WorldWideScience

Sample records for rapamycin responsive genes

  1. Disruption of mammalian target of rapamycin complex 1 in macrophages decreases chemokine gene expression and atherosclerosis

    NARCIS (Netherlands)

    Ai, Ding; Jiang, Hongfeng; Westerterp, Marit; Murphy, Andrew J.; Wang, Mi; Ganda, Anjali; Abramowicz, Sandra; Welch, Carrie; Almazan, Felicidad; Zhu, Yi; Miller, Yury I.; Tall, Alan R.

    2014-01-01

    The mammalian target of rapamycin complex 1 inhibitor, rapamycin, has been shown to decrease atherosclerosis, even while increasing plasma low-density lipoprotein levels. This suggests an antiatherogenic effect possibly mediated by the modulation of inflammatory responses in atherosclerotic plaques.

  2. The rapamycin-regulated gene expression signature determines prognosis for breast cancer

    Directory of Open Access Journals (Sweden)

    Tsavachidis Spiridon

    2009-09-01

    Full Text Available Abstract Background Mammalian target of rapamycin (mTOR is a serine/threonine kinase involved in multiple intracellular signaling pathways promoting tumor growth. mTOR is aberrantly activated in a significant portion of breast cancers and is a promising target for treatment. Rapamycin and its analogues are in clinical trials for breast cancer treatment. Patterns of gene expression (metagenes may also be used to simulate a biologic process or effects of a drug treatment. In this study, we tested the hypothesis that the gene-expression signature regulated by rapamycin could predict disease outcome for patients with breast cancer. Results Colony formation and sulforhodamine B (IC50 in vitro and in vivo gene expression data identified a signature, termed rapamycin metagene index (RMI, of 31 genes upregulated by rapamycin treatment in vitro as well as in vivo (false discovery rate of 10%. In the Miller dataset, RMI did not correlate with tumor size or lymph node status. High (>75th percentile RMI was significantly associated with longer survival (P = 0.015. On multivariate analysis, RMI (P = 0.029, tumor size (P = 0.015 and lymph node status (P = 0.001 were prognostic. In van 't Veer study, RMI was not associated with the time to develop distant metastasis (P = 0.41. In the Wang dataset, RMI predicted time to disease relapse (P = 0.009. Conclusion Rapamycin-regulated gene expression signature predicts clinical outcome in breast cancer. This supports the central role of mTOR signaling in breast cancer biology and provides further impetus to pursue mTOR-targeted therapies for breast cancer treatment.

  3. Target of Rapamycin (TOR) Regulates Growth in Response to Nutritional Signals.

    Science.gov (United States)

    Weisman, Ronit

    2016-10-01

    All organisms can respond to the availability of nutrients by regulating their metabolism, growth, and cell division. Central to the regulation of growth in response to nutrient availability is the target of rapamycin (TOR) signaling that is composed of two structurally distinct complexes: TOR complex 1 (TORC1) and TOR complex 2 (TORC2). The TOR genes were first identified in yeast as target of rapamycin, a natural product of a soil bacterium, which proved beneficial as an immunosuppressive and anticancer drug and is currently being tested for a handful of other pathological conditions including diabetes, neurodegeneration, and age-related diseases. Studies of the TOR pathway unraveled a complex growth-regulating network. TOR regulates nutrient uptake, transcription, protein synthesis and degradation, as well as metabolic pathways, in a coordinated manner that ensures that cells grow or cease growth in response to nutrient availability. The identification of specific signals and mechanisms that stimulate TOR signaling is an active and exciting field of research that has already identified nitrogen and amino acids as key regulators of TORC1 activity. The signals, as well as the cellular functions of TORC2, are far less well understood. Additional open questions in the field concern the relationships between TORC1 and TORC2, as well as the links with other nutrient-responsive pathways. Here I review the main features of TORC1 and TORC2, with a particular focus on yeasts as model organisms.

  4. GTPase ROP2 binds and promotes activation of target of rapamycin, TOR, in response to auxin.

    Science.gov (United States)

    Schepetilnikov, Mikhail; Makarian, Joelle; Srour, Ola; Geldreich, Angèle; Yang, Zhenbiao; Chicher, Johana; Hammann, Philippe; Ryabova, Lyubov A

    2017-04-03

    Target of rapamycin (TOR) promotes reinitiation at upstream ORFs (uORFs) in genes that play important roles in stem cell regulation and organogenesis in plants. Here, we report that the small GTPase ROP2, if activated by the phytohormone auxin, promotes activation of TOR, and thus translation reinitiation of uORF-containing mRNAs. Plants with high levels of active ROP2, including those expressing constitutively active ROP2 (CA-ROP2), contain high levels of active TOR ROP2 physically interacts with and, when GTP-bound, activates TOR in vitro TOR activation in response to auxin is abolished in ROP-deficient rop2 rop6 ROP4 RNAi plants. GFP-TOR can associate with endosome-like structures in ROP2-overexpressing plants, indicating that endosomes mediate ROP2 effects on TOR activation. CA-ROP2 is efficient in loading uORF-containing mRNAs onto polysomes and stimulates translation in protoplasts, and both processes are sensitive to TOR inhibitor AZD-8055. TOR inactivation abolishes ROP2 regulation of translation reinitiation, but not its effects on cytoskeleton or intracellular trafficking. These findings imply a mode of translation control whereby, as an upstream effector of TOR, ROP2 coordinates TOR function in translation reinitiation pathways in response to auxin. © 2017 The Authors.

  5. Activation of the unfolded protein response in sarcoma cells treated with rapamycin or temsirolimus.

    Directory of Open Access Journals (Sweden)

    Joseph W Briggs

    Full Text Available Activation of the unfolded protein response (UPR in eukaryotic cells represents an evolutionarily conserved response to physiological stress. Here, we report that the mTOR inhibitors rapamycin (sirolimus and structurally related temsirolimus are capable of inducing UPR in sarcoma cells. However, this effect appears to be distinct from the classical role for these drugs as mTOR inhibitors. Instead, we detected these compounds to be associated with ribosomes isolated from treated cells. Specifically, temsirolimus treatment resulted in protection from chemical modification of several rRNA residues previously shown to bind rapamycin in prokaryotic cells. As an application for these findings, we demonstrate maximum tumor cell growth inhibition occurring only at doses which induce UPR and which have been shown to be safely achieved in human patients. These results are significant because they challenge the paradigm for the use of these drugs as anticancer agents and reveal a connection to UPR, a conserved biological response that has been implicated in tumor growth and response to therapy. As a result, eIF2 alpha phosphorylation and Xbp-1 splicing may serve as useful biomarkers of treatment response in future clinical trials using rapamycin and rapalogs.

  6. The Drosophila FoxA ortholog Fork head regulates growth and gene expression downstream of Target of rapamycin.

    Directory of Open Access Journals (Sweden)

    Margret H Bülow

    2010-12-01

    Full Text Available Forkhead transcription factors of the FoxO subfamily regulate gene expression programs downstream of the insulin signaling network. It is less clear which proteins mediate transcriptional control exerted by Target of rapamycin (TOR signaling, but recent studies in nematodes suggest a role for FoxA transcription factors downstream of TOR. In this study we present evidence that outlines a similar connection in Drosophila, in which the FoxA protein Fork head (FKH regulates cellular and organismal size downstream of TOR. We find that ectopic expression and targeted knockdown of FKH in larval tissues elicits different size phenotypes depending on nutrient state and TOR signaling levels. FKH overexpression has a negative effect on growth under fed conditions, and this phenotype is not further exacerbated by inhibition of TOR via rapamycin feeding. Under conditions of starvation or low TOR signaling levels, knockdown of FKH attenuates the size reduction associated with these conditions. Subcellular localization of endogenous FKH protein is shifted from predominantly cytoplasmic on a high-protein diet to a pronounced nuclear accumulation in animals with reduced levels of TOR or fed with rapamycin. Two putative FKH target genes, CG6770 and cabut, are transcriptionally induced by rapamycin or FKH expression, and silenced by FKH knockdown. Induction of both target genes in heterozygous TOR mutant animals is suppressed by mutations in fkh. Furthermore, TOR signaling levels and FKH impact on transcription of the dFOXO target gene d4E-BP, implying a point of crosstalk with the insulin pathway. In summary, our observations show that an alteration of FKH levels has an effect on cellular and organismal size, and that FKH function is required for the growth inhibition and target gene induction caused by low TOR signaling levels.

  7. Involvement of the VDE homing endonuclease and rapamycin in regulation of the Saccharomyces cerevisiae GSH11 gene encoding the high affinity glutathione transporter.

    Science.gov (United States)

    Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro

    2003-10-10

    The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.

  8. Eukaryotic initiation factor 2α--a downstream effector of mammalian target of rapamycin--modulates DNA repair and cancer response to treatment.

    Directory of Open Access Journals (Sweden)

    Liron Tuval-Kochen

    Full Text Available In an effort to circumvent resistance to rapamycin--an mTOR inhibitor--we searched for novel rapamycin-downstream-targets that may be key players in the response of cancer cells to therapy. We found that rapamycin, at nM concentrations, increased phosphorylation of eukaryotic initiation factor (eIF 2α in rapamycin-sensitive and estrogen-dependent MCF-7 cells, but had only a minimal effect on eIF2α phosphorylation in the rapamycin-insensitive triple-negative MDA-MB-231 cells. Addition of salubrinal--an inhibitor of eIF2α dephosphorylation--decreased expression of a surface marker associated with capacity for self renewal, increased senescence and induced clonogenic cell death, suggesting that excessive phosphorylation of eIF2α is detrimental to the cells' survival. Treating cells with salubrinal enhanced radiation-induced increase in eIF2α phosphorylation and clonogenic death and showed that irradiated cells are more sensitive to increased eIF2α phosphorylation than non-irradiated ones. Similar to salubrinal--the phosphomimetic eIF2α variant--S51D--increased sensitivity to radiation, and both abrogated radiation-induced increase in breast cancer type 1 susceptibility gene, thus implicating enhanced phosphorylation of eIF2α in modulation of DNA repair. Indeed, salubrinal inhibited non-homologous end joining as well as homologous recombination repair of double strand breaks that were induced by I-SceI in green fluorescent protein reporter plasmids. In addition to its effect on radiation, salubrinal enhanced eIF2α phosphorylation and clonogenic death in response to the histone deacetylase inhibitor--vorinostat. Finally, the catalytic competitive inhibitor of mTOR--Ku-0063794--increased phosphorylation of eIF2α demonstrating further the involvement of mTOR activity in modulating eIF2α phosphorylation. These experiments suggest that excessive phosphorylation of eIF2α decreases survival of cancer cells; making eIF2α a worthy target for

  9. Rapamycin causes growth arrest and inhibition of invasion in human chondrosarcoma cells.

    Science.gov (United States)

    Song, Jian; Wang, Xiaobo; Zhu, Jiaxue; Liu, Jun

    2016-01-01

    Chondrosarcoma is a highly malignant tumor that is characterized by a potent capacity to invade locally and cause distant metastasis and notable for its lack of response to conventional chemotherapy or radiotherapy. Rapamycin, the inhibitor of mammalian target of rapamycin (mTOR), is a valuable drug with diverse clinical applications and regulates many cellular processes. However, the effects of rapamycin on cell growth and invasion of human chondrosarcoma cells are not well known. We determined the effect of rapamycin on cell proliferation, cell cycle arrest and invasion by using MTS, flow cytometry and invasion assays in two human chondrosarcoma cell lines, SW1353 and JJ012. Cell cycle regulatory and invasion-related genes' expression analysis was performed by quantitative RT-PCR (qRT-PCR). We also evaluated the effect of rapamycin on tumor growth by using mice xenograph models. Rapamycin significantly inhibited the cell proliferation, induced cell cycle arrest and decreased the invasion ability of human chondrosarcoma cells. Meanwhile, rapamycin modulated the cell cycle regulatory and invasion-related genes' expression. Furthermore, the tumor growth of mice xenograph models with human chondrosarcoma cells was significantly inhibited by rapamycin. These results provided further insight into the role of rapamycin in chondrosarcoma. Therefore, rapamycin targeted therapy may be a potential treatment strategy for chondrosarcoma.

  10. Serotonin induces memory-like, rapamycin-sensitive hyperexcitability in sensory axons of aplysia that contributes to injury responses.

    Science.gov (United States)

    Weragoda, Ramal M S; Walters, Edgar T

    2007-09-01

    The induction of long-term facilitation (LTF) of synapses of Aplysia sensory neurons (SNs) by serotonin (5-HT) has provided an important mechanistic model of memory, but little is known about other long-term effects of 5-HT on sensory properties. Here we show that crushing peripheral nerves results in long-term hyperexcitability (LTH) of the axons of these nociceptive SNs that requires 5-HT activity in the injured nerve. Serotonin application to a nerve segment induces local axonal (but not somal) LTH that is inhibited by 5-HT-receptor antagonists. Blockade of crush-induced axonal LTH by an antagonist, methiothepin, provides evidence for mediation of this injury response by 5-HT. This is the first demonstration in any axon of neuromodulator-induced LTH, a phenomenon potentially important for long-lasting pain. Methiothepin does not reduce axonal LTH induced by local depolarization, so 5-HT is not required for all forms of axonal LTH. Serotonin-induced axonal LTH is expressed as reduced spike threshold and increased repetitive firing, whereas depolarization-induced LTH involves only reduced threshold. Like crush- and depolarization-induced LTH, 5-HT-induced LTH is blocked by inhibiting protein synthesis. Blockade by rapamycin, which also blocks synaptic LTF, is interesting because the eukaryotic protein kinase that is the target of rapamycin (TOR) has a conserved role in promoting growth by stimulating translation of proteins required for translation. Rapamycin sensitivity suggests that localized increases in translation of proteins that promote axonal conduction and excitability at sites of nerve injury may be regulated by the same signals that increase translation of proteins that promote neuronal growth.

  11. PREDICTION OF THE COURSE OF OSTEOARTHROSIS FROM mTOR (MAMMALIAN TARGET OF RAPAMYCIN GENE EXPRESSION

    Directory of Open Access Journals (Sweden)

    E V Chetina

    2012-01-01

    Results. Analysis of gene expression in the outpatients with OA identified two subgroups: in one subgroup (n = 13 mTOR expression was considerably much less than that in the control group; the expression of ATG1 and p21 did not differ greatly from the control and that of caspase 3 and TNF-α was significantly higher. The other outpatients (n = 20 and all the examined patients needing endoprosthetic replacement were ascertained to have a higher gene expression of mTOR, ATG1, p21, caspase 3, and TNF-α than in the control group. Before endoprosthetic replacement, severe joint destruction in patients with OA was associated with enhanced gene expression of mTOR, ATG1, p21, and caspase 3. Conclusion. In early-stage disease, increased mTOR gene expression may serve as a prognostic marker of the severity of the disease and articular cartilage destruction.

  12. Differential responses of human regulatory T cells (Treg and effector T cells to rapamycin.

    Directory of Open Access Journals (Sweden)

    Laura Strauss

    Full Text Available BACKGROUND: The immunosuppressive drug rapamycin (RAPA promotes the expansion of CD4(+ CD25(highFoxp3(+ regulatory T cells via mechanisms that remain unknown. Here, we studied expansion, IL-2R-gamma chain signaling, survival pathways and resistance to apoptosis in human Treg responding to RAPA. METHODOLOGY/PRINCIPAL FINDINGS: CD4(+CD25(+ and CD4(+CD25(neg T cells were isolated from PBMC of normal controls (n = 21 using AutoMACS. These T cell subsets were cultured in the presence of anti-CD3/CD28 antibodies and 1000 IU/mL IL-2 for 3 to 6 weeks. RAPA (1-100 nM was added to half of the cultures. After harvest, the cell phenotype, signaling via the PI3K/mTOR and STAT pathways, expression of survival proteins and Annexin V binding were determined and compared to values obtained with freshly-separated CD4(+CD25(high and CD4(+CD25(neg T cells. Suppressor function was tested in co-cultures with autologous CFSE-labeled CD4(+CD25(neg or CD8(+CD25(neg T-cell responders. The frequency and suppressor activity of Treg were increased after culture of CD4(+CD25(+ T cells in the presence of 1-100 nM RAPA (p<0.001. RAPA-expanded Treg were largely CD4(+CD25(highFoxp3(+ cells and were resistant to apoptosis, while CD4(+CD25(neg T cells were sensitive. Only Treg upregulated anti-apoptotic and down-regulated pro-apoptotic proteins. Treg expressed higher levels of the PTEN protein than CD4(+CD25(neg cells. Activated Treg+/-RAPA preferentially phosphorylated STAT5 and STAT3 and did not utilize the PI3K/mTOR pathway. CONCLUSIONS/SIGNIFICANCE: RAPA favors Treg expansion and survival by differentially regulating signaling, proliferation and sensitivity to apoptosis of human effector T cells and Treg after TCR/IL-2 activation.

  13. Drosophila larvae lacking the bcl-2 gene, buffy, are sensitive to nutrient stress, maintain increased basal target of rapamycin (Tor signaling and exhibit characteristics of altered basal energy metabolism

    Directory of Open Access Journals (Sweden)

    Monserrate Jessica P

    2012-07-01

    Full Text Available Abstract Background B cell lymphoma 2 (Bcl-2 proteins are the central regulators of apoptosis. The two bcl-2 genes in Drosophila modulate the response to stress-induced cell death, but not developmental cell death. Because null mutants are viable, Drosophila provides an optimum model system to investigate alternate functions of Bcl-2 proteins. In this report, we explore the role of one bcl-2 gene in nutrient stress responses. Results We report that starvation of Drosophila larvae lacking the bcl-2 gene, buffy, decreases survival rate by more than twofold relative to wild-type larvae. The buffy null mutant reacted to starvation with the expected responses such as inhibition of target of rapamycin (Tor signaling, autophagy initiation and mobilization of stored lipids. However, the autophagic response to starvation initiated faster in larvae lacking buffy and was inhibited by ectopic buffy. We demonstrate that unusually high basal Tor signaling, indicated by more phosphorylated S6K, was detected in the buffy mutant and that removal of a genomic copy of S6K, but not inactivation of Tor by rapamycin, reverted the precocious autophagy phenotype. Instead, Tor inactivation also required loss of a positive nutrient signal to trigger autophagy and loss of both was sufficient to activate autophagy in the buffy mutant even in the presence of enforced phosphoinositide 3-kinase (PI3K signaling. Prior to starvation, the fed buffy mutant stored less lipid and glycogen, had high lactate levels and maintained a reduced pool of cellular ATP. These observations, together with the inability of buffy mutant larvae to adapt to nutrient restriction, indicate altered energy metabolism in the absence of buffy. Conclusions All animals in their natural habitats are faced with periods of reduced nutrient availability. This study demonstrates that buffy is required for adaptation to both starvation and nutrient restriction. Thus, Buffy is a Bcl-2 protein that plays an

  14. Nitrogen-responsive Regulation of GATA Protein Family Activators Gln3 and Gat1 Occurs by Two Distinct Pathways, One Inhibited by Rapamycin and the Other by Methionine Sulfoximine*

    Science.gov (United States)

    Georis, Isabelle; Tate, Jennifer J.; Cooper, Terrance G.; Dubois, Evelyne

    2011-01-01

    Nitrogen availability regulates the transcription of genes required to degrade non-preferentially utilized nitrogen sources by governing the localization and function of transcription activators, Gln3 and Gat1. TorC1 inhibitor, rapamycin (Rap), and glutamine synthetase inhibitor, methionine sulfoximine (Msx), elicit responses grossly similar to those of limiting nitrogen, implicating both glutamine synthesis and TorC1 in the regulation of Gln3 and Gat1. To better understand this regulation, we compared Msx- versus Rap-elicited Gln3 and Gat1 localization, their DNA binding, nitrogen catabolite repression-sensitive gene expression, and the TorC1 pathway phosphatase requirements for these responses. Using this information we queried whether Rap and Msx inhibit sequential steps in a single, linear cascade connecting glutamine availability to Gln3 and Gat1 control as currently accepted or alternatively inhibit steps in two distinct parallel pathways. We find that Rap most strongly elicits nuclear Gat1 localization and expression of genes whose transcription is most Gat1-dependent. Msx, on the other hand, elicits nuclear Gln3 but not Gat1 localization and expression of genes that are most Gln3-dependent. Importantly, Rap-elicited nuclear Gln3 localization is absolutely Sit4-dependent, but that elicited by Msx is not. PP2A, although not always required for nuclear GATA factor localization, is highly required for GATA factor binding to nitrogen-responsive promoters and subsequent transcription irrespective of the gene GATA factor specificities. Collectively, our data support the existence of two different nitrogen-responsive regulatory pathways, one inhibited by Msx and the other by rapamycin. PMID:22039046

  15. Nitrogen-responsive regulation of GATA protein family activators Gln3 and Gat1 occurs by two distinct pathways, one inhibited by rapamycin and the other by methionine sulfoximine.

    Science.gov (United States)

    Georis, Isabelle; Tate, Jennifer J; Cooper, Terrance G; Dubois, Evelyne

    2011-12-30

    Nitrogen availability regulates the transcription of genes required to degrade non-preferentially utilized nitrogen sources by governing the localization and function of transcription activators, Gln3 and Gat1. TorC1 inhibitor, rapamycin (Rap), and glutamine synthetase inhibitor, methionine sulfoximine (Msx), elicit responses grossly similar to those of limiting nitrogen, implicating both glutamine synthesis and TorC1 in the regulation of Gln3 and Gat1. To better understand this regulation, we compared Msx- versus Rap-elicited Gln3 and Gat1 localization, their DNA binding, nitrogen catabolite repression-sensitive gene expression, and the TorC1 pathway phosphatase requirements for these responses. Using this information we queried whether Rap and Msx inhibit sequential steps in a single, linear cascade connecting glutamine availability to Gln3 and Gat1 control as currently accepted or alternatively inhibit steps in two distinct parallel pathways. We find that Rap most strongly elicits nuclear Gat1 localization and expression of genes whose transcription is most Gat1-dependent. Msx, on the other hand, elicits nuclear Gln3 but not Gat1 localization and expression of genes that are most Gln3-dependent. Importantly, Rap-elicited nuclear Gln3 localization is absolutely Sit4-dependent, but that elicited by Msx is not. PP2A, although not always required for nuclear GATA factor localization, is highly required for GATA factor binding to nitrogen-responsive promoters and subsequent transcription irrespective of the gene GATA factor specificities. Collectively, our data support the existence of two different nitrogen-responsive regulatory pathways, one inhibited by Msx and the other by rapamycin.

  16. Convergence of the mammalian target of rapamycin complex 1- and glycogen synthase kinase 3-β-signaling pathways regulates the innate inflammatory response.

    Science.gov (United States)

    Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S; Greenway, Terrance; Martin, Michael

    2011-05-01

    The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin's ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3.

  17. Pirarubicin induces an autophagic cytoprotective response through suppression of the mammalian target of rapamycin signaling pathway in human bladder cancer cells

    International Nuclear Information System (INIS)

    Li, Kuiqing; Chen, Xu; Liu, Cheng; Gu, Peng; Li, Zhuohang; Wu, Shaoxu; Xu, Kewei; Lin, Tianxin; Huang, Jian

    2015-01-01

    Pirarubicin is widely used in intravesical chemotherapy for bladder cancer, but its efficacy is limited due to drug resistance; the mechanism has not been well studied. Emerging evidence shows that autophagy can be a novel target for cancer therapy. This study aimed to investigate the role of autophagy in pirarubicin-treated bladder cancer cells. Bladder cancer cells EJ and J82 were treated with pirarubicin, siRNA, 3-methyladenine or hydroxychloroquine. Cell proliferation and apoptosis were tested by cell survival assay and flow cytometric analysis, respectively. Autophagy was evaluated by immunoblotting before and after the treatments. The phosphorylated mammalian target of rapamycin, serine/threonine kinase p70 S6 kinase, and eukaryotic translation initiation factor 4E binding protein 1 were also investigated by immunoblotting. We found that pirarubicin could induce autophagy in bladder cancer cells. Inhibition of autophagy by 3-methyladenine, hydroxychloroquine or knockdown of autophagy related gene 3 significantly increased apoptosis in pirarubicin-treated bladder cancer cells. Pirarubicin-induced autophagy was mediated via the mTOR/p70S6K/4E-BP1 signaling pathway. In conclusion, autophagy induced by pirarubicin plays a cytoprotective role in bladder cancer cells, suggesting that inhibition of autophagy may improve efficacy over traditional pirarubicin chemotherapy in bladder cancer patients. - Highlights: • Pirarubicin induced autophagy in bladder cancer cells. • Inhibition of autophagy enhanced pirarubicin-induced apoptosis. • Pirarubicin induced autophagy through inhibition of mTOR signaling pathway

  18. Pirarubicin induces an autophagic cytoprotective response through suppression of the mammalian target of rapamycin signaling pathway in human bladder cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Kuiqing; Chen, Xu [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Liu, Cheng [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Gu, Peng; Li, Zhuohang; Wu, Shaoxu [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Xu, Kewei [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Lin, Tianxin, E-mail: tianxinl@sina.com [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Huang, Jian, E-mail: urolhj@sina.com [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China)

    2015-05-01

    Pirarubicin is widely used in intravesical chemotherapy for bladder cancer, but its efficacy is limited due to drug resistance; the mechanism has not been well studied. Emerging evidence shows that autophagy can be a novel target for cancer therapy. This study aimed to investigate the role of autophagy in pirarubicin-treated bladder cancer cells. Bladder cancer cells EJ and J82 were treated with pirarubicin, siRNA, 3-methyladenine or hydroxychloroquine. Cell proliferation and apoptosis were tested by cell survival assay and flow cytometric analysis, respectively. Autophagy was evaluated by immunoblotting before and after the treatments. The phosphorylated mammalian target of rapamycin, serine/threonine kinase p70 S6 kinase, and eukaryotic translation initiation factor 4E binding protein 1 were also investigated by immunoblotting. We found that pirarubicin could induce autophagy in bladder cancer cells. Inhibition of autophagy by 3-methyladenine, hydroxychloroquine or knockdown of autophagy related gene 3 significantly increased apoptosis in pirarubicin-treated bladder cancer cells. Pirarubicin-induced autophagy was mediated via the mTOR/p70S6K/4E-BP1 signaling pathway. In conclusion, autophagy induced by pirarubicin plays a cytoprotective role in bladder cancer cells, suggesting that inhibition of autophagy may improve efficacy over traditional pirarubicin chemotherapy in bladder cancer patients. - Highlights: • Pirarubicin induced autophagy in bladder cancer cells. • Inhibition of autophagy enhanced pirarubicin-induced apoptosis. • Pirarubicin induced autophagy through inhibition of mTOR signaling pathway.

  19. The rapamycin-binding domain of the protein kinase mammalian target of rapamycin is a destabilizing domain.

    Science.gov (United States)

    Edwards, Sarah R; Wandless, Thomas J

    2007-05-04

    Rapamycin is an immunosuppressive drug that binds simultaneously to the 12-kDa FK506- and rapamycin-binding protein (FKBP12, or FKBP) and the FKBP-rapamycin binding (FRB) domain of the mammalian target of rapamycin (mTOR) kinase. The resulting ternary complex has been used to conditionally perturb protein function, and one such method involves perturbation of a protein of interest through its mislocalization. We synthesized two rapamycin derivatives that possess large substituents at the C-16 position within the FRB-binding interface, and these derivatives were screened against a library of FRB mutants using a three-hybrid assay in Saccharomyces cerevisiae. Several FRB mutants responded to one of the rapamycin derivatives, and twenty of these mutants were further characterized in mammalian cells. The mutants most responsive to the ligand were fused to yellow fluorescent protein, and fluorescence levels in the presence and absence of the ligand were measured to determine stability of the fusion proteins. Wild-type and mutant FRB domains were expressed at low levels in the absence of the rapamycin derivative, and expression levels rose up to 10-fold upon treatment with ligand. The synthetic rapamycin derivatives were further analyzed using quantitative mass spectrometry, and one of the compounds was found to contain contaminating rapamycin. Furthermore, uncontaminated analogs retained the ability to inhibit mTOR, although with diminished potency relative to rapamycin. The ligand-dependent stability displayed by wild-type FRB and FRB mutants as well as the inhibitory potential and purity of the rapamycin derivatives should be considered as potentially confounding experimental variables when using these systems.

  20. Rapamycin inhibits poly(ADP-ribosyl)ation in intact cells

    International Nuclear Information System (INIS)

    Fahrer, Joerg; Wagner, Silvia; Buerkle, Alexander; Koenigsrainer, Alfred

    2009-01-01

    Rapamycin is an immunosuppressive drug, which inhibits the mammalian target of rapamycin (mTOR) kinase activity inducing changes in cell proliferation. Synthesis of poly(ADP-ribose) (PAR) is an immediate cellular response to genotoxic stress catalyzed mostly by poly(ADP-ribose) polymerase 1 (PARP-1), which is also controlled by signaling pathways. Therefore, we investigated whether rapamycin affects PAR production. Strikingly, rapamycin inhibited PAR synthesis in living fibroblasts in a dose-dependent manner as monitored by immunofluorescence. PARP-1 activity was then assayed in vitro, revealing that down-regulation of cellular PAR production by rapamycin was apparently not due to competitive PARP-1 inhibition. Further studies showed that rapamycin did not influence the cellular NAD pool and the activation of PARP-1 in extracts of pretreated fibroblasts. Collectively, our data suggest that inhibition of cellular PAR synthesis by rapamycin is mediated by formation of a detergent-sensitive complex in living cells, and that rapamycin may have a potential as therapeutic PARP inhibitor.

  1. Rapamycin inhibits poly(ADP-ribosyl)ation in intact cells

    Energy Technology Data Exchange (ETDEWEB)

    Fahrer, Joerg, E-mail: joerg.fahrer@uni-ulm.de [Molecular Toxicology Group, Department of Biology, University of Konstanz (Germany); Wagner, Silvia [Clinic of General, Visceral- and Transplantation Surgery, ZMF, University Hospital Tuebingen (Germany); Buerkle, Alexander [Molecular Toxicology Group, Department of Biology, University of Konstanz (Germany); Koenigsrainer, Alfred [Clinic of General, Visceral- and Transplantation Surgery, ZMF, University Hospital Tuebingen (Germany)

    2009-08-14

    Rapamycin is an immunosuppressive drug, which inhibits the mammalian target of rapamycin (mTOR) kinase activity inducing changes in cell proliferation. Synthesis of poly(ADP-ribose) (PAR) is an immediate cellular response to genotoxic stress catalyzed mostly by poly(ADP-ribose) polymerase 1 (PARP-1), which is also controlled by signaling pathways. Therefore, we investigated whether rapamycin affects PAR production. Strikingly, rapamycin inhibited PAR synthesis in living fibroblasts in a dose-dependent manner as monitored by immunofluorescence. PARP-1 activity was then assayed in vitro, revealing that down-regulation of cellular PAR production by rapamycin was apparently not due to competitive PARP-1 inhibition. Further studies showed that rapamycin did not influence the cellular NAD pool and the activation of PARP-1 in extracts of pretreated fibroblasts. Collectively, our data suggest that inhibition of cellular PAR synthesis by rapamycin is mediated by formation of a detergent-sensitive complex in living cells, and that rapamycin may have a potential as therapeutic PARP inhibitor.

  2. Disease Evolution and Response to Rapamycin in Activated Phosphoinositide 3-Kinase δ Syndrome: The European Society for Immunodeficiencies-Activated Phosphoinositide 3-Kinase δ Syndrome Registry

    Directory of Open Access Journals (Sweden)

    Maria Elena Maccari

    2018-03-01

    Full Text Available Activated phosphoinositide 3-kinase (PI3K δ Syndrome (APDS, caused by autosomal dominant mutations in PIK3CD (APDS1 or PIK3R1 (APDS2, is a heterogeneous primary immunodeficiency. While initial cohort-descriptions summarized the spectrum of clinical and immunological manifestations, questions about long-term disease evolution and response to therapy remain. The prospective European Society for Immunodeficiencies (ESID-APDS registry aims to characterize the disease course, identify outcome predictors, and evaluate treatment responses. So far, 77 patients have been recruited (51 APDS1, 26 APDS2. Analysis of disease evolution in the first 68 patients pinpoints the early occurrence of recurrent respiratory infections followed by chronic lymphoproliferation, gastrointestinal manifestations, and cytopenias. Although most manifestations occur by age 15, adult-onset and asymptomatic courses were documented. Bronchiectasis was observed in 24/40 APDS1 patients who received a CT-scan compared with 4/15 APDS2 patients. By age 20, half of the patients had received at least one immunosuppressant, but 2–3 lines of immunosuppressive therapy were not unusual before age 10. Response to rapamycin was rated by physician visual analog scale as good in 10, moderate in 9, and poor in 7. Lymphoproliferation showed the best response (8 complete, 11 partial, 6 no remission, while bowel inflammation (3 complete, 3 partial, 9 no remission and cytopenia (3 complete, 2 partial, 9 no remission responded less well. Hence, non-lymphoproliferative manifestations should be a key target for novel therapies. This report from the ESID-APDS registry provides comprehensive baseline documentation for a growing cohort that will be followed prospectively to establish prognostic factors and identify patients for treatment studies.

  3. Rapamycin: An InhibiTOR of Aging Emerges From the Soil of Easter Island.

    Science.gov (United States)

    Arriola Apelo, Sebastian I; Lamming, Dudley W

    2016-07-01

    Rapamycin (sirolimus) is a macrolide immunosuppressant that inhibits the mechanistic target of rapamycin (mTOR) protein kinase and extends lifespan in model organisms including mice. Although rapamycin is an FDA-approved drug for select indications, a diverse set of negative side effects may preclude its wide-scale deployment as an antiaging therapy. mTOR forms two different protein complexes, mTORC1 and mTORC2; the former is acutely sensitive to rapamycin whereas the latter is only chronically sensitive to rapamycin in vivo. Over the past decade, it has become clear that although genetic and pharmacological inhibition of mTORC1 extends lifespan and delays aging, inhibition of mTORC2 has negative effects on mammalian health and longevity and is responsible for many of the negative side effects of rapamycin. In this review, we discuss recent advances in understanding the molecular and physiological effects of rapamycin treatment, and we discuss how the use of alternative rapamycin treatment regimens or rapamycin analogs has the potential to mitigate the deleterious side effects of rapamycin treatment by more specifically targeting mTORC1. Although the side effects of rapamycin are still of significant concern, rapid progress is being made in realizing the revolutionary potential of rapamycin-based therapies for the treatment of diseases of aging. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Survival benefit with proapoptotic molecular and pathologic responses from dual targeting of mammalian target of rapamycin and epidermal growth factor receptor in a preclinical model of pancreatic neuroendocrine carcinogenesis.

    Science.gov (United States)

    Chiu, Christopher W; Nozawa, Hiroaki; Hanahan, Douglas

    2010-10-10

    Pancreatic neuroendocrine tumors (PNETs), although rare, often metastasize, such that surgery, the only potentially curative therapy, is not possible. There is no effective systemic therapy for patients with advanced PNETs. Therefore, new strategies are needed. Toward that end, we investigated the potential benefit of dual therapeutic targeting of the epidermal growth factor receptor (EGFR) and mammalian target of rapamycin (mTOR) kinases, using a preclinical mouse model of PNET. Rapamycin and erlotinib, inhibitors of mTOR and EGFR, respectively, were used to treat RIP-Tag2 transgenic mice bearing advanced multifocal PNET. Tumor growth and survival were monitored, and tumors were surveyed for potential biomarkers of response to the therapeutics. Rapamycin monotherapy was notably efficacious, prolonging survival concomitant with tumor stasis (stable disease). However, the tumors developed resistance, as evidenced by eventual relapse to progressive tumor growth. Erlotinib monotherapy slowed tumor growth and elicited a marginal survival benefit. In combination, there was an unprecedented survival benefit in the face of this aggressive multifocal cancer and, in contrast to either monotherapy, the development of adaptive resistance was not apparent. Additionally, the antiapoptotic protein survivin was implicated as a biomarker of sensitivity and beneficial responses to the dual targeted therapy. Preclinical trials in a mouse model of endogenous PNET suggest that combined targeting of the mTOR and EGFR signaling pathways could have potential clinical benefit in treating PNET. These results have encouraged development of an ongoing phase II clinical trial aimed to evaluate the efficacy of this treatment regimen in human neuroendocrine tumors.

  5. Phosphoproteomic profiling of in vivo signaling in liver by the mammalian target of rapamycin complex 1 (mTORC1.

    Directory of Open Access Journals (Sweden)

    Gokhan Demirkan

    Full Text Available Our understanding of signal transduction networks in the physiological context of an organism remains limited, partly due to the technical challenge of identifying serine/threonine phosphorylated peptides from complex tissue samples. In the present study, we focused on signaling through the mammalian target of rapamycin (mTOR complex 1 (mTORC1, which is at the center of a nutrient- and growth factor-responsive cell signaling network. Though studied extensively, the mechanisms involved in many mTORC1 biological functions remain poorly understood.We developed a phosphoproteomic strategy to purify, enrich and identify phosphopeptides from rat liver homogenates. Using the anticancer drug rapamycin, the only known target of which is mTORC1, we characterized signaling in liver from rats in which the complex was maximally activated by refeeding following 48 hr of starvation. Using protein and peptide fractionation methods, TiO(2 affinity purification of phosphopeptides and mass spectrometry, we reproducibly identified and quantified over four thousand phosphopeptides. Along with 5 known rapamycin-sensitive phosphorylation events, we identified 62 new rapamycin-responsive candidate phosphorylation sites. Among these were PRAS40, gephyrin, and AMP kinase 2. We observed similar proportions of increased and reduced phosphorylation in response to rapamycin. Gene ontology analysis revealed over-representation of mTOR pathway components among rapamycin-sensitive phosphopeptide candidates.In addition to identifying potential new mTORC1-mediated phosphorylation events, and providing information relevant to the biology of this signaling network, our experimental and analytical approaches indicate the feasibility of large-scale phosphoproteomic profiling of tissue samples to study physiological signaling events in vivo.

  6. Convergence of the Mammalian Target of Rapamycin Complex 1- and Glycogen Synthase Kinase 3-β–Signaling Pathways Regulates the Innate Inflammatory Response

    Science.gov (United States)

    Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A.; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S.; Greenway, Terrance; Martin, Michael

    2011-01-01

    The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin’s ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3. PMID:21422248

  7. Paradoxical effects of rapamycin on experimental house dust mite-induced asthma.

    Directory of Open Access Journals (Sweden)

    Karin Fredriksson

    Full Text Available The mammalian target of rapamycin (mTOR modulates immune responses and cellular proliferation. The objective of this study was to assess whether inhibition of mTOR with rapamycin modifies disease severity in two experimental murine models of house dust mite (HDM-induced asthma. In an induction model, rapamycin was administered to BALB/c mice coincident with nasal HDM challenges for 3 weeks. In a treatment model, nasal HDM challenges were performed for 6 weeks and rapamycin treatment was administered during weeks 4 through 6. In the induction model, rapamycin significantly attenuated airway inflammation, airway hyperreactivity (AHR and goblet cell hyperplasia. In contrast, treatment of established HDM-induced asthma with rapamycin exacerbated AHR and airway inflammation, whereas goblet cell hyperplasia was not modified. Phosphorylation of the S6 ribosomal protein, which is downstream of mTORC1, was increased after 3 weeks, but not 6 weeks of HDM-challenge. Rapamycin reduced S6 phosphorylation in HDM-challenged mice in both the induction and treatment models. Thus, the paradoxical effects of rapamycin on asthma severity paralleled the activation of mTOR signaling. Lastly, mediastinal lymph node re-stimulation experiments showed that treatment of rapamycin-naive T cells with ex vivo rapamycin decreased antigen-specific Th2 cytokine production, whereas prior exposure to in vivo rapamycin rendered T cells refractory to the suppressive effects of ex vivo rapamycin. We conclude that rapamycin had paradoxical effects on the pathogenesis of experimental HDM-induced asthma. Thus, consistent with the context-dependent effects of rapamycin on inflammation, the timing of mTOR inhibition may be an important determinant of efficacy and toxicity in HDM-induced asthma.

  8. Tomato FK506 Binding Protein 12KD (FKBP12 mediates the interaction between rapamycin and Target of Rapamycin (TOR

    Directory of Open Access Journals (Sweden)

    Fangjie Xiong

    2016-11-01

    Full Text Available Target of Rapamycin (TOR signaling is an important regulator in multiple organisms including yeast, plants and animals. However, the TOR signaling in plants is much less understood as compared to that in yeast and animals. TOR kinase can be efficiently suppressed by rapamycin in the presence of functional FK506 Binding Protein 12KD (FKBP12 in yeast and animals. In most examined higher plants rapamycin fails to inhibit TOR kinase due to the non-functional FKBP12. Here we find that tomato plants showed obvious growth inhibition when treated with rapamycin and the inhibitory phenotype is similar to suppression of TOR causing by active-site TOR inhibitors (asTORis such as KU63794, AZD8055 and Torin1. The chemical genetic assays using TOR inhibitors and heterologous expressing SlFKBP12 in Arabidopsis indicated that the TOR signaling is functional in tomato. The protein gel shifting and TOR inhibitors combination assays showed that SlFKBP12 can mediate the interaction between rapamycin and TOR. Furthermore, comparative expression profiling analysis between treatments with rapamycin and KU63794 identified highly overlapped Differentially Expressed Genes (DEGs which are involved in many anabolic and catabolic processes, such as photosynthesis, cell wall restructuring, and senescence in tomato. These observations suggest that SlFFBP12 is functional in tomato. The results provided basic information of TOR signaling in tomato, and also some new insights into how TOR controls plant growth and development through reprogramming the transcription profiles

  9. Tomato FK506 Binding Protein 12KD (FKBP12) Mediates the Interaction between Rapamycin and Target of Rapamycin (TOR).

    Science.gov (United States)

    Xiong, Fangjie; Dong, Pan; Liu, Mei; Xie, Gengxin; Wang, Kai; Zhuo, Fengping; Feng, Li; Yang, Lu; Li, Zhengguo; Ren, Maozhi

    2016-01-01

    Target of Rapamycin (TOR) signaling is an important regulator in multiple organisms including yeast, plants, and animals. However, the TOR signaling in plants is much less understood as compared to that in yeast and animals. TOR kinase can be efficiently suppressed by rapamycin in the presence of functional FK506 Binding Protein 12 KD (FKBP12) in yeast and animals. In most examined higher plants rapamycin fails to inhibit TOR kinase due to the non-functional FKBP12. Here we find that tomato plants showed obvious growth inhibition when treated with rapamycin and the inhibitory phenotype is similar to suppression of TOR causing by active-site TOR inhibitors (asTORis) such as KU63794, AZD8055, and Torin1. The chemical genetic assays using TOR inhibitors and heterologous expressing SlFKBP12 in Arabidopsis indicated that the TOR signaling is functional in tomato. The protein gel shifting and TOR inhibitors combination assays showed that SlFKBP12 can mediate the interaction between rapamycin and TOR. Furthermore, comparative expression profile analysis between treatments with rapamycin and KU63794 identified highly overlapped Differentially Expressed Genes (DEGs) which are involved in many anabolic and catabolic processes, such as photosynthesis, cell wall restructuring, and senescence in tomato. These observations suggest that SlFFBP12 is functional in tomato. The results provided basic information of TOR signaling in tomato, and also some new insights into how TOR controls plant growth and development through reprogramming the transcription profiles.

  10. Prevention and Reversal of Antibody Responses Against Factor IX in Gene Therapy for Hemophilia B

    Directory of Open Access Journals (Sweden)

    Sushrusha eNayak

    2011-12-01

    Full Text Available Intramuscular (IM administration of an adeno-associated viral (AAV vector represents a simple and safe method of gene transfer for treatment of the X-linked bleeding disorder hemophilia B (factor IX, F.IX, deficiency. However, the approach is hampered by an increased risk of immune responses against F.IX. Previously, we demonstrated that the drug cocktail of immune suppressants rapamycin, IL-10, and a specific peptide (encoding a dominant CD4+ T cell epitope caused an induction of regulatory T cells (Treg with a concomitant apoptosis of antigen-specific effector T cells (J. Thromb. Haemost. 7:1523, 2009. This protocol was effective in preventing inhibitory antibody formation against human F.IX (hF.IX in muscle gene transfer to C3H/HeJ hemophilia B mice (with targeted F9 gene deletion. Here, we show that this protocol can also be used to reverse inhibitor formation. IM injection of AAV1-hF.IX vector resulted in inhibitors of on average 8-10 BU within 1 month. Subsequent treatment with the tolerogenic cocktail accomplished a rapid reduction of hF.IX-specific antibodies to <2 BU, which lasted for >4.5 months. Systemic hF.IX expression increased from undetectable to >200 ng/ml, and coagulation times improved. In addition, we developed an alternative prophylactic protocol against inhibitor formation that did not require knowledge of T cell epitopes, consisting of daily oral administration of rapamycin for 1-month combined with frequent, low-dose intravenous injection of hF.IX protein. Experiments in T cell receptor transgenic mice showed that the route and dosing schedule of drug administration substantially affected Treg induction. When combined with intravenous antigen administration, oral delivery of rapamycin had to be performed daily in order to induce Treg, which were suppressive and phenotypically comparable to natural Treg.

  11. Rapamycin Rescues the Poor Developmental Capacity of Aged Porcine Oocytes

    Directory of Open Access Journals (Sweden)

    Seung Eun Lee

    2014-05-01

    Full Text Available Unfertilized oocytes age inevitably after ovulation, which limits their fertilizable life span and embryonic development. Rapamycin affects mammalian target of rapamycin (mTOR expression and cytoskeleton reorganization during oocyte meiotic maturation. The goal of this study was to examine the effects of rapamycin treatment on aged porcine oocytes and their in vitro development. Rapamycin treatment of aged oocytes for 24 h (68 h in vitro maturation [IVM]; 44 h+10 μM rapamycin/24 h, 47.52±5.68 or control oocytes (44 h IVM; 42.14±4.40 significantly increased the development rate and total cell number compared with untreated aged oocytes (68 h IVM, 22.04±5.68 (p<0.05. Rapamycin treatment of aged IVM oocytes for 24 h also rescued aberrant spindle organization and chromosomal misalignment, blocked the decrease in the level of phosphorylated-p44/42 mitogen-activated protein kinase (MAPK, and increased the mRNA expression of cytoplasmic maturation factor genes (MOS, BMP15, GDF9, and CCNB1 compared with untreated, 24 h-aged IVM oocytes (p<0.05. Furthermore, rapamycin treatment of aged oocytes decreased reactive oxygen species (ROS activity and DNA fragmentation (p<0.05, and downregulated the mRNA expression of mTOR compared with control or untreated aged oocytes. By contrast, rapamycin treatment of aged oocytes increased mitochondrial localization (p<0.05 and upregulated the mRNA expression of autophagy (BECN1, ATG7, MAP1LC3B, ATG12, GABARAP, and GABARAPL1, anti-apoptosis (BCL2L1 and BIRC5; p<0.05, and development (NANOG and SOX2; p<0.05 genes, but it did not affect the mRNA expression of pro-apoptosis genes (FAS and CASP3 compared with the control. This study demonstrates that rapamycin treatment can rescue the poor developmental capacity of aged porcine oocytes.

  12. Novel synergistic antitumor effects of rapamycin with bortezomib on hepatocellular carcinoma cells and orthotopic tumor model

    Directory of Open Access Journals (Sweden)

    Wang Cun

    2012-05-01

    Full Text Available Abstract Background Despite recent advances in the treatment of hepatocellular carcinoma (HCC, the chemotherapy efficacy against HCC is still unsatisfactory. The mammalian target of rapamycin (mTOR has been emerged as an important cancer therapeutic target. However, HCC cells often resistant to rapamycin because of the paradoxical activation of Akt by rapamycin. In this study, we investigated whether bortezomib could enhance the antitumor effects of rapamycin. Methods The effects of rapamycin and bortezomib on HCC proliferation, apoptosis, migration, and invasiveness in vitro were assessed by CCK-8 analysis, flow cytometry, Hoechst 33342 staining and transwell assays, respectively. Total and phosphorylated protein levels of Akt were detected by Western blotting. The effects of rapamycin and/or bortezomib on the mRNA expression levels of p53, p27, p21 and Bcl-2 family in HCCLM3 cells were evaluated by RT-PCR. The roles of rapamycin and bortezomib on HCC growth and metastasis in xenograft models were evaluated by tumor volumes and fluorescent signals. The effects of rapamycin and bortezomib on cell proliferation and apoptosis in vivo were test by PCNA and TUNEL staining. Results Bortezomib synergized with rapamycin to reduce cell growth, induce apoptosis, and inhibit cell mobility in vitro. Further mechanistic studies showed that bortezomib inhibited rapamycin-induced phosphorylated Akt, which in turn enhanced apoptosis of HCC cell lines. The alteration of the mRNA expression of cell cycle inhibitors p53, p27, p21 and apoptosis associated genes Bcl-2, Bax were also involved in the synergistic antitumor effects of rapamycin and bortezomib. P53 inhibitor PFT-α significantly attenuate the effect of rapamycin and bortezomib on cell apoptosis, which indicated that the pro-apoptotic effect of rapamycin and bortezomib may be p53-dependent. Treatment of HCCLM3-R bearing nude mice with rapamycin and bortezomib significantly enhanced tumor growth

  13. Inositol polyphosphate multikinase is a coactivator for serum response factor-dependent induction of immediate early genes

    Science.gov (United States)

    Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun

    2013-01-01

    Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338

  14. Rapamycin exerts antifungal activity in vitro and in vivo against Mucor circinelloides via FKBP12-dependent inhibition of Tor.

    Science.gov (United States)

    Bastidas, Robert J; Shertz, Cecelia A; Lee, Soo Chan; Heitman, Joseph; Cardenas, Maria E

    2012-03-01

    The zygomycete Mucor circinelloides is an opportunistic fungal pathogen that commonly infects patients with malignancies, diabetes mellitus, and solid organ transplants. Despite the widespread use of antifungal therapy in the management of zygomycosis, the incidence of infections continues to rise among immunocompromised individuals. In this study, we established that the target and mechanism of antifungal action of the immunosuppressant rapamycin in M. circinelloides are mediated via conserved complexes with FKBP12 and a Tor homolog. We found that spontaneous mutations that disrupted conserved residues in FKBP12 conferred rapamycin and FK506 resistance. Disruption of the FKBP12-encoding gene, fkbA, also conferred rapamycin and FK506 resistance. Expression of M. circinelloides FKBP12 (McFKBP12) complemented a Saccharomyces cerevisiae mutant strain lacking FKBP12 to restore rapamycin sensitivity. Expression of the McTor FKBP12-rapamycin binding (FRB) domain conferred rapamycin resistance in S. cerevisiae, and McFKBP12 interacted in a rapamycin-dependent fashion with the McTor FRB domain in a yeast two-hybrid assay, validating McFKBP12 and McTor as conserved targets of rapamycin. We showed that in vitro, rapamycin exhibited potent growth inhibitory activity against M. circinelloides. In a Galleria mellonella model of systemic mucormycosis, rapamycin improved survival by 50%, suggesting that rapamycin and nonimmunosuppressive analogs have the potential to be developed as novel antifungal therapies for treatment of patients with mucormycosis.

