculating the in-plane motion parameters, i.e., translation and rotation, by registering the low-resolution MR images. The rotation estimation method is based on the pseudo-polar FFT, where the Fourier domain is composed of frequencies that reside in an oversampled set of non-angularly, equispaced points. The essence of the method is that unlike other Fourier-based registration schemes, the employed approach does not require any interpolation to calculate the pseudo-polar FFT grid coordinates. Translation parameters are estimated by the phase correlation method. However, instead of two-dimensional analysis of the phase correlation matrix, a low complexity subspace identification of the phase

  11. Development of rapid methods for relaxation time mapping and motion estimation using magnetic resonance imaging

    International Nuclear Information System (INIS)

    Gilani, Syed Irtiza Ali

    2008-09-01

    Recent technological developments in the field of magnetic resonance imaging have resulted in advanced techniques that can reduce the total time to acquire images. For applications such as relaxation time mapping, which enables improved visualisation of in vivo structures, rapid imaging techniques are highly desirable. TAPIR is a Look- Locker-based sequence for high-resolution, multislice T 1 relaxation time mapping. Despite the high accuracy and precision of TAPIR, an improvement in the k-space sampling trajectory is desired to acquire data in clinically acceptable times. In this thesis, a new trajectory, termed line-sharing, is introduced for TAPIR that can potentially reduce the acquisition time by 40 %. Additionally, the line-sharing method was compared with the GRAPPA parallel imaging method. These methods were employed to reconstruct time-point images from the data acquired on a 4T high-field MR research scanner. Multislice, multipoint in vivo results obtained using these methods are presented. Despite improvement in acquisition speed, through line-sharing, for example, motion remains a problem and artefact-free data cannot always be obtained. Therefore, in this thesis, a rapid technique is introduced to estimate in-plane motion. The presented technique is based on calculating the in-plane motion parameters, i.e., translation and rotation, by registering the low-resolution MR images. The rotation estimation method is based on the pseudo-polar FFT, where the Fourier domain is composed of frequencies that reside in an oversampled set of non-angularly, equispaced points. The essence of the method is that unlike other Fourier-based registration schemes, the employed approach does not require any interpolation to calculate the pseudo-polar FFT grid coordinates. Translation parameters are estimated by the phase correlation method. However, instead of two-dimensional analysis of the phase correlation matrix, a low complexity subspace identification of the phase

  12. [Research on rapid and quantitative detection method for organophosphorus pesticide residue].

    Science.gov (United States)

    Sun, Yuan-Xin; Chen, Bing-Tai; Yi, Sen; Sun, Ming

    2014-05-01

    The methods of physical-chemical inspection is adopted in the traditional pesticide residue detection, which require a lot of pretreatment processes, are time-consuming and complicated. In the present study, the authors take chlorpyrifos applied widely in the present agricultural field as the research object and propose a rapid and quantitative detection method for organophosphorus pesticide residues. At first, according to the chemical characteristics of chlorpyrifos and comprehensive chromogenic effect of several colorimetric reagents and secondary pollution, the pretreatment of the scheme of chromogenic reaction of chlorpyrifos with resorcin in a weak alkaline environment was determined. Secondly, by analyzing Uv-Vis spectrum data of chlorpyrifos samples whose content were between 0. 5 and 400 mg kg-1, it was confirmed that the characteristic information after the color reaction mainly was concentrated among 360 approximately 400 nm. Thirdly, the full spectrum forecasting model was established based on the partial least squares, whose correlation coefficient of calibration was 0. 999 6, correlation coefficient of prediction reached 0. 995 6, standard deviation of calibration (RMSEC) was 2. 814 7 mg kg-1, and standard deviation of verification (RMSEP) was 8. 012 4 mg kg-1. Fourthly, the wavelengths whose center wavelength is 400 nm was extracted as characteristic region to build a forecasting model, whose correlation coefficient of calibration was 0. 999 6, correlation coefficient of prediction reached 0. 999 3, standard deviation of calibration (RMSEC) was 2. 566 7 mg kg-1 , standard deviation of verification (RMSEP) was 4. 886 6 mg kg-1, respectively. At last, by analyzing the near infrared spectrum data of chlorpyrifos samples with contents between 0. 5 and 16 mg kg-1, the authors found that although the characteristics of the chromogenic functional group are not obvious, the change of absorption peaks of resorcin itself in the neighborhood of 5 200 cm

  13. Pyroprinting: a rapid and flexible genotypic fingerprinting method for typing bacterial strains.

    Science.gov (United States)

    Black, Michael W; VanderKelen, Jennifer; Montana, Aldrin; Dekhtyar, Alexander; Neal, Emily; Goodman, Anya; Kitts, Christopher L

    2014-10-01

    Bacterial strain typing is commonly employed in studies involving epidemiology, population ecology, and microbial source tracking to identify sources of fecal contamination. Methods for differentiating strains generally use either a collection of phenotypic traits or rely on some interrogation of the bacterial genotype. This report introduces pyroprinting, a novel genotypic strain typing method that is rapid, inexpensive, and discriminating compared to the most sensitive methods already in use. Pyroprinting relies on the simultaneous pyrosequencing of polymorphic multicopy loci, such as the intergenic transcribed spacer regions of rRNA operons in bacterial genomes. Data generated by sequencing combinations of variable templates are reproducible and intrinsically digitized. The theory and development of pyroprinting in Escherichia coli, including the selection of similarity thresholds to define matches between isolates, are presented. The pyroprint-based strain differentiation limits and phylogenetic relevance compared to other typing methods are also explored. Pyroprinting is unique in its simplicity and, paradoxically, in its intrinsic complexity. This new approach serves as an excellent alternative to more cumbersome or less phylogenetically relevant strain typing methods. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. A Rapid and Efficient Screening Method for Antibacterial Compound-Producing Bacteria.

    Science.gov (United States)

    Hettiarachchi, Sachithra; Lee, Su-Jin; Lee, Youngdeuk; Kwon, Young-Kyung; De Zoysa, Mahanama; Moon, Song; Jo, Eunyoung; Kim, Taeho; Kang, Do-Hyung; Heo, Soo-Jin; Oh, Chulhong

    2017-08-28

    Antibacterial compounds are widely used in the treatment of human and animal diseases. The overuse of antibiotics has led to a rapid rise in the prevalence of drug-resistant bacteria, making the development of new antibacterial compounds essential. This study focused on developing a fast and easy method for identifying marine bacteria that produce antibiotic compounds. Eight randomly selected marine target bacterial species ( Agrococcus terreus, Bacillus algicola, Mesoflavibacter zeaxanthinifaciens, Pseudoalteromonas flavipulchra, P. peptidolytica, P. piscicida, P. rubra , and Zunongwangia atlantica ) were tested for production of antibacterial compounds against four strains of test bacteria ( B. cereus, B. subtilis, Halomonas smyrnensis , and Vibrio alginolyticus ). Colony picking was used as the primary screening method. Clear zones were observed around colonies of P. flavipulchra, P. peptidolytica, P. piscicida , and P. rubra tested against B. cereus, B. subtilis , and H. smyrnensis . The efficiency of colony scraping and broth culture methods for antimicrobial compound extraction was also compared using a disk diffusion assay. P. peptidolytica, P. piscicida , and P. rubra showed antagonistic activity against H. smyrnensis, B. cereus , and B. subtilis , respectively, only in the colony scraping method. Our results show that colony picking and colony scraping are effective, quick, and easy methods of screening for antibacterial compound-producing bacteria.

  15. A rapid method for myoglobin radioimmunoanalysis as a diagnostic tool in myocardial infarction

    International Nuclear Information System (INIS)

    Grachev, M.A.; Matveev, L.E.; Pressman, E.K.; Roschke, V.V.

    1982-01-01

    Stone et al. have elaborated a RIA-method for the determination of myoglobin, and found that increase of its concentration in serum is a reliable criterion for the diagnosis of myocardial infarction. However, the test took 24-28 h. Subsequently, the time of the analysis has been reduced to 5-6 h. Recently, a rapid method for the determination of myoglobin has been proposed based upon the use of antiserum immobilized on a powdered carrier. This method takes a little more than 1 h. The procedure according to Roxin et al. is fast due to its non-equilibrium character; after the incubation (30 min) the reaction of the antigen with the immobilized antibody still remains far from equilibrium. It is generally believed that non-equilibrium RIA procedures are less convenient than equilibrium ones for practical clinical applications. According to the RIA procedure proposed here, the time saving compared with the established methods is achieved by using relatively-high concentrations of radioactive myoglobin of moderate specific radioactivity. Under these conditions, the kinetic plateau is reached in 15-20 min. Hence, the total time of the analysis to obtain a standard curve and results for five unknown sera is 55 min. Therefore, the method becomes more useful as a guide in the treatment of myocardial infarction. (Auth.)

  16. Direct analysis in real time mass spectrometry and multivariate data analysis: a novel approach to rapid identification of analytical markers for quality control of traditional Chinese medicine preparation.

    Science.gov (United States)

    Zeng, Shanshan; Wang, Lu; Chen, Teng; Wang, Yuefei; Mo, Huanbiao; Qu, Haibin

    2012-07-06

    The paper presents a novel strategy to identify analytical markers of traditional Chinese medicine preparation (TCMP) rapidly via direct analysis in real time mass spectrometry (DART-MS). A commonly used TCMP, Danshen injection, was employed as a model. The optimal analysis conditions were achieved by measuring the contribution of various experimental parameters to the mass spectra. Salvianolic acids and saccharides were simultaneously determined within a single 1-min DART-MS run. Furthermore, spectra of Danshen injections supplied by five manufacturers were processed with principal component analysis (PCA). Obvious clustering was observed in the PCA score plot, and candidate markers were recognized from the contribution plots of PCA. The suitability of potential markers was then confirmed by contrasting with the results of traditional analysis methods. Using this strategy, fructose, glucose, sucrose, protocatechuic aldehyde and salvianolic acid A were rapidly identified as the markers of Danshen injections. The combination of DART-MS with PCA provides a reliable approach to the identification of analytical markers for quality control of TCMP. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. A Method to Represent Heterogeneous Materials for Rapid Prototyping: The Matryoshka Approach

    Science.gov (United States)

    Lei, Shuangyan; Frank, Matthew C.; Anderson, Donald D.; Brown, Thomas D.