  15. Rapamycin Exerts Antifungal Activity In Vitro and In Vivo against Mucor circinelloides via FKBP12-Dependent Inhibition of Tor

    Science.gov (United States)

    Bastidas, Robert J.; Shertz, Cecelia A.; Lee, Soo Chan; Heitman, Joseph

    2012-01-01

    The zygomycete Mucor circinelloides is an opportunistic fungal pathogen that commonly infects patients with malignancies, diabetes mellitus, and solid organ transplants. Despite the widespread use of antifungal therapy in the management of zygomycosis, the incidence of infections continues to rise among immunocompromised individuals. In this study, we established that the target and mechanism of antifungal action of the immunosuppressant rapamycin in M. circinelloides are mediated via conserved complexes with FKBP12 and a Tor homolog. We found that spontaneous mutations that disrupted conserved residues in FKBP12 conferred rapamycin and FK506 resistance. Disruption of the FKBP12-encoding gene, fkbA, also conferred rapamycin and FK506 resistance. Expression of M. circinelloides FKBP12 (McFKBP12) complemented a Saccharomyces cerevisiae mutant strain lacking FKBP12 to restore rapamycin sensitivity. Expression of the McTor FKBP12-rapamycin binding (FRB) domain conferred rapamycin resistance in S. cerevisiae, and McFKBP12 interacted in a rapamycin-dependent fashion with the McTor FRB domain in a yeast two-hybrid assay, validating McFKBP12 and McTor as conserved targets of rapamycin. We showed that in vitro, rapamycin exhibited potent growth inhibitory activity against M. circinelloides. In a Galleria mellonella model of systemic mucormycosis, rapamycin improved survival by 50%, suggesting that rapamycin and nonimmunosuppressive analogs have the potential to be developed as novel antifungal therapies for treatment of patients with mucormycosis. PMID:22210828

  16. Longitudinal imaging studies of tumor microenvironment in mice treated with the mTOR inhibitor rapamycin.

    Directory of Open Access Journals (Sweden)

    Keita Saito

    Full Text Available Rapamycin is an allosteric inhibitor of mammalian target of rapamycin, and inhibits tumor growth and angiogenesis. Recent studies suggested a possibility that rapamycin renormalizes aberrant tumor vasculature and improves tumor oxygenation. The longitudinal effects of rapamycin on angiogenesis and tumor oxygenation were evaluated in murine squamous cell carcinoma (SCCVII by electron paramagnetic resonance imaging (EPRI and magnetic resonance imaging (MRI to identify an optimal time after rapamycin treatment for enhanced tumor radioresponse. Rapamycin treatment was initiated on SCCVII solid tumors 8 days after implantation (500-750 mm(3 and measurements of tumor pO(2 and blood volume were conducted from day 8 to 14 by EPRI/MRI. Microvessel density was evaluated over the same time period by immunohistochemical analysis. Tumor blood volume as measured by MRI significantly decreased 2 days after rapamycin treatment. Tumor pO(2 levels modestly but significantly increased 2 days after rapamycin treatment; whereas, it decreased in non-treated control tumors. Furthermore, the fraction of hypoxic area (pixels with pO(2<10 mm Hg in the tumor region decreased 2 days after rapamycin treatments. Immunohistochemical analysis of tumor microvessel density and pericyte coverage revealed that microvessel density decreased 2 days after rapamycin treatment, but pericyte coverage did not change, similar to what was seen with anti-angiogenic agents such as sunitinib which cause vascular renormalization. Collectively, EPRI/MRI co-imaging can provide non-invasive evidence of rapamycin-induced vascular renormalization and resultant transient increase in tumor oxygenation. Improved oxygenation by rapamycin treatment provides a temporal window for anti-cancer therapies to realize enhanced response to radiotherapy.

  17. The Rapamycin-Binding Domain of the Protein Kinase mTOR is a Destabilizing Domain*

    Science.gov (United States)

    Edwards, Sarah R.; Wandless, Thomas J.

    2013-01-01

    Rapamycin is an immunosuppressive drug that binds simultaneously to the 12-kDa FK506- and rapamycin-binding protein (FKBP12, or FKBP) and the FKBP-rapamycin binding domain (FRB) of the mammalian target of rapamycin (mTOR) kinase. The resulting ternary complex has been used to conditionally perturb protein function, and one such method involves perturbation of a protein of interest through its mislocalization. We synthesized two rapamycin derivatives that possess large substituents at the C16 position within the FRB-binding interface, and these derivatives were screened against a library of FRB mutants using a three-hybrid assay in Saccharomyces cerevisiae. Several FRB mutants responded to one of the rapamycin derivatives, and twenty of these mutants were further characterized in mammalian cells. The mutants most responsive to the ligand were fused to yellow fluorescent protein, and fluorescence levels in the presence and absence of the ligand were measured to determine stability of the fusion proteins. Wild-type and mutant FRB domains were expressed at low levels in the absence of the rapamycin derivative, and expression levels rose up to ten-fold upon treatment with ligand. The synthetic rapamycin derivatives were further analyzed using quantitative mass spectrometry, and one of the compounds was found to contain contaminating rapamycin. Furthermore, uncontaminated analogs retain the ability to inhibit mTOR, albeit with diminished potency relative to rapamycin. The ligand-dependent stability displayed by wildtype FRB and FRB mutants as well as the inhibitory potential and purity of the rapamycin derivatives should be considered as potentially confounding experimental variables when using these systems. PMID:17350953

  18. Divergent tissue and sex effects of rapamycin on the proteasome-chaperone network of old mice

    Directory of Open Access Journals (Sweden)

    Karl Andrew Rodriguez

    2014-11-01

    Full Text Available Rapamycin, an allosteric inhibitor of the mTOR kinase, increases longevity in mice in a sex-specific manner. In contrast to the widely accepted theory that a loss of proteasome activity is detrimental to both life- and healthspan, biochemical studies in vitro reveal that rapamycin inhibits 20S proteasome peptidase activity. We tested if this unexpected finding is also evident after chronic rapamycin treatment in vivo by measuring peptidase activities for both the 26S and 20S proteasome in liver, fat, and brain tissues of old, male and female mice fed encapsulated chow containing 2.24mg/kg (14 ppm rapamycin for 6 months. Further we assessed if rapamycin altered expression of the chaperone proteins known to interact with the proteasome-mediated degradation system (PMDS, heat shock factor 1 (HSF1, and the levels of key mTOR pathway proteins. Rapamycin had little effect on liver proteasome activity in either gender, but increased proteasome activity in female brain lysates and lowered its activity in female fat tissue. Rapamycin-induced changes in molecular chaperone levels were also more substantial in tissues from female animals. Furthermore, mTOR pathway proteins showed more significant changes in female tissues compared to those from males. These data show collectively that there are divergent tissue and sex effects of rapamycin on the proteasome-chaperone network and that these may be linked to the disparate effects of rapamycin on males and females. Further our findings suggest that rapamycin induces indirect regulation of the PMDS/heat-shock response through its modulation of the mTOR pathway rather than via direct interactions between rapamycin and the proteasome.

  19. Protein kinase FgSch9 serves as a mediator of the target of rapamycin and high osmolarity glycerol pathways and regulates multiple stress responses and secondary metabolism in Fusarium graminearum.

    Science.gov (United States)

    Gu, Qin; Zhang, Chengqi; Yu, Fangwei; Yin, Yanni; Shim, Won-Bo; Ma, Zhonghua

    2015-08-01

    Saccharomyces cerevisiae protein kinase Sch9 is one of the downstream effectors of the target of rapamycin (TOR) complex 1 and plays multiple roles in stress resistance, longevity and nutrient sensing. However, the functions of Sch9 orthologs in filamentous fungi, particularly in pathogenic species, have not been characterized to date. Here, we investigated biological and genetic functions of FgSch9 in Fusarium graminearum. The FgSCH9 deletion mutant (ΔFgSch9) was defective in aerial hyphal growth, hyphal branching and conidial germination. The mutant exhibited increased sensitivity to osmotic and oxidative stresses, cell wall-damaging agents, and to rapamycin, while showing increased thermal tolerance. We identified FgMaf1 as one of the FgSch9-interacting proteins that plays an important role in regulating mycotoxin biosynthesis and virulence of F. graminearum. Co-immunoprecipitation and affinity capture-mass spectrometry assays showed that FgSch9 also interacts with FgTor and FgHog1. More importantly, both ΔFgSch9 and FgHog1 null mutant (ΔFgHog1) exhibited increased sensitivity to osmotic and oxidative stresses. This defect was more severe in the FgSch9/FgHog1 double mutant. Taken together, we propose that FgSch9 serves as a mediator of the TOR and high osmolarity glycerol pathways, and regulates vegetative differentiation, multiple stress responses and secondary metabolism in F. graminearum. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Rapamycin down-regulates LDL-receptor expression independently of SREBP-2

    International Nuclear Information System (INIS)

    Sharpe, Laura J.; Brown, Andrew J.

    2008-01-01

    As a key regulator of cholesterol homeostasis, sterol-regulatory element binding protein-2 (SREBP-2) up-regulates expression of genes involved in cholesterol synthesis (e.g., 3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA) Reductase) and uptake (the low density lipoprotein (LDL)-receptor). Previously, we showed that Akt, a critical kinase in cell growth and proliferation, contributes to SREBP-2 activation. However, the specific Akt target involved is unknown. A potential candidate is the mammalian target of rapamycin, mTOR. Rapamycin can cause hyperlipidaemia clinically, and we hypothesised that this may be mediated via an effect of mTOR on SREBP-2. Herein, we found that SREBP-2 activation and HMG-CoA Reductase gene expression were unaffected by rapamycin treatment. However, LDL-receptor gene expression was decreased by rapamycin, suggesting that this may contribute to the hyperlipidaemia observed in rapamycin-treated patients. Rapamycin did not affect mRNA stability, so the decrease in LDL-receptor gene expression is likely to be occurring at the transcriptional level, although independently of SREBP-2

  1. Rapamycin up-regulates triglycerides in hepatocytes by down-regulating Prox1.

    Science.gov (United States)

    Kwon, Sora; Jeon, Ji-Sook; Kim, Su Bin; Hong, Young-Kwon; Ahn, Curie; Sung, Jung-Suk; Choi, Inho

    2016-02-27

    Although the prolonged use of rapamycin may cause unwanted side effects such as hyperlipidemia, the underlying mechanism remains unknown. Prox1 is a transcription factor responsible for the development of several tissues including lymphatics and liver. There is growing evidences that Prox1 participates in metabolism in addition to embryogenesis. However, whether Prox1 is directly related to lipid metabolism is currently unknown. HepG2 human hepatoma cells were treated with rapamycin and total lipids were analyzed by thin layer chromatography. The effect of rapamycin on the expression of Prox1 was determined by western blotting. To investigate the role of Prox1 in triglycerides regulation, siRNA and overexpression system were employed. Rapamycin was injected into mice for 2 weeks and total lipids and proteins in liver were measured by thin layer chromatography and western blot analysis, respectively. Rapamycin up-regulated the amount of triglyceride and down-regulated the expression of Prox1 in HepG2 cells by reducing protein half-life but did not affect its transcript. The loss-of-function of Prox1 was coincident with the increase of triglycerides in HepG2 cells treated with rapamycin. The up-regulation of triglycerides by rapamycin in HepG2 cells reverted to normal levels by the compensation of Prox1 using the overexpression system. Rapamycin also down-regulated Prox1 expression but increased triglycerides in mouse liver. This study suggests that rapamycin can increase the amount of triglycerides by down-regulating Prox1 expression in hepatocytes, which means that the mammalian target of rapamycin (mTOR) signaling is important for the regulation of triglycerides by maintaining Prox1 expression.

  2. Alternative rapamycin treatment regimens mitigate the impact of rapamycin on glucose homeostasis and the immune system.

    Science.gov (United States)

    Arriola Apelo, Sebastian I; Neuman, Joshua C; Baar, Emma L; Syed, Faizan A; Cummings, Nicole E; Brar, Harpreet K; Pumper, Cassidy P; Kimple, Michelle E; Lamming, Dudley W

    2016-02-01

    Inhibition of the mechanistic target of rapamycin (mTOR) signaling pathway by the FDA-approved drug rapamycin has been shown to promote lifespan and delay age-related diseases in model organisms including mice. Unfortunately, rapamycin has potentially serious side effects in humans, including glucose intolerance and immunosuppression, which may preclude the long-term prophylactic use of rapamycin as a therapy for age-related diseases. While the beneficial effects of rapamycin are largely mediated by the inhibition of mTOR complex 1 (mTORC1), which is acutely sensitive to rapamycin, many of the negative side effects are mediated by the inhibition of a second mTOR-containing complex, mTORC2, which is much less sensitive to rapamycin. We hypothesized that different rapamycin dosing schedules or the use of FDA-approved rapamycin analogs with different pharmacokinetics might expand the therapeutic window of rapamycin by more specifically targeting mTORC1. Here, we identified an intermittent rapamycin dosing schedule with minimal effects on glucose tolerance, and we find that this schedule has a reduced impact on pyruvate tolerance, fasting glucose and insulin levels, beta cell function, and the immune system compared to daily rapamycin treatment. Further, we find that the FDA-approved rapamycin analogs everolimus and temsirolimus efficiently inhibit mTORC1 while having a reduced impact on glucose and pyruvate tolerance. Our results suggest that many of the negative side effects of rapamycin treatment can be mitigated through intermittent dosing or the use of rapamycin analogs. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  3. Suppression of AKT phosphorylation restores rapamycin-based synthetic lethality in SMAD4-defective pancreatic cancer cells.

    Science.gov (United States)

    Le Gendre, Onica; Sookdeo, Ayisha; Duliepre, Stephie-Anne; Utter, Matthew; Frias, Maria; Foster, David A

    2013-05-01

    mTOR has been implicated in survival signals for many human cancers. Rapamycin and TGF-β synergistically induce G1 cell-cycle arrest in several cell lines with intact TGF-β signaling pathway, which protects cells from the apoptotic effects of rapamycin during S-phase of the cell cycle. Thus, rapamycin is cytostatic in the presence of serum/TGF-β and cytotoxic in the absence of serum. However, if TGF-β signaling is defective, rapamycin induced apoptosis in both the presence and absence of serum/TGF-β in colon and breast cancer cell lines. Because genetic dysregulation of TGF-β signaling is commonly observed in pancreatic cancers-with defects in the Smad4 gene being most prevalent, we hypothesized that pancreatic cancers would display a synthetic lethality to rapamycin in the presence of serum/TGF-β. We report here that Smad4-deficient pancreatic cancer cells are killed by rapamycin in the absence of serum; however, in the presence of serum, we did not observe the predicted synthetic lethality with rapamycin. Rapamycin also induced elevated phosphorylation of the survival kinase Akt at Ser473. Suppression of rapamycin-induced Akt phosphorylation restored rapamycin sensitivity in Smad4-null, but not Smad4 wild-type pancreatic cancer cells. This study shows that the synthetic lethality to rapamycin in pancreatic cancers with defective TGF-β signaling is masked by rapamycin-induced increases in Akt phosphorylation. The implication is that a combination of approaches that suppress both Akt phosphorylation and mTOR could be effective in targeting pancreatic cancers with defective TGF-β signaling. ©2013 AACR.

  4. Radiation-induced gene responses

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Paunesku, T.; Shearin-Jones, P.; Oryhon, J.

    1996-01-01

    In the process of identifying genes that are differentially regulated in cells exposed to ultraviolet radiation (UV), we identified a transcript that was repressed following the exposure of cells to a combination of UV and salicylate, a known inhibitor of NF-kappaB. Sequencing this band determined that it has identify to lactate dehydrogenase, and Northern blots confirmed the initial expression pattern. Analysis of the sequence of the LDH 5' region established the presence of NF-kappaB, Sp1, and two Ap-2 elements; two partial AP- 1; one partial RE, and two halves of E-UV elements were also found. Electromobility shift assays were then performed for the AP-1, NF- kappaB, and E-UV elements. These experiments revealed that binding to NF-kappaB was induced by UV but repressed with salicylic acid; UV did not affect AP-1 binding, but salicylic acid inhibited it alone or following UV exposure; and E-UV binding was repressed by UV, and salicylic acid had little effect. Since the binding of no single element correlated with the expression pattern of LDH, it is likely that multiple elements govern UV/salicylate-mediated expression

  5. Rapamycin and chloroquine: the in vitro and in vivo effects of autophagy-modifying drugs show promising results in valosin containing protein multisystem proteinopathy.

    Directory of Open Access Journals (Sweden)

    Angèle Nalbandian

    Full Text Available Mutations in the valosin containing protein (VCP gene cause hereditary Inclusion body myopathy (hIBM associated with Paget disease of bone (PDB, frontotemporal dementia (FTD, more recently termed multisystem proteinopathy (MSP. Affected individuals exhibit scapular winging and die from progressive muscle weakness, and cardiac and respiratory failure, typically in their 40s to 50s. Histologically, patients show the presence of rimmed vacuoles and TAR DNA-binding protein 43 (TDP-43-positive large ubiquitinated inclusion bodies in the muscles. We have generated a VCPR155H/+ mouse model which recapitulates the disease phenotype and impaired autophagy typically observed in patients with VCP disease. Autophagy-modifying agents, such as rapamycin and chloroquine, at pharmacological doses have previously shown to alter the autophagic flux. Herein, we report results of administration of rapamycin, a specific inhibitor of the mechanistic target of rapamycin (mTOR signaling pathway, and chloroquine, a lysosomal inhibitor which reverses autophagy by accumulating in lysosomes, responsible for blocking autophagy in 20-month old VCPR155H/+ mice. Rapamycin-treated mice demonstrated significant improvement in muscle performance, quadriceps histological analysis, and rescue of ubiquitin, and TDP-43 pathology and defective autophagy as indicated by decreased protein expression levels of LC3-I/II, p62/SQSTM1, optineurin and inhibiting the mTORC1 substrates. Conversely, chloroquine-treated VCPR155H/+ mice revealed progressive muscle weakness, cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-I/II, p62/SQSTM1, and optineurin expression levels. Our in vitro patient myoblasts studies treated with rapamycin demonstrated an overall improvement in the autophagy markers. Targeting the mTOR pathway ameliorates an increasing list of disorders, and these findings suggest that VCP disease and related neurodegenerative multisystem

  6. Differential effects of rapamycin and dexamethasone in mouse models of established allergic asthma.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Mushaben

    Full Text Available The mammalian target of rapamycin (mTOR plays an important role in cell growth/differentiation, integrating environmental cues, and regulating immune responses. Our lab previously demonstrated that inhibition of mTOR with rapamycin prevented house dust mite (HDM-induced allergic asthma in mice. Here, we utilized two treatment protocols to investigate whether rapamycin, compared to the steroid, dexamethasone, could inhibit allergic responses during the later stages of the disease process, namely allergen re-exposure and/or during progression of chronic allergic disease. In protocol 1, BALB/c mice were sensitized to HDM (three i.p. injections and administered two intranasal HDM exposures. After 6 weeks of rest/recovery, mice were re-exposed to HDM while being treated with rapamycin or dexamethasone. In protocol 2, mice were exposed to HDM for 3 or 6 weeks and treated with rapamycin or dexamethasone during weeks 4-6. Characteristic features of allergic asthma, including IgE, goblet cells, airway hyperreactivity (AHR, inflammatory cells, cytokines/chemokines, and T cell responses were assessed. In protocol 1, both rapamycin and dexamethasone suppressed goblet cells and total CD4(+ T cells including activated, effector, and regulatory T cells in the lung tissue, with no effect on AHR or total inflammatory cell numbers in the bronchoalveolar lavage fluid. Rapamycin also suppressed IgE, although IL-4 and eotaxin 1 levels were augmented. In protocol 2, both drugs suppressed total CD4(+ T cells, including activated, effector, and regulatory T cells and IgE levels. IL-4, eotaxin, and inflammatory cell numbers were increased after rapamycin and no effect on AHR was observed. Dexamethasone suppressed inflammatory cell numbers, especially eosinophils, but had limited effects on AHR. We conclude that while mTOR signaling is critical during the early phases of allergic asthma, its role is much more limited once disease is established.

  7. Labor Inhibits Placental Mechanistic Target of Rapamycin Complex 1 Signaling

    Science.gov (United States)

    LAGER, Susanne; AYE, Irving L.M.H.; GACCIOLI, Francesca; RAMIREZ, Vanessa I.; JANSSON, Thomas; POWELL, Theresa L.

    2014-01-01

    Introduction Labor induces a myriad of changes in placental gene expression. These changes may represent a physiological adaptation inhibiting placental cellular processes associated with a high demand for oxygen and energy (e.g., protein synthesis and active transport) thereby promoting oxygen and glucose transfer to the fetus. We hypothesized that mechanistic target of rapamycin complex 1 (mTORC1) signaling, a positive regulator of trophoblast protein synthesis and amino acid transport, is inhibited by labor. Methods Placental tissue was collected from healthy, term pregnancies (n=15 no-labor; n=12 labor). Activation of Caspase-1, IRS1/Akt, STAT, mTOR, and inflammatory signaling pathways was determined by Western blot. NFκB p65 and PPARγ DNA binding activity was measured in isolated nuclei. Results Labor increased Caspase-1 activation and mTOR complex 2 signaling, as measured by phosphorylation of Akt (S473). However, mTORC1 signaling was inhibited in response to labor as evidenced by decreased phosphorylation of mTOR (S2448) and 4EBP1 (T37/46 and T70). Labor also decreased NFκB and PPARγ DNA binding activity, while having no effect on IRS1 or STAT signaling pathway. Discussion and conclusion Several placental signaling pathways are affected by labor, which has implications for experimental design in studies of placental signaling. Inhibition of placental mTORC1 signaling in response to labor may serve to down-regulate protein synthesis and amino acid transport, processes that account for a large share of placental oxygen and glucose consumption. We speculate that this response preserves glucose and oxygen for transfer to the fetus during the stressful events of labor. PMID:25454472

  8. Activation of phosphoinositide 3-kinase/Akt/mechanistic target of rapamycin pathway and response to everolimus in endocrine receptor-positive metastatic breast cancer – A retrospective pilot analysis and viewpoint

    Directory of Open Access Journals (Sweden)

    Jyoti Bajpai

    2017-01-01

    Full Text Available Introduction: Biomarkers predictive of response to mechanistic target of rapamycin (mTOR inhibitor, everolimus, in endocrine receptor (ER-positive metastatic breast cancer (MBC are a work in progress. We evaluated the feasibility of directly measuring mTOR activity and phosphatase and tensin homolog (PTEN expression and correlating their expression with response and survival. Materials and Methods: MBC patients who received everolimus with endocrine therapy (ET after progression on an aromatase inhibitor and had adequate tissue preservation for estimation of mTOR activity and PTEN expression were selected for analysis from a prospectively maintained database. Progression-free survival (PFS and overall survival (OS were estimated by Kaplan–Meier method, and correlation between mTOR activity and PTEN expression with survival was done by log-rank test. Results: Thirteen ER-positive MBC patients were available for analysis. PTEN expression was lost in 11/13 (84.6% patients and retained in 2/13 patients (15.4%. mTOR activity was absent in four patients (30.7%, weak in six patients (46.1%, and moderate in 3 patients (23.2%. Median PFS for the entire population was 2.5 months while median OS was not reached. Patients with an absent mTOR activity showed a longer PFS (5 vs. 1.5 vs. 2 months than those with weak and moderate activity, respectively (P = 0.043. There was no correlation between loss of PTEN expression and PFS. Conclusions: Measurement of direct mTOR activity in patients with MBC receiving everolimus/ET combination appears feasible. Absent mTOR activity may predict for longer PFS with everolimus-ET combination and requires further study.

  9. Rapamycin Influences the Efficiency of Fertilization and Development in the Mouse: A Role for Autophagic Activation

    Directory of Open Access Journals (Sweden)

    Geun-Kyung Lee

    2016-08-01

    Full Text Available The mammalian target of rapamycin (mTOR regulates cellular processes such as cell growth, metabolism, transcription, translation, and autophagy. Rapamycin is a selective inhibitor of mTOR, and induces autophagy in various systems. Autophagy contributes to clearance and recycling of macromolecules and organelles in response to stress. We previously reported that vitrified-warmed mouse oocytes show acute increases in autophagy during warming, and suggested that it is a natural response to cold stress. In this follow-up study, we examined whether the modulation of autophagy influences survival, fertilization, and developmental rates of vitrified-warmed mouse oocytes. We used rapamycin to enhance autophagy in metaphase II (MII oocytes before and after vitrification. The oocytes were then subjected to in vitro fertilization (IVF. The fertilization and developmental rates of vitrified-warmed oocytes after rapamycin treatment were significantly lower than those for control groups. Modulation of autophagy with rapamycin treatment shows that rapamycin-induced autophagy exerts a negative influence on fertilization and development of vitrified-warmed oocytes.

  10. Brain Injury-Induced Synaptic Reorganization in Hilar Inhibitory Neurons Is Differentially Suppressed by Rapamycin.

    Science.gov (United States)

    Butler, Corwin R; Boychuk, Jeffery A; Smith, Bret N

    2017-01-01

    Following traumatic brain injury (TBI), treatment with rapamycin suppresses mammalian (mechanistic) target of rapamycin (mTOR) activity and specific components of hippocampal synaptic reorganization associated with altered cortical excitability and seizure susceptibility. Reemergence of seizures after cessation of rapamycin treatment suggests, however, an incomplete suppression of epileptogenesis. Hilar inhibitory interneurons regulate dentate granule cell (DGC) activity, and de novo synaptic input from both DGCs and CA3 pyramidal cells after TBI increases their excitability but effects of rapamycin treatment on the injury-induced plasticity of interneurons is only partially described. Using transgenic mice in which enhanced green fluorescent protein (eGFP) is expressed in the somatostatinergic subset of hilar inhibitory interneurons, we tested the effect of daily systemic rapamycin treatment (3 mg/kg) on the excitability of hilar inhibitory interneurons after controlled cortical impact (CCI)-induced focal brain injury. Rapamycin treatment reduced, but did not normalize, the injury-induced increase in excitability of surviving eGFP+ hilar interneurons. The injury-induced increase in response to selective glutamate photostimulation of DGCs was reduced to normal levels after mTOR inhibition, but the postinjury increase in synaptic excitation arising from CA3 pyramidal cell activity was unaffected by rapamycin treatment. The incomplete suppression of synaptic reorganization in inhibitory circuits after brain injury could contribute to hippocampal hyperexcitability and the eventual reemergence of the epileptogenic process upon cessation of mTOR inhibition. Further, the cell-selective effect of mTOR inhibition on synaptic reorganization after CCI suggests possible mechanisms by which rapamycin treatment modifies epileptogenesis in some models but not others.

  11. Rapamycin delays growth of Wnt-1 tumors in spite of suppression of host immunity

    International Nuclear Information System (INIS)

    Svirshchevskaya, Elena V; Mariotti, Jacopo; Wright, Mollie H; Viskova, Natalia Y; Telford, William; Fowler, Daniel H; Varticovski, Lyuba

    2008-01-01

    Rapamycin, an inhibitor of mammalian target of Rapamycin (mTOR), is an immunosuppressive agent that has anti-proliferative effects on some tumors. However, the role of Rapamycin-induced immune suppression on tumor progression has not been examined. We developed a transplantation model for generation of mammary tumors in syngeneic recipients that can be used to address the role of the immune system on tumor progression. We examined the effect of Rapamycin on the immune system and growth of MMTV-driven Wnt-1 mammary tumors which were transplanted into irradiated and bone marrow-reconstituted, or naïve mice. Rapamycin induced severe immunosuppression and significantly delayed the growth of Wnt-1 tumors. T cell depletion in spleen and thymus and reduction in T cell cytokine secretion were evident within 7 days of therapy. By day 20, splenic but not thymic T cell counts, and cytokine secretion recovered. We determined whether adoptive T cell therapy enhances the anti-cancer effect using ex vivo generated Rapamycin-resistant T cells. However, T cell transfer during Rapamycin therapy did not improve the outcome relative to drug therapy alone. Thus, we could not confirm that suppression of T cell immunity contributes to tumor growth in this model. Consistent with suppression of the mTOR pathway, decreased 4E-BP1, p70 S6-kinase, and S6 protein phosphorylation correlated with a decrease in Wnt-1 tumor cell proliferation. Rapamycin has a direct anti-tumor effect on Wnt-1 breast cancer in vivo that involves inhibition of the mTOR pathway at doses that also suppress host immune responses

  12. Phosphorylation of translation factors in response to anoxia in turtles, Trachemys scripta elegans: role of the AMP-activated protein kinase and target of rapamycin signalling pathways.

    Science.gov (United States)

    Rider, Mark H; Hussain, Nusrat; Dilworth, Stephen M; Storey, Kenneth B

    2009-12-01

    Long-term survival of oxygen deprivation by animals with well-developed anoxia tolerance depends on multiple biochemical adaptations including strong metabolic rate depression. We investigated whether the AMP-activated protein kinase (AMPK) could play a regulatory role in the suppression of protein synthesis that occurs when turtles experience anoxic conditions. AMPK activity and the phosphorylation state of ribosomal translation factors were measured in liver, heart, red muscle and white muscle of red-eared slider turtles (Trachemys scripta elegans) subjected to 20 h of anoxic submergence. AMPK activity increased twofold in white muscle of anoxic turtles compared with aerobic controls but remained unchanged in liver and red muscle, whereas in heart AMPK activity decreased by 40%. Immunoblotting with phospho-specific antibodies revealed that eukaryotic elongation factor-2 phosphorylation at the inactivating Thr56 site increased six- and eightfold in red and white muscles from anoxic animals, respectively, but was unchanged in liver and heart. The phosphorylation state of the activating Thr389 site of p70 ribosomal protein S6 kinase was reduced under anoxia in red muscle and heart but was unaffected in liver and white muscle. Exposure to anoxia decreased 40S ribosomal protein S6 phosphorylation in heart and promoted eukaryotic initiation factor 4E-binding protein-1 (4E-BP1) dephosphorylation in red muscle, but surprisingly increased 4E-BP1 phosphorylation in white muscle. The changes in phosphorylation state of translation factors suggest that organ-specific patterns of signalling and response are involved in achieving the anoxia-induced suppression of protein synthesis in turtles.

  13. TORC1 Inhibition by Rapamycin Promotes Antioxidant Defences in a Drosophila Model of Friedreich's Ataxia.

    Directory of Open Access Journals (Sweden)

    Pablo Calap-Quintana

    Full Text Available Friedreich's ataxia (FRDA, the most common inherited ataxia in the Caucasian population, is a multisystemic disease caused by a significant decrease in the frataxin level. To identify genes capable of modifying the severity of the symptoms of frataxin depletion, we performed a candidate genetic screen in a Drosophila RNAi-based model of FRDA. We found that genetic reduction in TOR Complex 1 (TORC1 signalling improves the impaired motor performance phenotype of FRDA model flies. Pharmacologic inhibition of TORC1 signalling by rapamycin also restored this phenotype and increased the lifespan and ATP levels. Furthermore, rapamycin reduced the altered levels of malondialdehyde + 4-hydroxyalkenals and total glutathione of the model flies. The rapamycin-mediated protection against oxidative stress is due in part to an increase in the transcription of antioxidant genes mediated by cap-n-collar (Drosophila ortholog of Nrf2. Our results suggest that autophagy is indeed necessary for the protective effect of rapamycin in hyperoxia. Rapamycin increased the survival and aconitase activity of model flies subjected to high oxidative insult, and this improvement was abolished by the autophagy inhibitor 3-methyladenine. These results point to the TORC1 pathway as a new potential therapeutic target for FRDA and as a guide to finding new promising molecules for disease treatment.

  14. Target of rapamycin (TOR) plays a critical role in triacylglycerol accumulation in microalgae.

    Science.gov (United States)

    Imamura, Sousuke; Kawase, Yasuko; Kobayashi, Ikki; Sone, Toshiyuki; Era, Atsuko; Miyagishima, Shin-Ya; Shimojima, Mie; Ohta, Hiroyuki; Tanaka, Kan

    2015-10-01

    Most microalgae produce triacylglycerol (TAG) under stress conditions such as nitrogen depletion, but the underlying molecular mechanism remains unclear. In this study, we focused on the role of target of rapamycin (TOR) in TAG accumulation. TOR is a serine/threonine protein kinase that is highly conserved and plays pivotal roles in nitrogen and other signaling pathways in eukaryotes. We previously constructed a rapamycin-susceptible Cyanidioschyzon merolae, a unicellular red alga, by expressing yeast FKBP12 protein to evaluate the results of TOR inhibition (Imamura et al. in Biochem Biophys Res Commun 439:264-269, 2013). By using this strain, we here report that rapamycin-induced TOR inhibition results in accumulation of cytoplasmic lipid droplets containing TAG. Transcripts for TAG synthesis-related genes, such as glycerol-3-phosphate acyltransferase and acyl-CoA:diacylglycerol acyltransferase (DGAT), were increased by rapamycin treatment. We also found that fatty acid synthase-dependent de novo fatty acid synthesis was required for the accumulation of lipid droplets. Induction of TAG and up-regulation of DGAT gene expression by rapamycin were similarly observed in the unicellular green alga, Chlamydomonas reinhardtii. These results suggest the general involvement of TOR signaling in TAG accumulation in divergent microalgae.

  15. Rapamycin and Glucose-Target of Rapamycin (TOR) Protein Signaling in Plants*

    Science.gov (United States)

    Xiong, Yan; Sheen, Jen

    2012-01-01

    Target of rapamycin (TOR) kinase is an evolutionarily conserved master regulator that integrates energy, nutrients, growth factors, and stress signals to promote survival and growth in all eukaryotes. The reported land plant resistance to rapamycin and the embryo lethality of the Arabidopsis tor mutants have hindered functional dissection of TOR signaling in plants. We developed sensitive cellular and seedling assays to monitor endogenous Arabidopsis TOR activity based on its conserved S6 kinase (S6K) phosphorylation. Surprisingly, rapamycin effectively inhibits Arabidopsis TOR-S6K1 signaling and retards glucose-mediated root and leaf growth, mimicking estradiol-inducible tor mutants. Rapamycin inhibition is relieved in transgenic plants deficient in Arabidopsis FK506-binding protein 12 (FKP12), whereas FKP12 overexpression dramatically enhances rapamycin sensitivity. The role of Arabidopsis FKP12 is highly specific as overexpression of seven closely related FKP proteins fails to increase rapamycin sensitivity. Rapamycin exerts TOR inhibition by inducing direct interaction between the TOR-FRB (FKP-rapamycin binding) domain and FKP12 in plant cells. We suggest that variable endogenous FKP12 protein levels may underlie the molecular explanation for longstanding enigmatic observations on inconsistent rapamycin resistance in plants and in various mammalian cell lines or diverse animal cell types. Integrative analyses with rapamycin and conditional tor and fkp12 mutants also reveal a central role of glucose-TOR signaling in root hair formation. Our studies demonstrate the power of chemical genetic approaches in the discovery of previously unknown and pivotal functions of glucose-TOR signaling in governing the growth of cotyledons, true leaves, petioles, and primary and secondary roots and root hairs. PMID:22134914

  16. Biological constraints limit the use of rapamycin-inducible FKBP12-Inp54p for depleting PIP2 in dorsal root ganglia neurons.

    Science.gov (United States)

    Coutinho-Budd, Jaeda C; Snider, Samuel B; Fitzpatrick, Brendan J; Rittiner, Joseph E; Zylka, Mark J

    2013-09-08

    Rapamycin-induced translocation systems can be used to manipulate biological processes with precise temporal control. These systems are based on rapamycin-induced dimerization of FK506 Binding Protein 12 (FKBP12) with the FKBP Rapamycin Binding (FRB) domain of mammalian target of rapamycin (mTOR). Here, we sought to adapt a rapamycin-inducible phosphatidylinositol 4,5-bisphosphate (PIP2)-specific phosphatase (Inp54p) system to deplete PIP2 in nociceptive dorsal root ganglia (DRG) neurons. We genetically targeted membrane-tethered CFP-FRBPLF (a destabilized FRB mutant) to the ubiquitously expressed Rosa26 locus, generating a Rosa26-FRBPLF knockin mouse. In a second knockin mouse line, we targeted Venus-FKBP12-Inp54p to the Calcitonin gene-related peptide-alpha (CGRPα) locus. We hypothesized that after intercrossing these mice, rapamycin treatment would induce translocation of Venus-FKBP12-Inp54p to the plasma membrane in CGRP+ DRG neurons. In control experiments with cell lines, rapamycin induced translocation of Venus-FKBP12-Inp54p to the plasma membrane, and subsequent depletion of PIP2, as measured with a PIP2 biosensor. However, rapamycin did not induce translocation of Venus-FKBP12-Inp54p to the plasma membrane in FRBPLF-expressing DRG neurons (in vitro or in vivo). Moreover, rapamycin treatment did not alter PIP2-dependent thermosensation in vivo. Instead, rapamycin treatment stabilized FRBPLF in cultured DRG neurons, suggesting that rapamycin promoted dimerization of FRBPLF with endogenous FKBP12. Taken together, our data indicate that these knockin mice cannot be used to inducibly deplete PIP2 in DRG neurons. Moreover, our data suggest that high levels of endogenous FKBP12 could compete for binding to FRBPLF, hence limiting the use of rapamycin-inducible systems to cells with low levels of endogenous FKBP12.

  17. Negative Effects of Chronic Rapamycin Treatment on Behavior in a Mouse Model of Fragile X Syndrome

    Directory of Open Access Journals (Sweden)

    Rachel M. Saré

    2018-01-01

    Full Text Available Fragile X syndrome (FXS, the most common form of inherited intellectual disability, is also highly associated with autism spectrum disorders (ASD. It is caused by expansion of a CGG repeat sequence on the X chromosome resulting in silencing of the FMR1 gene. This is modeled in the mouse by deletion of Fmr1 (Fmr1 KO. Fmr1 KO mice recapitulate many of the behavioral features of the disorder including seizure susceptibility, hyperactivity, impaired social behavior, sleep problems, and learning and memory deficits. The mammalian target of rapamycin pathway (mTORC1 is upregulated in Fmr1 KO mice and is thought to be important for the pathogenesis of this disorder. We treated Fmr1 KO mice chronically with an mTORC1 inhibitor, rapamycin, to determine if rapamycin treatment could reverse behavioral phenotypes. We performed open field, zero maze, social behavior, sleep, passive avoidance, and audiogenic seizure testing. We found that pS6 was upregulated in Fmr1 KO mice and normalized by rapamycin treatment, but, except for an anxiogenic effect, it did not reverse any of the behavioral phenotypes examined. In fact, rapamycin treatment had an adverse effect on sleep and social behavior in both control and Fmr1 KO mice. These results suggest that targeting the mTOR pathway in FXS is not a good treatment strategy and that other pathways should be considered.

  18. Blocking mammalian target of rapamycin (mTOR) improves neuropathic pain evoked by spinal cord injury.

    Science.gov (United States)

    Wang, Xiaoping; Li, Xiaojia; Huang, Bin; Ma, Shuai

    2016-01-01

    Spinal cord injury (SCI) is an extremely serious type of physical trauma observed in clinics. Neuropathic pain resulting from SCI has a lasting and significant impact on most aspects of daily life. Thus, a better understanding of the molecular pathways responsible for the cause of neuropathic pain observed in SCI is important to develop effective therapeutic agents and treatment strategies. Mammalian target of rapamycin (mTOR) is a serine/threonine protein kinase that is well known for its critical roles in regulating protein synthesis and growth. Furthermore, compelling evidence supports the notion that widespread dysregulation of mTOR and its downstream pathways are involved in neuropathic pain. Thus, in this study we specifically examined the underlying mechanisms by which mTOR and its signaling pathways are involved in SCI-evoked neuropathic pain in a rat model. Overall, we demonstrated that SCI increased the protein expression of p-mTOR, and mTORmediated- phosphorylation of 4E-binding protein 4 (4E-BP1) and p70 ribosomal S6 protein kinase 1 (S6K1) in the superficial dorsal horn of the spinal cord. Also, we showed that blocking spinal mTOR by intrathecal injection of rapamycin significantly inhibited pain responses induced by mechanical and thermal stimulation. In addition, blocking spinal phosphatidylinositide 3-kinase (p-PI3K) pathway significantly attenuated activities of p-mTOR pathways as well as mechanical and thermal hyperalgesia in SCI rats. Moreover, blocking mTOR and PI3K decreased the enhanced levels of substance P and calcitonin gene-related peptide (CGRP) in the dorsal horn of SCI rats. We revealed specific signaling pathways leading to SCI-evoked neuropathic pain, including the activation of PI3K, mTOR and its downstream signaling pathways. Targeting one or more of these signaling molecules may present new opportunities for treatment and management of neuropathic pain often observed in patients with SCI.

  19. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Science.gov (United States)

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  20. Are invertebrates relevant models in ageing research? Focus on the effects of rapamycin on TOR.

    Science.gov (United States)

    Erdogan, Cihan Suleyman; Hansen, Benni Winding; Vang, Ole

    2016-01-01

    Ageing is the organisms increased susceptibility to death, which is linked to accumulated damage in the cells and tissues. Ageing is a complex process regulated by crosstalk of various pathways in the cells. Ageing is highly regulated by the Target of Rapamycin (TOR) pathway activity. TOR is an evolutionary conserved key protein kinase in the TOR pathway that regulates growth, proliferation and cell metabolism in response to nutrients, growth factors and stress. Comparing the ageing process in invertebrate model organisms with relatively short lifespan with mammals provides valuable information about the molecular mechanisms underlying the ageing process faster than mammal systems. Inhibition of the TOR pathway activity via either genetic manipulation or rapamycin increases lifespan profoundly in most invertebrate model organisms. This contribution will review the recent findings in invertebrates concerning the TOR pathway and effects of TOR inhibition by rapamycin on lifespan. Besides some contradictory results, the majority points out that rapamycin induces longevity. This suggests that administration of rapamycin in invertebrates is a promising tool for pursuing the scientific puzzle of lifespan prolongation. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton.

    Science.gov (United States)

    Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

    2017-04-04

    Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.

  2. Descending serotonergic facilitation mediated by spinal 5-HT3 receptors engages spinal rapamycin-sensitive pathways in the rat

    Science.gov (United States)

    Asante, Curtis O.; Dickenson, Anthony H.

    2010-01-01

    We have recently reported the importance of spinal rapamycin-sensitive pathways in maintaining persistent pain-like states. A descending facilitatory drive mediated through spinal 5-HT3 receptors (5-HT3Rs) originating from superficial dorsal horn NK1-expressing neurons and that relays through the parabrachial nucleus and the rostroventral medial medulla to act on deep dorsal horn neurons is known be important in maintaining these pain-like states. To determine if spinal rapamycin-sensitive pathways are activated by a descending serotonergic drive, we investigated the effects of spinally administered rapamycin on responses of deep dorsal horn neurons that had been pre-treated with the selective 5-HT3R antagonist ondansetron. We also investigated the effects of spinally administered cell cycle inhibitor (CCI)-779 (a rapamycin ester analogue) on deep dorsal horn neurons from rats with carrageenan-induced inflammation of the hind paw. Unlike some other models of persistent pain, this model does not involve an altered 5-HT3R-mediated descending serotonergic drive. We found that the inhibitory effects of rapamycin were significantly reduced for neuronal responses to mechanical and thermal stimuli when the spinal cord was pre-treated with ondansetron. Furthermore, CCI-779 was found to be ineffective in attenuating spinal neuronal responses to peripheral stimuli in carrageenan-treated rats. Therefore, we conclude that 5-HT3R-mediated descending facilitation is one requirement for activation of rapamycin-sensitive pathways that contribute to persistent pain-like states. PMID:20709148

  3. Rapamycin Eye Drops Suppress Lacrimal Gland Inflammation In a Murine Model of Sjögren's Syndrome

    Science.gov (United States)

    Shah, Mihir; Edman, Maria C.; Reddy Janga, Srikanth; Yarber, Frances; Meng, Zhen; Klinngam, Wannita; Bushman, Jonathan; Ma, Tao; Liu, Siyu; Louie, Stan; Mehta, Arjun; Ding, Chuanqing; MacKay, J. Andrew; Hamm-Alvarez, Sarah F.

    2017-01-01

    Purpose To evaluate the efficacy of topical rapamycin in treating autoimmune dacryoadenitis in a mouse model of Sjögren's syndrome. Methods We developed rapamycin in a poly(ethylene glycol)-distearoyl phosphatidylethanolamine (PEG-DSPE) micelle formulation to maintain solubility. Rapamycin or PEG-DSPE eye drops (vehicle) were administered in a well-established Sjögren's syndrome disease model, the male nonobese diabetic (NOD) mice, twice daily for 12 weeks starting at 8 weeks of age. Mouse tear fluid was collected and tear Cathepsin S, a putative tear biomarker for Sjögren's syndrome, was measured. Lacrimal glands were retrieved for histological evaluation, and quantitative real-time PCR of genes associated with Sjögren's syndrome pathogenesis. Tear secretion was measured using phenol red threads, and corneal fluorescein staining was used to assess corneal integrity. Results Lymphocytic infiltration of lacrimal glands from rapamycin-treated mice was significantly (P = 0.0001) reduced by 3.8-fold relative to vehicle-treated mice after 12 weeks of treatment. Rapamycin, but not vehicle, treatment increased tear secretion and decreased corneal fluorescein staining after 12 weeks. In rapamycin-treated mice, Cathepsin S activity was significantly reduced by 3.75-fold in tears (P eye. PMID:28122086

  4. Saccharomyces cerevisiae FKBP12 binds Arabidopsis thaliana TOR and its expression in plants leads to rapamycin susceptibility.

    Science.gov (United States)

    Sormani, Rodnay; Yao, Lei; Menand, Benoît; Ennar, Najla; Lecampion, Cécile; Meyer, Christian; Robaglia, Christophe

    2007-06-01

    The eukaryotic TOR pathway controls translation, growth and the cell cycle in response to environmental signals such as nutrients or growth-stimulating factors. The TOR protein kinase can be inactivated by the antibiotic rapamycin following the formation of a ternary complex between TOR, rapamycin and FKBP12 proteins. The TOR protein is also found in higher plants despite the fact that they are rapamycin insensitive. Previous findings using the yeast two hybrid system suggest that the FKBP12 plant homolog is unable to form a complex with rapamycin and TOR, while the FRB domain of plant TOR is still able to bind to heterologous FKBP12 in the presence of rapamycin. The resistance to rapamycin is therefore limiting the molecular dissection of the TOR pathway in higher plants. Here we show that none of the FKBPs from the model plant Arabidopsis (AtFKBPs) is able to form a ternary complex with the FRB domain of AtTOR in the presence of rapamycin in a two hybrid system. An antibody has been raised against the AtTOR protein and binding of recombinant yeast ScFKBP12 to native Arabidopsis TOR in the presence of rapamycin was demonstrated in pull-down experiments. Transgenic lines expressing ScFKBP12 were produced and were found to display a rapamycin-dependent reduction of the primary root growth and a lowered accumulation of high molecular weight polysomes. These results further strengthen the idea that plant resistance to rapamycin evolved as a consequence of mutations in plant FKBP proteins. The production of rapamycin-sensitive plants through the expression of the ScFKBP12 protein illustrates the conservation of the TOR pathway in eukaryotes. Since AtTOR null mutants were found to be embryo lethal 1, transgenic ScFKBP12 plants will provide an useful tool for the post-embryonic study of plant TOR functions. This work also establish for the first time a link between TOR activity and translation in plant cells.

  5. Saccharomyces cerevisiae FKBP12 binds Arabidopsis thaliana TOR and its expression in plants leads to rapamycin susceptibility

    Directory of Open Access Journals (Sweden)

    Meyer Christian

    2007-06-01

    Full Text Available Abstract Background The eukaryotic TOR pathway controls translation, growth and the cell cycle in response to environmental signals such as nutrients or growth-stimulating factors. The TOR protein kinase can be inactivated by the antibiotic rapamycin following the formation of a ternary complex between TOR, rapamycin and FKBP12 proteins. The TOR protein is also found in higher plants despite the fact that they are rapamycin insensitive. Previous findings using the yeast two hybrid system suggest that the FKBP12 plant homolog is unable to form a complex with rapamycin and TOR, while the FRB domain of plant TOR is still able to bind to heterologous FKBP12 in the presence of rapamycin. The resistance to rapamycin is therefore limiting the molecular dissection of the TOR pathway in higher plants. Results Here we show that none of the FKBPs from the model plant Arabidopsis (AtFKBPs is able to form a ternary complex with the FRB domain of AtTOR in the presence of rapamycin in a two hybrid system. An antibody has been raised against the AtTOR protein and binding of recombinant yeast ScFKBP12 to native Arabidopsis TOR in the presence of rapamycin was demonstrated in pull-down experiments. Transgenic lines expressing ScFKBP12 were produced and were found to display a rapamycin-dependent reduction of the primary root growth and a lowered accumulation of high molecular weight polysomes. Conclusion These results further strengthen the idea that plant resistance to rapamycin evolved as a consequence of mutations in plant FKBP proteins. The production of rapamycin-sensitive plants through the expression of the ScFKBP12 protein illustrates the conservation of the TOR pathway in eukaryotes. Since AtTOR null mutants were found to be embryo lethal 1, transgenic ScFKBP12 plants will provide an useful tool for the post-embryonic study of plant TOR functions. This work also establish for the first time a link between TOR activity and translation in plant cells

  6. KBERG: KnowledgeBase for Estrogen Responsive Genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam

    2007-01-01

    Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...

  7. The Two Translationally Controlled Tumor Protein Genes, CsTCTP1 and CsTCTP2, Are Negative Modulators in the Cucumis sativus Defense Response to Sphaerotheca fuliginea

    Directory of Open Access Journals (Sweden)

    Xiangnan Meng

    2018-04-01

    Full Text Available Pathogen stress often significantly decreases cucumber production. However, knowledge regarding the molecular mechanism and signals of cucumber disease resistance is far from complete. Here, we report two translationally controlled tumor protein genes, CsTCTP1 and CsTCTP2, that are both negative modulators in the Cucumis sativus defense response to Sphaerotheca fuliginea. Subcellular localization analysis showed that CsTCTP1 and CsTCTP2 were both localized in the cytoplasm. Expression analysis indicated that the transcript levels of CsTCTP1 and CsTCTP2 were linked to the degree of cucumber resistance to S. fuliginea. Transient overexpression of either CsTCTP1 or CsTCTP2 in cucumber cotyledons impaired resistance to S. fuliginea, whereas silencing of either CsTCTP1 or CsTCTP2 enhanced cucumber resistance to S. fuliginea. The relationship of several defense-related genes and ABA and target of rapamycin (TOR signaling pathway-related genes to the overexpressing and silencing of CsTCTP1/CsTCTP2 in non-infested cucumber plants was investigated. The results indicated that CsTCTP1 participates in the defense response to S. fuliginea by regulating the expression of certain defense-associated genes and/or ABA signaling pathway-associated genes, and CsTCTP2 participates through regulating the expression of TOR signaling pathway-associated genes. Our findings will guide enhancing the resistance of cucumber to powdery mildew.

  8. Synergistic Effect of Rapamycin and Metformin Against Age-Dependent Oxidative Stress in Rat Erythrocytes.

    Science.gov (United States)

    Singh, Abhishek Kumar; Garg, Geetika; Singh, Sandeep; Rizvi, Syed Ibrahim

    2017-10-01

    Erythrocytes are particularly vulnerable toward age-dependent oxidative stress-mediated damage. Caloric restriction mimetics (CRMs) may provide a novel strategy for the maintenance of redox balance as well as effective treatment of age-associated diseases. Herein, we have investigated the beneficial effect of cotreatment with CRM-candidate drugs, rapamycin (an immunosuppressant drug and inhibitor of mammalian target of rapamycin) and metformin (an antidiabetic biguanide and activator of adenosine monophosphate kinase), against aging-induced oxidative stress in erythrocytes and plasma of aging rats. Male Wistar rats of age 4 (young) and 24 months (old) were coexposed to rapamycin (0.5 mg/kg body weight [b.w.]) and metformin (300 mg/kg b.w.), and data were compared with the response of rats receiving an independent exposure to these chemicals at similar doses. The exposure of individual candidate drugs significantly reversed the age-dependent alterations in the endpoints associated with oxidative stress such as reactive oxygen species, ferric reducing ability of plasma, malondialdehyde, reduced glutathione, plasma membrane redox system, plasma protein carbonyl, and acetyl cholinesterase in erythrocytes and plasma of aging rats. However, the cotreatment with rapamycin and metformin showed a significant augmented effect compared with individual drug interventions on reversal of these age-dependent biomarkers of oxidative stress, suggesting a synergistic response. Thus, the findings open up further possibilities for the design of new combinatorial therapies to prevent oxidative stress- and age-associated health problems.