    2015-01-01

    Purpose The purpose of this paper is to present a new method for representing heterogeneous materials using nested STL shells, based, in particular, on the density distributions of human bones. Design/methodology/approach Nested STL shells, called Matryoshka models, are described, based on their namesake Russian nesting dolls. In this approach, polygonal models, such as STL shells, are “stacked” inside one another to represent different material regions. The Matryoshka model addresses the challenge of representing different densities and different types of bone when reverse engineering from medical images. The Matryoshka model is generated via an iterative process of thresholding the Hounsfield Unit (HU) data using computed tomography (CT), thereby delineating regions of progressively increasing bone density. These nested shells can represent regions starting with the medullary (bone marrow) canal, up through and including the outer surface of the bone. Findings The Matryoshka approach introduced can be used to generate accurate models of heterogeneous materials in an automated fashion, avoiding the challenge of hand-creating an assembly model for input to multi-material additive or subtractive manufacturing. Originality/Value This paper presents a new method for describing heterogeneous materials: in this case, the density distribution in a human bone. The authors show how the Matryoshka model can be used to plan harvesting locations for creating custom rapid allograft bone implants from donor bone. An implementation of a proposed harvesting method is demonstrated, followed by a case study using subtractive rapid prototyping to harvest a bone implant from a human tibia surrogate. PMID:26120277

  18. A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates.

    Science.gov (United States)

    Govindarajan, Dhanasekaran; Guan, Liming; Meschino, Steven; Fridman, Arthur; Bagchi, Ansu; Pak, Irene; ter Meulen, Jan; Casimiro, Danilo R; Bett, Andrew J

    2016-01-01

    Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT) viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD) viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses.

  19. A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates.

    Directory of Open Access Journals (Sweden)

    Dhanasekaran Govindarajan

    Full Text Available Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses.

  20. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Science.gov (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  1. Series-parallel method of direct solar array regulation

    Science.gov (United States)

    Gooder, S. T.

    1976-01-01

    A 40 watt experimental solar array was directly regulated by shorting out appropriate combinations of series and parallel segments of a solar array. Regulation switches were employed to control the array at various set-point voltages between 25 and 40 volts. Regulation to within + or - 0.5 volt was obtained over a range of solar array temperatures and illumination levels as an active load was varied from open circuit to maximum available power. A fourfold reduction in regulation switch power dissipation was achieved with series-parallel regulation as compared to the usual series-only switching for direct solar array regulation.

  2. Rapid Hydrothermal Synthesis of Zinc Oxide Nanowires by Annealing Methods on Seed Layers

    Directory of Open Access Journals (Sweden)

    Jang Bo Shim

    2011-01-01

    Full Text Available Well-aligned zinc oxide (ZnO nanowire arrays were successfully synthesized on a glass substrate using the rapid microwave heating process. The ZnO seed layers were produced by spinning the precursor solutions onto the substrate. Among coatings, the ZnO seed layers were annealed at 100°C for 5 minutes to ensure particle adhesion to the glass surface in air, nitrogen, and vacuum atmospheres. The annealing treatment of the ZnO seed layer was most important for achieving the high quality of ZnO nanowire arrays as ZnO seed nanoparticles of larger than 30 nm in diameter evolve into ZnO nanowire arrays. Transmission electron microscopy analysis revealed a single-crystalline lattice of the ZnO nanowires. Because of their low power (140 W, low operating temperatures (90°C, easy fabrication (variable microwave sintering system, and low cost (90% cost reduction compared with gas condensation methods, high quality ZnO nanowires created with the rapid microwave heating process show great promise for use in flexible solar cells and flexible display devices.

  3. Comprehensive and Methodical: Diagnostic and Management Approaches to Rapidly Progressive Dementia.

    Science.gov (United States)

    Mahajan, Supriya; Appleby, Brian S

    2017-09-30

    Purpose of review The sudden emergence of a change in cognitive abilities or behavior is an important symptom that warrants medical evaluation and may represent the early stages of a rapidly progressive dementia (RPD). To correctly ascertain the cause of RPD in a given patient, the clinician must be methodical and knowledgeable about the range of potential causes and must move forward with supportive treatment, and in some cases empiric treatment, based on clinical features alone. Recent findings Significant advances in prion disease biomarkers, the molecular features of rapidly progressive Alzheimer's disease, and new detection of autoimmune limbic encephalitis disease entities have caused a shift in the diagnostic and treatment framework of RPD. Additionally, in the past decade, emerging retrospective data have led to suggested treatments in autoimmune encephalitis that, if instituted early, can protect patients against residual deficits and disease relapse. Summary Here, we provide an integrative clinical and diagnostic treatment approach that is applicable to the various forms of RPD. We have highlighted the clinical features of selected types of RPD that have experienced advances in the last 10-15 years.

  4. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Performance of a Micro-UAV lifting system built with the usage of rapid prototyping methods

    International Nuclear Information System (INIS)

    Dalewski, R T; Gumowski, K; Barczak, T; Godek, J

    2014-01-01

    This article presents results of the aerodynamic testing of a micro unmanned aerial vehicle rotor efficiency. The rotors were prepared as a set of two rotors in a counter-rotating ducted drive. Prototypes of the drives were made using two rapid prototyping techniques – FDM – fused deposition modelling method and SLS – selective laser sintering. Rotors were made then treated by introducing additional finishing cyanoacrylate coating and abrasive processing. Main differences between those models were observed in fan shape, porosity, surface roughness and mechanical properties – stiffness. An influence of these factors was observed on an aerodynamic efficiency. For the obtained prototypes both simulations and experimental testing were conducted with thrust, power, torque measurements, as well as the measurement of velocity and pressure distribution at the outlet of the duct. The results show the possibility of using rapid prototyping techniques to produce prototypes of drives operating in the low and medium Reynolds numbers (6000-60000), and the aerodynamic shape relevant factors affecting the preparation and performance of such drives. In addition, simulation studies were performed using the Fluent environment where experimental results were confronted with the results of simulation studies.

  6. A rapid method for infectivity titration of Andes hantavirus using flow cytometry.

    Science.gov (United States)

    Barriga, Gonzalo P; Martínez-Valdebenito, Constanza; Galeno, Héctor; Ferrés, Marcela; Lozach, Pierre-Yves; Tischler, Nicole D

    2013-11-01

    The focus assay is currently the most commonly used technique for hantavirus titer determination. This method requires an incubation time of between 5 and 11 days to allow the appearance of foci after several rounds of viral infection. The following work presents a rapid Andes virus (ANDV) titration assay, based on viral nucleocapsid protein (N) detection in infected cells by flow cytometry. To this end, an anti-N monoclonal antibody was used that was developed and characterized previously. ANDV N could be detected as early as 6 h post-infection, while viral release was not observed until 24-48 h post-infection. Given that ANDV detection was performed during its first round of infection, a time reduction for titer determination was possible and provided results in only two days. The viral titer was calculated from the percentage of N positive cells and agreed with focus assay titers. Furthermore, the assay was applied to quantify the inhibition of ANDV cell entry by patient sera and by preventing endosome acidification. This novel hantavirus titration assay is a highly quantitative and sensitive tool that facilitates infectivity titration of virus stocks, rapid screening for antiviral drugs, and may be further used to detect and quantify infectious virus in human samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Rapid and Sensitive Lateral Flow Immunoassay Method for Procalcitonin (PCT Based on Time-Resolved Immunochromatography

    Directory of Open Access Journals (Sweden)

    Xiang-Yang Shao

    2017-02-01

    Full Text Available Procalcitonin (PCT is a current, frequently-used marker for severe bacterial infection. The aim of this study was to develop a cost-effective detection kit for rapid quantitative and on-site detection of PCT. To develop the new PCT quantitative detecting kit, a double-antibody sandwich immunofluorescent assay was employed based on time-resolved immunofluorescent assay (TRFIA combined with lateral flow immunoassay (LFIA. The performance of the new developed kit was evaluated in the aspects of linearity, precision, accuracy, and specificity. Two-hundred thirty-four serum samples were enrolled to carry out the comparison test. The new PCT quantitative detecting kit exhibited a higher sensitivity (0.08 ng/mL. The inter-assay coefficient of variation (CV and the intra-assay CV were 5.4%–7.7% and 5.7%–13.4%, respectively. The recovery rates ranged from 93% to 105%. Furthermore, a high correlation (n = 234, r = 0.977, p < 0.0001 and consistency (Kappa = 0.875 were obtained when compared with the PCT kit from Roche Elecsys BRAHMS. Thus, the new quantitative method for detecting PCT has been successfully established. The results indicated that the newly-developed system based on TRFIA combined with LFIA was suitable for rapid and on-site detection for PCT, which might be a useful platform for other biomarkers in point-of-care tests.

  8. Rapid and simple colorimetric method for the quantification of AI-2 produced from Salmonella Typhimurium.

    Science.gov (United States)

    Wattanavanitchakorn, Siriluck; Prakitchaiwattana, Cheunjit; Thamyongkit, Patchanita

    2014-04-01

    The aim of this study was to evaluate the feasibility of Fe(III) ion reduction for the simple and rapid quantification of autoinducer-2 (AI-2) produced from bacteria using Salmonella Typhimurium as a model. Since the molecular structure of AI-2 is somewhat similar to ascorbic acid it was expected that AI-2 would also act as a reducing agent and reduce Fe(III) ions in the presence of 1,10-phenanthroline to form the colored [(o-phen)3 Fe(II)]SO4 ferroin complex that could be quantified colorimetrically. In support of this, colony rinses and cell free supernatants from cultures of all tested AI-2 producing strains, but not the AI-2 negative Sinorhizobium meliloti, formed a colored complex with a λmax of 510nm. The OD510 values of these culture supernatants or colony rinses were in broad agreement with the % activity observed in the same samples using the standard Vibrio harveyi bioluminescence assay for AI-2 detection, and with previously reported results. This methodology could potentially be developed as an alternative method for the simple and rapid quantification of AI-2 levels produced in bacterial cultures. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Bacterial Cytological Profiling (BCP as a Rapid and Accurate Antimicrobial Susceptibility Testing Method for Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    D.T. Quach

    2016-02-01

    Full Text Available Successful treatment of bacterial infections requires the timely administration of appropriate antimicrobial therapy. The failure to initiate the correct therapy in a timely fashion results in poor clinical outcomes, longer hospital stays, and higher medical costs. Current approaches to antibiotic susceptibility testing of cultured pathogens have key limitations ranging from long run times to dependence on prior knowledge of genetic mechanisms of resistance. We have developed a rapid antimicrobial susceptibility assay for Staphylococcus aureus based on bacterial cytological profiling (BCP, which uses quantitative fluorescence microscopy to measure antibiotic induced changes in cellular architecture. BCP discriminated between methicillin-susceptible (MSSA and -resistant (MRSA clinical isolates of S. aureus (n = 71 within 1–2 h with 100% accuracy. Similarly, BCP correctly distinguished daptomycin susceptible (DS from daptomycin non-susceptible (DNS S. aureus strains (n = 20 within 30 min. Among MRSA isolates, BCP further identified two classes of strains that differ in their susceptibility to specific combinations of beta-lactam antibiotics. BCP provides a rapid and flexible alternative to gene-based susceptibility testing methods for S. aureus, and should be readily adaptable to different antibiotics and bacterial species as new mechanisms of resistance or multidrug-resistant pathogens evolve and appear in mainstream clinical practice.

  10. Functional graphene-gold nano-composite fabricated electrochemical biosensor for direct and rapid detection of bisphenol A.

    Science.gov (United States)

    Pan, Daodong; Gu, Yuanyuan; Lan, Hangzhen; Sun, Yangying; Gao, Huiju

    2015-01-01

    In this research, the graphene with excellent dispersity is prepared successfully by introducing gold nanoparticle to separate the individual sheets. Various techniques are adopted to characterize the prepared graphene and graphene-gold nanoparticle composite materials. This fabricated new composite material is used as the support material to construct a novel tyrosinase based biosensor for detection of bisphenol A (BPA). The electrochemical performances of the proposed new enzyme biosensor were investigated by differential pulse voltammetry (DPV) method. The proposed biosensor exhibited excellent performance for BPA determination with a wide linear range (2.5×10(-3)-3.0 μM), a highly reproducible response (RSD of 2.7%), low interferences and long-term stability. And more importantly, the calculated detection limit of the proposed biosensor was as low as 1 nM. Compared with other detection methods, this graphene-gold nanoparticle composite based tyrosinase biosensor is proved to be a promising and reliable tool for rapid detection of BPA for on-site analysis of emergency BPA related pollution affairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Review of the investigation of mixture formation and combustion process using rapid compression machine and direct visualization system

    Science.gov (United States)

    Jaat, M.; Khalid, Amir; Manshoor, B.; Ramsy, Him

    2013-12-01

    This paper reviews of some applications of optical visualization systems to compute the fuel-air mixing process during early stage of mixture formation in Diesel Combustion Engines. A number of studies have contributed to the understanding of fuel air mixing in DI diesel engine. This review has shown that the mixture formation process affects initial flame development. The review also found that injection pressure has a great effect on the mixture formation then the flame development and combustion characteristics. The method of the simulation of real phenomenon of diesel combustion with optical access rapid compression machine is also reviewed and experimental results are presented. The application of these methods to the investigation of diesel sprays highlights mechanisms which govern propagation and distribution of the formation of a combustible fuel-air mixture. A summary of the implementation of constant volume chamber and optical visualization system are shown in the accompanying tables and figures. The visualization of the formation process of diesel spray and its combustion in the diesel combustion chamber of diesel engine has been recognized as one of the best ways to understand the characteristics of the mixture formation.

  12. Rapid method for measuring protease activity in milk using radiolabeled casein

    International Nuclear Information System (INIS)

    Christen, G.L.

    1987-01-01

    A rapid means to detect the presence of protease activity in raw milk could be useful in predicting keeping ability of products made from that milk. A 30-min assay has been developed and compared with three other methods of detecting protease. Casein, [methyl- 14 C]-methylated-alpha was purchased from a radioisotope supplier. Concentrations of substrate from 2 to 20 nCi gave counts per minute, which increased linearly when counted with the Charm analyzer. There was not a significant difference in counting times of 10, 20, or 30 min. A mixture of sodium acetate and acetic acid precipitated nonhydrolyzed substrate with an efficiency of 97%. Comparison of the [ 14 C] casein assay, a casein fluorescein isothiocyanate assay, trinitrobenzenesulfonic acid procedure, and the Hull procedure using protease from psychrotrophic bacteria revealed that the [ 14 C] casein and casein fluorescein isothiocyanate methods were roughly equivalent and that the radiometric procedure was 10 times more sensitive than the trinitrobenzenesulfonic acid assay. The radiometric procedure was approximately 10(4) times more sensitive than the Hull procedure. The [ 14 C] casein and casein fluorescein isothiocyanate methods were similar in time required, about 30 min, while the trinitrobenzenesulfonic acid assay and Hull method required about 1 h plus reagent preparation time. The [ 14 C] casein procedure was most expensive per test; the other three were cheaper and similar to each other in cost

  13. Gas evolution as a rapid screening method for detection of irradiated foods

    International Nuclear Information System (INIS)

    Roberts, P.B.; Chambers, D.M.; Brailsford, G.W.

    1996-01-01

    A number of detection methods for irradiated foods are in advanced state of development. No single method is likely to be universally applicable but a battery of tests such as thermoluminescence, electron spin resonance and analysis of lipid radiolytic products may soon be available for most foods and technical uses of irradiation. Most of these proposed tests require relatively sophisticated equipment or technical skills and are often time consuming and costly. There would be value in relatively simple tests which could be used as a rapid screening system or confirmatory method. The literature on the use of radiolytic gases as a detection method is limited and this paper extends the above studies. In particular, it extends the work to frozen shellfish, for which irradiation has been used as a commercial decontaminant technique for many years, and considers the effect of storage temperature. Work on poultry is also reported as a cross-reference to earlier work and because irradiated poultry has recently been released into the US retail trade. (author)

  14. Sleep Can Eliminate List-Method Directed Forgetting

    Science.gov (United States)

    Abel, Magdalena; Bäuml, Karl-Heinz T.

    2013-01-01

    Recent work suggests a link between sleep and memory consolidation, indicating that sleep in comparison to wakefulness stabilizes memories. However, relatively little is known about how sleep affects forgetting. Here we examined whether sleep influences directed forgetting, the finding that people can intentionally forget obsolete memories when…

  15. Direct determination of anabolic steroids in pig urine by a new SPME-GC-MS method.

    Science.gov (United States)

    Zhang, Zhuomin; Duan, Hongbin; Zhang, Lan; Chen, Xi; Liu, Wei; Chen, Guonan

    2009-05-15

    A new solid phase microextraction (SPME) method coupled with gas chromatography-mass spectrometry (GC-MS) was developed for rapid determination of four anabolic steroids such as 3alpha-hydroxy-5alpha-androstane-17-one (HA), dihydrotestosterone (DHT), androstenedione (AD) and methyltestosterone (MT) in pig urine. SPME was used to extract the four anabolic compounds directly without derivatization. The optimum SPME sampling conditions were based on the home-made carbowax-divinylbenzene (CW-DVB) fiber coating during extraction at 40 degrees C for 50 min with 0.18 g/mL NaCl solution and 750 rpm stirring speed. The linear ranges of the proposed method were in the range of 8-640 pg/mL for HA and DHT and 16-510 pg/mL for AD and MT, respectively. The detection limits (S/N=3) were from 2 to 8 pg/mL for the four anabolic steroids. This SPME method provided very high enrichment factors for the four anabolic steroids, which were 1063-fold and 965-fold for HA and DHT at the concentration of 8 pg/mL and 207-fold and 451-fold for AD and MT at the concentration of 16 pg/mL, respectively. The recoveries ranged from 71.3 to 121%, and the RSDs were lower than 12.9%. The method was sensitive and reliable for determination of trace anabolic steroids in biological samples.

  16. A rapid method to estimate uranium using ionic liquid as extracting agent from basic aqueous media

    International Nuclear Information System (INIS)

    Prabhath Ravi, K.; Sathyapriya, R.S.; Rao, D.D.; Ghosh, S.K.

    2016-01-01

    Room temperature ionic liquids, as their name suggests are salts with a low melting point typically less than 100 °C and exist as liquid at room temperature. The common cationic parts of ionic liquids are imidazolium, pyridinium, pyrrolidinium, quaternary ammonium, or phosphonium ions, and common anionic parts are chloride, bromide, boron tetrafluorate, phosphorous hexafluorate, triflimide etc. The physical properties of ionic liquids can be tuned by choosing appropriate cations with differing alkyl chain lengths and anions. Application of ionic liquids in organic synthesis, liquid-liquid extractions, electrochemistry, catalysis, speciation studies, nuclear reprocessing is being studied extensively in recent times. In this paper a rapid method to estimate the uranium content in aqueous media by extraction with room temperature ionic liquid tricaprylammoniumthiosalicylate ((A- 336)(TS)) followed by liquid scintillation analysis is described. Re-extraction of uranium from ionic liquid phase to aqueous phase was also studied

  17. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  18. A robust and rapid method of producing soluble, stable, and functional G-protein coupled receptors.