  9. Synthesis of I-125 labeled photoaffinity rapamycin analogs

    International Nuclear Information System (INIS)

    Shu, A.Y.L.; Yamashita, D.S.; Holt, D.A.; Heys, J.R.

    1996-01-01

    Two no-carrier-added 125 I-labelled photoaffinity rapamycin analogs were prepared: 7-demethoxy-7-(4-azido-3- 125 I-benzyloxy) rapamycin and its C 28 -C 29 seco analog. The key reactions of the synthesis were substitution of the C 7 methoxyl of rapamycin with 4-azido-3-tributylstannylbenzyloxy group, exchange of tributyltin with 125 I using Na 125 I and Chloramine-T, and a ZnCl 2 mediated retro-Aldol cleavage of the C 28 -C 29 bond of rapamycin. (author)

  10. Diurnal oscillations of soybean circadian clock and drought responsive genes.

    Directory of Open Access Journals (Sweden)

    Juliana Marcolino-Gomes

    Full Text Available Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i drought stress affects gene expression of circadian clock components and (ii several stress responsive genes display diurnal oscillation in soybeans.

  11. Mechanical activation of mammalian target of rapamycin pathway is required for cartilage development

    OpenAIRE

    Guan, Yingjie; Yang, Xu; Yang, Wentian; Charbonneau, Cherie; Chen, Qian

    2014-01-01

    Mechanical stress regulates development by modulating cell signaling and gene expression. However, the cytoplasmic components mediating mechanotransduction remain unclear. In this study, elimination of muscle contraction during chicken embryonic development resulted in a reduction in the activity of mammalian target of rapamycin (mTOR) in the cartilaginous growth plate. Inhibition of mTOR activity led to significant inhibition of chondrocyte proliferation, cartilage tissue growth, and express...

  12. HRGFish: A database of hypoxia responsive genes in fishes

    Science.gov (United States)

    Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo

    2017-02-01

    Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.

  13. DNA sequence responsible for the amplification of adjacent genes.

    Science.gov (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  14. Mammalian Target of Rapamycin Inhibition With Rapamycin Mitigates Radiation-Induced Pulmonary Fibrosis in a Murine Model

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Eun Joo [Radiation Oncology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); Sowers, Anastasia; Thetford, Angela [Radiation Biology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); McKay-Corkum, Grace; Chung, Su I. [Radiation Oncology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); Mitchell, James B. [Radiation Biology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States); Citrin, Deborah E., E-mail: citrind@mail.nih.gov [Radiation Oncology Branch, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland (United States)

    2016-11-15

    Purpose: Radiation-induced pulmonary fibrosis (RIPF) is a late toxicity of therapeutic radiation. Signaling of the mammalian target of rapamycin drives several processes implicated in RIPF, including inflammatory cytokine production, fibroblast proliferation, and epithelial senescence. We sought to determine if mammalian target of rapamycin inhibition with rapamycin would mitigate RIPF. Methods and Materials: C57BL/6NCr mice received a diet formulated with rapamycin (14 mg/kg food) or a control diet 2 days before and continuing for 16 weeks after exposure to 5 daily fractions of 6 Gy of thoracic irradiation. Fibrosis was assessed with Masson trichrome staining and hydroxyproline assay. Cytokine expression was evaluated by quantitative real-time polymerase chain reaction. Senescence was assessed by staining for β-galactosidase activity. Results: Administration of rapamycin extended the median survival of irradiated mice compared with the control diet from 116 days to 156 days (P=.006, log-rank test). Treatment with rapamycin reduced hydroxyproline content compared with the control diet (irradiation plus vehicle, 45.9 ± 11.8 μg per lung; irradiation plus rapamycin, 21.4 ± 6.0 μg per lung; P=.001) and reduced visible fibrotic foci. Rapamycin treatment attenuated interleukin 1β and transforming growth factor β induction in irradiated lungs compared with the control diet. Type II pneumocyte senescence after irradiation was reduced with rapamycin treatment at 16 weeks (3-fold reduction at 16 weeks, P<.001). Conclusions: Rapamycin protected against RIPF in a murine model. Rapamycin treatment reduced inflammatory cytokine expression, extracellular matrix production, and senescence in type II pneumocytes.

  15. Mechanisms of radiation-induced gene responses

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Paunesku, T.

    1996-01-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5' region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3' region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process

  16. Blocking mammalian target of rapamycin (mTOR improves neuropathic pain evoked by spinal cord injury

    Directory of Open Access Journals (Sweden)

    Wang Xiaoping

    2016-01-01

    Full Text Available Spinal cord injury (SCI is an extremely serious type of physical trauma observed in clinics. Neuropathic pain resulting from SCI has a lasting and significant impact on most aspects of daily life. Thus, a better understanding of the molecular pathways responsible for the cause of neuropathic pain observed in SCI is important to develop effective therapeutic agents and treatment strategies. Mammalian target of rapamycin (mTOR is a serine/threonine protein kinase that is well known for its critical roles in regulating protein synthesis and growth. Furthermore, compelling evidence supports the notion that widespread dysregulation of mTOR and its downstream pathways are involved in neuropathic pain. Thus, in this study we specifically examined the underlying mechanisms by which mTOR and its signaling pathways are involved in SCI-evoked neuropathic pain in a rat model. Overall, we demonstrated that SCI increased the protein expression of p-mTOR, and mTORmediated- phosphorylation of 4E–binding protein 4 (4E-BP1 and p70 ribosomal S6 protein kinase 1 (S6K1 in the superficial dorsal horn of the spinal cord. Also, we showed that blocking spinal mTOR by intrathecal injection of rapamycin significantly inhibited pain responses induced by mechanical and thermal stimulation. In addition, blocking spinal phosphatidylinositide 3-kinase (p-PI3K pathway significantly attenuated activities of p-mTOR pathways as well as mechanical and thermal hyperalgesia in SCI rats. Moreover, blocking mTOR and PI3K decreased the enhanced levels of substance P and calcitonin gene-related peptide (CGRP in the dorsal horn of SCI rats. We revealed specific signaling pathways leading to SCI-evoked neuropathic pain, including the activation of PI3K, mTOR and its downstream signaling pathways. Targeting one or more of these signaling molecules may present new opportunities for treatment and management of neuropathic pain often observed in patients with SCI.

  17. Computational method for discovery of estrogen responsive genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar

    2004-01-01

    Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...

  18. Host genetic variation influences gene expression response to rhinovirus infection.

    Directory of Open Access Journals (Sweden)

    Minal Çalışkan

    2015-04-01

    Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  19. Host genetic variation influences gene expression response to rhinovirus infection.

    Science.gov (United States)

    Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole

    2015-04-01

    Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  20. T-cell activation and early gene response in dogs.

    Directory of Open Access Journals (Sweden)

    Sally-Anne Mortlock

    Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in

  1. Potential use of rapamycin in HIV infection

    DEFF Research Database (Denmark)

    Donia, Marco; McCubrey, James A; Bendtzen, Klaus

    2010-01-01

    The strong need for the development of alternative anti-HIV agents is primarily due to the emergence of strain-resistant viruses, the need for sustained adherence to complex treatment regimens and the toxicity of currently used antiviral drugs. This review analyzes proof of concept studies...... indicating that the immunomodulatory drug rapamycin (RAPA) possesses anti-HIV properties both in vitro and in vivo that qualifies it as a potential new anti-HIV drug. It represents a literature review of published studies that evaluated the in vitro and in vivo activity of RAPA in HIV. RAPA represses HIV-1...... replication in vitro through different mechanisms including, but not limited, to down regulation of CCR5. In addition RAPA synergistically enhances the anti-HIV activity of entry inhibitors such as vicriviroc, aplaviroc and enfuvirtide in vitro. RAPA also inhibits HIV-1 infection in human peripheral blood...

  2. Potential use of rapamycin in HIV infection

    DEFF Research Database (Denmark)

    Donia, Marco; McCubrey, James A; Bendtzen, Klaus

    2010-01-01

    The strong need for the development of alternative anti-HIV agents is primarily due to the emergence of strain-resistant viruses, the need for sustained adherence to complex treatment regimens and the toxicity of currently used antiviral drugs. This review analyzes proof of concept studies......, the evidence presented in this review suggests that RAPA may be a useful drug that should be evaluated for the prevention and treatment of HIV-1 infection....... indicating that the immunomodulatory drug rapamycin (RAPA) possesses anti-HIV properties both in vitro and in vivo that qualifies it as a potential new anti-HIV drug. It represents a literature review of published studies that evaluated the in vitro and in vivo activity of RAPA in HIV. RAPA represses HIV-1...

  3. Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.

    Science.gov (United States)

    Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang

    2018-03-08

    The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.

  4. Rapamycin suppresses brain aging in senescence-accelerated OXYS rats.

    Science.gov (United States)

    Kolosova, Nataliya G; Vitovtov, Anton O; Muraleva, Natalia A; Akulov, Andrey E; Stefanova, Natalia A; Blagosklonny, Mikhail V

    2013-06-01

    Cellular and organismal aging are driven in part by the MTOR (mechanistic target of rapamycin) pathway and rapamycin extends life span inC elegans, Drosophila and mice. Herein, we investigated effects of rapamycin on brain aging in OXYS rats. Previously we found, in OXYS rats, an early development of age-associated pathological phenotypes similar to several geriatric disorders in humans, including cerebral dysfunctions. Behavioral alterations as well as learning and memory deficits develop by 3 months. Here we show that rapamycin treatment (0.1 or 0.5 mg/kg as a food mixture daily from the age of 1.5 to 3.5 months) decreased anxiety and improved locomotor and exploratory behavior in OXYS rats. In untreated OXYS rats, MRI revealed an increase of the area of hippocampus, substantial hydrocephalus and 2-fold increased area of the lateral ventricles. Rapamycin treatment prevented these abnormalities, erasing the difference between OXYS and Wister rats (used as control). All untreated OXYS rats showed signs of neurodegeneration, manifested by loci of demyelination. Rapamycin decreased the percentage of animals with demyelination and the number of loci. Levels of Tau and phospho-Tau (T181) were increased in OXYS rats (compared with Wistar). Rapamycin significantly decreased Tau and inhibited its phosphorylation in the hippocampus of OXYS and Wistar rats. Importantly, rapamycin treatment caused a compensatory increase in levels of S6 and correspondingly levels of phospo-S6 in the frontal cortex, indicating that some downstream events were compensatory preserved, explaining the lack of toxicity. We conclude that rapamycin in low chronic doses can suppress brain aging.

  5. Development of a radiation-responsive gene expression system

    International Nuclear Information System (INIS)

    Ogawa, Ryohei; Morii, Akihiro; Watanabe, Akihiko

    2013-01-01

    We have obtained a promoter enhancing expression of a gene of our interest connected downstream after activation in response to radiation stimulation and it could be used in radiogenetic therapy, a combination between radiotherapy and gene therapy. The promoter has been chosen out of a library of DNA fragments constructed by connecting the TATA box to randomly combined binding sequences of transcription factors that are activated in response to radiation. Although it was shown that the promoter activation was cell type specific, it turned out that radiation responsive promoters could be obtained for a different type of cells by using another set of transcription factor binding sequences, suggesting that the method would be feasible to obtain promoters functioning in any type of cells. Radiation reactivity of obtained promoters could be improved by techniques such as random introduction of point mutations. The improved promoters significantly enhanced expression of the luciferase gene connected downstream in response to radiation even in vivo, in addition, a gene cassette composed of one such promoter and the fcy::fur gene was confirmed useful for suicide gene therapy as shown in vitro simulation experiment, suggesting possible clinical application. (author)

  6. Construction of a mutant of Actinoplanes sp. N902-109 that produces a new rapamycin analog.

    Science.gov (United States)

    Huang, He; Gao, Ping; Zhao, Qi; Hu, Hai-Feng

    2018-03-01

    In the present study, we introduced point mutations into Ac_rapA which encodes a polyketide synthase responsible for rapamycin biosynthesis in Actinoplanes sp. N902-109, in order to construct a mutant with an inactivated enoylreductase (ER) domain, which was able to synthesize a new rapamycin analog. Based on the homologous recombination induced by double-strand breaks in chromosome mediated by endonuclease I-SceI, the site-directed mutation in the first ER domain of Ac_rapA was introduced using non-replicating plasmid pLYERIA combined with an I-SceI expression plasmid. Three amino acid residues of the active center, Ala-Gly-Gly, were converted to Ala-Ser-Pro. The broth of the mutant strain SIPI-027 was analyzed by HPLC and a new peak with the similar UV spectrum to that of rapamycin was found. The sample of the new peak was prepared by solvent extraction, column chromatography, and crystallization methods. The structure of new compound, named as SIPI-rapxin, was elucidated by determining and analyzing its MS and NMR spectra and its biological activity was assessed using mixed lymphocyte reaction (MLR). An ER domain-deficient mutant of Actinoplanes sp. N902-109, named as SIPI-027, was constructed, which produced a novel rapamycin analog SIPI-rapxin and its structure was elucidated to be 35, 36-didehydro-27-O-demethylrapamycin. The biological activity of SIPI-rapxin was better than that of rapamycin. In conclusion, inactivation of the first ER domain of rapA, one of the modular polyketide synthase responsible for macro-lactone synthesis of rapamycin, gave rise to a mutant capable of producing a novel rapamycin analog, 35, 36-didehydro-27-O-demethylrapamycin, demonstrating that the enoylreductase domain was responsible for the reduction of the double bond between C-35 and C-36 during rapamycin synthesis. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  7. Biphasic Rapamycin Effects in Lymphoma and Carcinoma Treatment.

    Science.gov (United States)

    Liu, Yang; Pandeswara, Srilakshmi; Dao, Vinh; Padrón, Álvaro; Drerup, Justin M; Lao, Shunhua; Liu, Aijie; Hurez, Vincent; Curiel, Tyler J

    2017-01-15

    mTOR drives tumor growth but also supports T-cell function, rendering the applications of mTOR inhibitors complex especially in T-cell malignancies. Here, we studied the effects of the mTOR inhibitor rapamycin in mouse EL4 T-cell lymphoma. Typical pharmacologic rapamycin (1-8 mg/kg) significantly reduced tumor burden via direct suppression of tumor cell proliferation and improved survival in EL4 challenge independent of antitumor immunity. Denileukin diftitox (DD)-mediated depletion of regulatory T cells significantly slowed EL4 growth in vivo in a T-cell-dependent fashion. However, typical rapamycin inhibited T-cell activation and tumor infiltration in vivo and failed to boost DD treatment effects. Low-dose (LD) rapamycin (75 μg/kg) increased potentially beneficial CD44hiCD62L + CD8 + central memory T cells in EL4 challenge, but without clinical benefit. LD rapamycin significantly enhanced DD treatment efficacy, but DD plus LD rapamycin treatment effects were independent of antitumor immunity. Instead, rapamycin upregulated EL4 IL2 receptor in vitro and in vivo, facilitating direct DD tumor cell killing. LD rapamycin augmented DD efficacy against B16 melanoma and a human B-cell lymphoma, but not against human Jurkat T-cell lymphoma or ID8agg ovarian cancer cells. Treatment effects correlated with IL2R expression, but mechanisms in some tumors were not fully defined. Overall, our data define a distinct, biphasic mechanisms of action of mTOR inhibition at doses that are clinically exploitable, including in T-cell lymphomas. Cancer Res; 77(2); 520-31. ©2016 AACR. ©2016 American Association for Cancer Research.

  8. Macrophage Expression of Inflammatory Genes in Response to EMCV Infection

    Directory of Open Access Journals (Sweden)

    Zachary R. Shaheen

    2015-08-01

    Full Text Available The expression and production of type 1 interferon is the classic cellular response to virus infection. In addition to this antiviral response, virus infection also stimulates the production of proinflammatory mediators. In this review, the pathways controlling the induction of inflammatory genes and the roles that these inflammatory mediators contribute to host defense against viral pathogens will be discussed. Specific focus will be on the role of the chemokine receptor CCR5, as a signaling receptor controlling the activation of pathways leading to virus-induced inflammatory gene expression.

  9. Estrogen-Responsive Genes Overlap with Triiodothyronine-Responsive Genes in a Breast Carcinoma Cell Line

    Directory of Open Access Journals (Sweden)

    Nancy Bueno Figueiredo

    2014-01-01

    Full Text Available It has been well established that estrogen plays an important role in the progression and treatment of breast cancer. However, the role of triiodothyronine (T3 remains controversial. We have previously shown its capacity to stimulate the development of positive estrogen receptor breast carcinoma, induce the expression of genes (PR, TGF-alpha normally stimulated by estradiol (E2, and suppress genes (TGF-beta normally inhibited by E2. Since T3 regulates growth hormones, metabolism, and differentiation, it is important to verify its action on other genes normally induced by E2. Therefore, we used DNA microarrays to compare gene expression patterns in MCF-7 breast adenocarcinoma cells treated with E2 and T3. Several genes were modulated by both E2 and T3 in MCF-7 cells (Student’s t-test, P 2.0, pFDR < 0.05. We confirmed our microarray results by real-time PCR. Our findings reveal that certain genes in MCF-7 cells can be regulated by both E2 and T3.

  10. Faba bean drought responsive gene identification and validation

    Directory of Open Access Journals (Sweden)

    Megahed H. Ammar

    2017-01-01

    Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.

  11. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... Molecular responses and expression analysis of genes in a xerophytic desert shrub Haloxylon ammodendron .... physiological determination and cDNA-AFLP analysis, three groups of seeds were sowed in pots with sand and .... HaDR27. U. 234. PDR-like ABC transporter. AT1G59870. HaDR28. U. 135.

  12. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    Haloxylon ammodendron (C.A Mey.) Bunge is a xero-halophytic desert shrub with excellent drought resistance and salt tolerance. To decipher the molecular responses involved in its drought resistance, the cDNA-AFLP (amplified fragment length polymorphism) technique was employed to identify genes expressed ...

  13. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  14. Transcriptional Response of Selenopolypeptide Genes and Selenocysteine Biosynthesis Machinery Genes in Escherichia coli during Selenite Reduction.

    Science.gov (United States)

    Tetteh, Antonia Y; Sun, Katherine H; Hung, Chiu-Yueh; Kittur, Farooqahmed S; Ibeanu, Gordon C; Williams, Daniel; Xie, Jiahua

    2014-01-01

    Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se(0)), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼ 50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼ 30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.

  15. Transcriptional Response of Selenopolypeptide Genes and Selenocysteine Biosynthesis Machinery Genes in Escherichia coli during Selenite Reduction

    Directory of Open Access Journals (Sweden)

    Antonia Y. Tetteh

    2014-01-01

    Full Text Available Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se0, but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3 treatment and then used quantitative real-time PCR (qRT-PCR to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.

  16. Gene expression of corals in response to macroalgal competitors.

    Directory of Open Access Journals (Sweden)

    Tonya L Shearer

    Full Text Available As corals decline and macroalgae proliferate on coral reefs, coral-macroalgal competition becomes more frequent and ecologically important. Whether corals are damaged by these interactions depends on susceptibility of the coral and traits of macroalgal competitors. Investigating changes in gene expression of corals and their intracellular symbiotic algae, Symbiodinium, in response to contact with different macroalgae provides insight into the biological processes and cellular pathways affected by competition with macroalgae. We evaluated the gene expression profiles of coral and Symbiodinium genes from two confamilial corals, Acropora millepora and Montipora digitata, after 6 h and 48 h of contact with four common macroalgae that differ in their allelopathic potency to corals. Contacts with macroalgae affected different biological pathways in the more susceptible (A. millepora versus the more resistant (M. digitata coral. Genes of coral hosts and of their associated Symbiodinium also responded in species-specific and time-specific ways to each macroalga. Changes in number and expression intensity of affected genes were greater after 6 h compared to 48 h of contact and were greater following contact with Chlorodesmis fastigiata and Amphiroa crassa than following contact with Galaxaura filamentosa or Turbinaria conoides. We documented a divergence in transcriptional responses between two confamilial corals and their associated Symbiodinium, as well as a diversity of dynamic responses within each coral species with respect to the species of macroalgal competitor and the duration of exposure to that competitor. These responses included early initiation of immune processes by Montipora, which is more resistant to damage after long-term macroalgal contact. Activation of the immune response by corals that better resist algal competition is consistent with the hypothesis that some macroalgal effects on corals may be mediated by microbial pathogens.

  17. Stochastic biological response to radiation. Comprehensive analysis of gene expression

    International Nuclear Information System (INIS)

    Inoue, Tohru; Hirabayashi, Yoko

    2012-01-01

    Authors explain that the radiation effect on biological system is stochastic along the law of physics, differing from chemical effect, using instances of Cs-137 gamma-ray (GR) and benzene (BZ) exposures to mice and of resultant comprehensive analyses of gene expression. Single GR irradiation is done with Gamma Cell 40 (CSR) to C57BL/6 or C3H/He mouse at 0, 0.6 and 3 Gy. BE is given orally at 150 mg/kg/day for 5 days x 2 weeks. Bone marrow cells are sampled 1 month after the exposure. Comprehensive gene expression is analyzed by Gene Chip Mouse Genome 430 2.0 Array (Affymetrix) and data are processed by programs like case normalization, statistics, network generation, functional analysis etc. GR irradiation brings about changes of gene expression, which are classifiable in common genes variable commonly on the dose change and stochastic genes variable stochastically within each dose: e.g., with Welch-t-test, significant differences are between 0/3 Gy (dose-specific difference, 455 pbs (probe set), in stochastic 2113 pbs), 0/0.6 Gy (267 in 1284 pbs) and 0.6/3 Gy (532 pbs); and with one-way analysis of variation (ANOVA) and hierarchial/dendrographic analyses, 520 pbs are shown to involve the dose-dependent 226 and dose-specific 294 pbs. It is also shown that at 3 Gy, expression of common genes are rather suppressed, including those related to the proliferation/apoptosis of B/T cells, and of stochastic genes, related to cell division/signaling. Ven diagram of the common genes of above 520 pbs, stochastic 2113 pbs at 3 Gy and 1284 pbs at 0.6 Gy shows the overlapping genes 29, 2 and 4, respectively, indicating only 35 pbs are overlapping in total. Network analysis of changes by GR shows the rather high expression of genes around hub of cAMP response element binding protein (CREB) at 0.6 Gy, and rather variable expression around CREB hub/suppressed expression of kinesin hub at 3 Gy; in the network by BZ exposure, unchanged or low expression around p53 hub and suppression

  18. Gene expression in epithelial cells in response to pneumovirus infection

    Directory of Open Access Journals (Sweden)

    Rosenberg Helene F

    2001-05-01

    Full Text Available Abstract Respiratory syncytial virus (RSV and pneumonia virus of mice (PVM are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner.

  19. Oxytocin receptor gene variation predicts subjective responses to MDMA.

    Science.gov (United States)

    Bershad, Anya K; Weafer, Jessica J; Kirkpatrick, Matthew G; Wardle, Margaret C; Miller, Melissa A; de Wit, Harriet

    2016-12-01

    3,4-Methylenedioxymethamphetamine (MDMA, "ecstasy") enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug.

  20. Beneficial role of rapamycin in experimental autoimmune myositis.

    Directory of Open Access Journals (Sweden)

    Nicolas Prevel

    Full Text Available We developed an experimental autoimmune myositis (EAM mouse model of polymyositis where we outlined the role of regulatory T (Treg cells. Rapamycin, this immunosuppressant drug used to prevent rejection in organ transplantation, is known to spare Treg. Our aim was to test the efficacy of rapamycin in vivo in this EAM model and to investigate the effects of the drug on different immune cell sub-populations.EAM is induced by 3 injections of myosin emulsified in CFA. Mice received rapamycin during 25 days starting one day before myosin immunization (preventive treatment, or during 10 days following the last myosin immunization (curative treatment.Under preventive or curative treatment, an increase of muscle strength was observed with a parallel decrease of muscle inflammation, both being well correlated (R(2 = -0.645, p<0.0001. Rapamycin induced a general decrease in muscle of CD4 and CD8 T cells in lymphoid tissues, but spared B cells. Among T cells, the frequency of Treg was increased in rapamycin treated mice in draining lymph nodes (16.9 ± 2.2% vs. 9.3 ± 1.4%, p<0.001, which were mostly activated regulatory T cells (CD62L(lowCD44(high: 58.1 ± 5.78% vs. 33.1 ± 7%, treated vs. untreated, p<0.001. In rapamycin treated mice, inhibition of proliferation (Ki-67(+ is more important in effector T cells compared to Tregs cells (p<0.05. Furthermore, during preventive treatment, rapamycin increased the levels of KLF2 transcript in CD44(low CD62L(high naive T cell and in CD62L(low CD44(high activated T cell.Rapamycin showed efficacy both as curative and preventive treatment in our murine model of experimental myositis, in which it induced an increase of muscle strength with a parallel decrease in muscle inflammation. Rapamycin administration was also associated with a decrease in the frequency of effector T cells, an increase in Tregs, and, when administered as preventive treatment, an upregulation of KFL2 in naive and activated T cells.

  1. Moderation of antidepressant response by the serotonin transporter gene

    DEFF Research Database (Denmark)

    Huezo-Diaz, Patricia; Uher, Rudolf; Smith, Rebecca

    2009-01-01

    Background: There have been conflicting reports on whether the length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) moderates the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs). We hypothesised that the pharmacogenetic effect of 5-HTTLPR...... the serotonin transporter gene were genotyped in 795 adults with moderate-to-severe depression treated with escitalopram or nortriptyline in the Genome Based Therapeutic Drugs for Depression (GENDEP) project. Results: The 5-HTTLPR moderated the response to escitalopram, with long-allele carriers improving more...

  2. Enhanced genetic modification of adult growth factor mobilized peripheral blood hematopoietic stem and progenitor cells with rapamycin.

    Science.gov (United States)

    Li, Lijing; Torres-Coronado, Mónica; Gu, Angel; Rao, Anitha; Gardner, Agnes M; Epps, Elizabeth W; Gonzalez, Nancy; Tran, Chy-Anh; Wu, Xiwei; Wang, Jin-Hui; DiGiusto, David L

    2014-10-01

    Genetic modification of adult human hematopoietic stem and progenitor cells (HSPCs) with lentiviral vectors leads to long-term gene expression in the progeny of the HSPCs and has been used to successfully treat several monogenic diseases. In some cases, the gene-modified cells have a selective growth advantage over nonmodified cells and eventually are the dominant engrafted population. However, in disease indications for which the gene-modified cells do not have a selective advantage, optimizing transduction of HSPC is paramount to successful stem cell-based gene therapy. We demonstrate here that transduction of adult CD34+ HSPCs with lentiviral vectors in the presence of rapamycin, a widely used mTORC1 inhibitor, results in an approximately threefold increase in stable gene marking with minimal effects on HSPC growth and differentiation. Using this approach, we have demonstrated that we can enhance the frequency of gene-modified HSPCs that give rise to clonogenic progeny in vitro without excessive increases in the number of vector copies per cell or changes in integration pattern. The genetic marking of HSPCs and expression of transgenes is durable, and transplantation of gene-modified HSPCs into immunodeficient mice results in high levels of gene marking of the lymphoid and myeloid progeny in vivo. The prior safe clinical history of rapamycin in other applications supports the use of this compound to generate gene-modified autologous HSPCs for our HIV gene therapy clinical trials. ©AlphaMed Press.

  3. Synergism between the mTOR inhibitor rapamycin and FAK down-regulation in the treatment of acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Pei-Jie Shi

    2016-02-01

    Full Text Available Abstract Background Acute lymphoblastic leukemia (ALL is an aggressive malignant disorder of lymphoid progenitor cells in both children and adults. Although improvements in contemporary therapy and development of new treatment strategies have led to dramatic increases in the cure rate in children with ALL, the relapse rate remains high and the prognosis of relapsed childhood ALL is poor. Molecularly targeted therapies have emerged as the leading treatments in cancer therapy. Multi-cytotoxic drug regimens have achieved success, yet many studies addressing targeted therapies have focused on only one single agent. In this study, we attempted to investigate whether the effect of the mammalian target of rapamycin (mTOR inhibitor rapamycin is synergistic with the effect of focal adhesion kinase (FAK down-regulation in the treatment of ALL. Methods The effect of rapamycin combined with FAK down-regulation on cell proliferation, the cell cycle, and apoptosis was investigated in the human precursor B acute lymphoblastic leukemia cells REH and on survival time and leukemia progression in a non-obese diabetic/severe combined immunodeficiency (NOD/SCID mouse model. Results When combined with FAK down-regulation, rapamycin-induced suppression of cell proliferation, G0/G1 cell cycle arrest, and apoptosis were significantly enhanced. In addition, REH cell-injected NOD/SCID mice treated with rapamycin and a short-hairpin RNA (shRNA to down-regulate FAK had significantly longer survival times and slower leukemia progression compared with mice injected with REH-empty vector cells and treated with rapamycin. Moreover, the B-cell CLL/lymphoma-2 (BCL-2 gene family was shown to be involved in the enhancement, by combined treatment, of REH cell apoptosis. Conclusions FAK down-regulation enhanced the in vitro and in vivo inhibitory effects of rapamycin on REH cell growth, indicating that the simultaneous targeting of mTOR- and FAK-related pathways might offer a novel

  4. The mTOR inhibitor rapamycin has limited acute anticonvulsant effects in mice.

    Directory of Open Access Journals (Sweden)

    Adam L Hartman

    Full Text Available The mammalian target of rapamycin (mTOR pathway integrates signals from different nutrient sources, including amino acids and glucose. Compounds that inhibit mTOR kinase activity such as rapamycin and everolimus can suppress seizures in some chronic animal models and in patients with tuberous sclerosis. However, it is not known whether mTOR inhibitors exert acute anticonvulsant effects in addition to their longer term antiepileptogenic effects. To gain insights into how rapamycin suppresses seizures, we investigated the anticonvulsant activity of rapamycin using acute seizure tests in mice.Following intraperitoneal injection of rapamycin, normal four-week-old male NIH Swiss mice were evaluated for susceptibility to a battery of acute seizure tests similar to those currently used to screen potential therapeutics by the US NIH Anticonvulsant Screening Program. To assess the short term effects of rapamycin, mice were seizure tested in ≤ 6 hours of a single dose of rapamycin, and for longer term effects of rapamycin, mice were tested after 3 or more daily doses of rapamycin.The only seizure test where short-term rapamycin treatment protected mice was against tonic hindlimb extension in the MES threshold test, though this protection waned with longer rapamycin treatment. Longer term rapamycin treatment protected against kainic acid-induced seizure activity, but only at late times after seizure onset. Rapamycin was not protective in the 6 Hz or PTZ seizure tests after short or longer rapamycin treatment times. In contrast to other metabolism-based therapies that protect in acute seizure tests, rapamycin has limited acute anticonvulsant effects in normal mice.The efficacy of rapamycin as an acute anticonvulsant agent may be limited. Furthermore, the combined pattern of acute seizure test results places rapamycin in a third category distinct from both fasting and the ketogenic diet, and which is more similar to drugs acting on sodium channels.

  5. Prevention of age-related macular degeneration-like retinopathy by rapamycin in rats.

    Science.gov (United States)

    Kolosova, Nataliya G; Muraleva, Natalia A; Zhdankina, Anna A; Stefanova, Natalia A; Fursova, Anzhela Z; Blagosklonny, Mikhail V

    2012-08-01

    Age-related macular degeneration, a neurodegenerative and vascular retinal disease, is the most common cause of blindness in the Western countries. Evidence accumulates that target of rapamycin is involved in aging and age-related diseases, including neurodegeneration. The target of rapamycin inhibitor, rapamycin, suppresses the senescent cell phenotype and extends life span in diverse species, including mice. Rapamycin decreases senescence-associated phenotypes in retinal pigment epithelial cells in culture. Herein, we investigated the effect of rapamycin on spontaneous retinopathy in senescence-accelerated OXYS rats, an animal model of age-related macular degeneration. Rats were treated with either 0.1 or 0.5 mg/kg rapamycin, which was given orally as a food mixture. In a dose-dependent manner, rapamycin decreased the incidence and severity of retinopathy. Rapamycin improved some (but not all) histological abnormalities associated with retinopathy. Thus, in retinal pigment epithelial cell layers, rapamycin decreased nuclei heterogeneity and normalized intervals between nuclei. In photoreceptor cells, associated neurons, and radial glial cells, rapamycin prevented nuclear and cellular pyknosis. More important, rapamycin prevented destruction of ganglionar neurons in the retina. Rapamycin did not exert any adverse effects on the retina in control disease-free Wistar rats. Taken together, our data suggest the therapeutic potential of rapamycin for treatment and prevention of retinopathy. Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  6. Stress, and pathogen response gene expression in modeled microgravity

    Science.gov (United States)

    Sundaresan, Alamelu; Pellis, Neal R.

    2006-01-01

    Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and

  7. Dose response relationship in anti-stress gene regulatory networks.

    Science.gov (United States)

    Zhang, Qiang; Andersen, Melvin E

    2007-03-02

    To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products) in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear) depends on changes in the specific values of local response coefficients (gains) distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear, and depending on

  8. Dose response relationship in anti-stress gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2007-03-01

    Full Text Available To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear depends on changes in the specific values of local response coefficients (gains distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear

  9. Immunoglobulin gene usage in the human anti-pathogen response.

    Science.gov (United States)

    Newkirk, M M; Rioux, J D

    1995-09-01

    The human antibody response to foreign pathogens is generated to a relatively small number of target surface proteins and carbohydrates that nonetheless have an extensive array of epitopes. The study of human monoclonal antibodies to different pathogens shows that there are a diversity of mechanisms used to generate a sufficient repertoire of antibodies to combat the invading pathogens. Although many different immunoglobulin gene elements are used to construct the anti-pathogen response, some elements are used more often than would be expected if all elements were used randomly. For example, the immune response to Haemophilus influenzae polysaccharide appears to be quite narrow, being restricted primarily to a specific heavy-chain gene, 3-15, and a lambda light-chain family II member, 4A. In contrast, for the immune response to cytomegalovirus proteins, a wider group of gene elements is needed. It is also surprising that despite an investigator bias for IgG- rather than IgM-secreting immortal B cells (because of their high affinity and neutralizing abilities), 26% of light chains and 13% of heavy chains showed a very low level of somatic mutation, equivalent to an IgM molecule that has not undergone affinity maturation. Although some highly mutated IgG molecules are present in the anti-pathogen response, most of the monoclonal antibodies specific for viruses or bacteria have a level of somatic hypermutation similar to that of the adult IgM repertoire. A number of studies have shown that there are similarities in the antibody responses to pathogens and to self (autoantibodies).(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Transcriptomic analysis of salt stress responsive genes in Rhazya stricta.

    Directory of Open Access Journals (Sweden)

    Nahid H Hajrah

    Full Text Available Rhazya stricta is an evergreen shrub that is widely distributed across Western and South Asia, and like many other members of the Apocynaceae produces monoterpene indole alkaloids that have anti-cancer properties. This species is adapted to very harsh desert conditions making it an excellent system for studying tolerance to high temperatures and salinity. RNA-Seq analysis was performed on R. stricta exposed to severe salt stress (500 mM NaCl across four time intervals (0, 2, 12 and 24 h to examine mechanisms of salt tolerance. A large number of transcripts including genes encoding tetrapyrroles and pentatricopeptide repeat (PPR proteins were regulated only after 12 h of stress of seedlings grown in controlled greenhouse conditions. Mechanisms of salt tolerance in R. stricta may involve the upregulation of genes encoding chaperone protein Dnaj6, UDP-glucosyl transferase 85a2, protein transparent testa 12 and respiratory burst oxidase homolog protein b. Many of the highly-expressed genes act on protecting protein folding during salt stress and the production of flavonoids, key secondary metabolites in stress tolerance. Other regulated genes encode enzymes in the porphyrin and chlorophyll metabolic pathway with important roles during plant growth, photosynthesis, hormone signaling and abiotic responses. Heme biosynthesis in R. stricta leaves might add to the level of salt stress tolerance by maintaining appropriate levels of photosynthesis and normal plant growth as well as by the participation in reactive oxygen species (ROS production under stress. We speculate that the high expression levels of PPR genes may be dependent on expression levels of their targeted editing genes. Although the results of PPR gene family indicated regulation of a large number of transcripts under salt stress, PPR actions were independent of the salt stress because their RNA editing patterns were unchanged.

  11. Characterization of the metabolic phenotype of rapamycin-treated CD8+ T cells with augmented ability to generate long-lasting memory cells.

    Directory of Open Access Journals (Sweden)

    Shan He

    Full Text Available BACKGROUND: Cellular metabolism plays a critical role in regulating T cell responses and the development of memory T cells with long-term protections. However, the metabolic phenotype of antigen-activated T cells that are responsible for the generation of long-lived memory cells has not been characterized. DESIGN AND METHODS: Using lymphocytic choriomeningitis virus (LCMV peptide gp33-specific CD8(+ T cells derived from T cell receptor transgenic mice, we characterized the metabolic phenotype of proliferating T cells that were activated and expanded in vitro in the presence or absence of rapamycin, and determined the capability of these rapamycin-treated T cells to generate long-lived memory cells in vivo. RESULTS: Antigen-activated CD8(+ T cells treated with rapamycin gave rise to 5-fold more long-lived memory T cells in vivo than untreated control T cells. In contrast to that control T cells only increased glycolysis, rapamycin-treated T cells upregulated both glycolysis and oxidative phosphorylation (OXPHOS. These rapamycin-treated T cells had greater ability than control T cells to survive withdrawal of either glucose or growth factors. Inhibition of OXPHOS by oligomycin significantly reduced the ability of rapamycin-treated T cells to survive growth factor withdrawal. This effect of OXPHOS inhibition was accompanied with mitochondrial hyperpolarization and elevation of reactive oxygen species that are known to be toxic to cells. CONCLUSIONS: Our findings indicate that these rapamycin-treated T cells may represent a unique cell model for identifying nutrients and signals critical to regulating metabolism in both effector and memory T cells, and for the development of new methods to improve the efficacy of adoptive T cell cancer therapy.

  12. Bone growth during rapamycin therapy in young rats

    Directory of Open Access Journals (Sweden)

    He Yu-Zhu

    2009-01-01

    Full Text Available Abstract Background Rapamycin is an effective immunosuppressant widely used to maintain the renal allograft in pediatric patients. Linear growth may be adversely affected in young children since rapamycin has potent anti-proliferative and anti-angiogenic properties. Methods Weanling three week old rats were given rapamycin at 2.5 mg/kg daily by gavage for 2 or 4 weeks and compared to a Control group given equivalent amount of saline. Morphometric measurements and biochemical determinations for serum calcium, phosphate, iPTH, urea nitrogen, creatinine and insulin-growth factor I (IGF-I were obtained. Histomorphometric analysis of the growth plate cartilage, in-situ hybridization experiments and immunohistochemical studies for various proteins were performed to evaluate for chondrocyte proliferation, chondrocyte differentiation and chondro/osteoclastic resorption. Results At the end of the 2 weeks, body and tibia length measurements were shorter after rapamycin therapy associated with an enlargement of the hypertrophic zone in the growth plate cartilage. There was a decrease in chondrocyte proliferation assessed by histone-4 and mammalian target of rapamycin (mTOR expression. A reduction in parathyroid hormone/parathyroid hormone related peptide (PTH/PTHrP and an increase in Indian hedgehog (Ihh expression may explain in part, the increase number of hypertrophic chondrocytes. The number of TRAP positive multinucleated chondro/osteoclasts declined in the chondro-osseous junction with a decrease in the receptor activator of nuclear factor kappa β ligand (RANKL and vascular endothelial growth factor (VEGF expression. Although body and tibial length remained short after 4 weeks of rapamycin, changes in the expression of chondrocyte proliferation, chondrocyte differentiation and chondro/osteoclastic resorption which were significant after 2 weeks of rapamycin improved at the end of 4 weeks. Conclusion When given to young rats, 2 weeks of rapamycin

  13. Mammalian target of rapamycin activity is required for expansion of CD34(+) hematopoietic progenitor cells

    NARCIS (Netherlands)

    Geest, Christian R.; Zwartkruis, Fried J.; Vellenga, Edo; Coffer, Paul J.; Buitenhuis, Miranda

    Background The mammalian target of rapamycin is a conserved protein kinase known to regulate protein synthesis, cell size and proliferation. Aberrant regulation of mammalian target of rapamycin activity has been observed in hematopoietic malignancies, including acute leukemias and myelodysplastic

  14. GSK-3/Rb12 Pathway as a Novel Target of Rapamycin in Prostate Cancer

    National Research Council Canada - National Science Library

    Litovchick, Larissa

    2005-01-01

    .... Rapamycin exerts its effects through inhibition of mammalian Target of Rapamycin (mTOR) protein kinase resulting in a decreased expression of a subset of proteins essential for cell cycle progression...

  15. Local and global responses in complex gene regulation networks

    Science.gov (United States)

    Tsuchiya, Masa; Selvarajoo, Kumar; Piras, Vincent; Tomita, Masaru; Giuliani, Alessandro

    2009-04-01

    An exacerbated sensitivity to apparently minor stimuli and a general resilience of the entire system stay together side-by-side in biological systems. This apparent paradox can be explained by the consideration of biological systems as very strongly interconnected network systems. Some nodes of these networks, thanks to their peculiar location in the network architecture, are responsible for the sensitivity aspects, while the large degree of interconnection is at the basis of the resilience properties of the system. One relevant feature of the high degree of connectivity of gene regulation networks is the emergence of collective ordered phenomena influencing the entire genome and not only a specific portion of transcripts. The great majority of existing gene regulation models give the impression of purely local ‘hard-wired’ mechanisms disregarding the emergence of global ordered behavior encompassing thousands of genes while the general, genome wide, aspects are less known. Here we address, on a data analysis perspective, the discrimination between local and global scale regulations, this goal was achieved by means of the examination of two biological systems: innate immune response in macrophages and oscillating growth dynamics in yeast. Our aim was to reconcile the ‘hard-wired’ local view of gene regulation with a global continuous and scalable one borrowed from statistical physics. This reconciliation is based on the network paradigm in which the local ‘hard-wired’ activities correspond to the activation of specific crucial nodes in the regulation network, while the scalable continuous responses can be equated to the collective oscillations of the network after a perturbation.

  16. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    Science.gov (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  17. Identification of formaldehyde-responsive genes by suppression subtractive hybridization

    International Nuclear Information System (INIS)

    Lee, Min-Ho; Kim, Young-Ae; Na, Tae-Young; Kim, Sung-Hye; Shin, Young Kee; Lee, Byung-Hoon; Shin, Ho-Sang; Lee, Mi-Ock

    2008-01-01

    Formaldehyde is frequently used in indoor household and occupational environments. Inhalation of formaldehyde invokes an inflammatory response, including a variety of allergic signs and symptoms. Therefore, formaldehyde has been considered as the most prevalent cause of sick building syndrome, which has become a major social problem, especially in developing urban areas. Further formaldehyde is classified as a genotoxicant in the respiratory tract of rats and humans. To better understand the molecular mechanisms involved in formaldehyde intoxication, we sought differentially regulated genes by formaldehyde exposure to Hs 680.Tr human trachea cells, using polymerase chain reaction (PCR)-based suppression subtractive hybridization. We identified 27 different formaldehyde-inducible genes, including those coding for the major histocompatibility complex, class IA, calcyclin, glutathione S-transferase pi, mouse double minute 2 (MDM2), platelet-derived growth factor receptor alpha, and which are known to be associated with cell proliferation and differentiation, immunity and inflammation, and detoxification. Induction of these genes by formaldehyde treatment was confirmed by reverse transcription PCR and western blot analysis. Further, the expression of calcyclin, glutathione S-transferase pi, PDGFRA and MDM2 were significantly induced in the tracheal epithelium of Sprague Dawley rats after formaldehyde inhalation. Our results suggest that the elevated levels of these genes may be associated with the formaldehyde-induced toxicity, and that they deserve evaluation as potential biomarkers for formaldehyde intoxication

  18. Global gene response in Saccharomyces cerevisiae exposed to silver nanoparticles.

    Science.gov (United States)

    Niazi, Javed H; Sang, Byoung-In; Kim, Yeon Seok; Gu, Man Bock

    2011-08-01

    Silver nanoparticles (AgNPs), exhibiting a broad size range and morphologies with highly reactive facets, which are widely applicable in real-life but not fully verified for biosafety and ecotoxicity, were subjected to report transcriptome profile in yeast Saccharomyces cerevisiae. A large number of genes accounted for ∼3% and ∼5% of the genome affected by AgNPs and Ag-ions, respectively. Principal component and cluster analysis suggest that the different physical forms of Ag were the major cause in differential expression profile. Among 90 genes affected by both AgNPs and Ag-ions, metalloprotein mediating high resistance to copper (CUP1-1 and CUP1-2) were strongly induced by AgNPs (∼45-folds) and Ag-ions (∼22-folds), respectively. A total of 17 genes, responsive to chemical stimuli, stress, and transport processes, were differentially induced by AgNPs. The differential expression was also seen with Ag-ions that affected 73 up- and 161 down-regulating genes, and most of these were involved in ion transport and homeostasis. This study provides new information on the knowledge for impact of nanoparticles on living microorganisms that can be extended to other nanoparticles.

  19. Gene Expression Dynamics Accompanying the Sponge Thermal Stress Response.

    Science.gov (United States)

    Guzman, Christine; Conaco, Cecilia

    2016-01-01

    Marine sponges are important members of coral reef ecosystems. Thus, their responses to changes in ocean chemistry and environmental conditions, particularly to higher seawater temperatures, will have potential impacts on the future of these reefs. To better understand the sponge thermal stress response, we investigated gene expression dynamics in the shallow water sponge, Haliclona tubifera (order Haplosclerida, class Demospongiae), subjected to elevated temperature. Using high-throughput transcriptome sequencing, we show that these conditions result in the activation of various processes that interact to maintain cellular homeostasis. Short-term thermal stress resulted in the induction of heat shock proteins, antioxidants, and genes involved in signal transduction and innate immunity pathways. Prolonged exposure to thermal stress affected the expression of genes involved in cellular damage repair, apoptosis, signaling and transcription. Interestingly, exposure to sublethal temperatures may improve the ability of the sponge to mitigate cellular damage under more extreme stress conditions. These insights into the potential mechanisms of adaptation and resilience of sponges contribute to a better understanding of sponge conservation status and the prediction of ecosystem trajectories under future climate conditions.

  20. Rapamycin-based inducible translocation systems for studying phagocytosis.

    Science.gov (United States)

    Bohdanowicz, Michal; Fairn, Gregory D

    2011-01-01

    Phagocytosis is an immune receptor-mediated process whereby cells engulf large particles. The process is dynamic and requires several localized factors acting in concert with and sequentially after the engagement of immune receptors to envelope the particle. Once the particle is internalized, the nascent -phagosome undergoes a series of events leading to its maturation to the microbicidal phagolysosome. Investigating these dynamic and temporally controlled series of events in live cells requires noninvasive methods. The ability to rapidly recruit the proteins of interest to the sites of phagocytosis or to nascent phagosomes would help dissect the regulatory mechanisms involved during phagocytosis. Here, we describe a general approach to express in RAW264.7 murine macrophages, a genetically encoded rapamycin--induced heterodimerization system. In the presence of rapamycin, tight association between FK506-binding protein (FKBP) and FKBP rapamycin-binding protein (FRB) is observed. Based on this principle, a synthetic system consisting of a targeting domain attached to FKBP can recruit a protein of interest fused to FRB upon the addition of rapamycin. Previously, this technique has been used to target lipid-modifying enzymes and small GTPases to the phagosome or plasma membrane. The recruitment of the FRB module can be monitored by fluorescent microscopy if a fluorescent protein is fused to the FRB sequence. While the focus of this chapter is on phagocytic events, this method can be employed to study any organelle of interest when the appropriate targeting sequence is used.

  1. Suppression of Th17-polarized airway inflammation by rapamycin.

    Science.gov (United States)

    Joean, Oana; Hueber, Anja; Feller, Felix; Jirmo, Adan Chari; Lochner, Matthias; Dittrich, Anna-Maria; Albrecht, Melanie

    2017-11-10

    Because Th17-polarized airway inflammation correlates with poor control in bronchial asthma and is a feature of numerous other difficult-to-treat inflammatory lung diseases, new therapeutic approaches for this type of airway inflammation are necessary. We assessed different licensed anti-inflammatory agents with known or expected efficacy against Th17-polarization in mouse models of Th17-dependent airway inflammation. Upon intravenous transfer of in vitro derived Th17 cells and intranasal challenge with the corresponding antigen, we established acute and chronic murine models of Th17-polarised airway inflammation. Consecutively, we assessed the efficacy of methylprednisolone, roflumilast, azithromycin, AM80 and rapamycin against acute or chronic Th17-dependent airway inflammation. Quantifiers for Th17-associated inflammation comprised: bronchoalveolar lavage (BAL) differential cell counts, allergen-specific cytokine and immunoglobulin secretion, as well as flow cytometric phenotyping of pulmonary inflammatory cells. Only rapamycin proved effective against acute Th17-dependent airway inflammation, accompanied by increased plasmacytoid dendritic cells (pDCs) and reduced neutrophils as well as reduced CXCL-1 levels in BAL. Chronic Th17-dependent airway inflammation was unaltered by rapamycin treatment. None of the other agents showed efficacy in our models. Our results demonstrate that Th17-dependent airway inflammation is difficult to treat with known agents. However, we identify rapamycin as an agent with inhibitory potential against acute Th17-polarized airway inflammation.

  2. Modulation of translation-initiation in CHO-K1 cells by rapamycin-induced heterodimerization of engineered eIF4G fusion proteins.

    Science.gov (United States)

    Schlatter, Stefan; Senn, Claudia; Fussenegger, Martin

    2003-07-20

    Translation-initiation is a predominant checkpoint in mammalian cells which controls protein synthesis and fine-tunes the flow of information from gene to protein. In eukaryotes, translation-initiation is typically initiated at a 7-methyl-guanylic acid cap posttranscriptionally linked to the 5' end of mRNAs. Alternative cap-independent translation-initiation involves 5' untranslated regions (UTR) known as internal ribosome entry sites, which adopt a particular secondary structure. Translation-initiating ribosome assembly at cap or IRES elements is mediated by a multiprotein complex of which the initiation factor 4F (eIF4F) consisting of eIF4A (helicase), eIF4E (cap-binding protein), and eIF4G is a major constituent. eIF4G is a key target of picornaviral protease 2A, which cleaves this initiation factor into eIF4G(Delta) and (Delta)eIF4G to redirect the cellular translation machinery exclusively to its own IRES-containing transcripts. We have designed a novel translation control system (TCS) for conditional as well as adjustable translation of cap- and IRES-dependent transgene mRNAs in mammalian cells. eIF4G(Delta) and (Delta)eIF4G were fused C- and N-terminally to the FK506-binding protein (FKBP) and the FKBP-rapamycin-binding domain (FRB) of the human FKBP-rapamycin-associated protein (FRAP), respectively. Rapamycin-induced heterodimerization of eIF4G(Delta)-FKBP and FRB-(Delta)eIF4G fusion proteins reconstituted a functional chimeric elongation factor 4G in a dose-dependent manner. Rigorous quantitative expression analysis of cap- and IRES-dependent SEAP- (human placental secreted alkaline phosphatase) and luc- (Photinus pyralis luciferase) encoding reporter constructs confirmed adjustable translation control and revealed increased production of desired proteins in response to dimerization-induced heterologous eIF4G in Chinese hamster ovary (CHO-K1) cells. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 83: 210-225, 2003.

  3. Branched-chain amino acids enhance premature senescence through mammalian target of rapamycin complex I-mediated upregulation of p21 protein.