    Directory of Open Access Journals (Sweden)

    Karolina Corin

    Full Text Available Membrane proteins, particularly G-protein coupled receptors (GPCRs, are notoriously difficult to express. Using commercial E. coli cell-free systems with the detergent Brij-35, we could rapidly produce milligram quantities of 13 unique GPCRs. Immunoaffinity purification yielded receptors at >90% purity. Secondary structure analysis using circular dichroism indicated that the purified receptors were properly folded. Microscale thermophoresis, a novel label-free and surface-free detection technique that uses thermal gradients, showed that these receptors bound their ligands. The secondary structure and ligand-binding results from cell-free produced proteins were comparable to those expressed and purified from HEK293 cells. Our study demonstrates that cell-free protein production using commercially available kits and optimal detergents is a robust technology that can be used to produce sufficient GPCRs for biochemical, structural, and functional analyses. This robust and simple method may further stimulate others to study the structure and function of membrane proteins.

  19. NATO Advanced Research Workshop, 19-22 May 1997: Rapid Method for Monitoring the Environment for Biological Hazards

    National Research Council Canada - National Science Library

    1997-01-01

    The NATO Advanced Research Workshop met for the purpose of bringing to light rapid methods for monitoring the environment for biological hazards such as biological warfare agents, naturally occurring...

  20. Rapid radiometric methods to detect and differentiate Mycobacterium tuberculosis/M. bovis from other mycobacterial species

    International Nuclear Information System (INIS)

    Siddiqi, S.H.; Hwangbo, C.C.; Silcox, V.; Good, R.C.; Snider, D.E. Jr.; Middlebrook, G.

    1984-01-01

    Rapid methods for the differentiation of Mycobacterium tuberculosis/M. bovis (TB complex) from other mycobacteria (MOTT bacilli) were developed and evaluated in a three-phase study. In the first phase, techniques for identification of Mycobacterium species were developed by using radiometric technology and BACTEC Middlebrook 7H12 liquid medium. Based on 14 CO 2 evolution, characteristic growth patterns were established for 13 commonly encountered mycobacterial species. Mycobacteria belonging to the TB complex were differentiated from other mycobacteria by cellular morphology and rate of 14 CO 2 evolution. For further differentiation, radiometric tests for niacin production and inhibition by Q-nitro-alpha-acetyl amino-beta-hydroxy-propiophenone (NAP) were developed. In the second phase, 100 coded specimens on Lowenstein-Jensen medium were identified as members of the TB complex, MOTT bacilli, bacteria other than mycobacteria, or ''no viable organisms'' within 3 to 12 (average 6.4) days of receipt from the Centers for Disease Control. Isolation and identification of mycobacteria from 20 simulated sputum specimens were carried out in phase III. Out of 20 sputum specimens, 16 contained culturable mycobacteria, and all of the positives were detected by the BACTEC method in an average of 7.3 days. The positive mycobacterial cultures were isolated and identified as TB complex or MOTT bacilli in an average of 12.8 days. The radiometric NAP test was found to be highly sensitive and specific for a rapid identification of TB complex, whereas the radiometric niacin test was found to have some inherent problems. Radiometric BACTEC and conventional methodologies were in complete agreement in Phase II as well as in Phase III

  1. Use of predictive models and rapid methods to nowcast bacteria levels at coastal beaches

    Science.gov (United States)

    Francy, Donna S.

    2009-01-01

    The need for rapid assessments of recreational water quality to better protect public health is well accepted throughout the research and regulatory communities. Rapid analytical methods, such as quantitative polymerase chain reaction (qPCR) and immunomagnetic separation/adenosine triphosphate (ATP) analysis, are being tested but are not yet ready for widespread use.Another solution is the use of predictive models, wherein variable(s) that are easily and quickly measured are surrogates for concentrations of fecal-indicator bacteria. Rainfall-based alerts, the simplest type of model, have been used by several communities for a number of years. Deterministic models use mathematical representations of the processes that affect bacteria concentrations; this type of model is being used for beach-closure decisions at one location in the USA. Multivariable statistical models are being developed and tested in many areas of the USA; however, they are only used in three areas of the Great Lakes to aid in notifications of beach advisories or closings. These “operational” statistical models can result in more accurate assessments of recreational water quality than use of the previous day's Escherichia coli (E. coli)concentration as determined by traditional culture methods. The Ohio Nowcast, at Huntington Beach, Bay Village, Ohio, is described in this paper as an example of an operational statistical model. Because predictive modeling is a dynamic process, water-resource managers continue to collect additional data to improve the predictive ability of the nowcast and expand the nowcast to other Ohio beaches and a recreational river. Although predictive models have been shown to work well at some beaches and are becoming more widely accepted, implementation in many areas is limited by funding, lack of coordinated technical leadership, and lack of supporting epidemiological data.

  2. Rapid, convenient method for screening imidazole-containing compounds for heme oxygenase inhibition.

    Science.gov (United States)

    Vlahakis, Jason Z; Rahman, Mona N; Roman, Gheorghe; Jia, Zongchao; Nakatsu, Kanji; Szarek, Walter A

    2011-01-01

    Sensitive assays for measuring heme oxygenase activity have been based on the gas-chromatographic detection of carbon monoxide using elaborate, expensive equipment. The present study describes a rapid and convenient method for screening imidazole-containing candidates for inhibitory activity against heme oxygenase using a plate reader, based on the spectroscopic evaluation of heme degradation. A PowerWave XS plate reader was used to monitor the absorbance (as a function of time) of heme bound to purified truncated human heme oxygenase-1 (hHO-1) in the individual wells of a standard 96-well plate (with or without the addition of a test compound). The degradation of heme by heme oxygenase-1 was initiated using l-ascorbic acid, and the collected relevant absorbance data were analyzed by three different methods to calculate the percent control activity occurring in wells containing test compounds relative to that occurring in control wells with no test compound present. In the cases of wells containing inhibitory compounds, significant shifts in λ(max) from 404 to near 412 nm were observed as well as a decrease in the rate of heme degradation relative to that of the control. Each of the three methods of data processing (overall percent drop in absorbance over 1.5h, initial rate of reaction determined over the first 5 min, and estimated pseudo first-order reaction rate constant determined over 1.5h) gave similar and reproducible results for percent control activity. The fastest and easiest method of data analysis was determined to be that using initial rates, involving data acquisition for only 5 min once reactions have been initiated using l-ascorbic acid. The results of the study demonstrate that this simple assay based on the spectroscopic detection of heme represents a rapid, convenient method to determine the relative inhibitory activity of candidate compounds, and is useful in quickly screening a series or library of compounds for heme oxygenase inhibition

  3. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  4. 29 CFR 4211.13 - Modifications to the direct attribution method.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Modifications to the direct attribution method. 4211.13... Changes Not Subject to PBGC Approval § 4211.13 Modifications to the direct attribution method. (a) Error in direct attribution method. The unfunded vested benefits allocated to a withdrawing employer under...

  5. Development and Validation of a Bioanalytical Method for Direct ...

    African Journals Online (AJOL)

    Purpose: To develop and validate a user-friendly spiked plasma method for the extraction of diclofenac potassium that reduces the number of treatments with plasma sample, in order to minimize human error. Method: Instead of solvent evaporation technique, the spiked plasma sample was modified with H2SO4 and NaCl, ...

  6. Method of operating a direct dme fuel cell system

    DEFF Research Database (Denmark)

    2011-01-01

    The present invention relates to a method of operating a fuel cell system comprising one or more fuel cells with a proton exchange membrane, wherein the membrane is composed of a polymeric material comprising acid-doped polybenzimidazole (PBI). The method comprises adjusting the operating...

  7. Development and testing of monoclonal antibody-based rapid immunodiagnostic test kits for direct detection of Vibrio cholerae O139 synonym Bengal.

    Science.gov (United States)

    Hasan, J A; Huq, A; Nair, G B; Garg, S; Mukhopadhyay, A K; Loomis, L; Bernstein, D; Colwell, R R

    1995-11-01

    We report on the development and testing of two monoclonal antibody-based rapid immunodiagnostic test kits, BengalScreen, a coagglutination test, and Bengal DFA, a direct fluorescent-antibody test, for direct detection of Vibrio cholerae O139 synonym Bengal in clinical and environmental specimens. The BengalScreen test requires less than 5 min to complete and can be used in the field. Bengal DFA, being more sensitive than BengalScreen, requires only one reagent and less than 20 min for detection and enumeration of V. cholerae O139 synonym Bengal. In tests for specificity, all 40 strains of V. cholerae O139 reacted with both test kits, whereas 157 strains of heterologous species examined did not, yielding 100% specificity in this study. A field trial was conducted in with both BengalScreen and Bengal DFA, and the results were compared with those obtained by conventional culture methods. BengalScreen demonstrated a sensitivity of 95%, a specificity of 100%, a positive predictive value of 100%, and a negative predictive value of 94%. Results obtained by Bengal DFA, on the other hand, were 100% sensitive and 100% specific and yielded 100% positive and negative predictive values compared with culture methods. In a second evaluation, 93 stool specimens from Mexico that were negative for V. cholerae O139 by culture were also tested with both the BengalScreen and Bengal DFA kits. None of the 93 specimens were positive for V. cholerae O139 by both tests. A concentration method was optimized for screening of environmental water samples for V. cholerae O139 synonym Bengal with rapid test kits. BengalScreen results were unequivocally positive when water samples contained at least 2.0 x 10(3) CFU/ml, whereas Bengal DFA demonstrated an unequivocally positive reaction when the water sample contained at least 1.5 x 10(2) CFU/ml. When Bengal DFA was compared with conventional culture methods for enumeration of V. cholerae O139 synonym Bengal organisms, no difference was observed.

  8. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  9. Aptamer-mediated colorimetric method for rapid and sensitive detection of chloramphenicol in food.

    Science.gov (United States)

    Yan, Chao; Zhang, Jing; Yao, Li; Xue, Feng; Lu, Jianfeng; Li, Baoguang; Chen, Wei

    2018-09-15

    We report an aptamer-mediated colorimetric method for sensitive detection of chloramphenicol (CAP). The aptamer of CAP is immobilized by the hybridization with pre-immobilized capture probe in the microtiter plate. The horseradish peroxidase (HRP) is covalently attached to the aptamer by the biotin-streptavidin system for signal production. CAP will preferably bind with aptamer due to the high binding affinity, which attributes to the release of aptamer and HRP and thus, affects the optical signal intensity. Quantitative determination of CAP is successfully achieved in the wide range from 0.001 to 1000 ng/mL with detection limit of 0.0031 ng/mL, which is more sensitive than traditional immunoassays. This method is further validated by measuring the recovery of CAP spiked in two different food matrices (honey and fish). The aptamer-mediated colorimetric method can be a useful protocol for rapid and sensitive screening of CAP, and may be used as an alternative means for traditional immunoassays. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Natural transformation of Vibrio parahaemolyticus: A rapid method to create genetic deletions.

    Science.gov (United States)

    Chimalapati, Suneeta; de Souza Santos, Marcela; Servage, Kelly; De Nisco, Nicole J; Dalia, Ankur B; Orth, Kim

    2018-03-19

    The Gram-negative bacterium Vibrio parahaemolyticus is an opportunistic human pathogen and the leading cause of seafood borne acute gastroenteritis worldwide. Recently, this bacterium was implicated as the etiologic agent of a severe shrimp disease with consequent devastating outcomes to shrimp farming. In both cases, acquisition of genetic material via horizontal transfer provided V. parahaemolyticus with new virulence tools to cause disease. Dissecting the molecular mechanisms of V. parahaemolyticus pathogenesis often requires manipulating its genome. Classically, genetic deletions in V. parahaemolyticus are performed using a laborious, lengthy, multi-step process. Herein, we describe a fast and efficient method to edit this bacterium's genome based on V. parahaemolyticus natural competence. Although this method is similar to one previously described, V. parahaemolyticus requires counter selection for curing of acquired plasmids due to its recalcitrant nature of retaining extrachromosomal DNA. We believe this approach will be of use to the Vibrio community. Importance Spreading of Vibrios throughout the world correlates with increased global temperatures. As they spread, they find new niches to survive, proliferate and invade. Therefore, genetic manipulation of Vibrios is of utmost importance for studying these species. Herein, we have delineated and validated a rapid method to create genetic deletions in Vibrio parahaemolyticus This study provides insightful methodology for studies with other Vibrio species. Copyright © 2018 American Society for Microbiology.

  11. Novel rapid method for the characterisation of polymeric sugars from macroalgae.

    Science.gov (United States)

    Spicer, S E; Adams, J M M; Thomas, D S; Gallagher, J A; Winters, Ana L

    2017-01-01

    Laminarins are storage polysaccharides found only in brown seaweeds, specifically Laminarialaes and Fucales. Laminarin has been shown to have anti-apoptotic and anti-tumoural activities and is considered as a nutraceutical component that can positively influence human health. The structure is species dependent, generally composed of linear ß(1-3) glucans with intrachain β(1-6) branching and varies according to harvest season and environmental factors. Current methods for analysis of molar mass and DP length are technically demanding and are not widely available. Here, we present a simple inexpensive method which enables rapid analysis of laminarins from macroalgal biomass using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) without the need for hydrolysis or further processing. This is based on the linear relationship observed between log 10 DP and retention time following separation of laminarins on a CarboPac PA-100 column (Dionex) using standard 1,3-β-d-gluco-oligosaccharides ranging in DP from 2 to 8. This method was applied to analyse laminarin oligomers in extracts from different species harvested from within the intertidal zone on Welsh rocky shores containing laminarin polymers with different ranges of DP. The degree of polymerisation and extrapolated molar mass agreed well with values estimated by LC-ESI/MS n analysis and those reported in the literature.

  12. Rapid, high-temperature, field test method for evaluation of geothermal calcium carbonate scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1986-09-01

    A new test method is described that allows the rapid field testing of calcium carbonate scale inhibitors at 500/sup 0/F (260/sup 0/C). The method evolved from use of a full-flow test loop on a well with a mass flow rate of about 1 x 10/sup 6/ lbm/hr (126 kg/s). It is a simple, effective way to evaluate the effectiveness of inhibitors under field conditions. Five commercial formulations were chosen for field evaluation on the basis of nonflowing, laboratory screening tests at 500/sup 0/F (260/sup 0/C). Four of these formulations from different suppliers controlled calcium carbonate scale deposition as measured by the test method. Two of these could dislodge recently deposited scale that had not age-hardened. Performance-profile diagrams, which were measured for these four effective inhibitors, show the concentration interrelationship between brine calcium and inhibitor concentrations at which the formulations will and will not stop scale formation in the test apparatus. With these diagrams, one formulation was chosen for testing on the full-flow brine line. The composition was tested for 6 weeks and showed a dramatic decrease in the scaling occurring at the flow-control valve. This scaling was about to force a shutdown of a major, long-term flow test being done for reservoir economic evaluations. The inhibitor stopped the scaling, and the test was performed without interruption.

  13. Development of a rapid HRM genotyping method for detection of dog-derived Giardia lamblia.

    Science.gov (United States)

    Tan, Liping; Yu, Xingang; Abdullahi, Auwalu Yusuf; Wu, Sheng; Zheng, Guochao; Hu, Wei; Song, Meiran; Wang, Zhen; Jiang, Biao; Li, Guoqing

    2015-11-01

    Giardia lamblia is a zoonotic flagellate protozoan in the intestine of human and many mammals including dogs. To assess a threat of dog-derived G. lamblia to humans, the common dog-derived G. lamblia assemblages A, C, and D were genotyped by high-resolution melting (HRM) technology. According to β-giardin gene sequence, the qPCR-HRM primers BG5 and BG7 were designed. A series of experiments on the stability, sensitivity, and accuracy of the HRM method were also tested. Results showed that the primers BG5 and BG7 could distinguish among three assemblages A, C, and D, which Tm value differences were about 1 °C to each other. The melting curves of intra-assay reproducibility were almost coincided, and those of inter-assay reproducibility were much the same shape. The lowest detection concentration was about 5 × 10(-6)-ng/μL sample. The genotyping results from 21 G. lamblia samples by the HRM method were in complete accordance with sequencing results. It is concluded that the HRM genotyping method is rapid, stable, specific, highly sensitive, and suitable for clinical detection and molecular epidemiological survey of dog-derived G. lamblia.

  14. AO–MW–PLS method applied to rapid quantification of teicoplanin with near-infrared spectroscopy

    Directory of Open Access Journals (Sweden)

    Jiemei Chen

    2017-01-01

    Full Text Available Teicoplanin (TCP is an important lipoglycopeptide antibiotic produced by fermenting Actinoplanes teichomyceticus. The change in TCP concentration is important to measure in the fermentation process. In this study, a reagent-free and rapid quantification method for TCP in the TCP–Tris–HCl mixture samples was developed using near-infrared (NIR spectroscopy by focusing our attention on the fermentation process for TCP. The absorbance optimization (AO partial least squares (PLS was proposed and integrated with the moving window (MW PLS, which is called AO–MW–PLS method, to select appropriate wavebands. A model set that includes various wavebands that were equivalent to the optimal AO–MW–PLS waveband was proposed based on statistical considerations. The public region of all equivalent wavebands was just one of the equivalent wavebands. The obtained public regions were 1540–1868nm for TCP and 1114–1310nm for Tris. The root-mean-square error and correlation coefficient for leave-one-out cross validation were 0.046mg mL−1 and 0.9998mg mL−1 for TCP, and 0.235mg mL−1 and 0.9986mg mL−1 for Tris, respectively. All the models achieved highly accurate prediction effects, and the selected wavebands provided valuable references for designing specialized spectrometers. This study provided a valuable reference for further application of the proposed methods to TCP fermentation broth and to other spectroscopic analysis fields.

  15. Rapid, Simple, and Sensitive Spectrofluorimetric Method for the Estimation of Ganciclovir in Bulk and Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Garima Balwani

    2013-01-01

    Full Text Available A new, simple, rapid, sensitive, accurate, and affordable spectrofluorimetric method was developed and validated for the estimation of ganciclovir in bulk as well as in marketed formulations. The method was based on measuring the native fluorescence of ganciclovir in 0.2 M hydrochloric acid buffer of pH 1.2 at 374 nm after excitation at 257 nm. The calibration graph was found to be rectilinear in the concentration range of 0.25–2.00 μg mL−1. The limit of quantification and limit of detection were found to be 0.029 μg mL−1 and 0.010 μg mL−1, respectively. The method was fully validated for various parameters according to ICH guidelines. The results demonstrated that the procedure is accurate, precise, and reproducible (relative standard deviation <2% and can be successfully applied for the determination of ganciclovir in its commercial capsules with average percentage recovery of 101.31 ± 0.90.