    Directory of Open Access Journals (Sweden)

    Masayuki Nakano

    Full Text Available Branched-chain amino acids (BCAAs have been applied as an oral supplementation to patients with liver cirrhosis. BCAAs not only improve nutritional status of patients but also decrease the incidence of liver cancer. Mammalian target of rapamycin (mTOR links cellular metabolism with growth and proliferation in response to nutrients, energy, and growth factors. BCAAs, especially leucine, have been shown to regulate protein synthesis through mTOR activities. On the other hand, cellular senescence is suggested to function as tumor suppressor mechanisms, and induced by a variety of stimuli including DNA damage-inducing drugs. However, it is not clear how BCAA supplementation prevents the incidence of liver cancer in patients with cirrhosis. Here we showed that human cancer cells, HepG2 and U2OS, cultured in medium containing BCAAs with Fischer's ratio about 3, which was shown to have highest activities to synthesize and secrete of albumin, had higher activities to induce premature senescence and elevate mTORC1 activities. Furthermore, BCAAs themselves enhanced the execution of premature senescence induced by DNA damage-inducing drugs, which was effectively prevented by rapamycin. These results strongly suggested the contribution of the mTORC1 pathway to the regulation of premature senescence. Interestingly, the protein levels of p21, a p53 target and well-known gene essential for the execution of cellular senescence, were upregulated in the presence of BCAAs. These results suggested that BCAAs possibly contribute to tumor suppression by enhancing cellular senescence mediated through the mTOR signalling pathway.

  4. A central role for the mammalian target of rapamycin in LPS-induced anorexia in mice.

    Science.gov (United States)

    Yue, Yunshuang; Wang, Yi; Li, Dan; Song, Zhigang; Jiao, Hongchao; Lin, Hai

    2015-01-01

    Bacterial lipopolysaccharide (LPS), also known as endotoxin, induces profound anorexia. However, the LPS-provoked pro-inflammatory signaling cascades and the neural mechanisms underlying the development of anorexia are not clear. Mammalian target of rapamycin (mTOR) is a key regulator of metabolism, cell growth, and protein synthesis. This study aimed to determine whether the mTOR pathway is involved in LPS-induced anorexia. Effects of LPS on hypothalamic gene/protein expression in mice were measured by RT-PCR or western blotting analysis. To determine whether inhibition of mTOR signaling could attenuate LPS-induced anorexia, we administered an i.c.v. injection of rapamycin, an mTOR inhibitor, on LPS-treated male mice. In this study, we showed that LPS stimulates the mTOR signaling pathway through the enhanced phosphorylation of mTOR(Ser2448) and p70S6K(Thr389). We also showed that LPS administration increased the phosphorylation of FOXO1(Ser256), the p65 subunit of nuclear factor kappa B (Panorexia by decreasing the phosphorylation of p70S6K(Thr389), FOXO1(Ser256), and FOXO1/3a(Thr) (24) (/) (32). These results suggest promising approaches for the prevention and treatment of LPS-induced anorexia. © 2015 Society for Endocrinology.

  5. Ultrasound-responsive gene-activated matrices for osteogenic gene therapy using matrix-assisted sonoporation.

    Science.gov (United States)

    Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P

    2018-01-01

    Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  6. Genistein-induced alterations of radiation-responsive gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Grace, M.B. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F.; Landauer, M.R. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)

    2007-07-15

    In order to clarify the molecular mechanism of radioprotection and understand biological dosimetry in the presence of medical countermeasure-radioprotectants, their effects on ionizing radiation (IR)-responsive molecular biomarkers must be examined. We used genistein in a radiation model system and measured gene expression by multiplex QRT-PCR assay in drug-treated healthy human blood cultures. Genistein has been demonstrated to be a radiosensitizer of malignant cells and a radioprotector against IR-induced lethality in a mouse model. Whole-blood cultures were supplemented with 50, 100, and 200{mu}M concentrations of genistein, 16 h prior to receiving a 2-Gy ({sup 60}Co-{gamma} rays, 10 cGy/min) dose of IR. Total RNA was isolated from whole blood 24 h postirradiation for assessments. Combination treatments of genistein and IR resulted in no significant genistein effects on ddb2 and bax downstream transcripts to p53, or proliferating cell-nuclear antigen, pcna, necessary for DNA synthesis and cell-cycle progression. Use of these radiation-responsive targets would be recommended for dose-assessment applications. We also observed decreased expression of pro-survival transcript, bcl-2. Genistein and IR-increased expression of cdkn1a and gadd45a, showing that genistein also stimulates p53 transcriptional activity. These results confirm published molecular signatures for genistein in numerous in vitro models. Evaluation of gene biomarkers may be further exploited for devising novel radiation countermeasure and/or therapeutic strategies.

  7. OxyGene: an innovative platform for investigating oxidative-response genes in whole prokaryotic genomes

    Directory of Open Access Journals (Sweden)

    Barloy-Hubler Frédérique

    2008-12-01

    Full Text Available Abstract Background Oxidative stress is a common stress encountered by living organisms and is due to an imbalance between intracellular reactive oxygen and nitrogen species (ROS, RNS and cellular antioxidant defence. To defend themselves against ROS/RNS, bacteria possess a subsystem of detoxification enzymes, which are classified with regard to their substrates. To identify such enzymes in prokaryotic genomes, different approaches based on similarity, enzyme profiles or patterns exist. Unfortunately, several problems persist in the annotation, classification and naming of these enzymes due mainly to some erroneous entries in databases, mistake propagation, absence of updating and disparity in function description. Description In order to improve the current annotation of oxidative stress subsystems, an innovative platform named OxyGene has been developed. It integrates an original database called OxyDB, holding thoroughly tested anchor-based signatures associated to subfamilies of oxidative stress enzymes, and a new anchor-driven annotator, for ab initio detection of ROS/RNS response genes. All complete Bacterial and Archaeal genomes have been re-annotated, and the results stored in the OxyGene repository can be interrogated via a Graphical User Interface. Conclusion OxyGene enables the exploration and comparative analysis of enzymes belonging to 37 detoxification subclasses in 664 microbial genomes. It proposes a new classification that improves both the ontology and the annotation of the detoxification subsystems in prokaryotic whole genomes, while discovering new ORFs and attributing precise function to hypothetical annotated proteins. OxyGene is freely available at: http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software

  8. Targeting Rapamycin to Podocytes Using a Vascular Cell Adhesion Molecule-1 (VCAM-1-Harnessed SAINT-Based Lipid Carrier System.

    Directory of Open Access Journals (Sweden)

    Ganesh Ram R Visweswaran

    Full Text Available Together with mesangial cells, glomerular endothelial cells and the basement membrane, podocytes constitute the glomerular filtration barrier (GFB of the kidney. Podocytes play a pivotal role in the progression of various kidney-related diseases such as glomerular sclerosis and glomerulonephritis that finally lead to chronic end-stage renal disease. During podocytopathies, the slit-diaphragm connecting the adjacent podocytes are detached leading to severe loss of proteins in the urine. The pathophysiology of podocytopathies makes podocytes a potential and challenging target for nanomedicine development, though there is a lack of known molecular targets for cell selective drug delivery. To identify VCAM-1 as a cell-surface receptor that is suitable for binding and internalization of nanomedicine carrier systems by podocytes, we investigated its expression in the immortalized podocyte cell lines AB8/13 and MPC-5, and in primary podocytes. Gene and protein expression analyses revealed that VCAM-1 expression is increased by podocytes upon TNFα-activation for up to 24 h. This was paralleled by anti-VCAM-1 antibody binding to the TNFα-activated cells, which can be employed as a ligand to facilitate the uptake of nanocarriers under inflammatory conditions. Hence, we next explored the possibilities of using VCAM-1 as a cell-surface receptor to deliver the potent immunosuppressant rapamycin to TNFα-activated podocytes using the lipid-based nanocarrier system Saint-O-Somes. Anti-VCAM-1-rapamycin-SAINT-O-Somes more effectively inhibited the cell migration of AB8/13 cells than free rapamycin and non-targeted rapamycin-SAINT-O-Somes indicating the potential of VCAM-1 targeted drug delivery to podocytes.

  9. Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses

    Directory of Open Access Journals (Sweden)

    Magdalena eMazur

    2012-09-01

    Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.

  10. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  11. Global gene expression response to telomerase in bovine adrenocortical cells

    International Nuclear Information System (INIS)

    Perrault, Steven D.; Hornsby, Peter J.; Betts, Dean H.

    2005-01-01

    The infinite proliferative capability of most immortalized cells is dependent upon the presence of the enzyme telomerase and its ability to maintain telomere length and structure. However, telomerase may be involved in a greater system than telomere length regulation, as recent evidence has shown it capable of increasing wound healing in vivo, and improving cellular proliferation rate and survival from apoptosis in vitro. Here, we describe the global gene expression response to ectopic telomerase expression in an in vitro bovine adrenocortical cell model. Telomerase-immortalized cells showed an increased ability for proliferation and survival in minimal essential medium above cells transgenic for GFP. cDNA microarray analyses revealed an altered cell state indicative of increased adrenocortical cell proliferation regulated by the IGF2 pathway and alterations in members of the TGF-B family. As well, we identified alterations in genes associated with development and wound healing that support a model that high telomerase expression induces a highly adaptable, progenitor-like state

  12. Effects of ketamine administration on mTOR and reticulum stress signaling pathways in the brain after the infusion of rapamycin into prefrontal cortex.

    Science.gov (United States)

    Abelaira, Helena M; Réus, Gislaine Z; Ignácio, Zuleide M; Dos Santos, Maria Augusta B; de Moura, Airam B; Matos, Danyela; Demo, Júlia P; da Silva, Júlia B I; Michels, Monique; Abatti, Mariane; Sonai, Beatriz; Dal Pizzol, Felipe; Carvalho, André F; Quevedo, João

    2017-04-01

    Recent studies show that activation of the mTOR signaling pathway is required for the rapid antidepressant actions of glutamate N-methyl-D-aspartate (NMDA) receptor antagonists. A relationship between mTOR kinase and the endoplasmic reticulum (ER) stress pathway, also known as the unfolded protein response (UPR) has been shown. We evaluate the effects of ketamine administration on the mTOR signaling pathway and proteins of UPR in the prefrontal cortex (PFC), hippocampus, amygdala and nucleus accumbens, after the inhibiton of mTOR signaling in the PFC. Male adult Wistar rats received pharmacological mTOR inhibitor, rapamycin (0.2 nmol), or vehicle into the PFC and then a single dose of ketamine (15 mg/kg, i.p.). The immunocontent of mTOR, eukaryotic initiation factor 4E-binding protein 1 (4E-BP1), eukaryotic elongation factor 2 kinase (eEF2K) homologous protein (CHOP), PKR-like ER kinase (PERK) and inositol-requiring enzyme 1 (IRE1) - alpha were determined in the brain. The mTOR levels were reduced in the rapamycin group treated with saline and ketamine in the PFC; p4EBP1 levels were reduced in the rapamycin group treated with ketamine in the PFC and nucleus accumbens; the levels of peEF2K were increased in the PFC in the vehicle group treated with ketamine and reduced in the rapamycin group treated with ketamine. The PERK and IRE1-alpha levels were decreased in the PFC in the rapamycin group treated with ketamine. Our results suggest that mTOR signaling inhibition by rapamycin could be involved, at least in part, with the mechanism of action of ketamine; and the ketamine antidepressant on ER stress pathway could be also mediated by mTOR signaling pathway in certain brain structures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Target of rapamycin complex 1 and Tap42-associated phosphatases are required for sensing changes in nitrogen conditions in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Li, Jinmei; Yan, Gonghong; Liu, Sichi; Jiang, Tong; Zhong, Mingming; Yuan, Wenjie; Chen, Shaoxian; Zheng, Yin; Jiang, Yong; Jiang, Yu

    2017-12-01

    In yeast target of rapamycin complex 1 (TORC1) and Tap42-associated phosphatases regulate expression of genes involved in nitrogen limitation response and the nitrogen discrimination pathway. However, it remains unclear whether TORC1 and the phosphatases are required for sensing nitrogen conditions. Utilizing temperature sensitive mutants of tor2 and tap42, we examined the role of TORC1 and Tap42 in nuclear entry of Gln3, a key transcription factor in yeast nitrogen metabolism, in response to changes in nitrogen conditions. Our data show that TORC1 is essential for Gln3 nuclear entry upon nitrogen limitation and downshift in nitrogen quality. However, Tap42-associated phosphatases are required only under nitrogen limitation condition. In cells grown in poor nitrogen medium, the nitrogen permease reactivator kinase (Npr1) inhibits TORC1 activity and alters its association with Tap42, rendering Tap42-associated phosphatases unresponsive to nitrogen limitation. These findings demonstrate a direct role for TORC1 and Tap42-associated phosphatases in sensing nitrogen conditions and unveil an Npr1-dependent mechanism that controls TORC1 and the phosphatases in response to changes in nitrogen quality. © 2017 John Wiley & Sons Ltd.

  14. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis

    Directory of Open Access Journals (Sweden)

    Larissa Lazzarini Furlan

    2017-11-01

    Conclusions: This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene.

  15. Genome wide analyses of metal responsive genes in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Michael eAschner

    2012-04-01

    Full Text Available Metals are major contaminants that influence human health. Many metals have physiologic roles, but excessive levels can be harmful. Advances in technology have made toxicogenomic analyses possible to characterize the effects of metal exposure on the entire genome. Much of what is known about cellular responses to metals has come from mammalian systems; however the use of non-mammalian species is gaining wider attention. Caenorhabditis elegans (C. elegans is a small round worm whose genome has been fully sequenced and its development from egg to adult is well characterized. It is an attractive model for high throughput screens due to its short lifespan, ease of genetic mutability, low cost and high homology with humans. Research performed in C. elegans has led to insights in apoptosis, gene expression and neurodegeneration, all of which can be altered by metal exposure. Additionally, by using worms one can potentially study how the mechanisms that underline differential responses to metals in nematodes and humans, allowing for identification of novel pathways and therapeutic targets. In this review, toxicogenomic studies performed in C. elegans exposed to various metals will be discussed, highlighting how this non-mammalian system can be utilized to study cellular processes and pathways induced by metals. Recent work focusing on neurodegeneration in Parkinson’s disease will be discussed as an example of the usefulness of genetic screens in C. elegans and the novel findings that can be produced.

  16. Cooperative adaptive responses in gene regulatory networks with many degrees of freedom.

    Science.gov (United States)

    Inoue, Masayo; Kaneko, Kunihiko

    2013-04-01

    Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components.

  17. Meta-Analysis of 29 Experiments Evaluating the Effects of Rapamycin on Life Span in the Laboratory Mouse.

    Science.gov (United States)

    Swindell, William R

    2017-08-01

    Rapamycin has favorable effects on aging in mice and may eventually be applied to encourage "healthy aging" in humans. This study analyzed raw data from 29 survival studies of rapamycin- and control-treated mice, with the goals of estimating summary statistics and identifying factors associated with effect size heterogeneity. Meta-analysis demonstrated significant heterogeneity across studies, with hazard ratio (HR) estimates ranging from 0.22 (95% confidence interval [CI]: 0.06-0.82) to 0.92 (95% CI: 0.65-1.28). Sex was the major factor accounting for effect size variation, and mortality was decreased more in females (HR = 0.41; 95% CI: 0.35-0.48) as compared with males (HR = 0.63; 95% CI: 0.55-0.71). Rapamycin effects were also genotype dependent, however, with stronger survivorship increases in hybrid mice (14.4%; 95% CI: 12.5-16.3%) relative to pure inbred strains (8.8%; 95% CI: 6.2-11.6%). Number needed to treat was applied as an effect size metric, which consistently identified early senescence as the age of peak treatment benefit. These results provide synthesis of existing data to support the potential translation of findings from mouse to primate species. Because rapamycin's effect on survival depends on sex and genotype, further work is justified to understand how these factors shape treatment response. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Identification of estrogen responsive genes using esophageal squamous cell carcinoma (ESCC) as a model

    KAUST Repository

    Essack, Magbubah

    2012-10-26

    Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first

  19. Identification of estrogen responsive genes using esophageal squamous cell carcinoma (ESCC) as a model

    KAUST Repository

    Essack, Magbubah; MacPherson, Cameron Ross; Schmeier, Sebastian; Bajic, Vladimir B.

    2012-01-01

    Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first

  20. Mechanical activation of mammalian target of rapamycin pathway is required for cartilage development.

    Science.gov (United States)

    Guan, Yingjie; Yang, Xu; Yang, Wentian; Charbonneau, Cherie; Chen, Qian

    2014-10-01

    Mechanical stress regulates development by modulating cell signaling and gene expression. However, the cytoplasmic components mediating mechanotransduction remain unclear. In this study, elimination of muscle contraction during chicken embryonic development resulted in a reduction in the activity of mammalian target of rapamycin (mTOR) in the cartilaginous growth plate. Inhibition of mTOR activity led to significant inhibition of chondrocyte proliferation, cartilage tissue growth, and expression of chondrogenic genes, including Indian hedgehog (Ihh), a critical mediator of mechanotransduction. Conversely, cyclic loading (1 Hz, 5% matrix deformation) of embryonic chicken growth plate chondrocytes in 3-dimensional (3D) collagen scaffolding induced sustained activation of mTOR. Mechanical activation of mTOR occurred in serum-free medium, indicating that it is independent of growth factor or nutrients. Treatment of chondrocytes with Rapa abolished mechanical activation of cell proliferation and Ihh gene expression. Cyclic loading of chondroprogenitor cells deficient in SH2-containing protein tyrosine phosphatase 2 (Shp2) further enhanced mechanical activation of mTOR, cell proliferation, and chondrogenic gene expression. This result suggests that Shp2 is an antagonist of mechanotransduction through inhibition of mTOR activity. Our data demonstrate that mechanical activation of mTOR is necessary for cell proliferation, chondrogenesis, and cartilage growth during bone development, and that mTOR is an essential mechanotransduction component modulated by Shp2 in the cytoplasm. © FASEB.

  1. Plant responses to environmental stresses-from gene to biotechnology.

    Science.gov (United States)

    Ahanger, Mohammad Abass; Akram, Nudrat Aisha; Ashraf, Muhammad; Alyemeni, Mohammed Nasser; Wijaya, Leonard; Ahmad, Parvaiz

    2017-07-01

    Increasing global population, urbanization and industrialization are increasing the rate of conversion of arable land into wasteland. Supplying food to an ever-increasing population is one of the biggest challenges that agriculturalists and plant scientists are currently confronting. Environmental stresses make this situation even graver. Despite the induction of several tolerance mechanisms, sensitive plants often fail to survive under environmental extremes. New technological approaches are imperative. Conventional breeding methods have a limited potential to improve plant genomes against environmental stress. Recently, genetic engineering has contributed enormously to the development of genetically modified varieties of different crops such as cotton, maize, rice, canola and soybean. The identification of stress-responsive genes and their subsequent introgression or overexpression within sensitive crop species are now being widely carried out by plant scientists. Engineering of important tolerance pathways, like antioxidant enzymes, osmolyte accumulation, membrane-localized transporters for efficient compartmentation of deleterious ions and accumulation of essential elements and resistance against pests or pathogens is also an area that has been intensively researched. In this review, the role of biotechnology and its successes, prospects and challenges in developing stress-tolerant crop cultivars are discussed.

  2. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Xiangshu Dong

    Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a

  3. A systematic study on drug-response associated genes using baseline gene expressions of the Cancer Cell Line Encyclopedia

    Science.gov (United States)

    Liu, Xiaoming; Yang, Jiasheng; Zhang, Yi; Fang, Yun; Wang, Fayou; Wang, Jun; Zheng, Xiaoqi; Yang, Jialiang

    2016-03-01

    We have studied drug-response associated (DRA) gene expressions by applying a systems biology framework to the Cancer Cell Line Encyclopedia data. More than 4,000 genes are inferred to be DRA for at least one drug, while the number of DRA genes for each drug varies dramatically from almost 0 to 1,226. Functional enrichment analysis shows that the DRA genes are significantly enriched in genes associated with cell cycle and plasma membrane. Moreover, there might be two patterns of DRA genes between genders. There are significantly shared DRA genes between male and female for most drugs, while very little DRA genes tend to be shared between the two genders for a few drugs targeting sex-specific cancers (e.g., PD-0332991 for breast cancer and ovarian cancer). Our analyses also show substantial difference for DRA genes between young and old samples, suggesting the necessity of considering the age effects for personalized medicine in cancers. Lastly, differential module and key driver analyses confirm cell cycle related modules as top differential ones for drug sensitivity. The analyses also reveal the role of TSPO, TP53, and many other immune or cell cycle related genes as important key drivers for DRA network modules. These key drivers provide new drug targets to improve the sensitivity of cancer therapy.

  4. A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP Inhibitors

    Science.gov (United States)

    2017-02-01

    affecting the function of Fanconi Anemia (FA) genes ( FANCA /B/C/D2/E/F/G/I/J/L/M, PALB2) or DNA damage response genes involved in HR 5 (ATM, ATR...Award Number: W81XWH-10-1-0585 TITLE: A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP Inhibitors...To) 15 July 2010 – 2 Nov.2016 4. TITLE AND SUBTITLE A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP

  5. Granulomatous response to Coxiella burnetii, the agent of Q fever: the lessons from gene expression analysis

    Directory of Open Access Journals (Sweden)

    delphine efaugaret

    2014-12-01

    Full Text Available The formation of granulomas is associated with the resolution of Q fever, a zoonosis due to Coxiella burnetii; however the molecular mechanisms of granuloma formation remain poorly understood. We generated human granulomas with peripheral blood mononuclear cells and beads coated with C. burnetii, using BCG extracts as controls. A microarray analysis showed dramatic changes in gene expression in granuloma cells of which more than 50% were commonly modulated genes in response to C. burnetii and BCG. They included M1-related genes and genes related to chemotaxis. The inhibition of the chemokines, CCL2 and CCL5, directly interfered with granuloma formation. C. burnetii granulomas also expressed a specific transcriptional profile that was essentially enriched in genes associated with type I interferon response. Our results showed that granuloma formation is associated with a core of transcriptional response based on inflammatory genes. The specific granulomatous response to C. burnetii is characterized by the activation of type I interferon pathway.

  6. Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

    Science.gov (United States)

    Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

    2011-01-01

    The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

  7. Gene expression profiling of chicken intestinal host responses

    NARCIS (Netherlands)

    Hemert, van S.

    2007-01-01

    Chicken lines differ in genetic disease susceptibility. The scope of the research described in this thesis was to identify genes involved in genetic disease resistance in the chicken intestine. Therefore gene expression in the jejunum was investigated using a microarray approach. An intestine

  8. An Interactive Database of Cocaine-Responsive Gene Expression

    Directory of Open Access Journals (Sweden)

    Willard M. Freeman

    2002-01-01

    Full Text Available The postgenomic era of large-scale gene expression studies is inundating drug abuse researchers and many other scientists with findings related to gene expression. This information is distributed across many different journals, and requires laborious literature searches. Here, we present an interactive database that combines existing information related to cocaine-mediated changes in gene expression in an easy-to-use format. The database is limited to statistically significant changes in mRNA or protein expression after cocaine administration. The Flash-based program is integrated into a Web page, and organizes changes in gene expression based on neuroanatomical region, general function, and gene name. Accompanying each gene is a description of the gene, links to the original publications, and a link to the appropriate OMIM (Online Mendelian Inheritance in Man entry. The nature of this review allows for timely modifications and rapid inclusion of new publications, and should help researchers build second-generation hypotheses on the role of gene expression changes in the physiology and behavior of cocaine abuse. Furthermore, this method of organizing large volumes of scientific information can easily be adapted to assist researchers in fields outside of drug abuse.

  9. FK506 Binding Protein Mediates Glioma Cell Growth and Sensitivity to Rapamycin Treatment by Regulating NF-κB Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Wei Jiang

    2008-03-01

    Full Text Available FK506 binding protein 5 (FKBP5 belongs to a family of immunophilins named for their ability to bind immunosuppressive drugs, also known as peptidyl-prolyl cis-trans isomerases, and also with chaperones to help protein folding. Using glioma cDNA microarray analysis, we found that FKBP5 was overexpressed in glioma tumors. This finding was further validated by real-time reverse transcription-polymerase chain reaction and Western blot analysis. The roles of FKBP5 in glioma cells were then examined. We found that cell growth was suppressed after FKBP5 expression was inhibited by short interfering RNA transfection and enhanced by FKBP5 overexpression. Electrophoretic mobility shift assay showed that nuclear factor-kappa B (NF-κB and DNA binding was enhanced by FKBP5 overexpression. The expression level of I-kappa B alpha and phosphorylated NF-κB was regulated by the expression of FKBP5. These data suggest that FKBP5 is involved in NF-κB pathway activation in glioma cells. In addition, FKBP5 overexpression in rapamycin-sensitive U87 cells blocked the cells' response to rapamycin treatment, whereas rapamycin-resistant glioma cells, both PTEN-positive and -negative, were synergistically sensitive to rapamycin after FKBP5 was knocked down, suggesting that the FKBP5 regulates glioma cell response to rapamycin treatment. In conclusion, our study demonstrates that FKBP5 plays an important role in glioma growth and chemoresistance through regulating signal transduction of the NF-κB pathway.

  10. Mammalian target of rapamycin inhibition in polycystic kidney disease: From bench to bedside

    Directory of Open Access Journals (Sweden)

    Hyun-Jung Kim

    2012-09-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common life-threatening hereditary disease in the USA resulting in chronic kidney disease and the need for dialysis and transplantation. Approximately 85% of cases of ADPKD are caused by a mutation in the Pkd1 gene that encodes polycystin-1, a large membrane receptor. The Pkd1 gene mutation results in abnormal proliferation in tubular epithelial cells, which plays a crucial role in cyst development and/or growth in PKD. Activation of the proliferative mammalian target of rapamycin (mTOR signaling pathway has been demonstrated in polycystic kidneys from rodents and humans. mTOR inhibition with sirolimus or everolimus decreases cysts in most animal models of PKD including Pkd1 and Pkd2 gene deficient orthologous models of human disease. On the basis of animal studies, human studies were undertaken. Two large randomized clinical trials published in the New England Journal of Medicine of everolimus or sirolimus in ADPKD patients were very unimpressive and associated with a high side-effect profile. Possible reasons for the unimpressive nature of the human studies include their short duration, the high drop-out rate, suboptimal dosing, lack of randomization of “fast” and “slow progressors” and the lack of correlation between kidney size and kidney function in ADPKD. The future of mTOR inhibition in ADPKD is discussed.

  11. The schizophrenia risk gene ZNF804A influences the antipsychotic response of positive schizophrenia symptoms

    OpenAIRE

    Mössner, R; Schumacher, A; Wagner, M; Lennertz, L; Steinbrecher, A; Quednow, Boris B; Rujescu, D; Rietschel, M; Maier, W

    2012-01-01

    Genetic factors determining the response to antipsychotic treatment in schizophrenia are poorly understood. A new schizophrenia susceptibility gene, the zinc-finger gene ZNF804A, has recently been identified. To assess the pharmacogenetic importance of this gene, we treated 144 schizophrenia patients and assessed the response of positive and negative symptoms by PANSS. Patients homozygous for the ZNF804A risk allele for schizophrenia (rs1344706 AA) showed poorer improvement of positive sympto...

  12. Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

    Science.gov (United States)

    Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

    2009-05-01

    Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

  13. Device-based local delivery of siRNA against mammalian target of rapamycin (mTOR) in a murine subcutaneous implant model to inhibit fibrous encapsulation

    OpenAIRE

    Takahashi, Hironobu; Wang, Yuwei; Grainger, David W.

    2010-01-01

    Fibrous encapsulation of surgically implant devices is associated with elevated proliferation and activation of fibroblasts in tissues surrounding these implants, frequently causing foreign body complications. Here we test the hypothesis that inhibition of the expression of mammalian target of rapamycin (mTOR) in fibroblasts can mitigate the soft tissue implant foreign body response by suppressing fibrotic responses around implants. In this study, mTOR was knocked down using small interfering...

  14. A rice gene of de novo origin negatively regulates pathogen-induced defense response.

    Directory of Open Access Journals (Sweden)

    Wenfei Xiao

    Full Text Available How defense genes originated with the evolution of their specific pathogen-responsive traits remains an important problem. It is generally known that a form of duplication can generate new genes, suggesting that a new gene usually evolves from an ancestral gene. However, we show that a new defense gene in plants may evolve by de novo origination, resulting in sophisticated disease-resistant functions in rice. Analyses of gene evolution showed that this new gene, OsDR10, had homologs only in the closest relative, Leersia genus, but not other subfamilies of the grass family; therefore, it is a rice tribe-specific gene that may have originated de novo in the tribe. We further show that this gene may evolve a highly conservative rice-specific function that contributes to the regulation difference between rice and other plant species in response to pathogen infections. Biologic analyses including gene silencing, pathologic analysis, and mutant characterization by transformation showed that the OsDR10-suppressed plants enhanced resistance to a broad spectrum of Xanthomonas oryzae pv. oryzae strains, which cause bacterial blight disease. This enhanced disease resistance was accompanied by increased accumulation of endogenous salicylic acid (SA and suppressed accumulation of endogenous jasmonic acid (JA as well as modified expression of a subset of defense-responsive genes functioning both upstream and downstream of SA and JA. These data and analyses provide fresh insights into the new biologic and evolutionary processes of a de novo gene recruited rapidly.

  15. Rapamycin Induces Heme Oxygenase-1 in Liver but Inhibits Bile Flow Recovery after Ischemia

    NARCIS (Netherlands)

    Kist, Alwine; Wakkie, Joris; Madu, Max; Versteeg, Ruth; ten Berge, Judith; Nikolic, Andrej; Nieuwenhuijs, Vincent B.; Porte, Robert J.; Padbury, Robert T. A.; Barritt, Greg J.

    Background/Aims. Rapamycin, which is employed in the management of patients undergoing liver surgery, induces the synthesis of heme oxygenase-1 (HO-1) in some non-liver cell types. The aim was to investigate whether rapamycin can induce HO-1 expression in the liver, and to test the effects of

  16. Memory responses of jasmonic acid-associated Arabidopsis genes to a repeated dehydration stress.

    Science.gov (United States)

    Liu, Ning; Staswick, Paul E; Avramova, Zoya

    2016-11-01

    Dehydration stress activates numerous genes co-regulated by diverse signaling pathways. Upon repeated exposures, however, a subset of these genes does not respond maintaining instead transcription at their initial pre-stressed levels ('revised-response' genes). Most of these genes are involved in jasmonic acid (JA) biosynthesis, JA-signaling and JA-mediated stress responses. How these JA-associated genes are regulated to provide different responses to similar dehydration stresses is an enigma. Here, we investigate molecular mechanisms that contribute to this transcriptional behavior. The memory-mechanism is stress-specific: one exposure to dehydration stress or to abscisic acid (ABA) is required to prevent transcription in the second. Both ABA-mediated and JA-mediated pathways are critical for the activation of these genes, but the two signaling pathways interact differently during a single or multiple encounters with dehydration stress. Synthesis of JA during the first (S1) but not the second dehydration stress (S2) accounts for the altered transcriptional responses. We propose a model for these memory responses, wherein lack of MYC2 and of JA synthesis in S2 is responsible for the lack of expression of downstream genes. The similar length of the memory displayed by different memory-type genes suggests biological relevance for transcriptional memory as a gene-regulating mechanism during recurring bouts of drought. © 2016 John Wiley & Sons Ltd.

  17. Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Kenneth W. Berendzen

    2013-04-01

    Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.

  18. Extracting gene expression patterns and identifying co-expressed genes from microarray data reveals biologically responsive processes

    Directory of Open Access Journals (Sweden)

    Paules Richard S

    2007-11-01

    Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying

  19. The 'warrior gene' and the Mãori people: the responsibility of the geneticists.

    Science.gov (United States)

    Perbal, Laurence

    2013-09-01

    The 'gene of' is a teleosemantic expression that conveys a simplistic and linear relationship between a gene and a phenotype. Throughout the 20th century, geneticists studied these genes of traits. The studies were often polemical when they concerned human traits: the 'crime gene', 'poverty gene', 'IQ gene', 'gay gene' or 'gene of alcoholism'. Quite recently, a controversy occurred in 2006 in New Zealand that started with the claim that a 'warrior gene' exists in the Mãori community. This claim came from a geneticist working on the MAOA gene. This article is interested in the responsibility of that researcher regarding the origin of the controversy. Several errors were made: overestimation of results, abusive use of the 'gene of' kind of expression, poor communication with the media and a lack of scientific culture. The issues of the debate were not taken into account sufficiently, either from the political, social, ethical or even the genetic points of view. After more than 100 years of debates around 'genes of' all kinds (here, the 'warrior gene'), geneticists may not hide themselves behind the media when a controversy occurs. Responsibilities have to be assumed. © 2012 John Wiley & Sons Ltd.

  20. Genome-wide targeted prediction of ABA responsive genes in rice based on over-represented cis-motif in co-expressed genes.

    Science.gov (United States)

    Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C

    2009-02-01

    Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.

  1. Rapamycin preconditioning attenuates transient focal cerebral ischemia/reperfusion injury in mice.

    Science.gov (United States)

    Yin, Lele; Ye, Shasha; Chen, Zhen; Zeng, Yaoying

    2012-12-01

    Rapamycin, an mTOR inhibitor and immunosuppressive agent in clinic, has protective effects on traumatic brain injury and neurodegenerative diseases. But, its effects on transient focal ischemia/reperfusion disease are not very clear. In this study, we examined the effects of rapamycin preconditioning on mice treated with middle cerebral artery occlusion/reperfusion operation (MCAO/R). We found that the rapamycin preconditioning by intrahippocampal injection 20 hr before MCAO/R significantly improved the survival rate and longevity of mice. It also decreased the neurological deficit score, infracted areas and brain edema. In addition, rapamycin preconditioning decreased the production of NF-κB, TNF-α, and Bax, but not Bcl-2, an antiapoptotic protein in the ischemic area. From these results, we may conclude that rapamycin preconditioning attenuate transient focal cerebral ischemia/reperfusion injury and inhibits apoptosis induced by MCAO/R in mice.

  2. The antiaging activity and cerebral protection of rapamycin at micro-doses.

    Science.gov (United States)

    Qi, Haiyan; Su, Feng-Yun; Wan, Shan; Chen, Yongjie; Cheng, Yan-Qiong; Liu, Ai-Jun

    2014-11-01

    The immunosuppressant drug rapamycin was reported to have an antiaging activity, which was attributed to the TORC1 inhibition that inhibits cell proliferation and increases autophagy. However, rapamycin also exhibits a number of harmful adverse effects. Whether rapamycin can be developed into an antiaging agent remains unclear. We demonstrated that rapamycin at micro-doses (below the TORC1 inhibiting concentration) exhibits a cell-protective activity: (1) It protects cultured neurons against neurotoxin MPP(+) and H2O2. (2) It increases survival time of neuron in culture. (3) It maintains the nonproliferative state of cultured senescent human fibroblasts and prevents cell death induced by telomere dysfunction. (4) In animal models, it decreased the cerebral infarct sizes induced by acute ischemia and dramatically extended the life span of stroke prone spontaneously hypertensive rats (SHR-SPs). We propose that rapamycin at micro-dose can be developed into an antiaging agent with a novel mechanism. © 2014 John Wiley & Sons Ltd.

  3. Genetic control of eosinophilia in mice: gene(s) expressed in bone marrow-derived cells control high responsiveness

    International Nuclear Information System (INIS)

    Vadas, M.A.

    1982-01-01

    A heterogeneity in the capacity of strains of mice to mount eosinophilia is described. BALB/c and C3H are eosinophil high responder strains (EO-HR) and CBA and A/J are eosinophil low responder strains (EO-LR), judged by the response of blood eosinophils to Ascaris suum, and the response of blood, bone marrow, and spleen eosinophils to keyhole limpet hemocyanin given 2 days after 150 mg/kg cyclophosphamide. Some of the gene(s) for high responsiveness appear to be dominant because (EO-HR x EO-LR)F 1 mice were intermediate to high responders. This gene is expressed in bone marrow-derived cells because radiation chimeras of the type EO-HR→F 1 were high responders and EO-LR→F 1 were low responders. This description of a genetic control of eosinophilia in mice may be useful in understanding the role of this cell in parasite immunity and allergy

  4. Identification of vernalization responsive genes in the winter wheat ...

    Indian Academy of Sciences (India)

    2National Engineering Research Centre for Wheat, 3Collaborative Innovation Center of ... among the specific genes were selected for validation by quantitative reverse transcription ... expression of TaSnRK2.8 enhanced the tolerance to low.

  5. Plant reference genes for development and stress response studies

    Indian Academy of Sciences (India)

    Joyous T Joseph

    2018-02-09

    Feb 9, 2018 ... HKGs are constitutive genes required for the maintenance of basic cellular functions like cell ... abiotic, biotic, and developmental factors affecting the cells in which they express. ..... expression. Theory Biosci. 131 215–223.

  6. Predicting response to primary chemotherapy: gene expression profiling of paraffin-embedded core biopsy tissue.

    Science.gov (United States)

    Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D

    2007-06-01

    Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.

  7. Rapamycin prevents drug seeking via disrupting reconsolidation of reward memory in rats.

    Science.gov (United States)

    Lin, Jue; Liu, Lingqi; Wen, Quan; Zheng, Chunming; Gao, Yang; Peng, Shuxian; Tan, Yalun; Li, Yanqin

    2014-01-01

    The maladaptive drug memory developed between the drug-rewarding effect and environmental cues contributes to difficulty in preventing drug relapse. Established reward memories can be disrupted by pharmacologic interventions following their reactivation. Rapamycin, an inhibitor of mammalian target of rapamycin (mTOR) kinase, has been proved to be involved in various memory consolidation. However, it is less well characterized in drug memory reconsolidation. Using a conditioned place preference (CPP) procedure, we examined the effects of systemically administered rapamycin on reconsolidation of drug memory in rats. We found that systemically administered rapamycin (0.1 or 10 mg/kg, i.p.) after re-exposure to drug-paired environment, dose dependently decreased the expression of CPP 1 d later, and the effect lasted for up to 14 d and could not be reversed by a priming injection of morphine. The effect of rapamycin on morphine-associated memory was specific to drug-paired context, and rapamycin had no effect on subsequent CPP expression when rats were exposed to saline-paired context or homecage. These results indicated that systemic administration of rapamycin after memory reactivation can persistently inhibit the drug seeking behaviour via disruption of morphine memory reconsolidation in rats. Additionally, the effect of rapamycin on memory reconsolidation was reproduced in cocaine CPP and alcohol CPP. Furthermore, rapamycin did not induce conditioned place aversion and had no effect on locomotor activity and anxiety behaviour. These findings suggest that rapamycin could erase the acquired drug CPP in rats, and that mTOR activity plays an important role in drug reconsolidation and is required for drug relapse.

  8. Inhibition of repopulation is not a determining factor for the radiosensitizing effects of rapamycin

    International Nuclear Information System (INIS)

    Sarkaria, J.N.; Carlson, B.L.; Mladek, A.C.

    2003-01-01

    The mammalian target of rapamycin (mTOR) is a key downstream effector of the PI3K-Akt signaling pathway, and we have previously shown that inhibition of mTOR by rapamycin significantly enhances the efficacy of prolonged fractionated radiation in U87 glioma cells grown as xenografts or spheroids. To test whether inhibition of repopulation between radiation fractions contributes to the sensitizing effects of rapamycin, the efficacy of our previous protracted radiation schedule was compared with an accelerated regimen in U87 spheroids. Regrowth of individual spheroids was tracked over time following treatment with either accelerated or protracted radiation in the presence or absence of rapamycin. As in our previous studies, treatment with 10 nM rapamycin significantly increased the time required for U87 spheroids to regrow to 10 times their original volume (22 ± 2 days [mean ± 95% CI]) compared to control (7 ± 1 days). Regrowth after protracted radiation (2 Gy every 3 days x 4; 9 ± 2 days)did not significantly differ from control treatment, while accelerated radiation (2 Gy every 4 hours x 4) modestly delayed spheroid regrowth (12 ± 2 days). Specific to our model, the relatively small difference in regrowth time between the two radiation fractionation schedules suggests that repopulation is not a major detrimental factor in the protracted radiation schedule. Interestingly, the combination of rapamycin with either protracted or accelerated RT significantly enhanced the efficacy of the radiation with regrowth times of 31 ± 4 days and 29 ± 4 days, respectively. Consistent with this in vitro data, preliminary results from an animal study suggest that treatment with a rapamycin analog and daily radiation is as effective as protracted radiation/ rapamycin schedules. Thus, any effects of rapamycin on repopulation in our model systems do not contribute significantly to the sensitizing effects of rapamycin

  9. Transcriptional Profiling and Identification of Heat-Responsive Genes in Perennial Ryegrass by RNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Kehua Wang

    2017-06-01

    Full Text Available Perennial ryegrass (Lolium perenne is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants.

  10. Expression Analysis of MYC Genes from Tamarix hispida in Response to Different Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Guifeng Liu

    2012-01-01

    Full Text Available The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.

  11. Expression analysis of MYC genes from Tamarix hispida in response to different abiotic stresses.

    Science.gov (United States)

    Ji, Xiaoyu; Wang, Yucheng; Liu, Guifeng

    2012-01-01

    The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA)-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT)-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.

  12. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  13. Therapeutic Targeting of the IL-6 Trans-Signaling/Mechanistic Target of Rapamycin Complex 1 Axis in Pulmonary Emphysema.

    Science.gov (United States)

    Ruwanpura, Saleela M; McLeod, Louise; Dousha, Lovisa F; Seow, Huei J; Alhayyani, Sultan; Tate, Michelle D; Deswaerte, Virginie; Brooks, Gavin D; Bozinovski, Steven; MacDonald, Martin; Garbers, Christoph; King, Paul T; Bardin, Philip G; Vlahos, Ross; Rose-John, Stefan; Anderson, Gary P; Jenkins, Brendan J

    2016-12-15

    The potent immunomodulatory cytokine IL-6 is consistently up-regulated in human lungs with emphysema and in mouse emphysema models; however, the mechanisms by which IL-6 promotes emphysema remain obscure. IL-6 signals using two distinct modes: classical signaling via its membrane-bound IL-6 receptor (IL-6R), and trans-signaling via a naturally occurring soluble IL-6R. To identify whether IL-6 trans-signaling and/or classical signaling contribute to the pathogenesis of emphysema. We used the gp130 F/F genetic mouse model for spontaneous emphysema and cigarette smoke-induced emphysema models. Emphysema in mice was quantified by various methods including in vivo lung function and stereology, and terminal deoxynucleotidyl transferase dUTP nick end labeling assay was used to assess alveolar cell apoptosis. In mouse and human lung tissues, the expression level and location of IL-6 signaling-related genes and proteins were measured, and the levels of IL-6 and related proteins in sera from emphysematous mice and patients were also assessed. Lung tissues from patients with emphysema, and from spontaneous and cigarette smoke-induced emphysema mouse models, were characterized by excessive production of soluble IL-6R. Genetic blockade of IL-6 trans-signaling in emphysema mouse models and therapy with the IL-6 trans-signaling antagonist sgp130Fc ameliorated emphysema by suppressing augmented alveolar type II cell apoptosis. Furthermore, IL-6 trans-signaling-driven emphysematous changes in the lung correlated with mechanistic target of rapamycin complex 1 hyperactivation, and treatment of emphysema mouse models with the mechanistic target of rapamycin complex 1 inhibitor rapamycin attenuated emphysematous changes. Collectively, our data reveal that specific targeting of IL-6 trans-signaling may represent a novel treatment strategy for emphysema.

  14. Platelet-derived growth factor regulates vascular smooth muscle phenotype via mammalian target of rapamycin complex 1

    International Nuclear Information System (INIS)

    Ha, Jung Min; Yun, Sung Ji; Kim, Young Whan; Jin, Seo Yeon; Lee, Hye Sun; Song, Sang Heon; Shin, Hwa Kyoung; Bae, Sun Sik

    2015-01-01

    Mammalian target of rapamycin complex (mTORC) regulates various cellular processes including proliferation, growth, migration and differentiation. In this study, we showed that mTORC1 regulates platelet-derived growth factor (PDGF)-induced phenotypic conversion of vascular smooth muscle cells (VSMCs). Stimulation of contractile VSMCs with PDGF significantly reduced the expression of contractile marker proteins in a time- and dose-dependent manner. In addition, angiotensin II (AngII)-induced contraction of VSMCs was completely blocked by the stimulation of VSMCs with PDGF. PDGF-dependent suppression of VSMC marker gene expression was significantly blocked by inhibition of phosphatidylinositol 3-kinase (PI3K), extracellular signal-regulated kinase (ERK), and mTOR whereas inhibition of p38 MAPK had no effect. In particular, inhibition of mTORC1 by rapamycin or by silencing of Raptor significantly blocked the PDGF-dependent phenotypic change of VSMCs whereas silencing of Rictor had no effect. In addition, loss of AngII-dependent contraction by PDGF was significantly retained by silencing of Raptor. Inhibition of mTORC1 by rapamycin or by silencing of Raptor significantly blocked PDGF-induced proliferation of VSMCs. Taken together, we suggest that mTORC1 plays an essential role in PDGF-dependent phenotypic changes of VSMCs. - Graphical abstract: Regulation of VSMC phenotype by PDGF-dependent activation of mTORC1. - Highlights: • The expression of contractile marker proteins was reduced by PDGF stimulation. • PDGF-dependent phenotypic conversion of VSMCs was blocked by inhibition of mTOR. • PDGF-induced proliferation of VSMCs was attenuated by inhibition of mTORC1. • mTORC1 plays a critical role in PDGF-dependent phenotypic conversion of VSMCs

  15. Platelet-derived growth factor regulates vascular smooth muscle phenotype via mammalian target of rapamycin complex 1

    Energy Technology Data Exchange (ETDEWEB)

    Ha, Jung Min; Yun, Sung Ji; Kim, Young Whan; Jin, Seo Yeon; Lee, Hye Sun [Medical Research Institute, Department of Pharmacology, Pusan National University School of Medicine, Yangsan (Korea, Republic of); Song, Sang Heon [Department of Internal Medicine, Pusan National University Hospital, Busan (Korea, Republic of); Shin, Hwa Kyoung [Department of Anatomy, Pusan National University School of Korean Medicine, Yangsan (Korea, Republic of); Bae, Sun Sik, E-mail: sunsik@pusan.ac.kr [Medical Research Institute, Department of Pharmacology, Pusan National University School of Medicine, Yangsan (Korea, Republic of)

    2015-08-14

    Mammalian target of rapamycin complex (mTORC) regulates various cellular processes including proliferation, growth, migration and differentiation. In this study, we showed that mTORC1 regulates platelet-derived growth factor (PDGF)-induced phenotypic conversion of vascular smooth muscle cells (VSMCs). Stimulation of contractile VSMCs with PDGF significantly reduced the expression of contractile marker proteins in a time- and dose-dependent manner. In addition, angiotensin II (AngII)-induced contraction of VSMCs was completely blocked by the stimulation of VSMCs with PDGF. PDGF-dependent suppression of VSMC marker gene expression was significantly blocked by inhibition of phosphatidylinositol 3-kinase (PI3K), extracellular signal-regulated kinase (ERK), and mTOR whereas inhibition of p38 MAPK had no effect. In particular, inhibition of mTORC1 by rapamycin or by silencing of Raptor significantly blocked the PDGF-dependent phenotypic change of VSMCs whereas silencing of Rictor had no effect. In addition, loss of AngII-dependent contraction by PDGF was significantly retained by silencing of Raptor. Inhibition of mTORC1 by rapamycin or by silencing of Raptor significantly blocked PDGF-induced proliferation of VSMCs. Taken together, we suggest that mTORC1 plays an essential role in PDGF-dependent phenotypic changes of VSMCs. - Graphical abstract: Regulation of VSMC phenotype by PDGF-dependent activation of mTORC1. - Highlights: • The expression of contractile marker proteins was reduced by PDGF stimulation. • PDGF-dependent phenotypic conversion of VSMCs was blocked by inhibition of mTOR. • PDGF-induced proliferation of VSMCs was attenuated by inhibition of mTORC1. • mTORC1 plays a critical role in PDGF-dependent phenotypic conversion of VSMCs.

  16. Role of NPR1 dependent and NPR1 independent genes in response to Salicylic acid

    Directory of Open Access Journals (Sweden)

    Neha Agarwal

    2017-10-01

    Full Text Available NPR1 (Nonexpressor of pathogenesis-related gene is a transcription coactivator and central regulator of systemic acquired resistance (SAR pathway. It controls wide range of pathogenesis related genes involved in various defense responses, acts by sensing SAR signal molecule, Salicylic acid (SA. Mutation in NPR1 results in increased susceptibility to pathogen infection and less expression of pathogenesis related genes. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction. For this RNA-seq was performed in Arabidopsis thaliana Col-0 and npr1-1 in response to Salicylic acid. RNA-seq analysis revealed a total of 3811 differentially expressed gene in which 2109 genes are up-regulated and 1702 genes are down-regulated. We have divided these genes in 6 categories SA induced (SI, SA repressed (SR, NPR1 dependent SI (ND-SI, NPR1 dependent SR (ND-SR, NPR1 independent SI (NI-SI, NPR1 independent SR (NI-SR. Further, Gene ontology and MapMan pathway analysis of differentially expressed genes suggested variety of biological processes and metabolic pathways that are enriched during SAR defense pathway. These results contribute to shed light on importance of both NPR1-dependent (ND and NPR1-independent (NI gene acting downstream to Salicylic acid induction in SAR pathway. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction.

  17. The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs.

    Science.gov (United States)

    Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V

    2016-05-19

    Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.

  18. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  19. Gene expression changes in female zebrafish (Danio rerio) brain in response to acute exposure to methylmercury

    Science.gov (United States)

    Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.

    2011-01-01

    Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of pgenes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.

  20. Dynamic gene expression response to altered gravity in human T cells.

    Science.gov (United States)

    Thiel, Cora S; Hauschild, Swantje; Huge, Andreas; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver

    2017-07-12

    We investigated the dynamics of immediate and initial gene expression response to different gravitational environments in human Jurkat T lymphocytic cells and compared expression profiles to identify potential gravity-regulated genes and adaptation processes. We used the Affymetrix GeneChip® Human Transcriptome Array 2.0 containing 44,699 protein coding genes and 22,829 non-protein coding genes and performed the experiments during a parabolic flight and a suborbital ballistic rocket mission to cross-validate gravity-regulated gene expression through independent research platforms and different sets of control experiments to exclude other factors than alteration of gravity. We found that gene expression in human T cells rapidly responded to altered gravity in the time frame of 20 s and 5 min. The initial response to microgravity involved mostly regulatory RNAs. We identified three gravity-regulated genes which could be cross-validated in both completely independent experiment missions: ATP6V1A/D, a vacuolar H + -ATPase (V-ATPase) responsible for acidification during bone resorption, IGHD3-3/IGHD3-10, diversity genes of the immunoglobulin heavy-chain locus participating in V(D)J recombination, and LINC00837, a long intergenic non-protein coding RNA. Due to the extensive and rapid alteration of gene expression associated with regulatory RNAs, we conclude that human cells are equipped with a robust and efficient adaptation potential when challenged with altered gravitational environments.

  1. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  2. Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens.

    Directory of Open Access Journals (Sweden)

    Hai-Ting Hao

    Full Text Available Some plant growth-promoting rhizobacteria (PGPR regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE profiling of different growth stages (seedling and mature and tissues (leaves and roots. Compared with the control, 1,507 and 820 differentially expressed genes (DEGs were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response

  3. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  4. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  5. Transcriptional expression of type I interferon response genes and stability of housekeeping genes in the human endometrium and endometriosis

    DEFF Research Database (Denmark)

    Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben

    2011-01-01

    Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic locations. The pathogenesis is much debated, and type I interferons could be involved. The expression of genes of the type I interferon response were profiled by a specific PCR Array...... of RNA obtained from ectopic and eutopic endometrium collected from 9 endometriosis patients and 9 healthy control women. Transcriptional expression levels of selected interferon-regulated and housekeeping genes were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably...... expressed housekeeping genes for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven housekeeping genes were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP, and YWHAZ expression...