  16. Rapid maxillary expansion effects: An alternative assessment method by means of cone-beam tomography

    Directory of Open Access Journals (Sweden)

    Camilo Aquino Melgaço

    2014-10-01

    Full Text Available INTRODUCTION: This study aims to develop a method to assess the changes in palatal and lingual cross-sectional areas in patients submitted to rapid maxillary expansion (RME. METHODS: The sample comprised 31 Class I malocclusion individuals submitted to RME and divided into two groups treated with Haas (17 patients and Hyrax (14 patients expanders. Cone-beam computed tomography scans were acquired at T0 (before expansion and T1 (six months after screw stabilization. Maxillary and mandibular cross-sectional areas were assessed at first permanent molars and first premolars regions and compared at T0 and T1. Mandibular occlusal area was also analyzed. RESULTS: Maxillary cross-sectional areas increased in 56.18 mm2 and 44.32 mm2 for the posterior and anterior regions. These values were smaller for the mandible, representing augmentation of 40.32 mm2 and 39.91 mm2 for posterior and anterior sections. No differences were found when comparing both expanders. Mandibular occlusal area increased 43.99mm2 and mandibular incisors proclined. Increments of 1.74 mm and 1.7 mm occurred in mandibular intermolar and interpremolar distances. These same distances presented increments of 5.5 mm and 5.57 mm for the maxillary arch. CONCLUSION: Occlusal and cross-sectional areas increased significantly after RME. The method described seems to be reliable and precise to assess intraoral area changes.

  17. Development of a new rapid HPLC method for the fractionation of histones

    International Nuclear Information System (INIS)

    Gurley, L.R.; Valdez, J.G.; Prentice, D.A.; Spall, W.D.

    1983-01-01

    To study histone functions, it is necessary to fractionate the histones into their five classes (H1, H2A, H2B, H3 and H4) and then to subfractionate these classes into variants having slightly different primary structures and into different phosphorylated and acetylated forms. With the advent of high-performance liquid chromatography (HPLC), it was hoped that laborious and time-consuming conventional methods could be replaced by a simple, rapid, high-resolving HPLC method for fractionating histones. However, problems of irreversible adsorption of the histones to HPLC column packings discouraged this development. Our laboratory has now determined that the strong adsorption of histones to HPLC columns results from two different forces: (1) polar interactions between the histones and the silanol groups of silica-based HPLC column packing, and (2) hydrophobic interactions between the histones and the bound organic phase of the column packings. By minimizing these forces, we have succeeded in developing an HPLC method suitable for histone studies

  18. Study on a noninvasive method for rapid screening Human Serum albumin injectables by Raman spectroscopy

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2017-01-01

    Full Text Available Human serum albumin (HSA injectable product is a severely afflicted area on drug safety due to its high price and restricted supply. Raman spectroscopy performances high specificity on HSA detection and it is even possible to determine HSA injectable products noninvasively. In this study, we developed a noninvasive rapid screening method for of HSA injectable products by using portable Raman spectrometer. Qualitative models were established by using principal component analysis combined with classical least squares (PCA-CLS algorithm, while quantitative model was established by using partial least squares (PLS algorithm. Model transfer in different instruments of both the same and different apparatus modules was further discussed in this paper. A total of 34 HSA injectable samples collected from markets were used for verification. The identification results showed 100% accuracy and the predicted concentrations of those identified as true HSA were consistent with their labeled concentrations. The quantitative results also indicated that model transfer was excellent in the same apparatus modules of Raman spectrometer at all concentration levels, and still good enough in the different apparatus modules although the relative standard deviation (RSD value showed a little increasing trend at low HSA concentration level. In conclusion, the method was proved to be feasible and efficient for screening HSA injections, especially on its screening speed and the consideration of glass containers. Moreover, with inspiring results on the model transfer, the method could be used as a universal screening mean to different Raman instruments.

  19. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  20. Rapid diagnosis of diarrhea caused by Shigella sonnei using dipsticks; comparison of rectal swabs, direct stool and stool culture.

    Directory of Open Access Journals (Sweden)

    Claudia Duran

    Full Text Available BACKGROUND: We evaluated a dipstick test for rapid detection of Shigella sonnei on bacterial colonies, directly on stools and from rectal swabs because in actual field situations, most pathologic specimens for diagnosis correspond to stool samples or rectal swabs. METHODOLOGY/PRINCIPAL FINDINGS: The test is based on the detection of S. sonnei lipopolysaccharide (LPS O-side chains using phase I-specific monoclonal antibodies coupled to gold particles, and displayed on a one-step immunochromatographic dipstick. A concentration as low as 5 ng/ml of LPS was detected in distilled water and in reconstituted stools in 6 minutes. This is the optimal time for lecture to avoid errors of interpretation. In distilled water and in reconstituted stools, an unequivocal positive reaction was obtained with 4 x 10(6 CFU/ml of S. sonnei. The specificity was 100% when tested with a battery of Shigella and different unrelated strains. When tested on 342 rectal swabs in Chile, specificity (281/295 was 95.3% (95% CI: 92.9% - 97.7% and sensitivity (47/47 was 100%. Stool cultures and the immunochromatographic test showed concordant results in 95.5 % of cases (328/342 in comparative studies. Positive and negative predictive values were 77% (95% CI: 65% - 86.5% and 100% respectively. When tested on 219 stools in Chile, Vietnam, India and France, specificity (190/198 was 96% (95% CI 92%-98% and sensitivity (21/21 was 100%. Stool cultures and the immunochromatographic test showed concordant results in 96.3 % of cases (211/219 in comparative studies. Positive and negative predictive values were 72.4% (95% CI 56.1%-88.6% and 100 %, respectively. CONCLUSION: This one-step dipstick test performed well for diagnosis of S. sonnei both on stools and on rectal swabs. These data confirm a preliminary study done in Chile.

  1. A Rapid Method for Quantifying Viable Mycobacterium avium subsp. paratuberculosis in Cellular Infection Assays

    Science.gov (United States)

    Pooley, Hannah B.; de Silva, Kumudika; Purdie, Auriol C.; Begg, Douglas J.; Whittington, Richard J.

    2016-01-01

    ABSTRACT Determining the viability of bacteria is a key outcome of in vitro cellular infection assays. Currently, this is done by culture, which is problematic for fastidious slow-growing bacteria such as Mycobacterium avium subsp. paratuberculosis, where it can take up to 4 months to confirm growth. This study aimed to identify an assay that can rapidly quantify the number of viable M. avium subsp. paratuberculosis cells in a cellular sample. Three commercially available bacterial viability assays along with a modified liquid culture method coupled with high-throughput quantitative PCR growth detection were assessed. Criteria for assessment included the ability of each assay to differentiate live and dead M. avium subsp. paratuberculosis organisms and their accuracy at low bacterial concentrations. Using the culture-based method, M. avium subsp. paratuberculosis growth was reliably detected and quantified within 2 weeks. There was a strong linear association between the 2-week growth rate and the initial inoculum concentration. The number of viable M. avium subsp. paratuberculosis cells in an unknown sample was quantified based on the growth rate, by using growth standards. In contrast, none of the commercially available viability assays were suitable for use with samples from in vitro cellular infection assays. IMPORTANCE Rapid quantification of the viability of Mycobacterium avium subsp. paratuberculosis in samples from in vitro cellular infection assays is important, as it allows these assays to be carried out on a large scale. In vitro cellular infection assays can function as a preliminary screening tool, for vaccine development or antimicrobial screening, and also to extend findings derived from experimental animal trials. Currently, by using culture, it takes up to 4 months to obtain quantifiable results regarding M. avium subsp. paratuberculosis viability after an in vitro infection assay; however, with the quantitative PCR and liquid culture method

  2. Rapid and cost-effective identification and antimicrobial susceptibility testing in patients with Gram-negative bacteremia directly from blood-culture fluid.

    Science.gov (United States)

    Sakarikou, Christina; Altieri, Anna; Bossa, Maria Cristina; Minelli, Silvia; Dolfa, Camilla; Piperno, Micol; Favalli, Cartesio

    2018-03-01

    Rapid pathogen identification (ID) and antimicrobial susceptibility testing (AST) in bacteremia cases or sepsis could improve patient prognosis. Thus, it is important to provide timely reports, which make it possible for clinicians to set up appropriate antibiotic therapy during the early stages of bloodstream infection (BSI). This study evaluates an in-house microbiological protocol for early ID as well as AST on Gram negative bacteria directly from positive monomicrobial and polymicrobial blood cultures (BCs). A total of 102 non-duplicated positive BCs from patients with Gram-negative bacteremia were tested. Both IDs and ASTs were performed from bacterial pellets extracted directly from BCs using our protocol, which was applied through the combined use of a MALDI-TOF MS and Vitek2 automated system. The results of our study showed a 100% agreement in bacterial ID and 98.25% categorical agreement in AST when compared to those obtained by routine conventional methods. We recorded only a 0.76% minor error (mE), 0.76% major error (ME) and a 0.20% very major error (VME). Moreover, the turnaround time (TAT) regarding the final AST report was significantly shortened (ΔTAT = 8-20 h, p patient management, by early and appropriate antimicrobial treatment and could potentially optimize antimicrobial stewardship programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Validity and feasibility of a satellite imagery-based method for rapid estimation of displaced populations.

    Science.gov (United States)

    Checchi, Francesco; Stewart, Barclay T; Palmer, Jennifer J; Grundy, Chris

    2013-01-23

    Estimating the size of forcibly displaced populations is key to documenting their plight and allocating sufficient resources to their assistance, but is often not done, particularly during the acute phase of displacement, due to methodological challenges and inaccessibility. In this study, we explored the potential use of very high resolution satellite imagery to remotely estimate forcibly displaced populations. Our method consisted of multiplying (i) manual counts of assumed residential structures on a satellite image and (ii) estimates of the mean number of people per structure (structure occupancy) obtained from publicly available reports. We computed population estimates for 11 sites in Bangladesh, Chad, Democratic Republic of Congo, Ethiopia, Haiti, Kenya and Mozambique (six refugee camps, three internally displaced persons' camps and two urban neighbourhoods with a mixture of residents and displaced) ranging in population from 1,969 to 90,547, and compared these to "gold standard" reference population figures from census or other robust methods. Structure counts by independent analysts were reasonably consistent. Between one and 11 occupancy reports were available per site and most of these reported people per household rather than per structure. The imagery-based method had a precision relative to reference population figures of layout. For each site, estimates were produced in 2-5 working person-days. In settings with clearly distinguishable individual structures, the remote, imagery-based method had reasonable accuracy for the purposes of rapid estimation, was simple and quick to implement, and would likely perform better in more current application. However, it may have insurmountable limitations in settings featuring connected buildings or shelters, a complex pattern of roofs and multi-level buildings. Based on these results, we discuss possible ways forward for the method's development.