  6. Systematic screen for mutants resistant to TORC1 inhibition in fission yeast reveals genes involved in cellular ageing and growth

    Directory of Open Access Journals (Sweden)

    Charalampos Rallis

    2014-01-01

    Target of rapamycin complex 1 (TORC1, which controls growth in response to nutrients, promotes ageing in multiple organisms. The fission yeast Schizosaccharomyces pombe emerges as a valuable genetic model system to study TORC1 function and cellular ageing. Here we exploited the combinatorial action of rapamycin and caffeine, which inhibit fission yeast growth in a TORC1-dependent manner. We screened a deletion library, comprising ∼84% of all non-essential fission yeast genes, for drug-resistant mutants. This screen identified 33 genes encoding functions such as transcription, kinases, mitochondrial respiration, biosynthesis, intra-cellular trafficking, and stress response. Among the corresponding mutants, 5 showed shortened and 21 showed increased maximal chronological lifespans; 15 of the latter mutants showed no further lifespan increase with rapamycin and might thus represent key targets downstream of TORC1. We pursued the long-lived sck2 mutant with additional functional analyses, revealing that the Sck2p kinase functions within the TORC1 network and is required for normal cell growth, global protein translation, and ribosomal S6 protein phosphorylation in a nutrient-dependent manner. Notably, slow cell growth was associated with all long-lived mutants while oxidative-stress resistance was not.

  7. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... traditional breeding as well as gene-engineering approa- ches (Ottow et al., ... tolerance, H. ammodendron is one of the main tree species used for ... labeled with DIG-11-dUTP by reverse transcription using. SuperScript III ...

  8. Phenylalanine ammonia-lyase (PAL) gene activity in response to ...

    African Journals Online (AJOL)

    Phenylalanine ammonia-lyase (PAL) catalyzes the biosynthesis of rosmarinic acid (RA), tyrosine and phenylalanine are the precursors of RA, while proline drives metabolite precursors toward Shikimate and phenylpropanoid pathway ending with the production of RA. The aim of this study was to investigate the PAL gene ...

  9. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  10. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-12-07

    Dec 7, 2016 ... ... stress. Hormone ABA treatment induces, whereas GA treatment decreases, RS1 ... Key word: Rice (Oryza sativa L.), submergence, RNA-seq, Sub1A, abiotic stress. ... genes may interact with Sub1A-1 that are necessary for.

  11. The dynamics of histone H2A ubiquitination in HeLa cells exposed to rapamycin, ethanol, hydroxyurea, ER stress, heat shock and DNA damage.

    Science.gov (United States)

    Nakata, Shiori; Watanabe, Tadashi; Nakagawa, Koji; Takeda, Hiroshi; Ito, Akihiro; Fujimuro, Masahiro

    2016-03-25

    Polyubiquitination plays key roles in proteasome-dependent and independent cellular events, whereas monoubiquitination is involved in gene expression, DNA repair, protein-protein interaction, and protein trafficking. We previously developed an FK2 antibody, which specifically recognizes poly-Ub moieties but not free Ub. To elucidate the role of Ub conjugation in response to cellular stress, we used FK2 to investigate whether chemical stress (rapamycin, ethanol, or hydroxyurea), ER stress (thapsigargin or tunicamycin), heat shock or DNA damage (H2O2 or methyl methanesulfonate) affect the formation of Ub conjugates including histone H2A (hH2A) ubiquitination. First, we found that all forms of stress tested increased poly-ubiquitinated proteins in HeLa cells. Furthermore, rapamycin and hydroxyurea treatment, and ER stress increased ubiquitination of hH2A, while methyl methanesulfonate (MMS) treatment induced deubiquitination of hH2A. The ethanol and H2O2 treatments, and heat shock transiently induced hH2A de-ubiquitination, although deubiquitinated hH2A were ubiquitinated again by subsequent cultivation. We also revealed that FK2 reacts with not only polyubiquitinated proteins but also mono-ubiquitinated hH2A. With the exception of MMS, all forms of stress tested increased the acetylation of K5-hH2A, K9-hH3 and K8-hH4 in addition to ubiquitination. K118 and K119 of hH2A were ubiquitinated in cells under normal conditions, and K119 was the major ubiquitination site. The MMS-treatment and heat shock induced the deubiquitination of both K118 and K119-histone H2A. Interestingly, MMS treatment did not affect cell HeLa cell viability expressing double-mutant hH2A (KK118,119AA-hH2A), while heat shock slightly but significantly decreased viability of double-mutant hH2A expressing cells, indicating that ubiquitination of both sites associates with recovery from heat shock but not MMS treatment. Thus, we characterized FK2 reactivity and demonstrated that various stresses alter

  12. Rapamycin protects kidney against ischemia reperfusion injury through recruitment of NKT cells.

    Science.gov (United States)

    Zhang, Chao; Zheng, Long; Li, Long; Wang, Lingyan; Li, Liping; Huang, Shang; Gu, Chenli; Zhang, Lexi; Yang, Cheng; Zhu, Tongyu; Rong, Ruiming

    2014-08-19

    NKT cells play a protective role in ischemia reperfusion (IR) injury, of which the trafficking in the body and recruitment in injured organs can be influenced by immunosuppressive therapy. Therefore, we investigated the effects of rapamycin on kidneys exposed to IR injury in early stage and on trafficking of NKT cells in a murine model. Balb/c mice were subjected to kidney 30 min ischemia followed by 24 h reperfusion. Rapamycin (2.5 ml/kg) was administered by gavage daily, starting 1 day before the operation. Renal function and histological changes were assessed. The proportion of NKT cells in peripheral blood, spleen and kidney was detected by flow cytometry. The chemokines and corresponding receptor involved in NKT cell trafficking were determined by RT-PCR and flow cytometry respectively. Rapamycin significantly improved renal function and ameliorated histological injury. In rapamycin-treated group, the proportion of NKT cells in spleen was significantly decreased but increased in peripheral blood and kidney. In addition, the CXCR3+ NKT cell in the kidney increased remarkably in the rapamycin-treated group. The chemokines, CXCL9 and CXCL10, as the ligands of CXCR3, were also increased in the rapamycin-treated kidney. Rapamycin may recruit NKT cells from spleen to the IR-induced kidney to ameliorate renal IR injury in the early stage.

  13. Rapamycin treatment is associated with an increased apoptosis rate in experimental vein grafts.

    Science.gov (United States)

    Schachner, Thomas; Oberhuber, Alexander; Zou, Yping; Tzankov, Alexandar; Ott, Harald; Laufer, Günther; Bonatti, Johannes

    2005-02-01

    Rapamycin is an immunosuppressive agent with marked antiproliferative properties and is effective in reducing in stent restenosis and vein graft neointimal hyperplasia. Apoptosis is one mechanism counterbalancing cellular proliferation. We therefore investigated the role of apoptosis in rapamycin treated vein grafts in a mouse model. C57BL6J mice underwent interposition of the inferior vena cava from isogenic donor mice into the common carotid artery using a cuff technique. In the treatment group 200 microg of rapamycin were applied locally in pluronic gel. The control group did not receive local treatment. Vein grafts were harvested at 4 weeks postoperatively and underwent morphometric analysis as well as immunohistochemical analysis for apoptosis (TUNEL). In grafted veins without treatment (controls) neointimal thickness was 50 (12-58) microm at 4 weeks postoperatively. In 200 microg rapamycin treated grafts the neointimal thickness was 17 (5-55) microm. Rapamycin treated vein grafts showed a significantly increased rate of apoptosis in the adventitia as compared with controls (P=0.032). In the neointima the apoptosis rate was lower in both groups with no significant difference between rapamycin treated grafts and controls. We conclude that treatment of experimental vein grafts with rapamycin is associated with an increased apoptosis rate in the vascular wall and a trend towards reduction of neointimal hyperplasia. These results suggest that apoptosis may be a beneficial antiproliferative component for the treatment of vein graft disease.

  14. Function of the auxin-responsive gene TaSAUR75 under salt and drought stress

    Directory of Open Access Journals (Sweden)

    Yuan Guo

    2018-04-01

    Full Text Available Small auxin-upregulated RNAs (SAURs are genes regulated by auxin and environmental factors. In this study, we identified a SAUR gene in wheat, TaSAUR75. Under salt stress, TaSAUR75 is downregulated in wheat roots. Subcellular localization revealed that TaSAUR75 was localized in both the cytoplasm and nucleus. Overexpression of TaSAUR75 increased drought and salt tolerance in Arabidopsis. Transgenic lines showed higher root length and survival rate and higher expression of some stress-responsive genes than control plants under salt and drought stress. Less H2O2 accumulated in transgenic lines than in control plants under drought stress. Our findings reveal a positive regulatory role of the auxin-responsive gene TaSAUR75 in plant responses to drought and salt stress and provide a candidate gene for improvement of abiotic stress tolerance in crop breeding.

  15. Inhibition of Akt enhances the chemopreventive effects of topical rapamycin in mouse skin

    Science.gov (United States)

    Dickinson, Sally E; Janda, Jaroslav; Criswell, Jane; Blohm-Mangone, Karen; Olson, Erik R.; Liu, Zhonglin; Barber, Christie; Rusche, Jadrian J.; Petricoin, Emmanuel; Calvert, Valerie; Einspahr, Janine G.; Dickinson, Jesse; Stratton, Steven P.; Curiel-Lewandrowski, Clara; Saboda, Kathylynn; Hu, Chengcheng; Bode, Ann M.; Dong, Zigang; Alberts, David S.; Bowden, G. Timothy

    2016-01-01

    The PI3Kinase/Akt/mTOR pathway has important roles in cancer development for multiple tumor types, including UV-induced non-melanoma skin cancer. Immunosuppressed populations are at increased risk of aggressive cutaneous squamous cell carcinoma (SCC). Individuals who are treated with rapamycin, (sirolimus, a classical mTOR inhibitor) have significantly decreased rates of developing new cutaneous SCCs compared to those that receive traditional immunosuppression. However, systemic rapamycin use can lead to significant adverse events. Here we explored the use of topical rapamycin as a chemopreventive agent in the context of solar simulated light (SSL)-induced skin carcinogenesis. In SKH-1 mice, topical rapamycin treatment decreased tumor yields when applied after completion of 15 weeks of SSL exposure compared to controls. However, applying rapamycin during SSL exposure for 15 weeks, and continuing for 10 weeks after UV treatment, increased tumor yields. We also examined whether a combinatorial approach might result in more significant tumor suppression by rapamycin. We validated that rapamycin causes increased Akt (S473) phosphorylation in the epidermis after SSL, and show for the first time that this dysregulation can be inhibited in vivo by a selective PDK1/Akt inhibitor, PHT-427. Combining rapamycin with PHT-427 on tumor prone skin additively caused a significant reduction of tumor multiplicity compared to vehicle controls. Our findings indicate that patients taking rapamycin should avoid sun exposure, and that combining topical mTOR inhibitors and Akt inhibitors may be a viable chemoprevention option for individuals at high risk for cutaneous SCC.

  16. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response

    Directory of Open Access Journals (Sweden)

    Nasrine Bendjilali

    2017-01-01

    Full Text Available Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen.

  17. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.

    Science.gov (United States)

    Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J

    2017-01-05

    Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. Copyright © 2017 Bendjilali et al.

  18. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  19. Transcript accumulation of putative drought responsive genes in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... tories where radioactive labelling is not available by using the silver staining ... ICCV2 were removed from the soil and roots were dipped for 5 h into water with or .... respective PCR product in control and drought-stressed samples will testify to the ..... responsive elements and the dehydration-responsive.

  20. Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

    Science.gov (United States)

    Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

    2018-01-01

    The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

  1. Conservation of the response regulator gene gacA in Pseudomonas species

    NARCIS (Netherlands)

    Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.

    2003-01-01

    The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains

  2. Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome

    Directory of Open Access Journals (Sweden)

    Tai Dessmon

    2005-01-01

    Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.

  3. Characterizing gene responses to drought stress in fourwing saltbush [Atriplex canescens (Pursh.) Nutt.)

    Science.gov (United States)

    Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon

    1992-01-01

    New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub

  4. Association of Candidate Genes With Submergence Response in Perennial Ryegrass

    Directory of Open Access Journals (Sweden)

    Xicheng Wang

    2017-05-01

    Full Text Available Perennial ryegrass is a popular cool-season grass species due to its high quality for forage and turf. The objective of this study was to identify associations of candidate genes with growth and physiological traits to submergence stress and recovery after de-submergence in a global collection of 94 perennial ryegrass accessions. Accessions varied largely in leaf color, plant height (HT, leaf fresh weight (LFW, leaf dry weight (LDW, and chlorophyll fluorescence (Fv/Fm at 7 days of submergence and in HT, LFW and LDW at 7 days of recovery in two experiments. Among 26 candidate genes tested by various models, single nucleotide polymorphisms (SNPs in 10 genes showed significant associations with traits including 16 associations for control, 10 for submergence, and 8 for recovery. Under submergence, Lp1-SST encoding sucrose:sucrose 1-fructosyltransferase and LpGA20ox encoding gibberellin 20-oxidase were associated with LFW and LDW, and LpACO1 encoding 1-aminocyclopropane-1-carboxylic acid oxidase was associated with LFW. Associations between Lp1-SST and HT, Lp6G-FFT encoding fructan:fructan 6G-fructosyltransferase and Fv/Fm, LpCAT encoding catalase and HT were also detected under submergence stress. Upon de-submergence, Lp1-SST, Lp6G-FFT, and LpPIP1 encoding plasma membrane intrinsic protein type 1 were associated with LFW or LDW, while LpCBF1b encoding C-repeat binding factor were associated with HT. Nine significant SNPs in Lp1-SST, Lp6G-FFT, LpCAT, and LpACO1 resulted in amino acid changes with five substitutions found in Lp1-SST under submergence or recovery. The results indicated that allelic diversity in genes involved in carbohydrate and antioxidant metabolism, ethylene and gibberellin biosynthesis, and transcript factor could contribute to growth variations in perennial ryegrass under submergence stress and recovery after de-submergence.

  5. Nutritional Effect on Androgen-Response Gene Expression and Prostate Tumor Growth

    National Research Council Canada - National Science Library

    Wang, Zhou

    2001-01-01

    .... The dietary influence on ventral prostate weight does not seem to involve androgen action axis because dietary components did not influence the expression of several androgen-response genes, serum testosterone...

  6. Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.

    Science.gov (United States)

    Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M

    2013-03-28

    Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. A novel role for pigment genes in the stress response in rainbow trout (Oncorhynchus mykiss)

    KAUST Repository

    Khan, Uniza Wahid; Ø verli, Ø yvind; Hinkle, Patricia M.; Pasha, Farhan Ahmad; Johansen, Ida Beitnes; Berget, Ingunn; Silva, Patricia I. M.; Kittilsen, Silje; Hö glund, Erik; Omholt, Stig W.; Vå ge, Dag Inge

    2016-01-01

    pigmentation gene, melanocyte stimulating hormone receptor (MC1R), is strongly associated with distinct differences in steroidogenic melanocortin 2 receptor (MC2R) mRNA expression between high- (HR) and low-responsive (LR) rainbow trout (Oncorhynchus mykiss

  8. The genomic view of genes responsive to the antagonistic phytohormones, abscisic acid, and gibberellin.

    Science.gov (United States)

    Yazaki, Junshi; Kikuchi, Shoshi

    2005-01-01

    We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.

  9. Association between gene variants and response to buprenorphine maintenance treatment.

    Science.gov (United States)

    Gerra, Gilberto; Somaini, Lorenzo; Leonardi, Claudio; Cortese, Elena; Maremmani, Icro; Manfredini, Matteo; Donnini, Claudia

    2014-01-30

    A variety of studies were addressed to differentiate responders and non-responders to substitution treatment among heroin dependent patients, without conclusive findings. In particular, preliminary pharmacogenetic findings have been reported to predict treatment effectiveness in mental health and substance use disorders. Aim of the present study was to investigate the possible association of buprenorphine (BUP) treatment outcome with gene variants that may affect kappa-opioid receptors and dopamine system function. One hundred and seven heroin addicts (West European, Caucasians) who underwent buprenorphine maintenance treatment were genotyped and classified into two groups (A and B) on the basis of treatment outcome. Non-responders to buprenorphine (group B) have been identified taking into account early drop out, continuous use of heroin, severe behavioral or psychiatric problems, misbehavior and diversion during the 6 months treatment period. No difference was evidenced between responders and non-responders to BUP in the frequency of kappa opioid receptor (OPRK1) 36G>T SNP. The frequency of dopamine transporter (DAT) gene polymorphism (SLC6A3/DAT1), allele 10, was evidently much higher in "non-responder" than in "responder" individuals (64.9% vs. 55.93%) whereas the frequency of the category of other alleles (6, 7 and 11) was higher in responder than in non-responder individuals (11.02% vs. 2.13% respectively). On one hand, the hypothesis that possible gene-related changes in kappa-opioid receptor could consistently affect buprenorphine pharmacological action and clinical effectiveness was not confirmed in our study, at least in relation to the single nucleotide polymorphism 36G>T. On the other hand, the possibility that gene-related dopamine changes could have reduced BUP effectiveness and impaired maintenance treatment outcome was cautiously supported by our findings. DAT1 gene variants such as allele 10, previously reported in association with personality and

  10. Epigenetic modulation of gene expression governs the brain���s response to injury

    OpenAIRE

    Simon, Roger P.

    2015-01-01

    Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is...

  11. Streptococcus mutans differential gene expression in response to simulated microgravity

    Data.gov (United States)

    National Aeronautics and Space Administration — Astronauts have been previously shown to exhibit decreased salivary lysozyme and increased dental calculus and gingival inflammation in response to space flight host...

  12. Genetic dissection of acute ethanol responsive gene networks in prefrontal cortex: functional and mechanistic implications.

    Directory of Open Access Journals (Sweden)

    Aaron R Wolen

    Full Text Available Individual differences in initial sensitivity to ethanol are strongly related to the heritable risk of alcoholism in humans. To elucidate key molecular networks that modulate ethanol sensitivity we performed the first systems genetics analysis of ethanol-responsive gene expression in brain regions of the mesocorticolimbic reward circuit (prefrontal cortex, nucleus accumbens, and ventral midbrain across a highly diverse family of 27 isogenic mouse strains (BXD panel before and after treatment with ethanol.Acute ethanol altered the expression of ~2,750 genes in one or more regions and 400 transcripts were jointly modulated in all three. Ethanol-responsive gene networks were extracted with a powerful graph theoretical method that efficiently summarized ethanol's effects. These networks correlated with acute behavioral responses to ethanol and other drugs of abuse. As predicted, networks were heavily populated by genes controlling synaptic transmission and neuroplasticity. Several of the most densely interconnected network hubs, including Kcnma1 and Gsk3β, are known to influence behavioral or physiological responses to ethanol, validating our overall approach. Other major hub genes like Grm3, Pten and Nrg3 represent novel targets of ethanol effects. Networks were under strong genetic control by variants that we mapped to a small number of chromosomal loci. Using a novel combination of genetic, bioinformatic and network-based approaches, we identified high priority cis-regulatory candidate genes, including Scn1b, Gria1, Sncb and Nell2.The ethanol-responsive gene networks identified here represent a previously uncharacterized intermediate phenotype between DNA variation and ethanol sensitivity in mice. Networks involved in synaptic transmission were strongly regulated by ethanol and could contribute to behavioral plasticity seen with chronic ethanol. Our novel finding that hub genes and a small number of loci exert major influence over the ethanol

  13. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  14. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

    Directory of Open Access Journals (Sweden)

    Davey Jennifer C

    2007-12-01

    Full Text Available Abstract Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT. The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for

  15. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

    Science.gov (United States)

    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

    2016-09-01

    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. Identification, isolation and expression analysis of auxin response factor (ARF) genes in Solanum lycopersicum.

    Science.gov (United States)

    Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang

    2011-11-01

    Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.

  17. Reconstructing a Network of Stress-Response Regulators via Dynamic System Modeling of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Wei-Sheng Wu

    2008-01-01

    Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  18. Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma

    International Nuclear Information System (INIS)

    Ruijter, Annemieke J.M. de; Meinsma, Rutger J.; Bosma, Peter; Kemp, Stephan; Caron, Huib N.; Kuilenburg, Andre B.P. van

    2005-01-01

    Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype

  19. Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

    Science.gov (United States)

    Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

    2017-04-01

    Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are

  20. Spaceflight Modifies Escherichia coli Gene Expression in Response to Antibiotic Exposure and Reveals Role of Oxidative Stress Response

    Directory of Open Access Journals (Sweden)

    Thomas R. Aunins

    2018-03-01

    Full Text Available Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under

  1. Spaceflight Modifies Escherichia coli Gene Expression in Response to Antibiotic Exposure and Reveals Role of Oxidative Stress Response.

    Science.gov (United States)

    Aunins, Thomas R; Erickson, Keesha E; Prasad, Nripesh; Levy, Shawn E; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree

    2018-01-01

    Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress

  2. Spaceflight Modifies Escherichia coli Gene Expression in Response to Antibiotic Exposure and Reveals Role of Oxidative Stress Response

    Science.gov (United States)

    Aunins, Thomas R.; Erickson, Keesha E.; Prasad, Nripesh; Levy, Shawn E.; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree

    2018-01-01

    Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress

  3. Surgical trauma induces overgrowth in lower limb gigantism: regulation with use of rapamycin is promising.

    Science.gov (United States)

    Pinto, Rohan Sebastian; Harrison, William David; Graham, Kenneth; Nayagam, Durai

    2018-01-04

    We describe an unclassified overgrowth syndrome characterised by unregulated growth of dermal fibroblasts in the lower limbs of a 35-year-old woman. A PIK3CA gene mutation resulted in lower limb gigantism. Below the waist, she weighed 117 kg with each leg measuring over 100 cm in circumference. Her total adiposity was 50% accounted for by her legs mainly. Liposuction and surgical debulking were performed to reduce the size of the limbs but had exacerbated the overgrowth in her lower limbs. Systemic sepsis from an infected foot ulcer necessitated treatment by an above-knee amputation. Postoperatively, the stump increased in size by 19 kg. A trial of rapamycin to reverse the growth of the stump has shown promise. We discuss the clinical and genetic features of this previously unclassified disorder and the orthopaedic considerations involved. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Regulation of the E. coli SOS response by the lexA gene product

    International Nuclear Information System (INIS)

    Brent, R.

    1983-01-01

    In an Escherichia coli that is growing normally, transcription of many genes is repressed by the product of the lexA gene. If cellular DNA is damaged, proteolytically competent recA protein (recA protease) inactivates lexA protein and these genes are induced. Many of the cellular phenomena observed during the cellular response to DNA damage (the SOS response) are the consequence of the expression of these lexA-prepressed genes. Since the SOS response of E. coli has recently been the subject of a comprehensive review, in this paper I would like to concentrate on some modifications to the picture based on new data. 12 references, 2 figures

  5. Rapid and preferential activation of the c-jun gene during the mammalian UV response

    International Nuclear Information System (INIS)

    Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.

    1991-01-01

    Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase

  6. Rapamycin sensitizes T-ALL cells to dexamethasone-induced apoptosis

    Directory of Open Access Journals (Sweden)

    Mu Dezhi

    2010-11-01

    Full Text Available Abstract Background Glucocorticoid (GC resistance is frequently seen in acute lymphoblastic leukemia of T-cell lineage (T-ALL. In this study we investigate the potential and mechanism of using rapamycin to restore the sensitivity of GC-resistant T-ALL cells to dexamethasone (Dex treatment. Methods Cell proliferation was detected by 3-(4,5-dimethylthiazol-2-yl- 2,5-diphenyltetrazolium bromide (MTT assay. Fluorescence-activated cell sorting (FACS analysis was used to analyze apoptosis and cell cycles. Western blot analysis was performed to test the expression of the downstream effector proteins of mammalian target of rapamycin (mTOR, the cell cycle regulatory proteins, and apoptosis associated proteins. Results 10 nM rapamycin markedly increased GC sensitivity in GC-resistant T-ALL cells and this effect was mediated, at least in part, by inhibition of mTOR signaling pathway. Cell cycle arrest was associated with modulation of G1-S phase regulators. Both rapamycin and Dex can induce up-regulation of cyclin-dependent kinase (CDK inhibitors of p21 and p27 and co-treatment of rapamycin with Dex resulted in a synergistic induction of their expressions. Rapamycin did not obviously affect the expression of cyclin A, whereas Dex induced cyclin A expression. Rapamycin prevented Dex-induced expression of cyclin A. Rapamycin had a stronger inhibition of cyclin D1 expression than Dex. Rapamycin enhanced GC-induced apoptosis and this was not achieved by modulation of glucocorticoid receptor (GR expression, but synergistically up-regulation of pro-apoptotic proteins like caspase-3, Bax, and Bim, and down-regulation of anti-apoptotic protein of Mcl-1. Conclusion Our data suggests that rapamycin can effectively reverse GC resistance in T-ALL and this effect is achieved by inducing cell cycles arrested at G0/G1 phase and activating the intrinsic apoptotic program. Therefore, combination of mTOR inhibitor rapamycin with GC containing protocol might be an attracting

  7. Interactions between SNPs affecting inflammatory response genes are associated with multiple myeloma disease risk and survival

    DEFF Research Database (Denmark)

    Nielsen, Kaspar René; Rodrigo-Domingo, Maria; Steffensen, Rudi

    2017-01-01

    The origin of multiple myeloma depends on interactions with stromal cells in the course of normal B-cell differentiation and evolution of immunity. The concept of the present study is that genes involved in MM pathogenesis, such as immune response genes, can be identified by screening for single......3L1 gene promoters. The occurrence of single polymorphisms, haplotypes and SNP-SNP interactions were statistically analyzed for association with disease risk and outcome following high-dose therapy. Identified genes that carried SNPs or haplotypes that were identified as risk or prognostic factors......= .005). The 'risk genes' were analyzed for expression in normal B-cell subsets (N = 6) from seven healthy donors and we found TNFA and IL-6 expressed both in naïve and in memory B cells when compared to preBI, II, immature and plasma cells. The 'prognosis genes' CHI3L1, IL-6 and IL-10 were differential...

  8. A photocleavable rapamycin conjugate for spatiotemporal control of small GTPase activity.

    Science.gov (United States)

    Umeda, Nobuhiro; Ueno, Tasuku; Pohlmeyer, Christopher; Nagano, Tetsuo; Inoue, Takanari

    2011-01-12

    We developed a novel method to spatiotemporally control the activity of signaling molecules. A newly synthesized photocaged rapamycin derivative induced rapid dimerization of FKBP (FK-506 binding protein) and FRB (FKBP-rapamycin binding protein) upon UV irradiation. With this system and the spatially confined UV irradiation, we achieved subcellularly localized activation of Rac, a member of small GTPases. Our technique offers a powerful approach to studies of dynamic intracellular signaling events.

  9. Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

    Directory of Open Access Journals (Sweden)

    Feng Ding

    Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

  10. Association between gene expression profile of the primary tumor and chemotherapy response of metastatic breast cancer

    NARCIS (Netherlands)

    Savci-Heijink, Cemile Dilara; Halfwerk, Hans; Koster, Jan; van de Vijver, Marc Joan

    2017-01-01

    Background: To better predict the likelihood of response to chemotherapy, we have conducted a study comparing the gene expression patterns of primary tumours with their corresponding response to systemic chemotherapy in the metastatic setting. Methods: mRNA expression profiles of breast carcinomas

  11. In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

    Science.gov (United States)

    Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

    2017-02-01

    Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

  12. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

    Directory of Open Access Journals (Sweden)

    Yuling Bai

    2018-06-01

    Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

  13. Loss of prion protein induces a primed state of type I interferon-responsive genes

    DEFF Research Database (Denmark)

    Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind

    2017-01-01

    The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...

  14. Role of X-ray-inducible genes and proteins in adaptive survival responses

    International Nuclear Information System (INIS)

    Meyers, M.; Schea, R.A.; Petrowski, A.E.; Seabury, H.; McLaughlin, P.W.; Lee, I.; Lee, S.W.; Boothman, D.A.

    1992-01-01

    Certain X-ray-inducible genes and their corresponding protein products, appearing following low priming doses of ionizing radiation may subsequently give rise to an adaptive survival response, ultimately leading to increased radioresistance. Further, this adaptive radioresistance may be due to increased DNA repair (or misrepair) processes. Ultimately, the function of low-dose-induced cDNA clones within the cell is hoped to elucidate to follow the effects of specific gene turn-off on adaptive responses. Future research must determine the various functions of adaptive response gene products so that the beneficial or deleterious consequences of adaptive responses, which increases resistance to ionizing radiation, can be determined. (author). 19 refs., 1 fig

  15. Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

    Directory of Open Access Journals (Sweden)

    David Haase

    Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

  16. Transcriptome analysis identifies genes involved in ethanol response of Saccharomyces cerevisiae in Agave tequilana juice.

    Science.gov (United States)

    Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri

    2012-08-01

    During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.

  17. Supplementary Material for: Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro

    KAUST Repository

    Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard; Ravasi, Timothy; Marcondes, Maria

    2017-01-01

    Abstract Background Astrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use. Methods We developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders. Results We identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes. Conclusions Gene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.

  18. Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro

    KAUST Repository

    Bortell, Nikki

    2017-03-09

    BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.

  19. Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro

    KAUST Repository

    Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard S.; Ravasi, Timothy; Marcondes, Maria Cecilia G.

    2017-01-01

    BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.

  20. Global Analysis of WRKY Genes and Their Response to Dehydration and Salt Stress in Soybean.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Hou, Lei; Zhao, Shuzhen; Zhao, Chuanzhi; Xia, Han; Li, Pengcheng; Zhang, Ye; Bian, Xiaotong; Wang, Xingjun

    2016-01-01

    WRKY proteins are plant specific transcription factors involved in various developmental and physiological processes, especially in biotic and abiotic stress resistance. Although previous studies suggested that WRKY proteins in soybean (Glycine max var. Williams 82) involved in both abiotic and biotic stress responses, the global information of WRKY proteins in the latest version of soybean genome (Wm82.a2v1) and their response to dehydration and salt stress have not been reported. In this study, we identified 176 GmWRKY proteins from soybean Wm82.a2v1 genome. These proteins could be classified into three groups, namely group I (32 proteins), group II (120 proteins), and group III (24 proteins). Our results showed that most GmWRKY genes were located on Chromosome 6, while chromosome 11, 12, and 20 contained the least number of this gene family. More GmWRKY genes were distributed on the ends of chromosomes to compare with other regions. The cis-acting elements analysis suggested that GmWRKY genes were transcriptionally regulated upon dehydration and salt stress. RNA-seq data analysis indicated that three GmWRKY genes responded negatively to dehydration, and 12 genes positively responded to salt stress at 1, 6, and 12 h, respectively. We confirmed by qRT-PCR that the expression of GmWRKY47 and GmWRKY 58 genes was decreased upon dehydration, and the expression of GmWRKY92, 144 and 165 genes was increased under salt treatment.

  1. Induction of senescence and identification of differentially expressed genes in tomato in response to monoterpene.

    Directory of Open Access Journals (Sweden)

    Sumit Ghosh

    Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.

  2. Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

    Science.gov (United States)

    Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis

    2013-01-01

    Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

  3. Insights into resistome and stress responses genes in Bubalus bubalis rumen through metagenomic analysis.

    Science.gov (United States)

    Reddy, Bhaskar; Singh, Krishna M; Patel, Amrutlal K; Antony, Ancy; Panchasara, Harshad J; Joshi, Chaitanya G

    2014-10-01

    Buffalo rumen microbiota experience variety of diets and represents a huge reservoir of mobilome, resistome and stress responses. However, knowledge of metagenomic responses to such conditions is still rudimentary. We analyzed the metagenomes of buffalo rumen in the liquid and solid phase of the rumen biomaterial from river buffalo adapted to varying proportion of concentrate to green or dry roughages, using high-throughput sequencing to know the occurrence of antibiotics resistance genes, genetic exchange between bacterial population and environmental reservoirs. A total of 3914.94 MB data were generated from all three treatments group. The data were analysed with Metagenome rapid annotation system tools. At phyla level, Bacteroidetes were dominant in all the treatments followed by Firmicutes. Genes coding for functional responses to stress (oxidative stress and heat shock proteins) and resistome genes (resistance to antibiotics and toxic compounds, phages, transposable elements and pathogenicity islands) were prevalent in similar proportion in liquid and solid fraction of rumen metagenomes. The fluoroquinolone resistance, MDR efflux pumps and Methicillin resistance genes were broadly distributed across 11, 9, and 14 bacterial classes, respectively. Bacteria responsible for phages replication and prophages and phage packaging and rlt-like streptococcal phage genes were mostly assigned to phyla Bacteroides, Firmicutes and proteaobacteria. Also, more reads matching the sigma B genes were identified in the buffalo rumen. This study underscores the presence of diverse mechanisms of adaptation to different diet, antibiotics and other stresses in buffalo rumen, reflecting the proportional representation of major bacterial groups.

  4. Device-based local delivery of siRNA against mammalian target of rapamycin (mTOR) in a murine subcutaneous implant model to inhibit fibrous encapsulation.

    Science.gov (United States)

    Takahashi, Hironobu; Wang, Yuwei; Grainger, David W

    2010-11-01

    Fibrous encapsulation of surgically implanted devices is associated with elevated proliferation and activation of fibroblasts in tissues surrounding these implants, frequently causing foreign body complications. Here we test the hypothesis that inhibition of the expression of mammalian target of rapamycin (mTOR) in fibroblasts can mitigate the soft tissue implant foreign body response by suppressing fibrotic responses around implants. In this study, mTOR was knocked down using small interfering RNA (siRNA) conjugated with branched polyethylenimine (bPEI) in fibroblastic lineage cells in serum-based cell culture as shown by both gene and protein analysis. This mTOR knock-down led to an inhibition in fibroblast proliferation by 70% and simultaneous down-regulation in the expression of type I collagen in fibroblasts in vitro. These siRNA/bPEI complexes were released from poly(ethylene glycol) (PEG)-based hydrogel coatings surrounding model polymer implants in a subcutaneous rodent model in vivo. No significant reduction in fibrous capsule thickness and mTOR expression in the foreign body capsules were observed. The siRNA inefficacy in this in vivo implant model was attributed to siRNA dosing limitations in the gel delivery system, and lack of targeting ability of the siRNA complex specifically to fibroblasts. While in vitro data supported mTOR knock-down in fibroblast cultures, in vivo siRNA delivery must be further improved to produce clinically relevant effects on fibrotic encapsulation around implants. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Muscle myeloid type I interferon gene expression may predict therapeutic responses to rituximab in myositis patients.

    Science.gov (United States)

    Nagaraju, Kanneboyina; Ghimbovschi, Svetlana; Rayavarapu, Sree; Phadke, Aditi; Rider, Lisa G; Hoffman, Eric P; Miller, Frederick W

    2016-09-01

    To identify muscle gene expression patterns that predict rituximab responses and assess the effects of rituximab on muscle gene expression in PM and DM. In an attempt to understand the molecular mechanism of response and non-response to rituximab therapy, we performed Affymetrix gene expression array analyses on muscle biopsy specimens taken before and after rituximab therapy from eight PM and two DM patients in the Rituximab in Myositis study. We also analysed selected muscle-infiltrating cell phenotypes in these biopsies by immunohistochemical staining. Partek and Ingenuity pathway analyses assessed the gene pathways and networks. Myeloid type I IFN signature genes were expressed at higher levels at baseline in the skeletal muscle of rituximab responders than in non-responders, whereas classic non-myeloid IFN signature genes were expressed at higher levels in non-responders at baseline. Also, rituximab responders have a greater reduction of the myeloid and non-myeloid type I IFN signatures than non-responders. The decrease in the type I IFN signature following administration of rituximab may be associated with the decreases in muscle-infiltrating CD19(+) B cells and CD68(+) macrophages in responders. Our findings suggest that high levels of myeloid type I IFN gene expression in skeletal muscle predict responses to rituximab in PM/DM and that rituximab responders also have a greater decrease in the expression of these genes. These data add further evidence to recent studies defining the type I IFN signature as both a predictor of therapeutic responses and a biomarker of myositis disease activity. Published by Oxford University Press on behalf British Society for Rheumatology 2016. This work is written by US Government employees and is in the public domain in the US.

  6. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)

    2013-01-01

    textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with

  7. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  8. MALDI-TOF mass spectrometry for quantitative gene expression analysis of acid responses in Staphylococcus aureus.

    Science.gov (United States)

    Rode, Tone Mari; Berget, Ingunn; Langsrud, Solveig; Møretrø, Trond; Holck, Askild

    2009-07-01

    Microorganisms are constantly exposed to new and altered growth conditions, and respond by changing gene expression patterns. Several methods for studying gene expression exist. During the last decade, the analysis of microarrays has been one of the most common approaches applied for large scale gene expression studies. A relatively new method for gene expression analysis is MassARRAY, which combines real competitive-PCR and MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. In contrast to microarray methods, MassARRAY technology is suitable for analysing a larger number of samples, though for a smaller set of genes. In this study we compare the results from MassARRAY with microarrays on gene expression responses of Staphylococcus aureus exposed to acid stress at pH 4.5. RNA isolated from the same stress experiments was analysed using both the MassARRAY and the microarray methods. The MassARRAY and microarray methods showed good correlation. Both MassARRAY and microarray estimated somewhat lower fold changes compared with quantitative real-time PCR (qRT-PCR). The results confirmed the up-regulation of the urease genes in acidic environments, and also indicated the importance of metal ion regulation. This study shows that the MassARRAY technology is suitable for gene expression analysis in prokaryotes, and has advantages when a set of genes is being analysed for an organism exposed to many different environmental conditions.

  9. Transcriptional regulation of the Hansenula polymorpha GSH2 gene in the response to cadmium ion treatment

    Directory of Open Access Journals (Sweden)

    O. V. Blazhenko

    2014-02-01

    Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring­ a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.

  10. Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors

    International Nuclear Information System (INIS)

    Ahmed, M.

    2003-01-01

    Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation

  11. Induction of biogenic magnetization and redox control by a component of the target of rapamycin complex 1 signaling pathway.

    Directory of Open Access Journals (Sweden)

    Keiji Nishida

    Full Text Available Most organisms are simply diamagnetic, while magnetotactic bacteria and migratory animals are among organisms that exploit magnetism. Biogenic magnetization not only is of fundamental interest, but also has industrial potential. However, the key factor(s that enable biogenic magnetization in coordination with other cellular functions and metabolism remain unknown. To address the requirements for induction and the application of synthetic bio-magnetism, we explored the creation of magnetism in a simple model organism. Cell magnetization was first observed by attraction towards a magnet when normally diamagnetic yeast Saccharomyces cerevisiae were grown with ferric citrate. The magnetization was further enhanced by genetic modification of iron homeostasis and introduction of ferritin. The acquired magnetizable properties enabled the cells to be attracted to a magnet, and be trapped by a magnetic column. Superconducting quantum interference device (SQUID magnetometry confirmed and quantitatively characterized the acquired paramagnetism. Electron microscopy and energy-dispersive X-ray spectroscopy showed electron-dense iron-containing aggregates within the magnetized cells. Magnetization-based screening of gene knockouts identified Tco89p, a component of TORC1 (Target of rapamycin complex 1, as important for magnetization; loss of TCO89 and treatment with rapamycin reduced magnetization in a TCO89-dependent manner. The TCO89 expression level positively correlated with magnetization, enabling inducible magnetization. Several carbon metabolism genes were also shown to affect magnetization. Redox mediators indicated that TCO89 alters the intracellular redox to an oxidized state in a dose-dependent manner. Taken together, we demonstrated that synthetic induction of magnetization is possible and that the key factors are local redox control through carbon metabolism and iron supply.

  12. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.

    Science.gov (United States)

    Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima

    Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  13. Localization and cloning of the gene(s) of bacteriophage PM2 responsible for membrane morphogenesis

    International Nuclear Information System (INIS)

    Armour, G.A.

    1988-01-01

    Proteins implicated in membrane morphogenesis (sp6.6 and sp13) have been previously identified by analysis of membrane proteins in the membrane of the purified phage. Analysis of a ts viral mutant that produces empty membrane vesicles also indicated the unique presence of viral structural protein sp6.6. In this work the gene for sp6.6 was localized on the PM2 genome by in vitro coupled transcription-translation directed by restriction endonuclease fragments of PM2 DNA. A Hind III fragment containing the sp6.6 gene among others was cloned into pBR322 in E. coli. Examination with the electron microscope revealed the production of new membrane vesicles whose size were similar to that of the natural membrane of PM2. Clones were then constructed in the pUC family of plasmids which uses the Lac promoter and pPL-lambda which uses the promoter left of lambda. pUC clones were unable to produce vesicles or detectable sp6.6. A pPL-lambda clone was produced 3.5 Kbp in size, that produced p6.6 as detected by SDS-PAGE of radiolabeled protein and immunoblotting

  14. Mammalian target of rapamycin is essential for cardiomyocyte survival and heart development in mice

    International Nuclear Information System (INIS)

    Zhang, Pengpeng; Shan, Tizhong; Liang, Xinrong; Deng, Changyan; Kuang, Shihuan

    2014-01-01

    Highlights: • mTOR is a critical regulator of many biological processes yet its function in heart is not well understood. • MCK-Cre/Mtor flox/flox mice were established to delete Mtor in cardiomyocytes. • The mTOR-mKO mice developed normally but die prematurely within 5 weeks after birth due to heart disease. • The mTOR-mKO mice had dilated myocardium and increased cell death. • mTOR-mKO hearts had reduced expression of metabolic genes and activation of mTOR target proteins. - Abstract: Mammalian target of rapamycin (mTOR) is a critical regulator of protein synthesis, cell proliferation and energy metabolism. As constitutive knockout of Mtor leads to embryonic lethality, the in vivo function of mTOR in perinatal development and postnatal growth of heart is not well defined. In this study, we established a muscle-specific mTOR conditional knockout mouse model (mTOR-mKO) by crossing MCK-Cre and Mtor flox/flox mice. Although the mTOR-mKO mice survived embryonic and perinatal development, they exhibited severe postnatal growth retardation, cardiac muscle pathology and premature death. At the cellular level, the cardiac muscle of mTOR-mKO mice had fewer cardiomyocytes due to apoptosis and necrosis, leading to dilated cardiomyopathy. At the molecular level, the cardiac muscle of mTOR-mKO mice expressed lower levels of fatty acid oxidation and glycolysis related genes compared to the WT littermates. In addition, the mTOR-mKO cardiac muscle had reduced Myh6 but elevated Myh7 expression, indicating cardiac muscle degeneration. Furthermore, deletion of Mtor dramatically decreased the phosphorylation of S6 and AKT, two key targets downstream of mTORC1 and mTORC2 mediating the normal function of mTOR. These results demonstrate that mTOR is essential for cardiomyocyte survival and cardiac muscle function

  15. Gene expression response to EWS–FLI1 in mouse embryonic cartilage

    Directory of Open Access Journals (Sweden)

    Miwa Tanaka

    2014-12-01

    Full Text Available Ewing's sarcoma is a rare bone tumor that affects children and adolescents. We have recently succeeded to induce Ewing's sarcoma-like small round cell tumor in mice by expression of EWS–ETS fusion genes in murine embryonic osteochondrogenic progenitors. The Ewing's sarcoma precursors are enriched in embryonic superficial zone (eSZ cells of long bone. To get insights into the mechanisms of Ewing's sarcoma development, gene expression profiles between EWS–FLI1-sensitive eSZ cells and EWS–FLI1-resistant embryonic growth plate (eGP cells were compared using DNA microarrays. Gene expression of eSZ and eGP cells (total, 30 samples was evaluated with or without EWS–FLI1 expression 0, 8 or 48 h after gene transduction. Our data provide useful information for gene expression responses to fusion oncogenes in human sarcoma.

  16. Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex

    Directory of Open Access Journals (Sweden)

    Okada Yasukazu

    2010-04-01

    Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.

  17. Global analysis of transcriptome responses and gene expression profiles to cold stress of Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2013-01-01

    Jatropha curcas L., also called the Physic nut, is an oil-rich shrub with multiple uses, including biodiesel production, and is currently exploited as a renewable energy resource in many countries. Nevertheless, because of its origin from the tropical MidAmerican zone, J. curcas confers an inherent but undesirable characteristic (low cold resistance) that may seriously restrict its large-scale popularization. This adaptive flaw can be genetically improved by elucidating the mechanisms underlying plant tolerance to cold temperatures. The newly developed Illumina Hiseq™ 2000 RNA-seq and Digital Gene Expression (DGE) are deep high-throughput approaches for gene expression analysis at the transcriptome level, using which we carefully investigated the gene expression profiles in response to cold stress to gain insight into the molecular mechanisms of cold response in J. curcas. In total, 45,251 unigenes were obtained by assembly of clean data generated by RNA-seq analysis of the J. curcas transcriptome. A total of 33,363 and 912 complete or partial coding sequences (CDSs) were determined by protein database alignments and ESTScan prediction, respectively. Among these unigenes, more than 41.52% were involved in approximately 128 known metabolic or signaling pathways, and 4,185 were possibly associated with cold resistance. DGE analysis was used to assess the changes in gene expression when exposed to cold condition (12°C) for 12, 24, and 48 h. The results showed that 3,178 genes were significantly upregulated and 1,244 were downregulated under cold stress. These genes were then functionally annotated based on the transcriptome data from RNA-seq analysis. This study provides a global view of transcriptome response and gene expression profiling of J. curcas in response to cold stress. The results can help improve our current understanding of the mechanisms underlying plant cold resistance and favor the screening of crucial genes for genetically enhancing cold resistance

  18. Global analysis of transcriptome responses and gene expression profiles to cold stress of Jatropha curcas L.

    Directory of Open Access Journals (Sweden)

    Haibo Wang

    Full Text Available BACKGROUND: Jatropha curcas L., also called the Physic nut, is an oil-rich shrub with multiple uses, including biodiesel production, and is currently exploited as a renewable energy resource in many countries. Nevertheless, because of its origin from the tropical MidAmerican zone, J. curcas confers an inherent but undesirable characteristic (low cold resistance that may seriously restrict its large-scale popularization. This adaptive flaw can be genetically improved by elucidating the mechanisms underlying plant tolerance to cold temperatures. The newly developed Illumina Hiseq™ 2000 RNA-seq and Digital Gene Expression (DGE are deep high-throughput approaches for gene expression analysis at the transcriptome level, using which we carefully investigated the gene expression profiles in response to cold stress to gain insight into the molecular mechanisms of cold response in J. curcas. RESULTS: In total, 45,251 unigenes were obtained by assembly of clean data generated by RNA-seq analysis of the J. curcas transcriptome. A total of 33,363 and 912 complete or partial coding sequences (CDSs were determined by protein database alignments and ESTScan prediction, respectively. Among these unigenes, more than 41.52% were involved in approximately 128 known metabolic or signaling pathways, and 4,185 were possibly associated with cold resistance. DGE analysis was used to assess the changes in gene expression when exposed to cold condition (12°C for 12, 24, and 48 h. The results showed that 3,178 genes were significantly upregulated and 1,244 were downregulated under cold stress. These genes were then functionally annotated based on the transcriptome data from RNA-seq analysis. CONCLUSIONS: This study provides a global view of transcriptome response and gene expression profiling of J. curcas in response to cold stress. The results can help improve our current understanding of the mechanisms underlying plant cold resistance and favor the screening of

  19. Icotinib combined with rapamycin in a renal transplant recipient with epidermal growth factor receptor-mutated non-small cell lung cancer: A case report.

    Science.gov (United States)

    Zhao, Qiong; Wang, Yina; Tang, Yemin; Peng, Ling

    2014-01-01

    As kidney transplant recipients are at increased risk of developing cancer, regular monitoring should be undertaken to monitor the balance between immunosuppression and graft function and to identify malignancy. The present study reports the outcome of the treatment of adenocarcinoma of the lung (T1aN0M1a, stage IV) using the molecular-targeted therapy, icotinib, in a 66-year-old male renal transplant patient receiving rapamycin and prednisolone as ongoing renal immunosuppressive therapy. An initial partial response to icotinib was achieved, and graft function remained good. However, the patient subsequently developed interstitial pneumonitis. The plasma concentrations of rapamycin and icotinib were within the normal ranges, which excluded the possibility of a pharmacokinetic drug interaction and indicated that the interstitial pneumonitis was likely to be associated with the side-effects of icotinib. Drug therapy was discontinued and the patient underwent a segmentectomy. Tacrolimus was administered for ongoing renal graft immunosuppression. To the best of our knowledge, this is the first report of the concomitant administration of icotinib and rapamycin in post-transplant de novo lung cancer. It is also the first report of interstitial pneumonitis associated with icotinib in a post-transplant patient.

  20. MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    He, Qiuling; Zhu, Shuijin; Zhang, Baohong

    2014-09-01

    MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.

  1. Calmodulin Gene Expression in Response to Mechanical Wounding and Botrytis cinerea Infection in Tomato Fruit

    Directory of Open Access Journals (Sweden)

    Hui Peng

    2014-08-01

    Full Text Available Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen inoculation triggered expression of all those genes, with SlCaM2 being the most responsive one to both treatments. Furthermore, all calmodulin genes were upregulated by salicylic acid and methyl jasmonate, two signaling molecules involved in plant immunity. In addition to SlCaM2, SlCaM1 was highly responsive to salicylic acid and methyl jasmonate. However, SlCaM2 exhibited a more rapid and stronger response than SlCaM1. Overexpression of SlCaM2 in tomato fruit enhanced resistance to Botrytis-induced decay, whereas reducing its expression resulted in increased lesion development. These results indicate that calmodulin is a positive regulator of plant defense in fruit by activating defense pathways including salicylate- and jasmonate-signaling pathways, and SlCaM2 is the major calmodulin gene responsible for this event.

  2. GENE RESPONSE OF THE GASTROCNEMIUS AND SOLEUS MUSCLES TO AN ACUTE AEROBIC RUN IN RATS

    Directory of Open Access Journals (Sweden)

    Michael J. McKenzie

    2011-06-01

    Full Text Available Genes can be activated or inhibited by signals within the tissues in response to an acute bout of exercise. It is unclear how a particular aerobic exercise bout may influence two muscles with similar actions to the activity. Therefore, the purposes of this investigation was to determine the gene response of selected genes involved in the "stress" response of the gastrocnemius (fast-twitch and soleus (slow-twitch muscles to a single two hour aerobic exercise bout in female Sprague-Dawley Rats at the 1 hour time point after the exercise. Exercised rats were run (n=8 for 2 hours at 20 m.min-1 and one hour after the completion of the bout had their soleus (S and gastrocnemius (G muscles removed. Age and timed matched sedentary control rats had both S and G muscles removed also. RNA was isolated from all muscles. Real-time PCR analysis was performed on the following genes: NFκB, TNFα, and Atf3. GAPDH was used as the housekeeping gene for both muscles. S muscle showed more genes altered (n = 52 vs G (n = 26. NFκB gene expression was 0.83 ± 0.14 in the exercised S but was + 1.36 ± 0.58 in the exercised G and was not significantly different between the muscles. TNFα was altered 1.30 ± 0. 34 in the exercised S and 1.36 ± 0.71 in the exercised G and was not significantly different between the muscles. The gene Atf3 was significantly altered at 4.97 ± 1.01 in the exercised S, while it was not significantly altered in the exercised G (0.70 ± 0.55. This study demonstrates that an acute bout of aerobic exercise can alter gene expression to a different extent in both the S and G muscles. It is highly likely that muscle recruitment was a factor which influenced the gene expression in theses muscles. It is interesting to note that some genes were similarly activated in these two muscles but other genes may demonstrate a varied response to the same exercise bout depending on the type of muscle

  3. Identification and Characterization of Pathogen-Response Genes (repat) in Spodoptera frugiperda (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Machado, Vilmar; Serrano, Jose; Galián, Jose

    2016-01-01

    The fall armyworm (Spodoptera frugiperda, Noctuidae, Lepidoptera) is one of the most important crop pests in the Americas, causing significant damage to maize, rice and sorghum. The mechanisms that determine its defences against pathogens are particularly relevant for the development of management and control strategies. We used an in silico approach to identify and characterize pathogen response genes (repat) present in different tissue libraries of S. fugiperda. The analyses revealed complete cDNA for nine repat genes; of these, repat15 and repat39 were found in libraries from a specific tissue--the midgut of larvae fed with xenobiotic substances. High expression levels of some genes were found in different libraries: 39 hits in repat30 in challenged hemocytes, 16 hits in repat31 in fat body, 10 hits in repat32 in fat body and 10 in challenged hemocytes, and 10 hits in repat38 in midgut of non-treated larvae and midgut of larvae fed with natural and xenobiotic substances. The genes corresponded to two ontology categories, stress response and immune response, and their phylogenetic relationships, nucleotide similarity, number of amino acid residues and molecular weights agree with what has been described for repat genes. It is noteworthy that proteins encoded by the repat genes of S. frugiperda have important defence functions in other tissues beyond midgut and that their functional categories are likely diverse, as they are related to cell envelope structure, energy metabolism, transport and binding.

  4. Anaplasma phagocytophilum and Anaplasma marginale Elicit Different Gene Expression Responses in Cultured Tick Cells

    Directory of Open Access Journals (Sweden)

    Zorica Zivkovic

    2009-01-01

    Full Text Available The genus Anaplasma (Rickettsiales: Anaplasmataceae includes obligate tick-transmitted intracellular organisms, Anaplasma phagocytophilum and Anaplasma marginale that multiply in both vertebrate and tick host cells. Recently, we showed that A. marginale affects the expression of tick genes that are involved in tick survival and pathogen infection and multiplication. However, the gene expression profile in A. phagocytophilum-infected tick cells is currently poorly characterized. The objectives of this study were to characterize tick gene expression profile in Ixodes scapularis ticks and cultured ISE6 cells in response to infection with A. phagocypthilum and to compare tick gene expression responses in A. phagocytophilum- and A. marginale-infected tick cells by microarray and real-time RT-PCR analyses. The results of these studies demonstrated modulation of tick gene expression by A. phagocytophilum and provided evidence of different gene expression responses in tick cells infected with A. phagocytophilum and A. marginale. These differences in Anaplasma-tick interactions may reflect differences in pathogen life cycle in the tick cells.

  5. Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection

    Directory of Open Access Journals (Sweden)

    Yiming Wang

    2014-12-01

    Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

  6. Identification and network-enabled characterization of auxin response factor genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    David J. Burks

    2016-12-01

    Full Text Available The Auxin Response Factor (ARF family of transcription factors is an important regulator of environmental response and symbiotic nodulation in the legume Medicago truncatula. While previous studies have identified members of this family, a recent spurt in gene expression data coupled with genome update and reannotation calls for a reassessment of the prevalence of ARF genes and their interaction networks in M. truncatula. We performed a comprehensive analysis of the M. truncatula genome and transcriptome that entailed search for novel ARF genes and the co-expression networks. Our investigation revealed 8 novel M. truncatula ARF (MtARF genes, of the total 22 identified, and uncovered novel gene co-expression networks as well. Furthermore, the topological clustering and single enrichment analysis of several network models revealed the roles of individual members of the MtARF family in nitrogen regulation, nodule initiation, and post-embryonic development through a specialized protein packaging and secretory pathway. In summary, this study not just shines new light on an important gene family, but also provides a guideline for identification of new members of gene families and their functional characterization through network analyses.

  7. Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes

    Directory of Open Access Journals (Sweden)

    Siré Christelle

    2008-03-01

    Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and

  8. Pharmacokinetics of orally administered low-dose rapamycin in healthy dogs.

    Science.gov (United States)

    Larson, Jeanne C; Allstadt, Sara D; Fan, Timothy M; Khanna, Chand; Lunghofer, Paul J; Hansen, Ryan J; Gustafson, Daniel L; Legendre, Alfred M; Galyon, Gina D; LeBlanc, Amy K; Martin-Jimenez, Tomas

    2016-01-01

    To determine the pharmacokinetics of orally administered rapamycin in healthy dogs. 5 healthy purpose-bred hounds. The study consisted of 2 experiments. In experiment 1, each dog received rapamycin (0.1 mg/kg, PO) once; blood samples were obtained immediately before and at 0.5, 1, 2, 4, 6, 12, 24, 48, and 72 hours after administration. In experiment 2, each dog received rapamycin (0.1 mg/kg, PO) once daily for 5 days; blood samples were obtained immediately before and at 3, 6, 24, 27, 30, 48, 51, 54, 72, 75, 78, 96, 96.5, 97, 98, 100, 102, 108, 120, 144, and 168 hours after the first dose. Blood rapamycin concentration was determined by a validated liquid chromatography-tandem mass spectrometry assay. Pharmacokinetic parameters were determined by compartmental and noncompartmental analyses. Mean ± SD blood rapamycin terminal half-life, area under the concentration-time curve from 0 to 48 hours after dosing, and maximum concentration were 38.7 ± 12.7 h, 140 ± 23.9 ng•h/mL, and 8.39 ± 1.73 ng/mL, respectively, for experiment 1, and 99.5 ± 89.5 h, 126 ± 27.1 ng•h/mL, and 5.49 ± 1.99 ng/mL, respectively, for experiment 2. Pharmacokinetic parameters for rapamycin after administration of 5 daily doses differed significantly from those after administration of 1 dose. Results indicated that oral administration of low-dose (0.1 mg/kg) rapamycin to healthy dogs achieved blood concentrations measured in nanograms per milliliter. The optimal dose and administration frequency of rapamcyin required to achieve therapeutic effects in tumor-bearing dogs, as well as toxicity after chronic dosing, need to be determined.

  9. Mammalian target of rapamycin (mTOR): a central regulator of male fertility?

    Science.gov (United States)

    Jesus, Tito T; Oliveira, Pedro F; Sousa, Mário; Cheng, C Yan; Alves, Marco G

    2017-06-01

    Mammalian target of rapamycin (mTOR) is a central regulator of cellular metabolic phenotype and is involved in virtually all aspects of cellular function. It integrates not only nutrient and energy-sensing pathways but also actin cytoskeleton organization, in response to environmental cues including growth factors and cellular energy levels. These events are pivotal for spermatogenesis and determine the reproductive potential of males. Yet, the molecular mechanisms by which mTOR signaling acts in male reproductive system remain a matter of debate. Here, we review the current knowledge on physiological and molecular events mediated by mTOR in testis and testicular cells. In recent years, mTOR inhibition has been explored as a prime strategy to develop novel therapeutic approaches to treat cancer, cardiovascular disease, autoimmunity, and metabolic disorders. However, the physiological consequences of mTOR dysregulation and inhibition to male reproductive potential are still not fully understood. Compelling evidence suggests that mTOR is an arising regulator of male fertility and better understanding of this atypical protein kinase coordinated action in testis will provide insightful information concerning its biological significance in other tissues/organs. We also discuss why a new generation of mTOR inhibitors aiming to be used in clinical practice may also need to include an integrative view on the effects in male reproductive system.

  10. Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.

    Science.gov (United States)

    Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L

    2017-08-01

    Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

  11. Gene Expression Programs in Response to Hypoxia: Cell Type Specificity and Prognostic Significance in Human Cancers.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available BACKGROUND: Inadequate oxygen (hypoxia triggers a multifaceted cellular response that has important roles in normal physiology and in many human diseases. A transcription factor, hypoxia-inducible factor (HIF, plays a central role in the hypoxia response; its activity is regulated by the oxygen-dependent degradation of the HIF-1alpha protein. Despite the ubiquity and importance of hypoxia responses, little is known about the variation in the global transcriptional response to hypoxia among different cell types or how this variation might relate to tissue- and cell-specific diseases. METHODS AND FINDINGS: We analyzed the temporal changes in global transcript levels in response to hypoxia in primary renal proximal tubule epithelial cells, breast epithelial cells, smooth muscle cells, and endothelial cells with DNA microarrays. The extent of the transcriptional response to hypoxia was greatest in the renal tubule cells. This heightened response was associated with a uniquely high level of HIF-1alpha RNA in renal cells, and it could be diminished by reducing HIF-1alpha expression via RNA interference. A gene-expression signature of the hypoxia response, derived from our studies of cultured mammary and renal tubular epithelial cells, showed coordinated variation in several human cancers, and was a strong predictor of clinical outcomes in breast and ovarian cancers. In an analysis of a large, published gene-expression dataset from breast cancers, we found that the prognostic information in the hypoxia signature was virtually independent of that provided by the previously reported wound signature and more predictive of outcomes than any of the clinical parameters in current use. CONCLUSIONS: The transcriptional response to hypoxia varies among human cells. Some of this variation is traceable to variation in expression of the HIF1A gene. A gene-expression signature of the cellular response to hypoxia is associated with a significantly poorer prognosis

  12. A core filamentation response network in Candida albicans is restricted to eight genes.

    Directory of Open Access Journals (Sweden)

    Ronny Martin

    Full Text Available Although morphological plasticity is a central virulence trait of Candida albicans, the number of filament-associated genes and the interplay of mechanisms regulating their expression remain unknown. By correlation-based network modeling of the transcriptional response to different defined external stimuli for morphogenesis we identified a set of eight genes with highly correlated expression patterns, forming a core filamentation response. This group of genes included ALS3, ECE1, HGT2, HWP1, IHD1 and RBT1 which are known or supposed to encode for cell- wall associated proteins as well as the Rac1 guanine nucleotide exchange factor encoding gene DCK1 and the unknown function open reading frame orf19.2457. The validity of network modeling was confirmed using a dataset of advanced complexity that describes the transcriptional response of C. albicans during epithelial invasion as well as comparing our results with other previously published transcriptome studies. Although the set of core filamentation response genes was quite small, several transcriptional regulators are involved in the control of their expression, depending on the environmental condition.

  13. Identification of Arabidopsis candidate genes in response to biotic and abiotic stresses using comparative microarrays.

    Directory of Open Access Journals (Sweden)

    Arjun Sham

    Full Text Available Plants have evolved with intricate mechanisms to cope with multiple environmental stresses. To adapt with biotic and abiotic stresses, plant responses involve changes at the cellular and molecular levels. The current study was designed to investigate the effects of combinations of different environmental stresses on the transcriptome level of Arabidopsis genome using public microarray databases. We investigated the role of cyclopentenones in mediating plant responses to environmental stress through TGA (TGACG motif-binding factor transcription factor, independently from jasmonic acid. Candidate genes were identified by comparing plants inoculated with Botrytis cinerea or treated with heat, salt or osmotic stress with non-inoculated or non-treated tissues. About 2.5% heat-, 19% salinity- and 41% osmotic stress-induced genes were commonly upregulated by B. cinerea-treatment; and 7.6%, 19% and 48% of genes were commonly downregulated by B. cinerea-treatment, respectively. Our results indicate that plant responses to biotic and abiotic stresses are mediated by several common regulatory genes. Comparisons between transcriptome data from Arabidopsis stressed-plants support our hypothesis that some molecular and biological processes involved in biotic and abiotic stress response are conserved. Thirteen of the common regulated genes to abiotic and biotic stresses were studied in detail to determine their role in plant resistance to B. cinerea. Moreover, a T-DNA insertion mutant of the Responsive to Dehydration gene (rd20, encoding for a member of the caleosin (lipid surface protein family, showed an enhanced sensitivity to B. cinerea infection and drought. Overall, the overlapping of plant responses to abiotic and biotic stresses, coupled with the sensitivity of the rd20 mutant, may provide new interesting programs for increased plant resistance to multiple environmental stresses, and ultimately increases its chances to survive. Future research

  14. Esophageal cancer related gene-4 is a choroid plexus-derived injury response gene: evidence for a biphasic response in early and late brain injury.

    Directory of Open Access Journals (Sweden)

    Sonia Podvin

    Full Text Available By virtue of its ability to regulate the composition of cerebrospinal fluid (CSF, the choroid plexus (CP is ideally suited to instigate a rapid response to traumatic brain injury (TBI by producing growth regulatory proteins. For example, Esophageal Cancer Related Gene-4 (Ecrg4 is a tumor suppressor gene that encodes a hormone-like peptide called augurin that is present in large concentrations in CP epithelia (CPe. Because augurin is thought to regulate senescence, neuroprogenitor cell growth and differentiation in the CNS, we evaluated the kinetics of Ecrg4 expression and augurin immunoreactivity in CPe after CNS injury. Adult rats were injured with a penetrating cortical lesion and alterations in augurin immunoreactivity were examined by immunohistochemistry. Ecrg4 gene expression was characterized by in situ hybridization. Cell surface augurin was identified histologically by confocal microscopy and biochemically by sub-cellular fractionation. Both Ecrg4 gene expression and augurin protein levels were decreased 24-72 hrs post-injury but restored to uninjured levels by day 7 post-injury. Protein staining in the supraoptic nucleus of the hypothalamus, used as a control brain region, did not show a decrease of auguin immunoreactivity. Ecrg4 gene expression localized to CPe cells, and augurin protein to the CPe ventricular face. Extracellular cell surface tethering of 14 kDa augurin was confirmed by cell surface fractionation of primary human CPe cells in vitro while a 6-8 kDa fragment of augurin was detected in conditioned media, indicating release from the cell surface by proteolytic processing. In rat CSF however, 14 kDa augurin was detected. We hypothesize the initial release and proteolytic processing of augurin participates in the activation phase of injury while sustained Ecrg4 down-regulation is dysinhibitory during the proliferative phase. Accordingly, augurin would play a constitutive inhibitory function in normal CNS while down

  15. Global gene expression analysis of early response to chemotherapy treatment in ovarian cancer spheroids

    Directory of Open Access Journals (Sweden)

    Tetu Bernard

    2008-02-01

    Full Text Available Abstract Background Chemotherapy (CT resistance in ovarian cancer (OC is broad and encompasses diverse unrelated drugs, suggesting more than one mechanism of resistance. To better understand the molecular mechanisms controlling the immediate response of OC cells to CT exposure, we have performed gene expression profiling in spheroid cultures derived from six OC cell lines (OVCAR3, SKOV3, TOV-112, TOV-21, OV-90 and TOV-155, following treatment with 10,0 μM cisplatin, 2,5 μM paclitaxel or 5,0 μM topotecan for 72 hours. Results Exposure of OC spheroids to these CT drugs resulted in differential expression of genes associated with cell growth and proliferation, cellular assembly and organization, cell death, cell cycle control and cell signaling. Genes, functionally involved in DNA repair, DNA replication and cell cycle arrest were mostly overexpressed, while genes implicated in metabolism (especially lipid metabolism, signal transduction, immune and inflammatory response, transport, transcription regulation and protein biosynthesis, were commonly suppressed following all treatments. Cisplatin and topotecan treatments triggered similar alterations in gene and pathway expression patterns, while paclitaxel action was mainly associated with induction of genes and pathways linked to cellular assembly and organization (including numerous tubulin genes, cell death and protein synthesis. The microarray data were further confirmed by pathway and network analyses. Conclusion Most alterations in gene expression were directly related to mechanisms of the cytotoxics actions in OC spheroids. However, the induction of genes linked to mechanisms of DNA replication and repair in cisplatin- and topotecan-treated OC spheroids could be associated with immediate adaptive response to treatment. Similarly, overexpression of different tubulin genes upon exposure to paclitaxel could represent an early compensatory effect to this drug action. Finally, multicellular

  16. Snapshot of iron response in Shewanella oneidensis by gene network reconstruction

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yunfeng; Harris, Daniel P.; Luo, Feng; Xiong, Wenlu; Joachimiak, Marcin; Wu, Liyou; Dehal, Paramvir; Jacobsen, Janet; Yang, Zamin; Palumbo, Anthony V.; Arkin, Adam P.; Zhou, Jizhong

    2008-10-09

    Background: Iron homeostasis of Shewanella oneidensis, a gamma-proteobacterium possessing high iron content, is regulated by a global transcription factor Fur. However, knowledge is incomplete about other biological pathways that respond to changes in iron concentration, as well as details of the responses. In this work, we integrate physiological, transcriptomics and genetic approaches to delineate the iron response of S. oneidensis. Results: We show that the iron response in S. oneidensis is a rapid process. Temporal gene expression profiles were examined for iron depletion and repletion, and a gene co-expression network was reconstructed. Modules of iron acquisition systems, anaerobic energy metabolism and protein degradation were the most noteworthy in the gene network. Bioinformatics analyses suggested that genes in each of the modules might be regulated by DNA-binding proteins Fur, CRP and RpoH, respectively. Closer inspection of these modules revealed a transcriptional regulator (SO2426) involved in iron acquisition and ten transcriptional factors involved in anaerobic energy metabolism. Selected genes in the network were analyzed by genetic studies. Disruption of genes encoding a putative alcaligin biosynthesis protein (SO3032) and a gene previously implicated in protein degradation (SO2017) led to severe growth deficiency under iron depletion conditions. Disruption of a novel transcriptional factor (SO1415) caused deficiency in both anaerobic iron reduction and growth with thiosulfate or TMAO as an electronic acceptor, suggesting that SO1415 is required for specific branches of anaerobic energy metabolism pathways. Conclusions: Using a reconstructed gene network, we identified major biological pathways that were differentially expressed during iron depletion and repletion. Genetic studies not only demonstrated the importance of iron acquisition and protein degradation for iron depletion, but also characterized a novel transcriptional factor (SO1415) with a

  17. Induction of cytochrome P450 1 genes and stress response genes in developing zebrafish exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Behrendt, Lars [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Joensson, Maria E. [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Department of Environmental Toxicology, Uppsala University (Sweden); Goldstone, Jared V. [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States)

    2010-06-01

    Ultraviolet (UV) radiation damages cell molecules, and has been suggested to up-regulate mammalian cytochrome P4501 (CYP1) genes through an aryl hydrocarbon receptor (AHR) mediated mechanism. In this study, embryos and larvae of zebrafish (Danio rerio) were exposed to UV to determine the effects on expression of CYP1 and stress response genes in vivo in these fish. Zebrafish embryos were exposed for varying times to UV on two consecutive days, with exposure beginning at 24 and 48 h post-fertilization (hpf). Embryos exposed for 2, 4 or 6 h twice over 2 days to UVB (0.62 W/m{sup 2}; 8.9-26.7 kJ/m{sup 2}) plus UVA (2.05 W/m{sup 2}; 29.5-144.6 kJ/m{sup 2}) had moderately (2.4 {+-} 0.8-fold) but significantly up-regulated levels of CYP1A. UVA alone had no effect on CYP1A expression. Proliferating cellular nuclear antigen (PCNA) and Cu-Zn superoxide dismutase (SOD1) transcript levels were induced (2.1 {+-} 0.2 and 2.3 {+-} 0.5-fold, respectively) in embryos exposed to two 6-h pulses of 0.62 W/m{sup 2} UVB (26.8 kJ/m{sup 2}). CYP1A was induced also in embryos exposed to higher intensity UVB (0.93 W/m{sup 2}) for two 3-h or two 4-h pulses (20.1 or 26.8 kJ/m{sup 2}). CYP1B1, SOD1 and PCNA expression was induced by the two 3-h pulses of the higher intensity UVB, but not after two 4-h pulses of the higher intensity UVB, possibly due to impaired condition of surviving embryos, reflected in a mortality of 34% at that UVB dose. A single 8-h long exposure of zebrafish larvae (8 dpf) to UVB at 0.93 W/m{sup 2} (26.8 kJ/m{sup 2}) significantly induced CYP1A and CYP1B1 expression, but other CYP1 genes (CYP1C1, CYP1C2 and CYP1D1) showed no significant increase. The results show that UVB can induce expression of CYP1 genes as well stress response genes in developing zebrafish, and that UVB intensity and duration influence the responses.

  18. Drought response in wheat: key genes and regulatory mechanisms controlling root system architecture and transpiration efficiency

    Science.gov (United States)

    Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh

    2017-12-01

    Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome

  19. Construction and comparison of gene co-expression networks shows complex plant immune responses

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Leal

    2014-10-01

    Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

  20. A WRKY gene from Tamarix hispida, ThWRKY4, mediates abiotic stress responses by modulating reactive oxygen species and expression of stress-responsive genes.

    Science.gov (United States)

    Zheng, Lei; Liu, Guifeng; Meng, Xiangnan; Liu, Yujia; Ji, Xiaoyu; Li, Yanbang; Nie, Xianguang; Wang, Yucheng

    2013-07-01

    WRKY transcription factors are involved in various biological processes, such as development, metabolism and responses to stress. However, their exact roles in abiotic stress tolerance are largely unknown. Here, we demonstrated a working model for the function of a WRKY gene (ThWRKY4) from Tamarix hispida in the stress response. ThWRKY4 is highly induced by abscisic acid (ABA), salt and drought in the early period of stress (stress for 3, 6, or 9 h), which can be regulated by ABF (ABRE binding factors) and Dof (DNA binding with one finger), and also can be crossregulated by other WRKYs and autoregulated as well. Overexpression of ThWRKY4 conferred tolerance to salt, oxidative and ABA treatment in transgenic plants. ThWRKY4 can improve the tolerance to salt and ABA treatment by improving activities of superoxide dismutase and peroxidase, decreasing levels of O2 (-) and H2O2, reducing electrolyte leakage, keeping the loss of chlorophyll, and protecting cells from death. Microarray analyses showed that overexpression of ThWRKY4 in Arabidopsis leads to 165 and 100 genes significantly up- and downregulated, respectively. Promoter scanning analysis revealed that ThWRKY4 regulates the gene expression via binding to W-box motifs present in their promoter regions. This study shows that ThWRKY4 functions as a transcription factor to positively modulate abiotic stress tolerances, and is involved in modulating reactive oxygen species.

  1. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  2. Comparison of Fusarium graminearum transcriptomes on living or dead wheat differentiates substrate-responsive and defense-responsive genes.

    Directory of Open Access Journals (Sweden)

    Stefan Boedi

    2016-07-01

    Full Text Available Fusarium graminearum is an opportunistic pathogen of cereals where it causes severe yield losses and concomitant mycotoxin contamination of the grains. The pathogen has mixed biotrophic and necrotrophic (saprophytic growth phases during infection and the regulatory networks associated with these phases have so far always been analyzed together. In this study we compared the transcriptomes of fungal cells infecting a living, actively defending plant representing the mixed live style (pathogenic growth on living flowering wheat heads to the response of the fungus infecting identical, but dead plant tissues (cold-killed flowering wheat heads representing strictly saprophytic conditions. We found that the living plant actively suppressed fungal growth and promoted much higher toxin production in comparison to the identical plant tissue without metabolism suggesting that molecules signaling secondary metabolite induction are not pre-existing or not stable in the plant in sufficient amounts before infection. Differential gene expression analysis was used to define gene sets responding to the active or the passive plant as main impact factor and driver for gene expression. We correlated our results to the published F. graminearum transcriptomes, proteomes and secretomes and found that only a limited number of in planta- expressed genes require the living plant for induction but the majority uses simply the plant tissue as signal. Many secondary metabolite (SM gene clusters show a heterogeneous expression pattern within the cluster indicating that different genetic or epigenetic signals govern the expression of individual genes within a physically linked cluster. Our bioinformatic approach also identified fungal genes which were actively repressed by signals derived from the active plant and may thus represent direct targets of the plant defense against the invading pathogen.

  3. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  4. Restoration of Corticosteroid Sensitivity in Chronic Obstructive Pulmonary Disease by Inhibition of Mammalian Target of Rapamycin.

    Science.gov (United States)

    Mitani, Akihisa; Ito, Kazuhiro; Vuppusetty, Chaitanya; Barnes, Peter J; Mercado, Nicolas

    2016-01-15

    Corticosteroid resistance is a major barrier to the effective treatment of chronic obstructive pulmonary disease (COPD). Several molecular mechanisms have been proposed, such as activations of the phosphoinositide-3-kinase/Akt pathway and p38 mitogen-activated protein kinase. However, the mechanism for corticosteroid resistance is still not fully elucidated. To investigate the role of mammalian target of rapamycin (mTOR) in corticosteroid sensitivity in COPD. The corticosteroid sensitivity of peripheral blood mononuclear cells collected from patients with COPD, smokers, and nonsmoking control subjects, or of human monocytic U937 cells exposed to cigarette smoke extract (CSE), was quantified as the dexamethasone concentration required to achieve 30% inhibition of tumor necrosis factor-α-induced CXCL8 production in the presence or absence of the mTOR inhibitor rapamycin. mTOR activity was determined as the phosphorylation of p70 S6 kinase, using Western blotting. mTOR activity was increased in peripheral blood mononuclear cells from patients with COPD, and treatment with rapamycin inhibited this as well as restoring corticosteroid sensitivity. In U937 cells, CSE stimulated mTOR activity and c-Jun expression, but pretreatment with rapamycin inhibited both and also reversed CSE-induced corticosteroid insensitivity. mTOR inhibition by rapamycin restores corticosteroid sensitivity via inhibition of c-Jun expression, and thus mTOR is a potential novel therapeutic target for COPD.

  5. Identification and expression analysis of cold and freezing stress responsive genes of Brassica oleracea.

    Science.gov (United States)

    Ahmed, Nasar Uddin; Jung, Hee-Jeong; Park, Jong-In; Cho, Yong-Gu; Hur, Yoonkang; Nou, Ill-Sup

    2015-01-10

    Cold and freezing stress is a major environmental constraint to the production of Brassica crops. Enhancement of tolerance by exploiting cold and freezing tolerance related genes offers the most efficient approach to address this problem. Cold-induced transcriptional profiling is a promising approach to the identification of potential genes related to cold and freezing stress tolerance. In this study, 99 highly expressed genes were identified from a whole genome microarray dataset of Brassica rapa. Blast search analysis of the Brassica oleracea database revealed the corresponding homologous genes. To validate their expression, pre-selected cold tolerant and susceptible cabbage lines were analyzed. Out of 99 BoCRGs, 43 were differentially expressed in response to varying degrees of cold and freezing stress in the contrasting cabbage lines. Among the differentially expressed genes, 18 were highly up-regulated in the tolerant lines, which is consistent with their microarray expression. Additionally, 12 BoCRGs were expressed differentially after cold stress treatment in two contrasting cabbage lines, and BoCRG54, 56, 59, 62, 70, 72 and 99 were predicted to be involved in cold regulatory pathways. Taken together, the cold-responsive genes identified in this study provide additional direction for elucidating the regulatory network of low temperature stress tolerance and developing cold and freezing stress resistant Brassica crops. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    Directory of Open Access Journals (Sweden)

    Anastasia V. Ponasenko

    2017-01-01

    Full Text Available Infective endocarditis (IE is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE.

  7. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    Science.gov (United States)

    Rutkovskaya, Natalia V.; Kondyukova, Natalia V.; Odarenko, Yuri N.; Kazachek, Yana V.; Tsepokina, Anna V.; Barbarash, Leonid S.

    2017-01-01

    Infective endocarditis (IE) is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE. PMID:28659664

  8. Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses

    Directory of Open Access Journals (Sweden)

    Redon Emma

    2008-07-01

    Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis

  9. Gene expression profiles responses to aphid feeding in chrysanthemum (Chrysanthemum morifolium).

    Science.gov (United States)

    Xia, Xiaolong; Shao, Yafeng; Jiang, Jiafu; Ren, Liping; Chen, Fadi; Fang, Weimin; Guan, Zhiyong; Chen, Sumei

    2014-12-02

    Chrysanthemum is an important ornamental plant all over the world. It is easily attacked by aphid, Macrosiphoniella sanbourni. The molecular mechanisms of plant defense responses to aphid are only partially understood. Here, we investigate the gene expression changes in response to aphid feeding in chrysanthemum leaf by RNA-Seq technology. Three libraries were generated from pooled leaf tissues of Chrysanthemum morifolium 'nannongxunzhang' that were collected at different time points with (Y) or without (CK) aphid infestations and mock puncture treatment (Z), and sequenced using an Illumina HiSeqTM 2000 platform. A total of 7,363,292, 7,215,860 and 7,319,841 clean reads were obtained in library CK, Y and Z, respectively. The proportion of clean reads was >97.29% in each library. Approximately 76.35% of the clean reads were mapped to a reference gene database including all known chrysanthemum unigene sequences. 1,157, 527 and 340 differentially expressed genes (DEGs) were identified in the comparison of CK-VS-Y, CK-VS-Z and Z-VS-Y, respectively. These DEGs were involved in phytohormone signaling, cell wall biosynthesis, photosynthesis, reactive oxygen species (ROS) pathway and transcription factor regulatory networks, and so on. Changes in gene expression induced by aphid feeding are shown to be multifaceted. There are various forms of crosstalk between different pathways those genes belonging to, which would allow plants to fine-tune its defense responses.

  10. Calmodulin Gene Expression in Response to Mechanical Wounding and Botrytis cinerea Infection in Tomato Fruit

    OpenAIRE

    Peng, Hui; Yang, Tianbao; Jurick, Wayne M.

    2014-01-01

    Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs) in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen in...

  11. Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Andrea Farini

    2014-01-01

    Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.

  12. Muscle Contraction Induces Acute Hydroxymethylation of the Exercise-Responsive Gene Nr4a3

    DEFF Research Database (Denmark)

    Pattamaprapanont, Pattarawan; Garde, Christian; Fabre, Odile

    2016-01-01

    stimulated over time is required to determine whether contraction-induced demethylation is preceded by changes in the hydroxymethylcytosine level. Here, we established an acute skeletal muscle contraction model to mimic the effects of acute exercise on gene expression. We used this model to investigate...... promoters. Exercise induces dynamic DNA demethylation at gene promoters; however, the contribution of the demethylation precursor hydroxymethylcytosine is unknown. Given the evanescent nature of hydroxymethylcytosine, a muscle contraction model that allows for the collection of samples that are repeatedly...... the effect of muscle contraction on DNA demethylation and hydroxymethylation. First, we performed an acute exercise study in healthy humans to identify an exercise-responsive gene that we could study in culture. We identified the nuclear receptor subfamily 4 group A member 3 (Nr4a3) gene with the highest...

  13. Influence of the xonA gene of Escherichia coli in response to radiation

    International Nuclear Information System (INIS)

    Ponce M, J.; Serment G, J.; Brena V, M.

    2003-01-01

    The Escherichia coli bacteria has a repair and tolerance system known as SOS that works when there is damage in the DNA. However it is necessary that this damage modifies before the system is activated. For this it has intended to the enzymes that degrade DNA like responsible for generating this modifications. It has already been identified to the product of the gene recJ and according to the results that here are presented that of the gene xonA has similar activity. When both genes fail, not alone the activity SOS is inhibited but rather the mortality increases, for ionizing radiation. The above mentioned reinforces the importance of these genes in the recovery to the damage caused to the genome. (Author)

  14. Paradigmenwechsel in der Anti-Aging-Medizin: Hormesis, Target-of-Rapamycin-Komplex und erste Anti-Aging-Pillen // Paradigm Shift in Anti-Aging Medicine: Hormesis, Target of Rapamycin Complex and First Human Anti-Aging-Pills

    Directory of Open Access Journals (Sweden)

    Römmler A

    2016-01-01

    Full Text Available Studies in model organisms have shown that some drugs and lifestyle practices (calorie-restricted diets, regular exercise, e.g. can extend life and health span and protect against the onset of age-related chronic diseases by targeting physiological pathways.brA common mode of action was found via mTOR (mechanistic Target Of Rapamycin pathway signalling. This intracellular protein kinase complex plays a key role in stimulating anabolic and cell growth promoting processes, while inhibiting autophagy. On the other hand, downregulation results in antiproliferative, anticancer and intensive cell-repairing effects leading to life and health span extension and stress resistance. The mTOR complex regulates such basic cell activities and integrates signals from nutrition sensing, energy metabolism, insulin and growth factors, stress and hypoxia.brImportantly, mTOR can be inhibited by some molecules and their analogs (rapamycin, resveratrol, metformin, e.g., which are released naturally from plants, yeast or bacteria to protect against natural enemies. Its dosage resembles an adaptive hormetic response relationship, as high concentrations are toxic and mild doses are associated with anticancer and antiaging effects. This opens up new avenues for their use as „anti-aging pills“ in humans.brRecent human data suggest that metformin, rapamycin and other mTOR-inhibitors could delay heart disease, cancer, cognitive decline and improve survival time in people with diabetes mellitus. In addition, response to influenca vaccine was enhanced by rapamycin in adults with immunosenescence, indicating beneficial anti-aging effects in the elderly.br“Treat aging” is an actual call to recognize aging as an indication appropriate for clinical trials and treatments, as it was recently approved by the Federal Drug Administration (FDA USA. p bKurzfassung/b: Die ansteigende Morbidität und Invalidität in alternden Industrienationen stößt an die Grenzen der Ressourcen

  15. Defining genes using "blueprint" versus "instruction" metaphors: effects for genetic determinism, response efficacy, and perceived control.

    Science.gov (United States)

    Parrott, Roxanne; Smith, Rachel A

    2014-01-01

    Evidence supports mixed attributions aligned with personal and/or clinical control and gene expression for health in this era of genomic science and health care. We consider variance in these attributions and possible relationships to individual mind sets associated with essentialist beliefs that genes determine health versus threat beliefs that genes increase susceptibility for disease and severity linked to gene-environment interactions. Further, we contribute to theory and empirical research to evaluate the use of metaphors to define genes. Participants (N = 324) read a message that varied the introduction by providing a definition of genes that used either an "instruction" metaphor or a "blueprint" metaphor. The "instruction" metaphor compared to the "blueprint" metaphor promoted stronger threat perceptions, which aligned with both belief in the response efficacy of genetic research for health and perceived behavioral control linked to genes and health. The "blueprint" metaphor compared to the "instruction" metaphor promoted stronger essentialist beliefs, which aligned with more intense positive regard for the efficacy of genetic research and human health. Implications for health communicators include societal effects aligned with stigma and discrimination that such findings portend.

  16. Sugarcane genes differentially expressed in response to Puccinia melanocephala infection: identification and transcript profiling.

    Science.gov (United States)

    Oloriz, María I; Gil, Víctor; Rojas, Luis; Portal, Orelvis; Izquierdo, Yovanny; Jiménez, Elio; Höfte, Monica

    2012-05-01

    Brown rust caused by the fungus Puccinia melanocephala is a major disease of sugarcane (Saccharum spp.). A sugarcane mutant, obtained by chemical mutagenesis of the susceptible variety B4362, showed a post-haustorial hypersensitive response (HR)-mediated resistance to the pathogen and was used to identify genes differentially expressed in response to P. melanocephala via suppression subtractive hybridization (SSH). Tester cDNA was derived from the brown rust-resistant mutant after inoculation with P. melanocephala, while driver cDNAs were obtained from the non-inoculated resistant mutant and the inoculated susceptible donor variety B4362. Database comparisons of the sequences of the SSH recombinant clones revealed that, of a subset of 89 non-redundant sequences, 88% had similarity to known functional genes, while 12% were of unknown function. Thirteen genes were selected for transcript profiling in the resistant mutant and the susceptible donor variety. Genes involved in glycolysis and C4 carbon fixation were up-regulated in both interactions probably due to disturbance of sugarcane carbon metabolism by the pathogen. Genes related with the nascent polypeptide associated complex, post-translational proteome modulation and autophagy were transcribed at higher levels in the compatible interaction. Up-regulation of a putative L-isoaspartyl O-methyltransferase S-adenosylmethionine gene in the compatible interaction may point to fungal manipulation of the cytoplasmatic methionine cycle. Genes coding for a putative no apical meristem protein, S-adenosylmethionine decarboxylase, non-specific lipid transfer protein, and GDP-L-galactose phosphorylase involved in ascorbic acid biosynthesis were up-regulated in the incompatible interaction at the onset of haustorium formation, and may contribute to the HR-mediated defense response in the rust-resistant mutant.

  17. Identification of immune response-related genes in the Chinese oak silkworm, Antheraea pernyi by suppression subtractive hybridization.

    Science.gov (United States)

    Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang

    2013-11-01

    Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Effect of water pollution on expression of immune response genes of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... response genes of Solea aegyptiaca in Lake Qarun ... value of 37.8 g/l while the chloride content was 14.3 g/l on average. ... bacterial count (TVBC) ranged from 103 colony forming unit (CFU) in the middle of the Lake to 107 ...

  19. Functional Associations by Response Overlap (FARO), a functional genomics approach matching gene expression phenotypes

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Mundy, J.; Willenbrock, Hanni

    2007-01-01

    The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental facto...

  20. Cross-family translational genomics of abiotic stress-responsive genes between Arabidopsis and Medicago truncatula.

    Directory of Open Access Journals (Sweden)

    Daejin Hyung

    Full Text Available Cross-species translation of genomic information may play a pivotal role in applying biological knowledge gained from relatively simple model system to other less studied, but related, genomes. The information of abiotic stress (ABS-responsive genes in Arabidopsis was identified and translated into the legume model system, Medicago truncatula. Various data resources, such as TAIR/AtGI DB, expression profiles and literatures, were used to build a genome-wide list of ABS genes. tBlastX/BlastP similarity search tools and manual inspection of alignments were used to identify orthologous genes between the two genomes. A total of 1,377 genes were finally collected and classified into 18 functional criteria of gene ontology (GO. The data analysis according to the expression cues showed that there was substantial level of interaction among three major types (i.e., drought, salinity and cold stress of abiotic stresses. In an attempt to translate the ABS genes between these two species, genomic locations for each gene were mapped using an in-house-developed comparative analysis platform. The comparative analysis revealed that fragmental colinearity, represented by only 37 synteny blocks, existed between Arabidopsis and M. truncatula. Based on the combination of E-value and alignment remarks, estimated translation rate was 60.2% for this cross-family translation. As a prelude of the functional comparative genomic approaches, in-silico gene network/interactome analyses were conducted to predict key components in the ABS responses, and one of the sub-networks was integrated with corresponding comparative map. The results demonstrated that core members of the sub-network were well aligned with previously reported ABS regulatory networks. Taken together, the results indicate that network-based integrative approaches of comparative and functional genomics are important to interpret and translate genomic information for complex traits such as abiotic stresses.

  1. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance.

    Science.gov (United States)

    Morimoto, Shimpei; Yahara, Koji

    2018-03-01

    Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential

  2. Four-week rapamycin treatment improves muscular dystrophy in a fukutin-deficient mouse model of dystroglycanopathy.

    Science.gov (United States)

    Foltz, Steven J; Luan, Junna; Call, Jarrod A; Patel, Ankit; Peissig, Kristen B; Fortunato, Marisa J; Beedle, Aaron M

    2016-01-01

    Secondary dystroglycanopathies are a subset of muscular dystrophy caused by abnormal glycosylation of α-dystroglycan (αDG). Loss of αDG functional glycosylation prevents it from binding to laminin and other extracellular matrix receptors, causing muscular dystrophy. Mutations in a number of genes, including FKTN (fukutin), disrupt αDG glycosylation. We analyzed conditional Fktn knockout (Fktn KO) muscle for levels of mTOR signaling pathway proteins by Western blot. Two cohorts of Myf5-cre/Fktn KO mice were treated with the mammalian target of rapamycin (mTOR) inhibitor rapamycin (RAPA) for 4 weeks and evaluated for changes in functional and histopathological features. Muscle from 17- to 25-week-old fukutin-deficient mice has activated mTOR signaling. However, in tamoxifen-inducible Fktn KO mice, factors related to Akt/mTOR signaling were unchanged before the onset of dystrophic pathology, suggesting that Akt/mTOR signaling pathway abnormalities occur after the onset of disease pathology and are not causative in early dystroglycanopathy development. To determine any pharmacological benefit of targeting mTOR signaling, we administered RAPA daily for 4 weeks to Myf5/Fktn KO mice to inhibit mTORC1. RAPA treatment reduced fibrosis, inflammation, activity-induced damage, and central nucleation, and increased muscle fiber size in Myf5/Fktn KO mice compared to controls. RAPA-treated KO mice also produced significantly higher torque at the conclusion of dosing. These findings validate a misregulation of mTOR signaling in dystrophic dystroglycanopathy skeletal muscle and suggest that such signaling molecules may be relevant targets to delay and/or reduce disease burden in dystrophic patients.

  3. Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.

    Directory of Open Access Journals (Sweden)

    Luciane S Fonseca

    Full Text Available Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2 one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.

  4. Identification of Lactobacillus plantarum genes modulating the cytokine response of human peripheral blood mononuclear cells

    Directory of Open Access Journals (Sweden)

    Molenaar Douwe

    2010-11-01

    Full Text Available Abstract Background Modulation of the immune system is one of the most plausible mechanisms underlying the beneficial effects of probiotic bacteria on human health. Presently, the specific probiotic cell products responsible for immunomodulation are largely unknown. In this study, the genetic and phenotypic diversity of strains of the Lactobacillus plantarum species were investigated to identify genes of L. plantarum with the potential to influence the amounts of cytokines interleukin 10 (IL-10 and IL-12 and the ratio of IL-10/IL-12 produced by peripheral blood mononuclear cells (PBMCs. Results A total of 42 Lactobacillus plantarum strains isolated from diverse environmental and human sources were evaluated for their capacity to stimulate cytokine production in PBMCs. The L. plantarum strains induced the secretion of the anti-inflammatory cytokine IL-10 over an average 14-fold range and secretion of the pro-inflammatory cytokine IL-12 over an average 16-fold range. Comparisons of the strain-specific cytokine responses of PBMCs to comparative genome hybridization profiles obtained with L. plantarum WCFS1 DNA microarrays (also termed gene-trait matching resulted in the identification of 6 candidate genetic loci with immunomodulatory capacities. These loci included genes encoding an N-acetyl-glucosamine/galactosamine phosphotransferase system, the LamBDCA quorum sensing system, and components of the plantaricin (bacteriocin biosynthesis and transport pathway. Deletion of these genes in L. plantarum WCFS1 resulted in growth phase-dependent changes in the PBMC IL-10 and IL-12 cytokine profiles compared with wild-type cells. Conclusions The altered PBMC cytokine profiles obtained with the L. plantarum WCFS1 mutants were in good agreement with the predictions made by gene-trait matching for the 42 L. plantarum strains. This study therefore resulted in the identification of genes present in certain strains of L. plantarum which might be responsible for

  5. Functional Associations by Response Overlap (FARO, a functional genomics approach matching gene expression phenotypes.

    Directory of Open Access Journals (Sweden)

    Henrik Bjørn Nielsen

    2007-08-01

    Full Text Available The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental factors including treatments, mutations and pathogen infections. Similarly, drugs may be discovered by the relationship between the transcript profiles effectuated or impacted by a candidate drug and by the target disease. The integration of such data enables systems biology to predict the interplay between experimental factors affecting a biological system. Unfortunately, direct comparisons of gene expression profiles obtained in independent, publicly available microarray experiments are typically compromised by substantial, experiment-specific biases. Here we suggest a novel yet conceptually simple approach for deriving 'Functional Association(s by Response Overlap' (FARO between microarray gene expression studies. The transcriptional response is defined by the set of differentially expressed genes independent from the magnitude or direction of the change. This approach overcomes the limited comparability between studies that is typical for methods that rely on correlation in gene expression. We apply FARO to a compendium of 242 diverse Arabidopsis microarray experimental factors, including phyto-hormones, stresses and pathogens, growth conditions/stages, tissue types and mutants. We also use FARO to confirm and further delineate the functions of Arabidopsis MAP kinase 4 in disease and stress responses. Furthermore, we find that a large, well-defined set of genes responds in opposing directions to different stress conditions and predict the effects of different stress combinations. This demonstrates the usefulness of our approach for exploiting public microarray data to derive biologically meaningful associations between experimental factors. Finally, our

  6. Blood-brain barrier leakage after status epilepticus in rapamycin-treated rats I: Magnetic resonance imaging.

    Science.gov (United States)

    van Vliet, Erwin A; Otte, Willem M; Wadman, Wytse J; Aronica, Eleonora; Kooij, Gijs; de Vries, Helga E; Dijkhuizen, Rick M; Gorter, Jan A

    2016-01-01

    The mammalian target of rapamycin (mTOR) pathway has received increasing attention as a potential antiepileptogenic target. Treatment with the mTOR inhibitor rapamycin after status epilepticus reduces the development of epilepsy in a rat model. To study whether rapamycin mediates this effect via restoration of blood-brain barrier (BBB) dysfunction, contrast-enhanced magnetic resonance imaging (CE-MRI) was used to determine BBB permeability throughout epileptogenesis. Imaging was repeatedly performed until 6 weeks after kainic acid-induced status epilepticus in rapamycin (6 mg/kg for 6 weeks starting 4 h after SE) and vehicle-treated rats, using gadobutrol as contrast agent. Seizures were detected using video monitoring in the week following the last imaging session. Gadobutrol leakage was widespread and extensive in both rapamycin and vehicle-treated epileptic rats during the acute phase, with the piriform cortex and amygdala as the most affected regions. Gadobutrol leakage was higher in rapamycin-treated rats 4 and 8 days after status epilepticus compared to vehicle-treated rats. However, during the chronic epileptic phase, gadobutrol leakage was lower in rapamycin-treated epileptic rats along with a decreased seizure frequency. This was confirmed by local fluorescein staining in the brains of the same rats. Total brain volume was reduced by this rapamycin treatment regimen. The initial slow recovery of BBB function in rapamycin-treated epileptic rats indicates that rapamycin does not reduce seizure activity by a gradual recovery of BBB integrity. The reduced BBB leakage during the chronic phase, however, could contribute to the decreased seizure frequency in post-status epilepticus rats treated with rapamycin. Furthermore, the data show that CE-MRI (using step-down infusion with gadobutrol) can be used as biomarker for monitoring the effect of drug therapy in rats. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

  7. Functional pathway analysis of genes associated with response to treatment for chronic hepatitis C.

    Science.gov (United States)

    Birerdinc, A; Afendy, A; Stepanova, M; Younossi, I; Manyam, G; Baranova, A; Younossi, Z M

    2010-10-01

    Chronic hepatitis C (CH-C) is among the most common causes of chronic liver disease. Approximately 50% of patients with CH-C treated with pegylated interferon-α and ribavirin (PEG-IFN-α + RBV) achieve a sustained virological response (SVR). Several factors such as genotype 1, African American (AA) race, obesity and the absence of an early virological response (EVR) are associated with low SVR. This study elucidates molecular pathways deregulated in patients with CH-C with negative predictors of response to antiviral therapy. Sixty-eight patients with CH-C who underwent a full course of treatment with PEG-IFN-α + RBV were included in the study. Pretreatment blood samples were collected in PAXgene™ RNA tubes. EVR, complete EVR (cEVR), and SVR rates were 76%, 57% and 41%, respectively. Total RNA was extracted from pretreatment peripheral blood mononuclear cells, quantified and used for one-step RT-PCR to profile 154 mRNAs. The expression of mRNAs was normalized with six 'housekeeping' genes. Differentially expressed genes were separated into up and downregulated gene lists according to the presence or absence of a risk factor and subjected to KEGG Pathway Painter which allows high-throughput visualization of the pathway-specific changes in expression profiles. The genes were consolidated into the networks associated with known predictors of response. Before treatment, various genes associated with core components of the JAK/STAT pathway were activated in the cohorts least likely to achieve SVR. Genes related to focal adhesion and TGF-β pathways were activated in some patients with negative predictors of response. Pathway-centred analysis of gene expression profiles from treated patients with CH-C points to the Janus kinase-signal transducers and activators of transcription signalling cascade as the major pathogenetic component responsible for not achieving SVR. In addition, focal adhesion and TGF-β pathways are associated with some predictors of response.

  8. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Directory of Open Access Journals (Sweden)

    Hettne Kristina M

    2013-01-01

    Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.

  9. The Role of Osteopontin and Its Gene on Glucocorticoid Response in Myasthenia Gravis

    Directory of Open Access Journals (Sweden)

    Yanchen Xie

    2017-05-01

    Full Text Available Biomarkers that assess treatment response for patients with the autoimmune disorder, myasthenia gravis (MG, have not been evaluated to a significant extent. We hypothesized the pro-inflammatory cytokine, osteopontin (OPN, may be associated with variability of response to glucocorticoids (GCs in patients with MG. A cohort of 250 MG patients treated with standardized protocol of GCs was recruited, and plasma OPN and polymorphisms of its gene, secreted phosphoprotein 1 (SPP1, were evaluated. Mean OPN levels were higher in patients compared to healthy controls. Carriers of rs11728697*T allele (allele definition: one of two or more alternative forms of a gene were more frequent in the poorly GC responsive group compared to the GC responsive group indicating an association of rs11728697*T allele with GC non-responsiveness. One risk haplotype (AGTACT was identified associated with GC non-responsiveness compared with GC responsive MG group. Genetic variations of SPP1 were found associated with the response to GC among MG patients.

  10. TOR (target of rapamycin) is a key regulator of triacylglycerol accumulation in microalgae.

    Science.gov (United States)

    Imamura, Sousuke; Kawase, Yasuko; Kobayashi, Ikki; Shimojima, Mie; Ohta, Hiroyuki; Tanaka, Kan

    2016-01-01

    Most microalgae abundantly accumulate lipid droplets (LDs) containing triacylglycerols (TAGs) under several stress conditions, but the underlying molecular mechanism of this accumulation remains unclear. In a recent study, we found that inhibition of TOR (target of rapamycin), a highly conserved protein kinase of eukaryotes, by rapamycin resulted in TAG accumulation in microalgae, indicating that TOR negatively regulates TAG accumulation. Here, we show that formation of intracellular LDs and TAG accumulation were also induced in the unicellular green alga Chlamydomonas reinhardtii after exposure to Torin1 or AZD8055, which are novel TOR inhibitors that inhibit TOR activity in a manner different from rapamycin. These results supported quite well our previous conclusion that TOR is a central regulator of TAG accumulation in microalgae.

  11. Identification of heat-responsive genes in carnation (Dianthus caryophyllus L. by RNA-seq

    Directory of Open Access Journals (Sweden)

    Xueli eWan

    2015-07-01

    Full Text Available Carnation (Dianthus caryophyllus L. is an important flower crop, having substantial commercial value as a cut-flower due to the long vase-life and wide array of flower colours and forms. Standard carnation varieties perform well under cool climates but are very susceptible to high temperatures which adversely affect the yield and the quality of the cut-flowers. Despite several studies of carnation contributing to the number of expressed sequence tags (ESTs, transcriptomic information of this species remains very limited, particularly regarding abiotic stress-related genes. Here, transcriptome analysis was performed to generate expression profiles of heat stress (HS-responsive genes in carnation. We sequenced a cDNA library constructed with mixed RNA from carnation leaves subjected to 42oC HS (0, 0.5, 1 and 2 h and 46oC HS (0.5, 1 and 2 h, and obtained 45,604,882 high quality paired-end reads. After de novo assembly and quantitative assessment, 99,255 contigs were generated with an average length of 1053bp. We then obtained functional annotations by aligning contigs with public protein databases including NR, SwissProt, KEGG and COG. Using the above carnation transcriptome as the reference, we compared the effects of high temperature treatments (42oC: duration 0.5, 2 or 12h delivered to aseptic carnation seedlings, relative to untreated controls, using the FPKM metric. Overall, 11,471 genes were identified which showed a significant response to one or more of the three HS treatment times. In addition, based on GO and metabolic pathway enrichment analyses, a series of candidate genes involved in thermo-tolerance responses were selected and characterized. This study represents the first expression profiling analysis of D. caryophyllus under heat stress treatments. Numerous genes were found to be induced in response to HS, the study of which may advance our understanding of heat response of carnation.