  4. Improved Savitzky-Golay-method-based fluorescence subtraction algorithm for rapid recovery of Raman spectra.

    Science.gov (United States)

    Chen, Kun; Zhang, Hongyuan; Wei, Haoyun; Li, Yan

    2014-08-20

    In this paper, we propose an improved subtraction algorithm for rapid recovery of Raman spectra that can substantially reduce the computation time. This algorithm is based on an improved Savitzky-Golay (SG) iterative smoothing method, which involves two key novel approaches: (a) the use of the Gauss-Seidel method and (b) the introduction of a relaxation factor into the iterative procedure. By applying a novel successive relaxation (SG-SR) iterative method to the relaxation factor, additional improvement in the convergence speed over the standard Savitzky-Golay procedure is realized. The proposed improved algorithm (the RIA-SG-SR algorithm), which uses SG-SR-based iteration instead of Savitzky-Golay iteration, has been optimized and validated with a mathematically simulated Raman spectrum, as well as experimentally measured Raman spectra from non-biological and biological samples. The method results in a significant reduction in computing cost while yielding consistent rejection of fluorescence and noise for spectra with low signal-to-fluorescence ratios and varied baselines. In the simulation, RIA-SG-SR achieved 1 order of magnitude improvement in iteration number and 2 orders of magnitude improvement in computation time compared with the range-independent background-subtraction algorithm (RIA). Furthermore the computation time of the experimentally measured raw Raman spectrum processing from skin tissue decreased from 6.72 to 0.094 s. In general, the processing of the SG-SR method can be conducted within dozens of milliseconds, which can provide a real-time procedure in practical situations.

  5. Evaluation of a rapid method for measurement of catalase activity in cooked beef and sausage.

    Science.gov (United States)

    Davis, C E; Cyrus, S

    1998-02-01

    Catalase (CAT) activity in ground beef and pork was determined on samples cooked from 60 to 71.1 degrees C. One-gram samples of ground round (4% fat), hamburger (24% fat), and commercial pork sausage (38%fat) were cooked in a controlled-temperature waterbath at 65, 68.3 and 71 degrees C. Chilled samples were immersed in direct contact with the cooking water; the test samples were removed every 15 s and immediately immersed in an ice-water bath (O to 1 degrees C) to quick-chill the samples to prevent temperature over-run. Samples retained high (HMB value 20+, over range) CAT activity through 90, 60, and 45 s at 65, 68.3, and 71 degrees C, respectively, before showing rapid activity decreases. Four USDA-FSIS approved meat patty heating processes (66.1 degrees C, 41 s; 67.2 degrees C, 26 s; 68.3 degrees C, 16 s; and 69.4 degrees C, 10 s) were analyzed for CAT activity in meat frozen prior to cooking was slightly lower (P sausage products and may be useful to USDA FSIS process inspectors and food processors in quality assurance and HACCP (hazard analysis critical control points) programs for thermal input verification.

  6. Application of rapid microbiological screening methods for detection of irradiated frozen foods

    International Nuclear Information System (INIS)

    Hussain, A.A.; Rady, A.H.; ElBary, N.A.A.

    2003-01-01

    The exposure of food to ionizing radiation is being progressively used in many countries to, inactivate food pathogens, eradicate pests and extend shelf-life. To ensure free consumer choice, irradiated food. The direct epi fluorescent filter technique (DEFT) was applied as recent and rapid technique for determination of total bacterial count in irradiated minced chicken (2,4,6, and 8 kGy) as well as non-irradiated samples. Also aerobic plate count (APC) was used to determine the viable bacterial cells. A large significant differences between the profiteered DEFT and APC counts were obtained with the irradiated samples of each chicken and fish where the conventional plating gives a much lower values than the (DEFT) technique compared with non-irradiated samples. A highly correlation (r=0.99 and 1.00) were detected at 8 and 6 kGy with irradiated minced chicken and fish respectively. The Gram-negative bacteria belonging to (Enterobacteriaceae and fluorescence pseudomonas) showed very low count in the irradiated selected fish samples compared with control while the endotoxin selected fish samples compared with control while the endotoxin levels did not affect under the same conditions. Micro-gel electrophoresis indicated that gamma irradiation at 8 kGy can induce DNA damage in the cells of both minced chicken and fish where, some bands disappeared compared with the non-irradiated samples

  7. Ecosytem Services: A Rapid Assessment Method Tested at 35 Sites of the LTER-Europe Network

    Directory of Open Access Journals (Sweden)

    Dick Jan

    2014-08-01

    Full Text Available The identification of parameters to monitor the ecosystem services delivered at a site is fundamental to the concept’s adoption as a useful policy instrument at local, national and international scales. In this paper we (i describe the process of developing a rapid comprehensive ecosystem service assessment methodology and (ii test the applicability of the protocol at 35 long-term research (LTER sites across 14 countries in the LTER-Europe network (www.lter-europe.net including marine, urban, agricultural, forest, desert and conservation sites. An assessment of probability of occurrence with estimated confidence score using 83 ecosystem service parameters was tested. The parameters were either specific services like food production or proxies such as human activities which were considered surrogates for cultural diversity and economic activity. This initial test of the ecosystem service parameter list revealed that the parameters tested were relatively easy to score by site managers with a high level of certainty (92% scored as either occurring or not occurring at the site with certainty of over 90%. Based on this assessment, we concluded that (i this approach to operationalise the concept of ecosystem services is practical and applicable by many sectors of civil society as a first screen of the ecosystem services present at a site, (ii this study has direct relevance to land management and policy decision makers as a transparent vehicle to focus testing scenarios and target data gathering, but (iii further work beyond the scale investigated here is required to ensure global applicability.

  8. Blind compressed sensing image reconstruction based on alternating direction method

    Science.gov (United States)

    Liu, Qinan; Guo, Shuxu

    2018-04-01

    In order to solve the problem of how to reconstruct the original image under the condition of unknown sparse basis, this paper proposes an image reconstruction method based on blind compressed sensing model. In this model, the image signal is regarded as the product of a sparse coefficient matrix and a dictionary matrix. Based on the existing blind compressed sensing theory, the optimal solution is solved by the alternative minimization method. The proposed method solves the problem that the sparse basis in compressed sensing is difficult to represent, which restrains the noise and improves the quality of reconstructed image. This method ensures that the blind compressed sensing theory has a unique solution and can recover the reconstructed original image signal from a complex environment with a stronger self-adaptability. The experimental results show that the image reconstruction algorithm based on blind compressed sensing proposed in this paper can recover high quality image signals under the condition of under-sampling.

  9. Rapid determination of piracetam in human plasma and cerebrospinal fluid by micellar electrokinetic chromatography with sample direct injection.

    Science.gov (United States)

    Yeh, Hsin-Hua; Yang, Yuan-Han; Ko, Ju-Yun; Chen, Su-Hwei

    2006-07-07

    A simple micellar electrokinetic chromatography (MEKC) method with UV detection at 200 nm for analysis of piracetam in plasma and in cerebrospinal fluid (CSF) by direct injection without any sample pretreatment is described. The separation of piracetam from biological matrix was performed at 25 degrees C using a background electrolyte consisting of Tris buffer with sodium dodecyl sulfate (SDS) as the electrolyte solution. Several parameters affecting the separation of the drug from biological matrix were studied, including the pH and concentrations of the Tris buffer and SDS. Under optimal MEKC condition, good separation with high efficiency and short analyses time is achieved. Using imidazole as an internal standard (IS), the linear ranges of the method for the determination of piracetam in plasma and in CSF were all between 5 and 500 microg/mL; the detection limit of the drug in plasma and in CSF (signal-to-noise ratio=3; injection 0.5 psi, 5s) was 1.0 microg/mL. The applicability of the proposed method for determination of piracetam in plasma and CSF collected after intravenous administration of 3g piracetam every 6h and oral administration 1.2g every 6h in encephalopathy patients with aphasia was demonstrated.

  10. Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

    Directory of Open Access Journals (Sweden)

    Hyoung Rai Ko

    2017-09-01

    Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

  11. Rapid filtration separation-based sample preparation method for Bacillus spores in powdery and environmental matrices.

    Science.gov (United States)

    Isabel, Sandra; Boissinot, Maurice; Charlebois, Isabelle; Fauvel, Chantal M; Shi, Lu-E; Lévesque, Julie-Christine; Paquin, Amélie T; Bastien, Martine; Stewart, Gale; Leblanc, Eric; Sato, Sachiko; Bergeron, Michel G

    2012-03-01

    Authorities frequently need to analyze suspicious powders and other samples for biothreat agents in order to assess environmental safety. Numerous nucleic acid detection technologies have been developed to detect and identify biowarfare agents in a timely fashion. The extraction of microbial nucleic acids from a wide variety of powdery and environmental samples to obtain a quality level adequate for these technologies still remains a technical challenge. We aimed to develop a rapid and versatile method of separating bacteria from these samples and then extracting their microbial DNA. Bacillus atrophaeus subsp. globigii was used as a simulant of Bacillus anthracis. We studied the effects of a broad variety of powdery and environmental samples on PCR detection and the steps required to alleviate their interference. With a benchmark DNA extraction procedure, 17 of the 23 samples investigated interfered with bacterial lysis and/or PCR-based detection. Therefore, we developed the dual-filter method for applied recovery of microbial particles from environmental and powdery samples (DARE). The DARE procedure allows the separation of bacteria from contaminating matrices that interfere with PCR detection. This procedure required only 2 min, while the DNA extraction process lasted 7 min, for a total of sample preparation procedure allowed the recovery of cleaned bacterial spores and relieved detection interference caused by a wide variety of samples. Our procedure was easily completed in a laboratory facility and is amenable to field application and automation.