  12. Responses of human cells to ZnO nanoparticles: a gene transcription study†

    Science.gov (United States)

    Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.

    2013-01-01

    The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377

  13. Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

    Directory of Open Access Journals (Sweden)

    Eneour Puill-Stephan

    Full Text Available Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals.Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR. Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria during winnowing processes as symbioses are fine-tuned.Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are

  14. Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

    Science.gov (United States)

    Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L

    2012-01-01

    Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further

  15. Study of the Genes and Mechanism Involved in the Radioadaptive Response

    Science.gov (United States)

    Dasgupta, Pushan R.

    2009-01-01

    The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor

  16. The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Ruichao Yu

    2016-02-01

    Full Text Available Background/Aims: There is increasing evidence showing that innate immune responses and inflammatory processes play an important role in the development and progression of diabetic nephropathy (DN. The potential effect of innate immunity in the early stage of DN is still unclear. Toll-Like-Receptor 4 (TLR4 is vigorously involved in the progress of kidney diseases in a sterile environment. The activation of the interleukin 17 (IL-17 pathway produces inflammatory cytokines, appearing in various kidney diseases. Unfortunately the relationship between TLR4 and IL-17 has not been investigated in diabetic nephropathy to date. The aim of this study is to investigate whether mammalian target of rapamycin (mTOR inhibition may be dependent on TLR4 signaling and the pro-inflammatory factor IL-17 to delay the progression of DN. Methods: Streptozotocin (STZ-induced diabetic rats were randomly assigned to 3 experimental groups: a diabetic nephropathy group (DN, n = 6; and a diabetic nephropathy treated with rapamycin group (Rapa, n = 6 and a control group (Control, n =6. Body weight, fasting blood sugar, and 24h urine albumin were assessed at week 2, week 4 and week 8. Renal tissues were harvested for H&E, PAS staining, as well as an immunohistochemistry assay for TLR4 and IL-17. TLR4 quantitative expression was measured by Western-Blot analysis and RT-PCR. Results: Our results demonstrated that the expression of both TLR4 and IL-17 were upregulated in early stage DN and reduced by rapamycin. TLR4 and IL-17 both increased and positively related to 24h urinary albumin and kidney/weight ratio. However, neither TLR4 nor IL-17 made a significant difference on fasting blood sugar. Conclusions: Taken together, our results confirm and extend previous studies identifying the significance of the TLR4 and Th17 pathways in development of early stage DN. Furthermore, we suggest this overexpression of TLR4 might be involved in the immunopathogenesis of DN through

  17. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Science.gov (United States)

    2013-01-01

    Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the

  18. Enhanced antitumor activity of 3-bromopyruvate in combination with rapamycin in vivo and in vitro.

    Science.gov (United States)

    Zhang, Qi; Pan, Jing; Lubet, Ronald A; Komas, Steven M; Kalyanaraman, Balaraman; Wang, Yian; You, Ming

    2015-04-01

    3-Bromopyruvate (3-BrPA) is an alkylating agent and a well-known inhibitor of energy metabolism. Rapamycin is an inhibitor of the serine/threonine protein kinase mTOR. Both 3-BrPA and rapamycin show chemopreventive efficacy in mouse models of lung cancer. Aerosol delivery of therapeutic drugs for lung cancer has been reported to be an effective route of delivery with little systemic distribution in humans. In this study, 3-BrPA and rapamycin were evaluated in combination for their preventive effects against lung cancer in mice by aerosol treatment, revealing a synergistic ability as measured by tumor multiplicity and tumor load compared treatment with either single-agent alone. No evidence of liver toxicity was detected by monitoring serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) enzymes. To understand the mechanism in vitro experiments were performed using human non-small cell lung cancer (NSCLC) cell lines. 3-BrPA and rapamycin also synergistically inhibited cell proliferation. Rapamycin alone blocked the mTOR signaling pathway, whereas 3-BrPA did not potentiate this effect. Given the known role of 3-BrPA as an inhibitor of glycolysis, we investigated mitochondrial bioenergetics changes in vitro in 3-BrPA-treated NSCLC cells. 3-BrPA significantly decreased glycolytic activity, which may be due to adenosine triphosphate (ATP) depletion and decreased expression of GAPDH. Our results demonstrate that rapamycin enhanced the antitumor efficacy of 3-BrPA, and that dual inhibition of mTOR signaling and glycolysis may be an effective therapeutic strategy for lung cancer chemoprevention. ©2015 American Association for Cancer Research.

  19. Pharmacokinetics of orally administered low-dose rapamycin in healthy dogs: A pilot study

    Science.gov (United States)

    Larson, Jeanne C.; Allstadt, Sara D.; Fan, Timothy M.; Khanna, Chand; Lunghofer, Paul J.; Hansen, Ryan J.; Gustafson, Daniel L.; Legendre, Alfred M.; Galyon, Gina D.; LeBlanc, Amy K.; Martin-Jimenez, Tomas

    2017-01-01

    Objective To determine the pharmacokinetics of orally administered rapamycin in healthy dogs. Animals 5 healthy purpose-bred hounds. Procedures The study consisted of 2 experiments. In experiment 1, each dog received rapamycin (0.1 mg/kg, PO) once; blood samples were obtained immediately before and at 0.5, 1, 2, 4, 6, 12, 24, 48, and 72 hours after administration. In experiment 2, each dog received (0.1 mg/kg, PO) once daily for 5 days; blood samples were obtained immediately before and at 3, 6, 24, 27, 30, 48, 51, 54, 72, 75, 78, 96, 96.5, 97, 98, 100, 102, 108, 120, 144, and 168 hours after the first dose. Blood rapamycin concentration was determined by a validated liquid chromatography-tandem mass spectrometry assay. Pharmacokinetic parameters were determined by compartmental and non-compartmental analyses. Results Mean ± SD blood rapamycin terminal half-life, area under the concentration-time curve from 0 to 48 hours after dosing, and maximum concentration were 38.7 ± 12.7 h, 140 ± 23.9 ng•h/mL, and 8.39 ± 1.73 ng/mL, respectively, for experiment 1, and 99.5 ± 89.5 h, 126 ± 27.1 ng•h/mL, and 5.49 ± 1.99 ng/mL, respectively, for experiment 2. Pharmacokinetic parameters for rapamycin after administration of 5 daily doses differed significantly from those after administration of 1 dose. Conclusions and Clinical Relevance Results indicated that oral administration of low-dose (0.1 mg/kg) rapamycin to healthy dogs achieved blood concentrations measured in ng/mL. The optimal dose and administration frequency of rapamcyin required to achieve therapeutic effects in tumor-bearing dogs, as well as toxicity after chronic dosing, needs to be determined. PMID:26709938

  20. Epigenetic modulation of gene expression governs the brain's response to injury.

    Science.gov (United States)

    Simon, Roger P

    2016-06-20

    Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is consistent with an epigenetic model of regulation mediated by changes in DNA methylation and histone modification. Here, we summarize our evolving understanding of the molecular basis for endogenous neuroprotection and review recent findings that implicate DNA methylation and protein mediators of histone modification as epigenetic regulators of the brain's response to injury. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Epigenetic modulation of gene expression governs the brain’s response to injury

    Science.gov (United States)

    Simon, Roger P.

    2016-01-01

    Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is consistent with an epigenetic model of regulation mediated by changes in DNA methylation and histone modification. Here, we summarize our evolving understanding of the molecular basis for endogenous neuroprotection and review recent findings that implicate DNA methylation and protein mediators of histone modification as epigenetic regulators of the brain’s response to injury. PMID:26739198

  2. Vector analysis as a fast and easy method to compare gene expression responses between different experimental backgrounds

    NARCIS (Netherlands)

    Breitling, R.; Armengaud, P.; Amtmann, A.

    2005-01-01

    Background Gene expression studies increasingly compare expression responses between different experimental backgrounds (genetic, physiological, or phylogenetic). By focusing on dynamic responses rather than a direct comparison of static expression levels, this type of study allows a finer

  3. Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection.

    Science.gov (United States)

    Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne

    2005-04-15

    The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.

  4. The characterization and geographical distribution of the genes responsible for vernalization requirement in Chinese bread wheat.

    Science.gov (United States)

    Sun, Qing-Ming; Zhou, Rong-Hua; Gao, Li-Feng; Zhao, Guang-Yao; Jia, Ji-Zeng

    2009-04-01

    The frequency and distribution of the major vernalization requirement genes and their effects on growth habits were studied. Of the 551 bread wheat genotypes tested, seven allelic combinations of the three Vrn-1 genes were found to be responsible for the spring habit, three for the facultative habit and one for the winter habit. The three Vrn-1 genes behaved additively with the dominant allele of Vrn-A1 exerting the strongest effect. The allele combinations of the facultative genotypes and the discovery of spring genotypes with "winter" allele of Vrn-1 implied the presence of as yet unidentified alleles/genes for vernalization response. The dominant alleles of the three Vrn-1 genes were found in all ten ecological regions where wheat is cultivated in China, with Vrn-D1 as the most common allele in nine and Vrn-A1 in one. The combination of vrn-A1vrn-B1Vrn-D1 was the predominant genotype in seven of the regions. Compared with landraces, improved varieties contain a higher proportion of the spring type. This was attributed by a higher frequency of the dominant Vrn-A1 and Vrn-B1 alleles in the latter. Correlations between Vrn-1 allelic constitutions and heading date, spike length, plant type as well as cold tolerance were established.

  5. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan

    2010-01-01

    Full Text Available Purpose The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  6. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan

    2010-03-01

    Full Text Available Purpose: The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods: The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results: Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  7. Nuclear PIM1 confers resistance to rapamycin-impaired endothelial proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Walpen, Thomas; Kalus, Ina [Research Unit, Division Internal Medicine, University Hospital Zuerich, 8091 Zuerich (Switzerland); Schwaller, Juerg [Department of Biomedicine, University of Basel, 4031 Basel (Switzerland); Peier, Martin A. [Research Unit, Division Internal Medicine, University Hospital Zuerich, 8091 Zuerich (Switzerland); Battegay, Edouard J. [Research Unit, Division Internal Medicine, University Hospital Zuerich, 8091 Zuerich (Switzerland); Zurich Center for Integrative Human Physiology (ZIHP), 8057 Zuerich (Switzerland); Humar, Rok, E-mail: Rok.Humar@usz.ch [Research Unit, Division Internal Medicine, University Hospital Zuerich, 8091 Zuerich (Switzerland); Zurich Center for Integrative Human Physiology (ZIHP), 8057 Zuerich (Switzerland)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer Pim1{sup -/-} endothelial cell proliferation displays increased sensitivity to rapamycin. Black-Right-Pointing-Pointer mTOR inhibition by rapamycin enhances PIM1 cytosolic and nuclear protein levels. Black-Right-Pointing-Pointer Truncation of Pim1 beyond serine 276 results in nuclear localization of the kinase. Black-Right-Pointing-Pointer Nuclear PIM1 increases endothelial proliferation independent of rapamycin. -- Abstract: The PIM serine/threonine kinases and the mTOR/AKT pathway integrate growth factor signaling and promote cell proliferation and survival. They both share phosphorylation targets and have overlapping functions, which can partially substitute for each other. In cancer cells PIM kinases have been reported to produce resistance to mTOR inhibition by rapamycin. Tumor growth depends highly on blood vessel infiltration into the malignant tissue and therefore on endothelial cell proliferation. We therefore investigated how the PIM1 kinase modulates growth inhibitory effects of rapamycin in mouse aortic endothelial cells (MAEC). We found that proliferation of MAEC lacking Pim1 was significantly more sensitive to rapamycin inhibition, compared to wildtype cells. Inhibition of mTOR and AKT in normal MAEC resulted in significantly elevated PIM1 protein levels in the cytosol and in the nucleus. We observed that truncation of the C-terminal part of Pim1 beyond Ser 276 resulted in almost exclusive nuclear localization of the protein. Re-expression of this Pim1 deletion mutant significantly increased the proliferation of Pim1{sup -/-} cells when compared to expression of the wildtype Pim1 cDNA. Finally, overexpression of the nuclear localization mutant and the wildtype Pim1 resulted in complete resistance to growth inhibition by rapamycin. Thus, mTOR inhibition-induced nuclear accumulation of PIM1 or expression of a nuclear C-terminal PIM1 truncation mutant is sufficient to increase endothelial cell proliferation

  8. Onconase responsive genes in human mesothelioma cells: implications for an RNA damaging therapeutic agent

    International Nuclear Information System (INIS)

    Altomare, Deborah A; Rybak, Susanna M; Pei, Jianming; Maizel, Jacob V; Cheung, Mitchell; Testa, Joseph R; Shogen, Kuslima

    2010-01-01

    Onconase represents a new class of RNA-damaging drugs. Mechanistically, Onconase is thought to internalize, where it degrades intracellular RNAs such as tRNA and double-stranded RNA, and thereby suppresses protein synthesis. However, there may be additional or alternative mechanism(s) of action. In this study, microarray analysis was used to compare gene expression profiles in untreated human malignant mesothelioma (MM) cell lines and cells exposed to 5 μg/ml Onconase for 24 h. A total of 155 genes were found to be regulated by Onconase that were common to both epithelial and biphasic MM cell lines. Some of these genes are known to significantly affect apoptosis (IL-24, TNFAIP3), transcription (ATF3, DDIT3, MAFF, HDAC9, SNAPC1) or inflammation and the immune response (IL-6, COX-2). RT-PCR analysis of selected up- or down-regulated genes treated with varying doses and times of Onconase generally confirmed the expression array findings in four MM cell lines. Onconase treatment consistently resulted in up-regulation of IL-24, previously shown to have tumor suppressive activity, as well as ATF3 and IL-6. Induction of ATF3 and the pro-apoptotic factor IL-24 by Onconase was highest in the two most responsive MM cell lines, as defined by DNA fragmentation analysis. In addition to apoptosis, gene ontology analysis indicated that pathways impacted by Onconase include MAPK signaling, cytokine-cytokine-receptor interactions, and Jak-STAT signaling. These results provide a broad picture of gene activity after treatment with a drug that targets small non-coding RNAs and contribute to our overall understanding of MM cell response to Onconase as a therapeutic strategy. The findings provide insights regarding mechanisms that may contribute to the efficacy of this novel drug in clinical trials of MM patients who have failed first line chemotherapy or radiation treatment

  9. Stat1-independent regulation of gene expression in response to IFN-γ

    Science.gov (United States)

    Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.

    2001-01-01

    Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994

  10. In silico identification of known osmotic stress responsive genes from Arabidopsis in soybean and Medicago

    Directory of Open Access Journals (Sweden)

    Nina M. Soares-Cavalcanti

    2012-01-01

    Full Text Available Plants experience various environmental stresses, but tolerance to these adverse conditions is a very complex phenomenon. The present research aimed to evaluate a set of genes involved in osmotic response, comparing soybean and medicago with the well-described Arabidopsis thaliana model plant. Based on 103 Arabidopsis proteins from 27 categories of osmotic stress response, comparative analyses against Genosoja and Medicago truncatula databases allowed the identification of 1,088 soybean and 1,210 Medicago sequences. The analysis showed a high number of sequences and high diversity, comprising genes from all categories in both organisms. Genes with unknown function were among the most representative, followed by transcription factors, ion transport proteins, water channel, plant defense, protein degradation, cellular structure, organization & biogenesis and senescence. An analysis of sequences with unknown function allowed the annotation of 174 soybean and 217 Medicago sequences, most of them concerning transcription factors. However, for about 30% of the sequences no function could be attributed using in silico procedures. The establishment of a gene set involved in osmotic stress responses in soybean and barrel medic will help to better understand the survival mechanisms for this type of stress condition in legumes.

  11. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  12. Transcriptional response of stress genes to metal exposure in zebra mussel larvae and adults

    International Nuclear Information System (INIS)

    Navarro, Anna; Faria, Melissa; Barata, Carlos; Pina, Benjamin

    2011-01-01

    Development of stress markers for the invader freshwater zebra mussel (Dreissena polymorpha) is of great interest for both conservation and biomonitoring purposes. Gene expression profiles of several putative or already established gene expression stress markers (Metallothionein, Superoxide dismutase, Catalase, Glutathione S transferase, Glutathione peroxidase, Cytochrome c oxidase, the multixenobiotic resistance P-gp1, and heat shock proteins HSP70 and HSP90) were analyzed by quantitative Real-Time PCR in adults and pediveliger larvae after exposure to metals (Hg, Cu, Cd). A defined pattern of coordinated responses to metal exposure and, presumably, to oxidative stress was observed in gills and digestive gland from adults. A similar, albeit partial response was observed in larvae, indicating an early development of stress-related gene responses in zebra mussel. The tools developed in this study may be useful both for future control strategies and for the use of zebra mussel as sentinel species in water courses with stable populations. - Coordinated expression of stress genes in zebra mussel.

  13. Transcriptional response of stress genes to metal exposure in zebra mussel larvae and adults

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, Anna; Faria, Melissa; Barata, Carlos [Institute of Environmental Assessment and Water Research (IDAEA-CSIC), Jordi Girona 18, 08034 Barcelona (Spain); Pina, Benjamin, E-mail: bpcbmc@cid.csic.e [Institute of Environmental Assessment and Water Research (IDAEA-CSIC), Jordi Girona 18, 08034 Barcelona (Spain)

    2011-01-15

    Development of stress markers for the invader freshwater zebra mussel (Dreissena polymorpha) is of great interest for both conservation and biomonitoring purposes. Gene expression profiles of several putative or already established gene expression stress markers (Metallothionein, Superoxide dismutase, Catalase, Glutathione S transferase, Glutathione peroxidase, Cytochrome c oxidase, the multixenobiotic resistance P-gp1, and heat shock proteins HSP70 and HSP90) were analyzed by quantitative Real-Time PCR in adults and pediveliger larvae after exposure to metals (Hg, Cu, Cd). A defined pattern of coordinated responses to metal exposure and, presumably, to oxidative stress was observed in gills and digestive gland from adults. A similar, albeit partial response was observed in larvae, indicating an early development of stress-related gene responses in zebra mussel. The tools developed in this study may be useful both for future control strategies and for the use of zebra mussel as sentinel species in water courses with stable populations. - Coordinated expression of stress genes in zebra mussel.

  14. Identification of water-deficit responsive genes in maritime pine (Pinus pinaster Ait.) roots.

    Science.gov (United States)

    Dubos, Christian; Plomion, Christophe

    2003-01-01

    Root adaptation to soil environmental factors is very important to maritime pine, the main conifer species used for reforestation in France. The range of climates in the sites where this species is established varies from flooded in winter to drought-prone in summer. No studies have yet focused on the morphological, physiological or molecular variability of the root system to adapt its growth to such an environment. We developed a strategy to isolate drought-responsive genes in the root tissue in order to identify the molecular mechanisms that trees have evolved to cope with drought (the main problem affecting wood productivity), and to exploit this information to improve drought stress tolerance. In order to provide easy access to the root system, seedlings were raised in hydroponic solution. Polyethylene glycol was used as an osmoticum to induce water deficit. Using the cDNA-AFLP technique, we screened more than 2500 transcript derived fragments, of which 33 (1.2%) showed clear variation in presence/absence between non stressed and stressed medium. The relative abundance of these transcripts was then analysed by reverse northern. Only two out of these 33 genes showed significant opposite behaviour between both techniques. The identification and characterization of water-deficit responsive genes in roots provide the emergence of physiological understanding of the patterns of gene expression and regulation involved in the drought stress response of maritime pine.

  15. Gene transcription and biomarker responses in the clam Ruditapes philippinarum after exposure to ibuprofen

    International Nuclear Information System (INIS)

    Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca; Marin, Maria Gabriella; Matozzo, Valerio

    2013-01-01

    Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 μg IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both “IBU concentration” and “exposure duration” on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.

  16. Gene expression during different periods of the handling-stress response in Pampus argenteus

    Science.gov (United States)

    Sun, Peng; Tang, Baojun; Yin, Fei

    2017-11-01

    Common aquaculture practices subject fish to a variety of acute and chronic stressors. Such stressors are inherent in aquaculture production but can adversely affect survival, growth, immune response, reproductive capacity, and behavior. Understanding the biological mechanisms underlying stress responses helps with methods to alleviate the negative effects through better aquaculture practices, resulting in improved animal welfare and production efficiency. In the present study, transcriptome sequencing of liver and kidney was performed in silver pomfret (Pampus argenteus) subjected to handling stress versus controls. A total of 162.19 million clean reads were assembled to 30 339 unigenes. The quality of the assembly was high, with an N50 length of 2 472 bases. For function classification and pathway assignment, the unigenes were categorized into three GO (gene ontology) categories, twenty-six clusters of eggNOG (evolutionary genealogy of genes: non-supervised orthologous groups) function categories, and thirty-eight KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways. Stress affected different functional groups of genes in the tissues studied. Differentially expressed genes were mainly involved in metabolic pathways (carbohydrate metabolism, lipid metabolism, amino-acid metabolism, uptake of cofactors and vitamins, and biosynthesis of other secondary metabolites), environmental information processing (signaling molecules and their interactions), organismal systems (endocrine system, digestive system), and disease (immune, neurodegenerative, endocrine and metabolic diseases). This is the first reported analysis of genome-wide transcriptome in P. argenteus, and the findings expand our understanding of the silver pomfret genome and gene expression in association with stress. The results will be useful to future analyses of functional genes and studies of healthy artificial breeding in P. argenteus and other related fish species.

  17. Expression of estrogen-related gene markers in breast cancer tissue predicts aromatase inhibitor responsiveness.

    Directory of Open Access Journals (Sweden)

    Irene Moy

    Full Text Available Aromatase inhibitors (AIs are the most effective class of drugs in the endocrine treatment of breast cancer, with an approximate 50% treatment response rate. Our objective was to determine whether intratumoral expression levels of estrogen-related genes are predictive of AI responsiveness in postmenopausal women with breast cancer. Primary breast carcinomas were obtained from 112 women who received AI therapy after failing adjuvant tamoxifen therapy and developing recurrent breast cancer. Tumor ERα and PR protein expression were analyzed by immunohistochemistry (IHC. Messenger RNA (mRNA levels of 5 estrogen-related genes-AKR1C3, aromatase, ERα, and 2 estradiol/ERα target genes, BRCA1 and PR-were measured by real-time PCR. Tumor protein and mRNA levels were compared with breast cancer progression rates to determine predictive accuracy. Responsiveness to AI therapy-defined as the combined complete response, partial response, and stable disease rates for at least 6 months-was 51%; rates were 56% in ERα-IHC-positive and 14% in ERα-IHC-negative tumors. Levels of ERα, PR, or BRCA1 mRNA were independently predictive for responsiveness to AI. In cross-validated analyses, a combined measurement of tumor ERα and PR mRNA levels yielded a more superior specificity (36% and identical sensitivity (96% to the current clinical practice (ERα/PR-IHC. In patients with ERα/PR-IHC-negative tumors, analysis of mRNA expression revealed either non-significant trends or statistically significant positive predictive values for AI responsiveness. In conclusion, expression levels of estrogen-related mRNAs are predictive for AI responsiveness in postmenopausal women with breast cancer, and mRNA expression analysis may improve patient selection.

  18. Gene Expression Deconvolution for Uncovering Molecular Signatures in Response to Therapy in Juvenile Idiopathic Arthritis.

    Directory of Open Access Journals (Sweden)

    Ang Cui

    Full Text Available Gene expression-based signatures help identify pathways relevant to diseases and treatments, but are challenging to construct when there is a diversity of disease mechanisms and treatments in patients with complex diseases. To overcome this challenge, we present a new application of an in silico gene expression deconvolution method, ISOpure-S1, and apply it to identify a common gene expression signature corresponding to response to treatment in 33 juvenile idiopathic arthritis (JIA patients. Using pre- and post-treatment gene expression profiles only, we found a gene expression signature that significantly correlated with a reduction in the number of joints with active arthritis, a measure of clinical outcome (Spearman rho = 0.44, p = 0.040, Bonferroni correction. This signature may be associated with a decrease in T-cells, monocytes, neutrophils and platelets. The products of most differentially expressed genes include known biomarkers for JIA such as major histocompatibility complexes and interleukins, as well as novel biomarkers including α-defensins. This method is readily applicable to expression datasets of other complex diseases to uncover shared mechanistic patterns in heterogeneous samples.

  19. Venezuelan equine encephalitis virus infection causes modulation of inflammatory and immune response genes in mouse brain

    Directory of Open Access Journals (Sweden)

    Puri Raj K

    2008-06-01

    Full Text Available Abstract Background Neurovirulent Venezuelan equine encephalitis virus (VEEV causes lethal encephalitis in equines and is transmitted to humans by mosquitoes. VEEV is highly infectious when transmitted by aerosol and has been developed as a bio-warfare agent, making it an important pathogen to study from a military and civilian standpoint. Molecular mechanisms of VEE pathogenesis are poorly understood. To study these, the gene expression profile of VEEV infected mouse brains was investigated. Changes in gene expression were correlated with histological changes in the brain. In addition, a molecular framework of changes in gene expression associated with progression of the disease was studied. Results Our results demonstrate that genes related to important immune pathways such as antigen presentation, inflammation, apoptosis and response to virus (Cxcl10, CxCl11, Ccl5, Ifr7, Ifi27 Oas1b, Fcerg1,Mif, Clusterin and MHC class II were upregulated as a result of virus infection. The number of over-expressed genes (>1.5-fold level increased as the disease progressed (from 197, 296, 400, to 1086 at 24, 48, 72 and 96 hours post infection, respectively. Conclusion Identification of differentially expressed genes in brain will help in the understanding of VEEV-induced pathogenesis and selection of biomarkers for diagnosis and targeted therapy of VEEV-induced neurodegeneration.

  20. Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)

    1997-01-01

    Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.

  1. A class V chitinase from Arabidopsis thaliana: gene responses, enzymatic properties, and crystallographic analysis

    DEFF Research Database (Denmark)

    Ohnuma, Takayuki; Numata, Tomoyuki; Osawa, Takuo

    2011-01-01

    Expression of a class V chitinase gene (At4g19810, AtChiC) in Arabidopsis thaliana was examined by quantitative real-time PCR and by analyzing microarray data available at Genevestigator. The gene expression was induced by the plant stress-related hormones abscisic acid (ABA) and jasmonic acid (JA......, the amino acid residues responsible for substrate binding were found to be well conserved when compared with those of the class V chitinase from Nicotiana tabacum (NtChiV). All of the structural and functional properties of AtChiC are quite similar to those obtained for NtChiV, and seem to be common...

  2. Radiation and desiccation response motif mediates radiation induced gene expression in D. radiodurans

    International Nuclear Information System (INIS)

    Anaganti, Narasimha; Basu, Bhakti; Apte, Shree Kumar

    2015-01-01

    Deinococcus radiodurans is an extremophile that withstands lethal doses of several DNA damaging agents such as gamma irradiation, UV rays, desiccation and chemical mutagens. The organism responds to DNA damage by inducing expression of several DNA repair genes. At least 25 radiation inducible gene promoters harbour a 17 bp palindromic sequence known as radiation and desiccation response motif (RDRM) implicated in gamma radiation inducible gene expression. However, mechanistic details of gamma radiation-responsive up-regulation in gene expression remain enigmatic. The promoters of highly radiation induced genes ddrB (DR0070), gyrB (DR0906), gyrA (DR1913), a hypothetical gene (DR1143) and recA (DR2338) from D. radiodurans were cloned in a green fluorescence protein (GFP)-based promoter probe shuttle vector pKG and their promoter activity was assessed in both E. coli as well as in D. radiodurans. The gyrA, gyrB and DR1143 gene promoters were active in E. coli although ddrB and recA promoters showed very weak activity. In D. radiodurans, all the five promoters were induced several fold following 6 kGy gamma irradiation. Highest induction was observed for ddrB promoter (25 fold), followed by DR1143 promoter (15 fold). The induction in the activity of gyrB, gyrA and recA promoters was 5, 3 and 2 fold, respectively. To assess the role of RDRM, the 17 bp palindromic sequence was deleted from these promoters. The promoters devoid of RDRM sequence displayed increase in the basal expression activity, but the radiation-responsive induction in promoter activity was completely lost. The substitution of two conserved bases of RDRM sequence yielded decreased radiation induction of PDR0070 promoter. Deletion of 5 bases from 5'-end of PDR0070 RDRM increased basal promoter activity, but radiation induction was completely abolished. Replacement of RDRM with non specific sequence of PDR0070 resulted in loss of basal expression and radiation induction. The results demonstrate that

  3. GST ( phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses

    Science.gov (United States)

    Chen, Shihua; Chen, Xin; Dou, Weihong; Wang, Liang; Yin, Haibo; Guo, Shanli

    2016-03-01

    Reactive oxygen species (ROS) scavengers, including ascorbate peroxidase, superoxide dismutase, catalase and peroxidase, are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses. In this study, we cloned an 866 bp GST ( phi) gene in Lemna minor and investigated its characteristics, expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers. GST ( phi) gene expression patterns were similar to those of other scavengers of ROS. This suggests that GST ( phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.

  4. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  5. Occupational Styrene Exposure Induces Stress-Responsive Genes Involved in Cytoprotective and Cytotoxic Activities

    Science.gov (United States)

    Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory

    2013-01-01

    Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524

  6. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  7. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  8. Rapamycin causes activation of protein phosphatase-2A1 and nuclear translocation of PCNA in CD4+ T cells

    International Nuclear Information System (INIS)

    Morrow, Peter W.; Tung, H.Y. Lim; Hemmings, Hugh C.

    2004-01-01

    Rapamycin is a powerful immunosuppressant that causes cell cycle arrest in T cells and several other cell types. Despite its important clinical role, the mechanism of action of rapamycin is not fully understood. Here, we show that rapamycin causes the activation of protein phosphatase-2A 1 which forms a complex with proliferation cell nuclear antigen (PCNA) in a CD 4+ T cell line. Rapamycin also induces PCNA translocation from the cytoplasm to the nucleus, an effect which is antagonized by okadaic acid, an inhibitor of type 2A protein phosphatases. These findings provide evidence for the existence of a signal transduction pathway that links a rapamycin-activated type 2A protein phosphatase to the control of DNA synthesis, DNA repair, cell cycle, and cell death via PCNA

  9. Exploring valid internal-control genes in Porphyra yezoensis (Bangiaceae) during stress response conditions

    Science.gov (United States)

    Wang, Wenlei; Wu, Xiaojie; Wang, Chao; Jia, Zhaojun; He, Linwen; Wei, Yifan; Niu, Jianfeng; Wang, Guangce

    2014-07-01

    To screen the stable expression genes related to the stress (strong light, dehydration and temperature shock) we applied Absolute real-time PCR technology to determine the transcription numbers of the selected test genes in P orphyra yezoensis, which has been regarded as a potential model species responding the stress conditions in the intertidal. Absolute real-time PCR technology was applied to determine the transcription numbers of the selected test genes in P orphyra yezoensis, which has been regarded as a potential model species in stress responding. According to the results of photosynthesis parameters, we observed that Y(II) and F v/ F m were significantly affected when stress was imposed on the thalli of P orphyra yezoensis, but underwent almost completely recovered under normal conditions, which were collected for the following experiments. Then three samples, which were treated with different grade stresses combined with salinity, irradiation and temperature, were collected. The transcription numbers of seven constitutive expression genes in above samples were determined after RNA extraction and cDNA synthesis. Finally, a general insight into the selection of internal control genes during stress response was obtained. We found that there were no obvious effects in terms of salinity stress (at salinity 90) on transcription of most genes used in the study. The 18S ribosomal RNA gene had the highest expression level, varying remarkably among different tested groups. RPS8 expression showed a high irregular variance between samples. GAPDH presented comparatively stable expression and could thus be selected as the internal control. EF-1α showed stable expression during the series of multiple-stress tests. Our research provided available references for the selection of internal control genes for transcripts determination of P. yezoensis.

  10. Network-based association of hypoxia-responsive genes with cardiovascular diseases

    International Nuclear Information System (INIS)

    Wang, Rui-Sheng; Oldham, William M; Loscalzo, Joseph

    2014-01-01

    Molecular oxygen is indispensable for cellular viability and function. Hypoxia is a stress condition in which oxygen demand exceeds supply. Low cellular oxygen content induces a number of molecular changes to activate regulatory pathways responsible for increasing the oxygen supply and optimizing cellular metabolism under limited oxygen conditions. Hypoxia plays critical roles in the pathobiology of many diseases, such as cancer, heart failure, myocardial ischemia, stroke, and chronic lung diseases. Although the complicated associations between hypoxia and cardiovascular (and cerebrovascular) diseases (CVD) have been recognized for some time, there are few studies that investigate their biological link from a systems biology perspective. In this study, we integrate hypoxia genes, CVD genes, and the human protein interactome in order to explore the relationship between hypoxia and cardiovascular diseases at a systems level. We show that hypoxia genes are much closer to CVD genes in the human protein interactome than that expected by chance. We also find that hypoxia genes play significant bridging roles in connecting different cardiovascular diseases. We construct a hypoxia-CVD bipartite network and find several interesting hypoxia-CVD modules with significant gene ontology similarity. Finally, we show that hypoxia genes tend to have more CVD interactors in the human interactome than in random networks of matching topology. Based on these observations, we can predict novel genes that may be associated with CVD. This network-based association study gives us a broad view of the relationships between hypoxia and cardiovascular diseases and provides new insights into the role of hypoxia in cardiovascular biology. (paper)

  11. Meta-analysis of the effect of overexpression of CBF/DREB family genes on drought stress response

    Science.gov (United States)

    Transcription factors C-repeat/dehydration-responsive element binding proteins (CBF/DREB) play an important role in plant response to abiotic stresses. Over-expression of various CBF/DREB genes in diverse plants have been reported, but inconsistency of gene donor, recipient genus, parameters used i...

  12. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K

    2006-10-01

    Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent

  13. Influence of the gene xthA in the activation of SOS response of Escherichia coli

    International Nuclear Information System (INIS)

    Dominguez M, V.

    2013-01-01

    The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)

  14. Socially cued seminal fluid gene expression mediates responses in ejaculate quality to sperm competition risk.

    Science.gov (United States)

    Simmons, Leigh W; Lovegrove, Maxine

    2017-08-30

    There is considerable evidence that males will increase the number of sperm ejaculated in response to sperm competition risk. However, whether they have the capacity to adjust seminal fluid components of the ejaculate has received less attention. Male crickets ( Teleogryllus oceanicus ) have been shown to adjust the viability of sperm in their ejaculate in response to sperm competition risk. Here we show that socially mediated plasticity in sperm viability is probably due, at least in part, to male adjustments in the protein composition of the seminal fluid. Seven seminal fluid protein genes were found to have an increased expression in males exposed to rival calls. Increased expression of these genes was correlated with increased sperm viability in whole ejaculates, and gene knockdown confirmed that at least one of these proteins promotes sperm viability. Our results lend support for recent theoretical models that predict complex responses in male allocation to seminal fluid composition in response to sperm competition risk. © 2017 The Author(s).

  15. Transcriptional profiling uncovers a network of cholesterol-responsive atherosclerosis target genes.

    Directory of Open Access Journals (Sweden)

    Josefin Skogsberg

    2008-03-01

    Full Text Available Despite the well-documented effects of plasma lipid lowering regimes halting atherosclerosis lesion development and reducing morbidity and mortality of coronary artery disease and stroke, the transcriptional response in the atherosclerotic lesion mediating these beneficial effects has not yet been carefully investigated. We performed transcriptional profiling at 10-week intervals in atherosclerosis-prone mice with human-like hypercholesterolemia and a genetic switch to lower plasma lipoproteins (Ldlr(-/-Apo(100/100Mttp(flox/flox Mx1-Cre. Atherosclerotic lesions progressed slowly at first, then expanded rapidly, and plateaued after advanced lesions formed. Analysis of lesion expression profiles indicated that accumulation of lipid-poor macrophages reached a point that led to the rapid expansion phase with accelerated foam-cell formation and inflammation, an interpretation supported by lesion histology. Genetic lowering of plasma cholesterol (e.g., lipoproteins at this point all together prevented the formation of advanced plaques and parallel transcriptional profiling of the atherosclerotic arterial wall identified 37 cholesterol-responsive genes mediating this effect. Validation by siRNA-inhibition in macrophages incubated with acetylated-LDL revealed a network of eight cholesterol-responsive atherosclerosis genes regulating cholesterol-ester accumulation. Taken together, we have identified a network of atherosclerosis genes that in response to plasma cholesterol-lowering prevents the formation of advanced plaques. This network should be of interest for the development of novel atherosclerosis therapies.

  16. Physiological and gene expression responses of sunflower (Helianthus annuus L.) plants differ according to irrigation placement.

    Science.gov (United States)

    Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M

    2014-10-01

    To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Mutual information and the fidelity of response of gene regulatory models

    International Nuclear Information System (INIS)

    Tabbaa, Omar P; Jayaprakash, C

    2014-01-01

    We investigate cellular response to extracellular signals by using information theory techniques motivated by recent experiments. We present results for the steady state of the following gene regulatory models found in both prokaryotic and eukaryotic cells: a linear transcription-translation model and a positive or negative auto-regulatory model. We calculate both the information capacity and the mutual information exactly for simple models and approximately for the full model. We find that (1) small changes in mutual information can lead to potentially important changes in cellular response and (2) there are diminishing returns in the fidelity of response as the mutual information increases. We calculate the information capacity using Gillespie simulations of a model for the TNF-α-NF-κ B network and find good agreement with the measured value for an experimental realization of this network. Our results provide a quantitative understanding of the differences in cellular response when comparing experimentally measured mutual information values of different gene regulatory models. Our calculations demonstrate that Gillespie simulations can be used to compute the mutual information of more complex gene regulatory models, providing a potentially useful tool in synthetic biology. (paper)

  18. PKG in honey bees: spatial expression, Amfor gene expression, sucrose responsiveness, and division of labor.

    Science.gov (United States)

    Thamm, Markus; Scheiner, Ricarda

    2014-06-01

    Division of labor is a hallmark of social insects. In honey bees, division of labor involves transition of female workers from one task to the next. The most distinct tasks are nursing (providing food for the brood) and foraging (collecting pollen and nectar). The brain mechanisms regulating this form of behavioral plasticity have largely remained elusive. Recently, it was suggested that division of labor is based on nutrition-associated signaling pathways. One highly conserved gene associated with food-related behavior across species is the foraging gene, which encodes a cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG). Our analysis of this gene reveals the presence of alternative splicing in the honey bee. One isoform is expressed in the brain. Expression of this isoform is most pronounced in the mushroom bodies, the subesophageal ganglion, and the corpora allata. Division of labor and sucrose responsiveness in honey bees correlate significantly with foraging gene expression in distinct brain regions. Activating PKG selectively increases sucrose responsiveness in nurse bees to the level of foragers, whereas the same treatment does not affect responsiveness to light. These findings demonstrate a direct link between PKG signaling in distinct brain areas and division of labor. Furthermore, they demonstrate that the difference in sensory responsiveness between nurse bees and foragers can be compensated for by activating PKG. Our findings on the function of PKG in regulating specific sensory responsiveness and social organization offer valuable indications for the function of the cGMP/PKG pathway in many other insects and vertebrates. Copyright © 2013 Wiley Periodicals, Inc.

  19. A gene expression profile indicative of early stage HER2 targeted therapy response.

    Science.gov (United States)

    O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert

    2013-07-01

    Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.

  20. Cytogenetic responses to ionizing radiation exposure of human fibroblasts with knocked-down expressions of various DNA damage signaling genes

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry; Wu, Honglu

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have demonstrated that genes with up-regulated expression induced by IR may play important roles in DNA damage sensing, cell cycle checkpoint and chromosomal repair, the relationship between the regulation of gene expression by IR and its impact on cytogenetic responses to ionizing radiation has not been systematically studied. Here, the expression of 25 genes selected based on their transcriptional changes in response to IR or from their known DNA repair roles were individually knocked down by siRNA transfection in human fibroblast cells. Chromosome aberrations (CA) and micronuclei (MN) formation were measured as the cytogenetic endpoints. Our results showed that the yields of MN and/or CA formation were significantly increased by suppressed expression of some of the selected genes in DSB and other DNA repair pathways. Knocked-down expression of other genes showed significant impact on cell cycle progression, possibly because of severe impairment of DNA damage repair. Of these 11 genes that affected the cytogenetic response, 9 were up-regulated in the cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulating the biological consequences after IR. Failure to express these IR-responsive genes, such as by gene mutation, could seriously change the outcome of the post IR scenario and lead to carcinogenesis.

  1. Transcriptional 'memory' of a stress: transient chromatin and memory (epigenetic) marks at stress-response genes.

    Science.gov (United States)

    Avramova, Zoya

    2015-07-01

    Drought, salinity, extreme temperature variations, pathogen and herbivory attacks are recurring environmental stresses experienced by plants throughout their life. To survive repeated stresses, plants provide responses that may be different from their response during the first encounter with the stress. A different response to a similar stress represents the concept of 'stress memory'. A coordinated reaction at the organismal, cellular and gene/genome levels is thought to increase survival chances by improving the plant's tolerance/avoidance abilities. Ultimately, stress memory may provide a mechanism for acclimation and adaptation. At the molecular level, the concept of stress memory indicates that the mechanisms responsible for memory-type transcription during repeated stresses are not based on repetitive activation of the same response pathways activated by the first stress. Some recent advances in the search for transcription 'memory factors' are discussed with an emphasis on super-induced dehydration stress memory response genes in Arabidopsis. © 2015 The Author The Plant Journal © 2015 John Wiley & Sons Ltd.

  2. Differential gene expression profile of the calanoid copepod, Pseudodiaptomus annandalei, in response to nickel exposure.

    Science.gov (United States)

    Jiang, Jie-Lan; Wang, Gui-Zhong; Mao, Ming-Guang; Wang, Ke-Jian; Li, Shao-Jing; Zeng, Chao-Shu

    2013-03-01

    To better understand the underlying mechanisms of reactions of copepods exposed to elevated level of nickel, the suppression subtractive hybridization (SSH) was used to elucidate the response of the copepod Pseudodiaptomus annandalei to nickel exposure at the gene level. P. annandale is one of a few copepod species that can be cultured relatively easy under laboratory condition, and it is considered to be a potential model species for toxicity study. In the present study, P. annandalei were exposed to nickel at a concentration of 8.86 mgL(-1) for 24h, after which the RNA was prepared for SSH using unexposed P. annandalei as drivers. A total of 474 clones on the middle scale in the SSH library were sequenced. Among these genes, 129 potential functional genes were recognized based on the BLAST searches in NCBI and Uniprot databases. These genes were then categorized into nine groups in association with different biological processes using AmiGO against the Gene Ontology database. Of the 129 genes, 127 translatable DNA sequences were predicted to be proteins, and the putative amino acid sequences were searched for conserved domains (CD) and proteins using the CD-Search service and BLASTp. Among 129 genes, 119 (92.2%) were annotated to be involved in different biological processes, while 10 genes (7.8%) were classified as an unknown-function gene group. To further confirm the up-regulation of differentially expressed genes, the quantitative real time PCR were performed to test eight randomly selected genes, in which five of them, i.e. α-tubulin, ribosomal protein L13, ferritin, separase and Myohemerythrin-1, exhibited clear up-regulation after nickel exposure. In addition, MnSOD was further studied for the differential expression pattern after nickel exposure and the results showed that MnSOD had a time- and dose-dependent expression pattern in the copepod after nickel exposure. To the best of our knowledge, this is the first attempt to investigate the toxicity

  3. Life in a changing world: TCH gene regulation of expression and responses to environmental signals

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.

    1996-01-01

    The Arabidopsis TCH genes were discovered as a consequence of their marked upregulation of expression in response to seemingly innocuous stimuli such as touch. Further analyses have indicated that these genes are upregulated by a variety of diverse stimuli. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to changing environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicate that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that the TCH proteins may collaborate in cell wall biogenesis.

  4. Trichomonas vaginalis Cysteine Proteinases: Iron Response in Gene Expression and Proteolytic Activity

    Science.gov (United States)

    Cárdenas-Guerra, Rosa Elena; Figueroa-Angulo, Elisa Elvira; Puente-Rivera, Jonathan; Zamudio-Prieto, Olga; Ortega-López, Jaime

    2015-01-01

    We focus on the iron response of Trichomonas vaginalis to gene family products such as the cysteine proteinases (CPs) involved in virulence properties. In particular, we examined the effect of iron on the gene expression regulation and function of cathepsin L-like and asparaginyl endopeptidase-like CPs as virulence factors. We addressed some important aspects about CPs genomic organization and we offer possible explanations to the fact that only few members of this large gene family are expressed at the RNA and protein levels and the way to control their proteolytic activity. We also summarized all known iron regulations of CPs at transcriptional, posttranscriptional, and posttranslational levels along with new insights into the possible epigenetic and miRNA processes. PMID:26090464

  5. Evidence for adaptive evolution of low-temperature stress response genes in a Pooideae grass ancestor

    DEFF Research Database (Denmark)

    Vigeland, Magnus D; Spannagl, Manuel; Asp, Torben

    2013-01-01

    Adaptation to temperate environments is common in the grass subfamily Pooideae, suggesting an ancestral origin of cold climate adaptation. Here, we investigated substitution rates of genes involved in low-temperature-induced (LTI) stress responses to test the hypothesis that adaptive molecular...... evolution of LTI pathway genes was important for Pooideae evolution. Substitution rates and signatures of positive selection were analyzed using 4330 gene trees including three warm climate-adapted species (maize (Zea mays), sorghum (Sorghum bicolor), and rice (Oryza sativa)) and five temperate Pooideae...... species (Brachypodium distachyon, wheat (Triticum aestivum), barley (Hordeum vulgare), Lolium perenne and Festuca pratensis). Nonsynonymous substitution rate differences between Pooideae and warm habitat-adapted species were elevated in LTI trees compared with all trees. Furthermore, signatures...

  6. High throughput sequencing identifies chilling responsive genes in sweetpotato (Ipomoea batatas Lam.) during storage.

    Science.gov (United States)

    Xie, Zeyi; Zhou, Zhilin; Li, Hongmin; Yu, Jingjing; Jiang, Jiaojiao; Tang, Zhonghou; Ma, Daifu; Zhang, Baohong; Han, Yonghua; Li, Zongyun

    2018-05-21

    Sweetpotato (Ipomoea batatas L.) is a globally important economic food crop. It belongs to Convolvulaceae family and origins in the tropics; however, sweetpotato is sensitive to cold stress during storage. In this study, we performed transcriptome sequencing to investigate the sweetpotato response to chilling stress during storage. A total of 110,110 unigenes were generated via high-throughput sequencing. Differentially expressed genes (DEGs) analysis showed that 18,681 genes were up-regulated and 21,983 genes were down-regulated in low temperature condition. Many DEGs were related to the cell membrane system, antioxidant enzymes, carbohydrate metabolism, and hormone metabolism, which are potentially associated with sweetpotato resistance to low temperature. The existence of DEGs suggests a molecular basis for the biochemical and physiological consequences of sweetpotato in low temperature storage conditions. Our analysis will provide a new target for enhancement of sweetpotato cold stress tolerance in postharvest storage through genetic manipulation. Copyright © 2018. Published by Elsevier Inc.

  7. Genome-wide analysis of WRKY gene family in the sesame genome and identification of the WRKY genes involved in responses to abiotic stresses.

    Science.gov (United States)

    Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong

    2017-09-11

    Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.

  8. Combination of rapamycin, CI-1040, and 17-AAG inhibits metastatic capacity of prostate cancer via Slug inhibition.

    Directory of Open Access Journals (Sweden)

    Guanxiong Ding

    Full Text Available Though prostate cancer (PCa has slow progression, the hormone refractory (HRCP and metastatic entities are substantially lethal and lack effective treatments. Transcription factor Slug is critical in regulating metastases of various tumors including PCa. Here we studied targeted therapy against Slug using combination of 3 drugs targeting 3 pathways respectively converging via Slug and further regulating PCa metastasis. Using in vitro assays we confirmed that Slug up-regulation incurred inhibition of E-cadherin that was anti-metastatic, and inhibited Bim-regulated cell apoptosis in PCa. Upstream PTEN/Akt, mTOR, Erk, and AR/Hsp90 pathways were responsible for Slug up-regulation and each of these could be targeted by rapamycin, CI-1040, and 17-AAG respectively. In 4 PCa cell lines with different traits in terms of PTEN loss and androgen sensitivity we tested the efficacy of mono- and combined therapy with the drugs. We found that metastatic capacity of the cells was maximally inhibited only when all 3 drugs were combined, due to the crosstalk between the pathways. 17-AAG decreases Slug expression via blockade of HSP90-dependent AR stability. Combination of rapamycin and CI-1040 diminishes invasiveness more potently in PCa cells that are androgen insensitive and with PTEN loss. Slug inhibited Bim-mediated apoptosis that could be rescued by mTOR/Erk/HSP90 inhibitors. Using mouse models for circulating PCa DNA quantification, we found that combination of mTOR/Erk/HSP90 inhibitors reduced circulating PCa cells in vivo significantly more potently than combination of 2 or monotherapy. Conclusively, combination of mTOR/Erk/Hsp90 inhibits metastatic capacity of prostate cancer via Slug inhibition.

  9. Drought Response in Wheat: Key Genes and Regulatory Mechanisms Controlling Root System Architecture and Transpiration Efficiency

    Directory of Open Access Journals (Sweden)

    Manoj Kulkarni

    2017-12-01

    Full Text Available Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors, DREB (dehydration responsive element binding, ZFP (zinc finger proteins, WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a

  10. Serine Proteolytic Pathway Activation Reveals an Expanded Ensemble of Wound Response Genes in Drosophila

    Science.gov (United States)

    Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William

    2013-01-01

    After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905

  11. Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare

    Directory of Open Access Journals (Sweden)

    Chevalier Frédéric

    2012-01-01

    Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host

  12. Evaluation of gene expression profile of keratinocytes in response to JP-8 jet fuel

    International Nuclear Information System (INIS)

    Espinoza, Luis A.; Li Peijun; Lee, Richard Y.; Wang Yue; Boulares, A. Hamid; Clarke, Robert; Smulson, Mark E.

    2004-01-01

    The skin is the principal barrier against any environmental insult. Therefore, there is a high risk for a large number of military and civilian personnel exposed to jet fuel JP-8 to suffer percutaneous absorption of this fuel. This paper reports the use of cDNA microarray to identify the gene expression profile in normal human epidermal keratinocytes exposed to JP-8 for 24-h and 7-day periods. The effects of JP-8 exposure on keratinocytes at these two different periods induced a set of genes with altered expression in response to this type of insult. Microarray data were visualized using a novel algorithm based on simple statistical analyses to reduce data dimensionality and identify subsets of discriminant genes. Predictive neural networks were built using a multiplayer perceptron to carry out a proper classification task in microarray data in the untreated versus JP-8-treated samples. The pattern of expressions in response to JP-8 provides evidences that detoxificant-related and cell growth regulator genes with the most variability in the level of expression may be useful genetic markers in adverse health effects of personnel exposed to JP-8. The approaches in our analysis provide a simple, safe, novel, and effective method that is reliable in identifying and analyzing gene expression in samples treated with JP-8 or over potential toxic agents. Gene expression data from these studies can be used to build accurate predictive models that separate different molecular profiles. The data establish the use and effectiveness of these approaches for future prospective studies

  13. Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.

    Science.gov (United States)

    Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L

    2016-02-19

    Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.

  14. Rapamycin inhibits BMP-7-induced osteogenic and lipogenic marker expressions in fetal rat calvarial cells.

    Science.gov (United States)

    Yeh, Lee-Chuan C; Ma, Xiuye; Ford, Jeffery J; Adamo, Martin L; Lee, John C

    2013-08-01

    Bone morphogenetic proteins (BMPs) promote osteoblast differentiation and bone formation in vitro and in vivo. BMPs canonically signal through Smad transcription factors, but BMPs may activate signaling pathways traditionally stimulated by growth factor tyrosine kinase receptors. Of these, the mTOR pathway has received considerable attention because BMPs activate P70S6K, a downstream effector of mTOR, suggesting that BMP-induced osteogenesis is mediated by mTOR activation. However, contradictory effects of the mTOR inhibitor rapamycin (RAPA) on bone formation have been reported. Since bone formation is thought to be inversely related to lipid accumulation and mTOR is also important for lipid synthesis, we postulated that BMP-7 may stimulate lipogenic enzyme expression in a RAPA-sensitive mechanism. To test this hypothesis, we determined the effects of RAPA on BMP-7-stimulated expression of osteogenic and lipogenic markers in cultured fetal rat calvarial cells. Our study showed that BMP-7 promoted the expression of osteogenic and lipogenic markers. The effect of BMP-7 on osteogenic markers was greater in magnitude than on lipogenic markers and was temporally more sustained. RAPA inhibited basal and BMP-7-stimulated osteogenic and lipogenic marker expression and bone nodule mineralization. The acetyl CoA carboxylase inhibitor TOFA stimulated the expression of osteoblast differentiation markers, whereas palmitate suppressed their expression. We speculate that the BMP-7-stimulated adipogenesis is part of the normal anabolic response to BMPs, but that inappropriate activation of the lipid biosynthetic pathway by mTOR could have deleterious effects on bone formation and could explain paradoxical effects of RAPA to promote bone formation. Copyright © 2013 Wiley Periodicals, Inc.

  15. Nerve Growth Factor Gene Therapy: Activation of Neuronal Responses in Alzheimer Disease.

    Science.gov (United States)

    Tuszynski, Mark H; Yang, Jennifer H; Barba, David; U, Hoi-Sang; Bakay, Roy A E; Pay, Mary M; Masliah, Eliezer; Conner, James M; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H

    2015-10-01

    Alzheimer disease (AD) is the most common neurodegenerative disorder and lacks effective disease-modifying therapies. In 2001, we initiated a clinical trial of nerve growth factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in patients with AD. We present postmortem findings in 10 patients with survival times ranging from 1 to 10 years after treatment. To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. Patients in this anatomicopathological study were enrolled in clinical trials from March 2001 to October 2012 at the University of California, San Diego, Medical Center in La Jolla. Ten patients with early AD underwent NGF gene therapy using ex vivo or in vivo gene transfer. The brains of all 8 patients in the first phase 1 ex vivo trial and of 2 patients in a subsequent phase 1 in vivo trial were examined. Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In 2 patients, NGF protein levels were measured by enzyme-linked immunosorbent assay. Among 10 patients, degenerating neurons in the AD brain responded to NGF. All patients exhibited a trophic response to NGF in the form of axonal sprouting toward the NGF source. Comparing treated and nontreated sides of the brain in 3 patients who underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P < .05). Activation of cellular signaling and functional markers was present in 2 patients who underwent adeno-associated viral vectors (serotype 2)-mediated NGF gene transfer. Neurons exhibiting tau pathology and neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic

  16. Mammalian target of rapamycin is essential for cardiomyocyte survival and heart development in mice

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Pengpeng [Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Department of Animal Sciences, Purdue University, West Lafayette, IN 47907 (United States); Shan, Tizhong; Liang, Xinrong [Department of Animal Sciences, Purdue University, West Lafayette, IN 47907 (United States); Deng, Changyan [Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Kuang, Shihuan, E-mail: skuang@purdue.edu [Department of Animal Sciences, Purdue University, West Lafayette, IN 47907 (United States)

    2014-09-12

    Highlights: • mTOR is a critical regulator of many biological processes yet its function in heart is not well understood. • MCK-Cre/Mtor{sup flox/flox} mice were established to delete Mtor in cardiomyocytes. • The mTOR-mKO mice developed normally but die prematurely within 5 weeks after birth due to heart disease. • The mTOR-mKO mice had dilated myocardium and increased cell death. • mTOR-mKO hearts had reduced expression of metabolic genes and activation of mTOR target proteins. - Abstract: Mammalian target of rapamycin (mTOR) is a critical regulator of protein synthesis, cell proliferation and energy metabolism. As constitutive knockout of Mtor leads to embryonic lethality, the in vivo function of mTOR in perinatal development and postnatal growth of heart is not well defined. In this study, we established a muscle-specific mTOR conditional knockout mouse model (mTOR-mKO) by crossing MCK-Cre and Mtor{sup flox/flox} mice. Although the mTOR-mKO mice survived embryonic and perinatal development, they exhibited severe postnatal growth retardation, cardiac muscle pathology and premature death. At the cellular level, the cardiac muscle of mTOR-mKO mice had fewer cardiomyocytes due to apoptosis and necrosis, leading to dilated cardiomyopathy. At the molecular level, the cardiac muscle of mTOR-mKO mice expressed lower levels of fatty acid oxidation and glycolysis related genes compared to the WT littermates. In addition, the mTOR-mKO cardiac muscle had reduced Myh6 but elevated Myh7 expression, indicating cardiac muscle degeneration. Furthermore, deletion of Mtor dramatically decreased the phosphorylation of S6 and AKT, two key targets downstream of mTORC1 and mTORC2 mediating the normal function of mTOR. These results demonstrate that mTOR is essential for cardiomyocyte survival and cardiac muscle function.

  17. Gene expression patterns of the coral Acropora millepora in response to contact with macroalgae

    Science.gov (United States)

    Shearer, T. L.; Rasher, D. B.; Snell, T. W.; Hay, M. E.

    2012-12-01

    Contact with macroalgae often causes coral mortality, but the roles of abrasion versus shading versus allelopathy in these interactions are rarely clear, and effects on gene expression are unknown. Identification of gene expression changes within corals in response to contact with macroalgae can provide insight into the mode of action of allelochemicals, as well as reveal transcriptional strategies of the coral that mitigate damage from this competitive interaction, enabling the coral to survive. Gene expression responses of the coral Acropora millepora after long-term (20 days) direct contact with macroalgae ( Chlorodesmis fastigiata, Dictyota bartayresiana, Galaxaura filamentosa, and Turbinaria conoides) and short-term (1 and 24 h) exposure to C. fastigiata thalli and their hydrophobic extract were assessed. After 20 days of exposure, T. conoides thalli elicited no significant change in visual bleaching or zooxanthellae PSII quantum yield within A. millepora nubbins, but stimulated the greatest alteration in gene expression of all treatments. Chlorodesmis fastigiata, D. bartayresiana, and G. filamentosa caused significant visual bleaching of coral nubbins and reduced the PSII quantum yield of associated zooxanthellae after 20 days, but elicited fewer changes in gene expression relative to T. conoides at day 20. To evaluate initial molecular processes leading to reduction of zooxanthella PSII quantum yield, visual bleaching, and coral death, short-term exposures to C. fastigiata thalli and hydrophobic extracts were conducted; these interactions revealed protein degradation and significant changes in catalytic and metabolic activity within 24 h of contact. These molecular responses are consistent with the hypothesis that allelopathic interactions lead to alteration of signal transduction and an imbalance between reactive oxidant species production and antioxidant capabilities within the coral holobiont. This oxidative imbalance results in rapid protein degradation

  18. Gene expression profile of the fibrotic response in the peritoneal cavity.

    Science.gov (United States)

    Le, S J; Gongora, M; Zhang, B; Grimmond, S; Campbell, G R; Campbell, J H; Rolfe, B E

    2010-01-01

    The cellular response to materials implanted in the peritoneal cavity has been utilised to produce tissue for grafting to hollow smooth muscle organs (blood vessels, bladder, uterus and vas deferens). To gain insight into the regulatory mechanisms involved in encapsulation of a foreign object, and subsequent differentiation of encapsulating cells, the present study used microarray technology and real-time RT-PCR to identify the temporal changes in gene expression associated with tissue development. Immunohistochemical analysis showed that 3-7 days post-implantation of foreign objects (cubes of boiled egg white) into rats, they were encapsulated by tissue comprised primarily of haemopoietic (CD45(+)) cells, mainly macrophages (CD68(+), CCR1(+)). By day 14, tissue capsule cells no longer expressed CD68, but were positive for myofibroblast markers alpha-smooth muscle (SM) actin and SM22. In accordance with these results, gene expression data showed that early capsule (days 3-7) development was dominated by the expression of monocyte/macrophage-specific genes (CD14, CSF-1, CSF-1R, MCP-1) and pro-inflammatory mediators such as transforming growth factor (TGF-beta). As tissue capsule development progressed (days 14-21), myofibroblast-associated and pro-fibrotic genes (associated with TGF-beta and Wnt/beta-catenin signalling pathways, including Wnt 4, TGFbetaRII, connective tissue growth factor (CTGF), SMADs-1, -2, -4 and collagen-1 subunits) were significantly up-regulated. The up-regulation of genes associated with Cardiovascular and Skeletal and Muscular System Development at later time-points suggests the capacity of cells within the tissue capsule for further differentiation to smooth muscle, and possibly other cell types. The identification of key regulatory pathways and molecules associated with the fibrotic response to implanted materials has important applications not only for optimising tissue engineering strategies, but also to control deleterious fibrotic

  19. Phenotypic and gene expression responses of E. coli to antibiotics during spaceflight

    Science.gov (United States)

    Zea, Luis

    Bacterial susceptibility to antibiotics has been shown in vitro to be reduced during spaceflight; however, the underlying mechanisms responsible for this outcome are not fully understood. In particular, it is not yet clear whether this observed response is due to increased drug resistance (a microbial defense response) or decreased drug efficacy (a microgravity biophysical mass transport effect). To gain insight into the differentiation between these two potential causes, an investigation was undertaken onboard the International Space Station (ISS) in 2014 termed Antibiotic Effectiveness in Space-1 (AES-1). For this purpose, E. coli was challenged with two antibiotics, Gentamicin Sulfate and Colistin Sulfate, at concentrations higher than those needed to inhibit growth on Earth. Phenotypic parameters (cell size, cell envelope thickness, population density and lag phase duration) and gene expression were compared between the spaceflight samples and ground controls cultured in varying levels of drug concentration. It was observed that flight samples proliferated in antibiotic concentrations that were inhibitory on Earth, growing on average to a 13-fold greater concentration than matched 1g controls. Furthermore, at the highest drug concentrations in space, E. coli cells were observed to aggregate into visible clusters. In spaceflight, cell size was significantly reduced, translating to a decrease in cell surface area to about one half of the ground controls. Smaller cell surface area can in turn proportionally reduce the rate of antibiotic molecules reaching the cell. Additionally, it was observed that genes --- in some cases more than 2000 --- were overexpressed in space with respect to ground controls. Up-regulated genes include poxB, which helps catabolize glucose into organic acids that alter acidity around and inside the cell, and the gadABC family genes, which confer resistance to extreme acid conditions. The next step is to characterize the mechanisms behind

  20. Identification of cytokinin-responsive genes using microarray meta-analysis and RNA-Seq in Arabidopsis.

    Science.gov (United States)

    Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J

    2013-05-01

    Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.

  1. Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions

    Directory of Open Access Journals (Sweden)

    Hamed Rezaei

    2017-07-01

    Full Text Available Herb dodder ( Cuscuta spp. is one of the most important parasitic plants that can severely affect crop yields in the world. So far, interactions of this parasitic plant with hosts were not investigated adequately. Here, we conducted a differential expression analyzes and identified a number of genes that were differentially expressed in haustorium tissue compared with the stem of Cuscuta campestris growing on Alfalfa. We obtained 439 cDNA fragments from haustoria (parasite-host connection zone and stems (25 cm away from connections zones using the cDNA-AFLP (Amplified Fragment Length Polymorphism method with eight different primer combinations. Of 439 transcript-derived fragments (TDFs that were detected, 145 fragments were identified as differentially expressed genes. Five TDF sequences were similar to known functional genes involved in signal transduction, metabolism, respiration, and stress responses. Genes encoding DEAD-box ATP-dependent RNA helicase, potential heme-binding protein, lysine-specific demethylase 5A were selected for qRT-PCR. The qRT-PCR analyzes confirmed the results obtained using cDNA-AFLP. Our findings shed light on the elicitation of dodder defense responses in the connection zone to overcome plant defense reactions.

  2. Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.

    Science.gov (United States)

    Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale

    2016-08-01

    Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Transcriptomic profiling of Arabidopsis gene expression in response to varying micronutrient zinc supply

    DEFF Research Database (Denmark)

    Azevedo, Herlânder; Azinheiro, Sarah Gaspar; Muñoz-Mérida, Antonio

    2016-01-01

    Deficiency of the micronutrient zinc is a widespread condition in agricultural soils, causing a negative impact on crop quality and yield. Nevertheless, there is an insufficient knowledge on the regulatory and molecular mechanisms underlying the plant response to inadequate zinc nutrition [1......]. This information should contribute to the development of plant-based solutions with improved nutrient-use-efficiency traits in crops. Previously, the transcription factors bZIP19 and bZIP23 were identified as essential regulators of the response to zinc deficiency in Arabidopsis thaliana [2]. A microarray...... experiment comparing gene expression between roots of wild-type and the mutant bzip19 bzip23, exposed to zinc deficiency, led to the identification of differentially expressed genes related with zinc homeostasis, namely its transport and plant internal translocation [2]. Here, we provide the detailed...

  4. Rapamycin doses sufficient to extend lifespan do not compromise muscle mitochondrial content or endurance

    DEFF Research Database (Denmark)

    Widlund, Anne Lykkegaard; Vang, Ole; Ye, Lan

    2013-01-01

    mitochondrial transcripts were decreased, particularly in the highly oxidative soleus muscle, we found no consistent change in mitochondrial DNA or protein levels. In agreement with the lack of change in mitochondrial components, rapamycin-treated mice had endurance equivalent to that of untreated controls...

  5. Rapamycin blocks the antidepressant effect of ketamine in task-dependent manner

    Czech Academy of Sciences Publication Activity Database

    Holubová, Kristína; Kletečková, Lenka; Škurlová, Martina; Říčný, J.; Stuchlík, Aleš; Valeš, Karel

    2016-01-01

    Roč. 233, č. 11 (2016), s. 2077-2097 ISSN 0033-3158 R&D Projects: GA MZd(CZ) NT13403 Institutional support: RVO:67985823 Keywords : ketamine * rapamycin * antidepressants * anxiety * cognitive deficit * bulbectomy * mTOR * BDNF Subject RIV: FH - Neurology Impact factor: 3.308, year: 2016

  6. The Immunosuppressive drug – Rapamycin – Electroanalytical Sensing Using Boron- Doped Diamond electrode

    International Nuclear Information System (INIS)

    Stanković, Dalibor M.; Kalcher, Kurt

    2015-01-01

    Graphical abstract: Display Omitted -- Abstract: This paper presents for the first time the study of electrochemical behavior of well known immunosuppressant drug – rapamycin (sirolimus) using boron-doped diamond electrode. Rapamycin provided single and oval-shaped oxidation peak at +1.1 V vs. Ag/AgCl electrode in Britton–Robinson buffer solution at pH 3 confirming highly irreversible behavior of analyte at boron-doped diamond electrode. A differential pulse voltammetry was used for quantification of tested drug under the optimum experimental conditions. The calibration curve was linear over the range from 0.5 to 19.5 μM (R 2 = 0.9976) with detection limit of 0.22 μM. Repeatability of ten successfully measurements of three different concentrations (5, 10 and 15 μM) was 2.5, 1.9 and 1,7 %, respectively. Influence of most common biomolecules presented in urine samples was evaluated. The suggested analytical methodology was successfully applied for determination of rapamycin in four urine samples with excellent recoveries. The developed approach could be beneficial in analysis of rapamycin in biological samples using boron-doped diamond electrode as up-to-date electrochemical sensor and could represent inexpensive analytical alternative to separation methods

  7. Rapamycin potentiates cytotoxicity by docetaxel possibly through downregulation of Survivin in lung cancer cells

    Directory of Open Access Journals (Sweden)

    Li Hui

    2011-03-01

    Full Text Available Abstract Background To elucidate whether rapamycin, the inhibitor of mTOR (mammalian target of rapamycin, can potentiate the cytotoxic effect of docetaxel in lung cancer cells and to probe the mechanism underlying such enhancement. Methods Lung cancer cells were treated with docetaxel and rapamycin. The effect on the proliferation of lung cancer cells was evaluated using the MTT method, and cell apoptosis was measured by flow cytometry. Protein expression and level of phosphorylation were assayed using Western Blot method. Results Co-treatment of rapamycin and docetaxel was found to favorably enhance the cytotoxic effect of docetaxel in four lung cancer cell lines. This tumoricidal boost is associated with a reduction in the expression and phosphorylation levels of Survivin and ERK1/2, respectively. Conclusion The combined application of mTOR inhibitor and docetaxel led to a greater degree of cancer cell killing than that by either compound used alone. Therefore, this combination warrants further investigation in its suitability of serving as a novel therapeutic scheme for treating advanced and recurrent lung cancer patients.

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  9. Responsible innovation in human germline gene editing: Background document to the recommendations of ESHG and ESHRE.

    Science.gov (United States)

    De Wert, Guido; Heindryckx, Björn; Pennings, Guido; Clarke, Angus; Eichenlaub-Ritter, Ursula; van El, Carla G; Forzano, Francesca; Goddijn, Mariëtte; Howard, Heidi C; Radojkovic, Dragica; Rial-Sebbag, Emmanuelle; Dondorp, Wybo; Tarlatzis, Basil C; Cornel, Martina C

    2018-04-01

    Technological developments in gene editing raise high expectations for clinical applications, including editing of the germline. The European Society of Human Reproduction and Embryology (ESHRE) and the European Society of Human Genetics (ESHG) together developed a Background document and Recommendations to inform and stimulate ongoing societal debates. This document provides the background to the Recommendations. Germline gene editing is currently not allowed in many countries. This makes clinical applications in these countries impossible now, even if germline gene editing would become safe and effective. What were the arguments behind this legislation, and are they still convincing? If a technique could help to avoid serious genetic disorders, in a safe and effective way, would this be a reason to reconsider earlier standpoints? This Background document summarizes the scientific developments and expectations regarding germline gene editing, legal regulations at the European level, and ethics for three different settings (basic research, preclinical research and clinical applications). In ethical terms, we argue that the deontological objections (e.g., gene editing goes against nature) do not seem convincing while consequentialist objections (e.g., safety for the children thus conceived and following generations) require research, not all of which is allowed in the current legal situation in European countries. Development of this Background document and Recommendations reflects the responsibility to help society understand and debate the full range of possible implications of the new technologies, and to contribute to regulations that are adapted to the dynamics of the field while taking account of ethical considerations and societal concerns.

  10. Cellular Stress Response Gene Expression During Upper and Lower Body High Intensity Exercises.

    Science.gov (United States)

    Kochanowicz, Andrzej; Sawczyn, Stanisław; Niespodziński, Bartłomiej; Mieszkowski, Jan; Kochanowicz, Kazimierz; Żychowska, Małgorzata

    2017-01-01

    The aim was to compare the effect of upper and lower body high-intensity exercise on chosen genes expression in athletes and non-athletes. Fourteen elite male artistic gymnasts (EAG) aged 20.6 ± 3.3 years and 14 physically active men (PAM) aged 19.9 ± 1.0 years performed lower and upper body 30 s Wingate Tests. Blood samples were collected before, 5 and 30 minutes after each effort to assess gene expression via PCR. Significantly higher mechanical parameters after lower body exercise was observed in both groups, for relative power (8.7 ± 1.2 W/kg in gymnasts, 7.2 ± 1.2 W/kg in controls, p = 0.01) and mean power (6.7 ± 0.7 W/kg in gymnasts, 5.4 ± 0.8 W/kg in controls, p = 0.01). No differences in lower versus upper body gene expression were detected for all tested genes as well as between gymnasts and physical active man. For IL-6 m-RNA time-dependent effect was observed. Because of no significant differences in expression of genes associated with cellular stress response the similar adaptive effect to exercise may be obtained so by lower and upper body exercise.

  11. Gene expression analysis in response to osmotic stimuli in the intervertebral disc with DNA microarray.

    Science.gov (United States)

    Zhang, Wenzhi; Li, Xu; Shang, Xifu; Zhao, Qichun; Hu, Yefeng; Xu, Xiang; He, Rui; Duan, Liqun; Zhang, Feng

    2013-12-27

    Intervertebral disc (IVD) cells experience a broad range of physicochemical stimuli under physiologic conditions, including alterations in their osmotic environment. At present, the molecular mechanisms underlying osmotic regulation in IVD cells are poorly understood. This study aims to screen genes affected by changes in osmotic pressure in cells of subjects aged 29 to 63 years old, with top-scoring pair (TSP) method. Gene expression data set GSE1648 was downloaded from Gene Expression Omnibus database, including four hyper-osmotic stimuli samples, four iso-osmotic stimuli samples, and three hypo-osmotic stimuli samples. A novel, simple method, referred to as the TSP, was used in this study. Through this method, there was no need to perform data normalization and transformation before data analysis. A total of five pairs of genes ((CYP2A6, FNTB), (PRPF8, TARDBP), (RPS5, OAZ1), (SLC25A3, NPM1) and (CBX3, SRSF9)) were selected based on the TSP method. We inferred that all these genes might play important roles in response to osmotic stimuli and age in IVD cells. Additionally, hyper-osmotic and iso-osmotic stimuli conditions were adverse factors for IVD cells. We anticipate that our results will provide new thoughts and methods for the study of IVD disease.

  12. Nitrogen-responsive genes are differentially regulated in planta during Fusarium oxyspsorum f. sp. lycopersici infection.

    Science.gov (United States)

    Divon, Hege H; Rothan-Denoyes, Beatrice; Davydov, Olga; DI Pietro, Antonio; Fluhr, Robert

    2005-07-01

    SUMMARY Nitrogen is an essential growth component whose availability will limit microbial spread, and as such it serves as a key control point in dictating an organism's adaptation to various environments. Little is known about fungal nutrition in planta. To enhance our understanding of this process we examined the transcriptional adaptation of Fusarium oxysporum f. sp. lycopersici, the causal agent for vascular wilt in tomato, during nutritional stress and plant colonization. Using RT-PCR and microarray technology we compared fungal gene expression in planta to axenic nitrogen starvation culture. Several expressed sequence tags, representing at least four genes, were identified that are concomitantly induced during nitrogen starvation and in planta growth. Three of these genes show similarity to a general amino acid permease, a peptide transporter and an uricase, all functioning in organic nitrogen acquisition. We further show that these genes represent a distinguishable subset of the nitrogen-responsive transcripts that respond to amino acids commonly available in the plant. Our results indicate that nitrogen starvation partially mimics in planta growth conditions, and further suggest that minute levels of organic nitrogen sources dictate the final outcome of fungal gene expression in planta. The nature of the identified transcripts suggests modes of nutrient uptake and survival for Fusarium during colonization.

  13. Differential expression of genes regulated in response to drought stress in diploid cotton (Gossypium arboreum) (abstract)

    International Nuclear Information System (INIS)

    Hussain, T.; Majeed, A.; Maqbool, A.; Hussain, S.S.; Ali, T.; Riazuddin, S.

    2005-01-01

    Negative effects on the Water status of plants is one of the most common and deleterious stresses experienced by wild and cultivated plants throughout the World. Our project is designed to identify, clone and characterize gene sequences regulated in response to Water stress (e.g., drought). We used the differential-display reverse transcriptase polymerase chain reaction (DD-RT- PCA) methodology to accomplish our Objectives. Structural and functional characterization of environmental stress-induced genes has contributed to a better understanding of how plants respond and adapt to different abiotic stresses. Differential display was used to compare overall difference in gene expression between draught stressed and unstressed (control) plants of diploid Cotton (Gossypium arboreum). DDRT-PCR product from stressed and unstressed samples resolved side by side on 6% PAGE to compare qualitative and quantitative difference in mRNA expression. A total of 81 primer combinations were tested. DDRT -PCR enabled us to identify differentially expressed transcripts between water stressed and non-stressed cotton seedlings. PAGE revealed a total of 347 DNA transcripts in stressed samples (New Transcripts) while 110 down regulated and 209 up regulated DNA transcripts were also recorded. Similarly. 22 DNA transcripts were identified based on the comparative study of PAGE and Agarose gel electrophoresis. These sequences showed various degree homology With draught tolerant genes in the gene bank. (author)

  14. The landscape of human genes involved in the immune response to parasitic worms

    Directory of Open Access Journals (Sweden)

    Fumagalli Matteo

    2010-08-01

    Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.

  15. Combined treatment of rapamycin and dietary restriction has a larger effect on the transcriptome and metabolome of liver.

    Science.gov (United States)

    Fok, Wilson C; Bokov, Alex; Gelfond, Jonathan; Yu, Zhen; Zhang, Yiqiang; Doderer, Mark; Chen, Yidong; Javors, Martin; Wood, William H; Zhang, Yongqing; Becker, Kevin G; Richardson, Arlan; Pérez, Viviana I

    2014-04-01

    Rapamycin (Rapa) and dietary restriction (DR) have consistently been shown to increase lifespan. To investigate whether Rapa and DR affect similar pathways in mice, we compared the effects of feeding mice ad libitum (AL), Rapa, DR, or a combination of Rapa and DR (Rapa + DR) on the transcriptome and metabolome of the liver. The principal component analysis shows that Rapa and DR are distinct groups. Over 2500 genes are significantly changed with either Rapa or DR when compared with mice fed AL; more than 80% are unique to DR or Rapa. A similar observation was made when genes were grouped into pathways; two-thirds of the pathways were uniquely changed by DR or Rapa. The metabolome shows an even greater difference between Rapa and DR; no metabolites in Rapa-treated mice were changed significantly from AL mice, whereas 173 metabolites were changed in the DR mice. Interestingly, the number of genes significantly changed by Rapa + DR when compared with AL is twice as large as the number of genes significantly altered by either DR or Rapa alone. In summary, the global effects of DR or Rapa on the liver are quite different and a combination of Rapa and DR results in alterations in a large number of genes and metabolites that are not significantly changed by either manipulation alone, suggesting that a combination of DR and Rapa would be more effective in extending longevity than either treatment alone. © 2013 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  16. Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays

    Science.gov (United States)

    Badri, Hanène; Monsieurs, Pieter; Coninx, Ilse; Nauts, Robin; Wattiez, Ruddy; Leys, Natalie

    2015-01-01

    The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA) and Calvin-Benson-Bassham (CBB) cycles, combined with an activation of the pentose phosphate pathway (PPP). For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation resistance of

  17. Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays.

    Directory of Open Access Journals (Sweden)

    Hanène Badri

    Full Text Available The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA and Calvin-Benson-Bassham (CBB cycles, combined with an activation of the pentose phosphate pathway (PPP. For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation

  18. Regulation of disease-responsive genes mediated by epigenetic factors: interaction of Arabidopsis-Pseudomonas.

    Science.gov (United States)

    De-La-Peña, Clelia; Rangel-Cano, Alicia; Alvarez-Venegas, Raúl

    2012-05-01

    Genes in eukaryotic organisms function within the context of chromatin, and the mechanisms that modulate the structure of chromatin are defined as epigenetic. In Arabidopsis, pathogen infection induces the expression of at least one histone deacetylase, suggesting that histone acetylation/deacetylation has an important role in the pathogenic response in plants. How/whether histone methylation affects gene response to pathogen infection is unknown. To gain a better understanding of the epigenetic mechanisms regulating the interaction between Pseudomonas syringae and Arabidopsis thaliana, we analysed three different Arabidopsis ash1-related (absent, small or homeotic discs 1) mutants. We found that the loss of function of ASHH2 and ASHR1 resulted in faster hypersensitive responses (HRs) to both mutant (hrpA) and pathogenic (DC3000) strains of P. syringae, whereas control (Col-0) and ashr3 mutants appeared to be more resistant to the infection after 2 days. Furthermore, we showed that, in the ashr3 background, the PR1 gene (PATHOGENESIS-RELATED GENE 1) displayed the highest expression levels on infection with DC3000, correlating with increased resistance against this pathogen. Our results show that, in both the ashr1 and ashh2 backgrounds, the histone H3 lysine 4 dimethylation (H3K4me2) levels decreased at the promoter region of PR1 on infection with the DC3000 strain, suggesting that an epigenetically regulated PR1 expression is involved in the plant defence. Our results suggest that histone methylation in response to pathogen infection may be a critical component in the signalling and defence processes occurring between plants and microbes. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

  19. Herpesvirus of turkeys: microarray analysis of host gene responses to infection

    International Nuclear Information System (INIS)

    Karaca, Gamze; Anobile, Jonathan; Downs, Danielle; Burnside, Joan; Schmidt, Carl J.

    2004-01-01

    Herpesvirus of turkeys (HVT) provides an economically important live vaccine for prevention of Marek's disease (MD) of chickens. MD, characterized by both immunosuppression and T-cell lymphoma, is caused by another herpesvirus termed Marek's disease virus (MDV). Microarrays were used to investigate the response of chicken embryonic fibroblasts (CEF) to infection with HVT. Genes responding to HVT infection include several induced by interferon along with others modulating signal transduction, transcription, scaffolding proteins, and the cytoskeleton. Results are compared with earlier studies examining the responses of CEF cells to infection with MDV

  20. Surface Engineering of Porous Silicon Microparticles for Intravitreal Sustained Delivery of Rapamycin

    Science.gov (United States)

    Nieto, Alejandra; Hou, Huiyuan; Moon, Sang Woong; Sailor, Michael J.; Freeman, William R.; Cheng, Lingyun

    2015-01-01

    Purpose. To understand the relationship between rapamycin loading/release and surface chemistries of porous silicon (pSi) to optimize pSi-based intravitreal delivery system. Methods. Three types of surface chemical modifications were studied: (1) pSi-COOH, containing 10-carbon aliphatic chains with terminal carboxyl groups grafted via hydrosilylation of undecylenic acid; (2) pSi-C12, containing 12-carbon aliphatic chains grafted via hydrosilylation of 1-dodecene; and (3) pSiO2-C8, prepared by mild oxidation of the pSi particles followed by grafting of 8-hydrocarbon chains to the resulting porous silica surface via a silanization. Results. The efficiency of rapamycin loading follows the order (micrograms of drug/milligrams of carrier): pSiO2-C8 (105 ± 18) > pSi-COOH (68 ± 8) > pSi-C12 (36 ± 6). Powder X-ray diffraction data showed that loaded rapamycin was amorphous and dynamic drug-release study showed that the availability of the free drug was increased by 6-fold (compared with crystalline rapamycin) by using pSiO2-C8 formulation (P = 0.0039). Of the three formulations in this study, pSiO2-C8-RAP showed optimal performance in terms of simultaneous release of the active drug and carrier degradation, and drug-loading capacity. Released rapamycin was confirmed with the fingerprints of the mass spectrometry and biologically functional as the control of commercial crystalline rapamycin. Single intravitreal injections of 2.9 ± 0.37 mg pSiO2-C8-RAP into rabbit eyes resulted in more than 8 weeks of residence in the vitreous while maintaining clear optical media and normal histology of the retina in comparison to the controls. Conclusions. Porous silicon–based rapamycin delivery system using the pSiO2-C8 formulation demonstrated good ocular compatibility and may provide sustained drug release for retina. PMID:25613937

  1. Surface engineering of porous silicon microparticles for intravitreal sustained delivery of rapamycin.

    Science.gov (United States)

    Nieto, Alejandra; Hou, Huiyuan; Moon, Sang Woong; Sailor, Michael J; Freeman, William R; Cheng, Lingyun

    2015-01-22

    To understand the relationship between rapamycin loading/release and surface chemistries of porous silicon (pSi) to optimize pSi-based intravitreal delivery system. Three types of surface chemical modifications were studied: (1) pSi-COOH, containing 10-carbon aliphatic chains with terminal carboxyl groups grafted via hydrosilylation of undecylenic acid; (2) pSi-C12, containing 12-carbon aliphatic chains grafted via hydrosilylation of 1-dodecene; and (3) pSiO2-C8, prepared by mild oxidation of the pSi particles followed by grafting of 8-hydrocarbon chains to the resulting porous silica surface via a silanization. The efficiency of rapamycin loading follows the order (micrograms of drug/milligrams of carrier): pSiO2-C8 (105 ± 18) > pSi-COOH (68 ± 8) > pSi-C12 (36 ± 6). Powder X-ray diffraction data showed that loaded rapamycin was amorphous and dynamic drug-release study showed that the availability of the free drug was increased by 6-fold (compared with crystalline rapamycin) by using pSiO2-C8 formulation (P = 0.0039). Of the three formulations in this study, pSiO2-C8-RAP showed optimal performance in terms of simultaneous release of the active drug and carrier degradation, and drug-loading capacity. Released rapamycin was confirmed with the fingerprints of the mass spectrometry and biologically functional as the control of commercial crystalline rapamycin. Single intravitreal injections of 2.9 ± 0.37 mg pSiO2-C8-RAP into rabbit eyes resulted in more than 8 weeks of residence in the vitreous while maintaining clear optical media and normal histology of the retina in comparison to the controls. Porous silicon-based rapamycin delivery system using the pSiO2-C8 formulation demonstrated good ocular compatibility and may provide sustained drug release for retina. Copyright 2015 The Association for Research in Vision and Ophthalmology, Inc.

  2. Mammalian target of rapamycin complex 1 activation is required for the stimulation of human skeletal muscle protein synthesis by essential amino acids.

    Science.gov (United States)

    Dickinson, Jared M; Fry, Christopher S; Drummond, Micah J; Gundermann, David M; Walker, Dillon K; Glynn, Erin L; Timmerman, Kyle L; Dhanani, Shaheen; Volpi, Elena; Rasmussen, Blake B

    2011-05-01

    The relationship between mammalian target of rapamycin complex 1 (mTORC1) signaling and muscle protein synthesis during instances of amino acid surplus in humans is based solely on correlational data. Therefore, the goal of this study was to use a mechanistic approach specifically designed to determine whether increased mTORC1 activation is requisite for the stimulation of muscle protein synthesis following L-essential amino acid (EAA) ingestion in humans. Examination of muscle protein synthesis and signaling were performed on vastus lateralis muscle biopsies obtained from 8 young (25 ± 2 y) individuals who were studied prior to and following ingestion of 10 g of EAA during 2 separate trials in a randomized, counterbalanced design. The trials were identical except during 1 trial, participants were administered a single oral dose of a potent mTORC1 inhibitor (rapamycin) prior to EAA ingestion. In response to EAA ingestion, an ~60% increase in muscle protein synthesis was observed during the control trial, concomitant with increased phosphorylation of mTOR (Ser(2448)), ribosomal S6 kinase 1 (Thr(389)), and eukaryotic initiation factor 4E binding protein 1 (Thr(37/46)). In contrast, prior administration of rapamycin completely blocked the increase in muscle protein synthesis and blocked or attenuated activation of mTORC1-signaling proteins. The inhibition of muscle protein synthesis and signaling was not due to differences in either extracellular or intracellular amino acid availability, because these variables were similar between trials. These data support a fundamental role for mTORC1 activation as a key regulator of human muscle protein synthesis in response to increased EAA availability. This information will be useful in the development of evidence-based nutritional therapies targeting mTORC1 to counteract muscle wasting associated with numerous clinical conditions.

  3. Dual responsive promoters to target therapeutic gene expression to radiation-resistant hypoxic tumor cells

    International Nuclear Information System (INIS)

    Chadderton, Naomi; Cowen, Rachel L.; Sheppard, Freda C.D.; Robinson, Suzanne; Greco, Olga; Scott, Simon D.; Stratford, Ian J.; Patterson, Adam V.; Williams, Kaye J.

    2005-01-01

    Purpose: Tumor hypoxia is unequivocally linked to poor radiotherapy outcome. This study aimed to identify enhancer sequences that respond maximally to a combination of radiation and hypoxia for use in genetic radiotherapy approaches. Methods and materials: The influence of radiation (5 Gy) and hypoxia (1% O 2 ) on reporter-gene expression driven by hypoxia (HRE) and radiation (Egr-1) responsive elements was evaluated in tumor cells grown as monolayers or multicellular spheroids. Hypoxia-inducible factor-1α (HIF-1α) and HIF-2α protein expression was monitored in parallel. Results: Of the sequences tested, an HRE from the phosphoglycerate kinase-1 gene (PGK-18[5+]) was maximally induced in response to hypoxia plus radiation in all 5 cell lines tested. The additional radiation treatment afforded a significant increase in the induction of PGK-18[5+] compared with hypoxia alone in 3 cell lines. HIF-1α/2α were induced by radiation but combined hypoxia/radiation treatment did not yield a further increase. The dual responsive nature of HREs was maintained when spheroids were irradiated after delivery of HRE constructs in a replication-deficient adenovirus. Conclusions: Hypoxia-responsive enhancer element sequences are dually responsive to combined radiation and hypoxic treatment. Their use in genetic radiotherapy in vivo could maximize expression in the most radio-resistant population at the time of radiation and also exploit microenvironmental changes after radiotherapy to yield additional switch-on

  4. Testing differential susceptibility: Plasticity genes, the social environment, and their interplay in adolescent response inhibition.

    Science.gov (United States)

    Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K

    2017-06-01

    Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.

  5. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Science.gov (United States)

    Xu, Pei; Moshelion, Menachem; Wu, XiaoHua; Halperin, Ofer; Wang, BaoGen; Luo, Jie; Wallach, Rony; Wu, Xinyi; Lu, Zhongfu; Li, Guojing

    2015-01-01

    Asparagus bean (Vigna unguiculata ssp. sesquipedalis) is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS). Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between different genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding. PMID:26579145

  6. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  7. A survey of genomic studies supports association of circadian clock genes with bipolar disorder spectrum illnesses and lithium response.

    Directory of Open Access Journals (Sweden)

    Michael J McCarthy

    Full Text Available Circadian rhythm abnormalities in bipolar disorder (BD have led to a search for genetic abnormalities in circadian "clock genes" associated with BD. However, no significant clock gene findings have emerged from genome-wide association studies (GWAS. At least three factors could account for this discrepancy: complex traits are polygenic, the organization of the clock is more complex than previously recognized, and/or genetic risk for BD may be shared across multiple illnesses. To investigate these issues, we considered the clock gene network at three levels: essential "core" clock genes, upstream circadian clock modulators, and downstream clock controlled genes. Using relaxed thresholds for GWAS statistical significance, we determined the rates of clock vs. control genetic associations with BD, and four additional illnesses that share clinical features and/or genetic risk with BD (major depression, schizophrenia, attention deficit/hyperactivity. Then we compared the results to a set of lithium-responsive genes. Associations with BD-spectrum illnesses and lithium-responsiveness were both enriched among core clock genes but not among upstream clock modulators. Associations with BD-spectrum illnesses and lithium-responsiveness were also enriched among pervasively rhythmic clock-controlled genes but not among genes that were less pervasively rhythmic or non-rhythmic. Our analysis reveals previously unrecognized associations between clock genes and BD-spectrum illnesses, partly reconciling previously discordant results from past GWAS and candidate gene studies.

  8. Nerve Growth Factor Gene Therapy Activates Neuronal Responses in Alzheimer’s Disease

    Science.gov (United States)

    Tuszynski, Mark H.; Yang, Jennifer H.; Barba, David; U, H S.; Bakay, Roy; Pay, Mary M.; Masliah, Eliezer; Conner, James M.; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H.

    2016-01-01

    IMPORTANCE Alzheimer’s disease (AD) is the most common neurodegenerative disorder, and lacks effective disease modifying therapies. In 2001 we initiated a clinical trial of Nerve Growth Factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in AD patients. We present post-mortem findings in 10 subjects with survival times ranging from 1 to 10 years post-treatment. OBJECTIVE To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. DESIGN, SETTING, AND PARTICIPANTS 10 patients with early AD underwent NGF gene therapy using either ex vivo or in vivo gene transfer. The brains of all eight patients in the first Phase 1 ex vivo trial and two patients in a subsequent Phase 1 in vivo trial were examined. MAIN OUTCOME MEASURES Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In two cases, NGF protein levels were measured by ELISA. RESULTS Degenerating neurons in the AD brain respond to NGF. All patients exhibited a trophic response to NGF, in the form of axonal sprouting toward the NGF source. Comparing treated and non-treated sides of the brain in three patients that underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P>0.05). Activation of cellular signaling and functional markers were present in two patients that underwent AAV2-mediated NGF gene transfer. Neurons exhibiting tau pathology as well as neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic genes with resulting activation of cell signaling. No adverse pathological effects related to NGF were observed. CONCLUSIONS AND RELEVANCE These findings indicate that

  9. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance

    Directory of Open Access Journals (Sweden)

    Shimpei Morimoto

    2018-03-01

    Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after

  10. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  11. Cloning and characterization of stress responsive Glp genes and their promotor regions from rice (abstract)

    International Nuclear Information System (INIS)

    Naqvi, S.M.S.; Mahmood, T.

    2005-01-01

    Plants respond to a number of environmental stimuli by modulating expression of genes. One such family of genes is now known as germin/germin-like protein genes (Glps). In order to detect any Glp gene response in rice, a pair of degenerate primers was designed based on consensus region from Glp sequences in Genbank. Using these primers a DNA fragment of about 550 bp was obtained by PCR amplification from genomic template. This 550 bp DNA was used as probe in Northern analysis. These studies provided evidence pointing to differential response of Glp expression to salt stress. RNA obtained from the roots was used for synthesis of cDNA. This cDNA was amplifiable with sense primer (RGLP1) from above mentioned pair and oligo-(dt) yielding a fragment of approx. 800 bp. Restriction analysis revealed that the PCR product was heterogeneous. After establishing that 800 bp fragment was the desired product, it was cloned in pCRII-TOPO. Five clones were picked up and analyzed by restriction analysis and sequencing. Two different Glp cDNAs were represented by these partial clones. Remaining sequence of the 5' end for clone 4 and 16 was obtained by Rapid Amplification of cDNA ends (RACE). The resultant sequences have been submitted to Genbank as Oryza sativa Rice Germin-like Protein 1 and 2 (osRGLP1 and 2). When full length genes corresponding to these sequences were amplified from genomic templates, resulting fragments were nearly 150 by larger than cDNAs. Cloning of structural genes for osRGLP1 revealed presence of a 162 bp intron in the coding region near 3' end. Preliminary evidence shows that expression of both osRGLP1 and 2 is severely reduced during salt stress. Another approach to establish both osRGLP1 and 2 genes involvement in stress tolerance is to study the ability of their promotor regions to drive expression of some reporter gene during stress. Promotor regions of about 1100 bp has been amplified and cloned and has been confirmed by restriction analysis and nested

  12. Integrating Genetic and Gene Co-expression Analysis Identifies Gene Networks Involved in Alcohol and Stress Responses.

    Science.gov (United States)

    Luo, Jie; Xu, Pei; Cao, Peijian; Wan, Hongjian; Lv, Xiaonan; Xu, Shengchun; Wang, Gangjun; Cook, Melloni N; Jones, Byron C; Lu, Lu; Wang, Xusheng

    2018-01-01

    Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses.

  13. Integrating Genetic and Gene Co-expression Analysis Identifies Gene Networks Involved in Alcohol and Stress Responses

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-04-01

    Full Text Available Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1, down-regulation in NOE but rescue in RSE (pattern 2, up-regulation in both restraint stress followed by a saline injection (RSS and NOE, and further amplification in RSE (pattern 3, and up-regulation in RSS but reduction in both NOE and RSE (pattern 4. We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses.

  14. The effect of the immunophilin ligands rapamycin and FK506 on proliferation of mast cells and other hematopoietic cell lines.

    Science.gov (United States)

    Hultsch, T; Martin, R; Hohman, R J

    1992-01-01

    The immunosuppressive drugs FK506 and cyclosporin A have an identical spectrum of activities with respect to IgE receptor (Fc epsilon RI)-mediated exocytosis from mast cells and T cell receptor-mediated transcription of IL-2. These findings suggest a common step in receptor-mediated signal transduction leading to exocytosis and transcription and imply that immunosuppressive drugs target specific signal transduction pathways, rather than specific cell types. This hypothesis is supported by studies on the effect of rapamycin on IL-3 dependent proliferation of the rodent mast cell line PT18. Rapamycin inhibits proliferation of PT18 cells, achieving a plateau of 80% inhibition at 1 nM. This inhibition is prevented in a competitive manner by FK506, a structural analogue of rapamycin. Proliferation of rat basophilic leukemia cells and WEHI-3 cells was also inhibited, at doses comparable to those shown previously to inhibit IL-2-dependent proliferation of cytotoxic T lymphocyte line (CTLL) cells. In contrast, proliferation of A-431 cells, a epidermoid cell line, was not affected by rapamycin. DNA histograms indicate that complexes formed between the rapamycin-FK506-binding protein (FKBP) and rapamycin arrest-proliferating PT18 cells in the G0/G1-phase. It is concluded that FKBP-rapamycin complexes may inhibit proliferative signals emanating from IL-3 receptors, resulting in growth arrest of cytokine-dependent, hematopoietic cells. PMID:1384815

  15. A Signal-On Fluorosensor Based on Quench-Release Principle for Sensitive Detection of Antibiotic Rapamycin

    Directory of Open Access Journals (Sweden)

    Hee-Jin Jeong

    2015-03-01

    Full Text Available An antibiotic rapamycin is one of the most commonly used immunosuppressive drugs, and also implicated for its anti-cancer activity. Hence, the determination of its blood level after organ transplantation or tumor treatment is of great concern in medicine. Although there are several rapamycin detection methods, many of them have limited sensitivity, and/or need complicated procedures and long assay time. As a novel fluorescent biosensor for rapamycin, here we propose “Q’-body”, which works on the fluorescence quench-release principle inspired by the antibody-based quenchbody (Q-body technology. We constructed rapamycin Q’-bodies by linking the two interacting domains FKBP12 and FRB, whose association is triggered by rapamycin. The fusion proteins were each incorporated position-specifically with one of fluorescence dyes ATTO520, tetramethylrhodamine, or ATTO590 using a cell-free translation system. As a result, rapid rapamycin dose-dependent fluorescence increase derived of Q’-bodies was observed, especially for those with ATTO520 with a lowest detection limit of 0.65 nM, which indicates its utility as a novel fluorescent biosensor for rapamycin.

  16. A signal-on fluorosensor based on quench-release principle for sensitive detection of antibiotic rapamycin.

    Science.gov (United States)

    Jeong, Hee-Jin; Itayama, Shuya; Ueda, Hiroshi

    2015-03-26

    An antibiotic rapamycin is one of the most commonly used immunosuppressive drugs, and also implicated for its anti-cancer activity. Hence, the determination of its blood level after organ transplantation or tumor treatment is of great concern in medicine. Although there are several rapamycin detection methods, many of them have limited sensitivity, and/or need complicated procedures and long assay time. As a novel fluorescent biosensor for rapamycin, here we propose "Q'-body", which works on the fluorescence quench-release principle inspired by the antibody-based quenchbody (Q-body) technology. We constructed rapamycin Q'-bodies by linking the two interacting domains FKBP12 and FRB, whose association is triggered by rapamycin. The fusion proteins were each incorporated position-specifically with one of fluorescence dyes ATTO520, tetramethylrhodamine, or ATTO590 using a cell-free translation system. As a result, rapid rapamycin dose-dependent fluorescence increase derived of Q'-bodies was observed, especially for those with ATTO520 with a lowest detection limit of 0.65 nM, which indicates its utility as a novel fluorescent biosensor for rapamycin.

  17. Rapamycin enhances the anti-angiogenesis and anti-proliferation ability of YM155 in oral squamous cell carcinoma.

    Science.gov (United States)

    Li, Kong-Liang; Wang, Yu-Fan; Qin, Jia-Ruo; Wang, Feng; Yang, Yong-Tao; Zheng, Li-Wu; Li, Ming-Hua; Kong, Jie; Zhang, Wei; Yang, Hong-Yu

    2017-06-01

    YM155, a small molecule inhibitor of survivin, has been studied in many tumors. It has been shown that YM155 inhibited oral squamous cell carcinoma through promoting apoptosis and autophagy and inhibiting proliferation. It was found that YM155 also inhibited the oral squamous cell carcinoma-mediated angiogenesis through the inactivation of the mammalian target of rapamycin pathway. Rapamycin, a mammalian target of rapamycin inhibitor, played an important role in the proliferation and angiogenesis of oral squamous cell carcinoma cell lines. In our study, cell proliferation assay, transwell assay, tube formation assay, and western blot assay were used to investigate the synergistic effect of rapamycin on YM155 in oral squamous cell carcinoma. Either in vitro or in vivo, rapamycin and YM155 exerted a synergistic effect on the inhibition of survivin and vascular endothelial growth factor through mammalian target of rapamycin pathway. Overall, our results revealed that low-dose rapamycin strongly promoted the sensitivity of oral squamous cell carcinoma cell lines to YM155.

  18. Transcriptomic profiling of Arabidopsis gene expression in response to varying micronutrient zinc supply

    Directory of Open Access Journals (Sweden)

    Herlânder Azevedo

    2016-03-01

    Full Text Available Deficiency of the micronutrient zinc is a widespread condition in agricultural soils, causing a negative impact on crop quality and yield. Nevertheless, there is an insufficient knowledge on the regulatory and molecular mechanisms underlying the plant response to inadequate zinc nutrition [1]. This information should contribute to the development of plant-based solutions with improved nutrient-use-efficiency traits in crops. Previously, the transcription factors bZIP19 and bZIP23 were identified as essential regulators of the response to zinc deficiency in Arabidopsis thaliana [2]. A microarray experiment comparing gene expression between roots of wild-type and the mutant bzip19 bzip23, exposed to zinc deficiency, led to the identification of differentially expressed genes related with zinc homeostasis, namely its transport and plant internal translocation [2]. Here, we provide the detailed methodology, bioinformatics analysis and quality controls related to the microarray gene expression profiling published by Assunção and co-workers [2]. Most significantly, the present dataset comprises new experimental variables, including analysis of shoot tissue, and zinc sufficiency and excess supply. Thus, it expands from 8 to 42 microarrays hybridizations, which have been deposited at the Gene Expression Omnibus (GEO under the accession number GSE77286. Overall, it provides a resource for research on the molecular basis and regulatory events of the plant response to zinc supply, emphasizing the importance of Arabidopsis bZIP19 and bZIP23 transcription factors. Keywords: Microarray, Micronutrient, Zinc deficiency, Arabidopsis, bZIP

  19. Gene transcription and biomarker responses in the clam Ruditapes philippinarum after exposure to ibuprofen

    Energy Technology Data Exchange (ETDEWEB)

    Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca [Department of Comparative Biomedicine and Food Science, University of Padova, Viale dell' Universita 16, Legnaro (Padova) (Italy); Marin, Maria Gabriella [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy); Matozzo, Valerio, E-mail: matozzo@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy)

    2013-01-15

    Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 {mu}g IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both 'IBU concentration' and 'exposure duration' on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.

  20. Differential response of two somatolactin genes to zinc or estrogen in pituitary of Cyprinus carpio.

    Science.gov (United States)

    Valenzuela, G E; Perez, A; Navarro, M; Romero, A; Figueroa, J; Kausel, G

    2015-05-01

    Environmental changes affect gene expression that we addressed in the pituitary, a central regulatory organ at the interface between the central nervous system and the endocrine system. With the aim to reveal effects of changes in the aquatic environment on the expression of hypothalamo-hypophyseal factors, we characterized somatolactin (SL) in Cyprinus carpio. SL, a fish specific pituitary hormone belonging to the prolactin (PRL) superfamily, is involved in background adaptation, osmoregulation, reproduction and fatty acid metabolism. Two sl genes, α and β, were discovered in carp and transcripts of both were detected in pituitaries. Clearly, expression of slα and slβ was modulated significantly in pituitary of male adult carp in response to treatment with ZnCl2 (Zn), but only slβ responded to 17β-estrogen (E2), relative to control carp as shown by RT-qPCR analyses. Furthermore, the amount of mRNA of related factors was assessed revealing variable effects on prl, growth hormone (gh), and facto