  12. Rapid processing method for solution deposited YBa2Cu3O7-δ thin films

    International Nuclear Information System (INIS)

    Dawley, J.T.; Clem, P.G.; Boyle, T.J.; Ottley, L.M.; Overmyer, D.L.; Siegal, M.P.

    2004-01-01

    YBa 2 Cu 3 O 7-δ (YBCO) films, deposited on buffered metal substrates, are the primary candidate for second-generation superconducting (SC) wires, with applications including expanded power grid transmission capability, compact motors, and enhanced sensitivity magnetic resonance imaging. Feasibility of manufacturing such superconducting wires is dependent on high processing speed, often a limitation of vapor and solution-based YBCO deposition processes. In this work, YBCO films were fabricated via a new diethanolamine-modified trifluoroacetic film solution deposition method. Modifying the copper chemistry of the YBCO precursor solution with diethanolamine enables a hundredfold decrease in the organic pyrolysis time required for MA/cm 2 current density (J c ) YBCO films, from multiple hours to ∼20 s in atmospheric pressure air. High quality, ∼0.2 μm thick YBCO films with J c (77 K) values ≥2 MA/cm 2 at 77 K are routinely crystallized from these rapidly pyrolyzed films deposited on LaAlO 3 . This process has also enabled J c (77 K)=1.1 MA/cm 2 YBCO films via 90 m/h dip-coating on Oak Ridge National Laboratory RABiTS textured metal tape substrates. This new YBCO solution deposition method suggests a route toward inexpensive and commercializable ∼$10/kA m solution deposited YBCO coated conductor wires

  13. Comparing rapid and culture indicator bacteria methods at inland lake beaches

    Science.gov (United States)

    Francy, Donna S.; Bushon, Rebecca N.; Brady, Amie M.G.; Kephart, Christopher M.

    2013-01-01

    A rapid method, quantitative polymerase chain reaction (qPCR), for quantifying indicator bacteria in recreational waters is desirable for public health protection. We report that replacing current Escherichia coli standards with new US Environmental Protection Agency beach action values (BAVs) for enterococci by culture or qPCR may result in more advisories being posted at inland recreational lakes. In this study, concentrations of E. coli and enterococci by culture methods were compared to concentrations of Enterococcus spp. by qPCR at 3 inland lake beaches in Ohio. The E. coli and enterococci culture results were significantly related at all beaches; however, the relations between culture results and Enterococcus spp. qPCR results were not always significant and differed among beaches. All the qPCR results exceeded the new BAV for Enterococcus spp. by qPCR, whereas only 23.7% of culture results for E. coli and 79% of culture results for enterococci exceeded the current standard for E. coli or BAV for enterococci.

  14. Development of a Rapid and Simple Method to Remove Polyphenols from Plant Extracts

    Directory of Open Access Journals (Sweden)

    Imali Ranatunge

    2017-01-01

    Full Text Available Polyphenols are secondary metabolites of plants, which are responsible for prevention of many diseases. Polyvinylpolypyrrolidone (PVPP has a high affinity towards polyphenols. This method involves the use of PVPP column to remove polyphenols under centrifugal force. Standards of gallic acid, epigallocatechin gallate, vanillin, and tea extracts (Camellia sinensis were used in this study. PVPP powder was packed in a syringe with different quantities. The test samples were layered over the PVPP column and subjected to centrifugation. Supernatant was tested for the total phenol content. The presence of phenolic compounds and caffeine was screened by HPLC and measuring the absorbance at 280. The antioxidant capacity of standards and tea extracts was compared with the polyphenol removed fractions using DPPH scavenging assay. No polyphenols were found in polyphenolic standards or tea extracts after PVPP treatment. The method described in the present study to remove polyphenols is simple, inexpensive, rapid, and efficient and can be employed to investigate the contribution of polyphenols present in natural products to their biological activity.

  15. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  16. A novel method for rapid comparative quantitative analysis of nuclear fuel cycles

    International Nuclear Information System (INIS)

    Eastham, Sebastian D.; Coates, David J.; Parks, Geoffrey T.

    2012-01-01

    Highlights: ► Metric framework determined to compare nuclear fuel cycles. ► Fast and thermal reactors simulated using MATLAB models, including thorium. ► Modelling uses deterministic methods instead of Monte–Carlo for speed. ► Method rapidly identifies relative cycle strengths and weaknesses. ► Significant scope for use in project planning and cycle optimisation. - Abstract: One of the greatest obstacles facing the nuclear industry is that of sustainability, both in terms of the finite reserves of uranium ore and the production of highly radiotoxic spent fuel which presents proliferation and environmental hazards. Alternative nuclear technologies have been suggested as a means of delivering enhanced sustainability with proposals including fast reactors, the use of thorium fuel and tiered fuel cycles. The debate as to which is the most appropriate technology continues, with each fuel system and reactor type delivering specific advantages and disadvantages which can be difficult to compare fairly. This paper demonstrates a framework of performance metrics which, coupled with a first-order lumped reactor model to determine nuclide population balances, can be used to quantify the aforementioned pros and cons for a range of different fuel and reactor combinations. The framework includes metrics such as fuel efficiency, spent fuel toxicity and proliferation resistance, and relative cycle performance is analysed through parallel coordinate plots, yielding a quantitative comparison of disparate cycles.

  17. A rapid and quantitative method to determine the tritium content in DNA from small tissue sampes

    International Nuclear Information System (INIS)

    Kasche, V.; Zoellner, R.

    1979-01-01

    A rapid and quantitative two-step procedure to isolate double-strand DNA from small (10-100 mg) animal tissue samples is presented. The method is developed for investigations to evaluate the relative importance of organically bound tritium for the dose factors used to calculate dose commitments due to this nuclide. In the first step the proteins in the homogenized sample are hydrolysed, at a high pH (9.0) and ionic strength (1.5) to dissociate protein from DNA, using immobilized Proteinase K as a proteolytic enzyme. The DNA is then absorbed to hydroxylapatite and separated from impurities by step-wise elution with buffers of increasing ionic strength. More than 90% of the DNA in the samples could be isolated in double-strand form by this procedure. The method has been applied to determine pool-sizes and biological half-life times of tritium in DNA from various animal (mouse) tissues. It has also been shown to be suitable in other radiobiological studies where effects on DNA are investigated. (author)

  18. Method for rapid particle size analysis by hydrosizing and nuclear sensing

    International Nuclear Information System (INIS)

    Daellenbach, C.B.; Mahan, W.M.

    1977-01-01

    A method and apparatus to practice the method for rapidly determining the size and mass distribution of a sample of randomly sized particles of a known total mass are described. A series of substantially identical hydrocyclones are connected by conduits to each other and to a temperature controlled water feed. By restricting the cross-sectional areas of these conduits to progressively smaller values, the slurry containing the sample particles is caused to increase its velocity as it moves from hydrocyclone to hydrocyclone. As described by the Stokesian theory which relates particle diameter and settling velocity, the largest sized particles are suspended in the closed apex of the first hydrocyclone with smaller sized particles, in given size ranges, being suspended in the next succeeding hydrocyclone's apexes. In this manner, the particles are separated into discrete fractional sizes with a residual slurry of the very smallest particles being discharged. Before the discrete fractions of particles are suspended in their hydrocyclone apexes, a combined photon source, like a gamma ray source, and detector are calibrated with the water temperature kept constant. When the suspension of particles takes place, an attenuation of the radiation from the source is observed at the detector. This attenuation can be related to the mass or weight of the discrete fractions of suspended particles. Electronic circuitry is used to indicate what this fractional mass or weight is as it relates to the total weight of the sample. 6 claims, 4 figs

  19. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  20. Rapid Separation Methods to Characterize Actinides and Metallic Impurities in Plutonium Scrap Materials at SRS

    International Nuclear Information System (INIS)

    Maxwell, S.L. III; Jones, V.D.

    1998-07-01

    The Nuclear Materials Stabilization and Storage Division at SRS plans to stabilize selected plutonium scrap residue materials for long term storage by dissolution processing and plans to stabilize other plutonium vault materials via high-temperature furnace processing. To support these nuclear material stabilization activities, the SRS Analytical Laboratories Department (ALD) will provide characterization of materials required prior to the dissolution or the high-firing of these materials. Lab renovations to install new analytical instrumentation are underway to support these activities that include glove boxes with simulated-process dissolution and high- pressure microwave dissolution capability. Inductively-coupled plasma atomic emission spectrometry (ICP-AES), inductively- coupled mass spectrometry (ICP-MS) and thermal-ionization mass spectrometry (TIMS) will be used to measure actinide isotopics and metallic impurities. New high-speed actinide separation methods have been developed that will be applied to isotopic characterization of nuclear materials by TIMS and ICP-MS to eliminate isobaric interferences between Pu-238 /U- 238 and Pu-241/Am-241. TEVA Resin, UTEVA Resin, and TRU Resin columns will be used with vacuum-assisted flow rates to minimize TIMS and ICP-MS sample turnaround times. For metallic impurity analysis, rapid column removal methods using UTEVA Resin, AGMP-1 anion resin and AG MP-50 cation resin have also been developed to remove plutonium and uranium matrix interferences prior to ICP-AES and ICP- MS measurements