Structural Basis of Rap Phosphatase Inhibition by Phr Peptides

Science.gov (United States)

Gallego del Sol, Francisca; Marina, Alberto

2013-01-01

Two-component systems, composed of a sensor histidine kinase and an effector response regulator (RR), are the main signal transduction devices in bacteria. In Bacillus, the Rap protein family modulates complex signaling processes mediated by two-component systems, such as competence, sporulation, or biofilm formation, by inhibiting the RR components involved in these pathways. Despite the high degree of sequence homology, Rap proteins exert their activity by two completely different mechanisms of action: inducing RR dephosphorylation or blocking RR binding to its target promoter. However the regulatory mechanism involving Rap proteins is even more complex since Rap activity is antagonized by specific signaling peptides (Phr) through a mechanism that remains unknown at the molecular level. Using X-ray analyses, we determined the structure of RapF, the anti-activator of competence RR ComA, alone and in complex with its regulatory peptide PhrF. The structural and functional data presented herein reveal that peptide PhrF blocks the RapF-ComA interaction through an allosteric mechanism. PhrF accommodates in the C-terminal tetratricopeptide repeat domain of RapF by inducing its constriction, a conformational change propagated by a pronounced rotation to the N-terminal ComA-binding domain. This movement partially disrupts the ComA binding site by triggering the ComA disassociation, whose interaction with RapF is also sterically impaired in the PhrF-induced conformation of RapF. Sequence analyses of the Rap proteins, guided by the RapF-PhrF structure, unveil the molecular basis of Phr recognition and discrimination, allowing us to relax the Phr specificity of RapF by a single residue change. PMID:23526880

Genetic diversity and natural selection in the rhoptry-associated protein 1 (RAP-1) of recent Plasmodium knowlesi clinical isolates from Malaysia.

Science.gov (United States)

Rawa, Mira Syahfriena Amir; Fong, Mun-Yik; Lau, Yee-Ling

2016-02-05

The Plasmodium rhoptry-associated protein 1 (RAP-1) plays a role in the formation of the parasitophorous vacuole following the parasite's invasion of red blood cells. Although there is some evidence that the protein is recognized by the host's immune system, study of Plasmodium falciparum RAP-1 (PfRAP-1) suggests that it is not under immune pressure. A previous study on five old (1953-1962) P. knowlesi strains suggested that RAP-1 has limited genetic polymorphism and might be under negative selection. In the present study, 30 recent P. knowlesi isolates were studied to obtain a better insight into the polymorphism and natural selection of PkRAP-1. Blood samples from 30 knowlesi malaria patients were used. These samples were collected between 2010 and 2014. The PkRAP-1 gene, which contains two exons, was amplified by PCR, cloned into Escherichia coli and sequenced. Genetic diversity and phylogenetic analyses were performed using MEGA6 and DnaSP ver. 5.10.00 programs. Thirty PkRAP-1 sequences were obtained. The nucleotide diversity (π) of exons 1, 2 and the total coding region (0.00915, 0.01353 and 0.01298, respectively) were higher than those of the old strains. Further analysis revealed a lower rate of non-synonymous (dN) than synonymous (dS) mutations, suggesting negative (purifying) selection of PkRAP-1. Tajima's D test and Fu and Li's D test values were not significant. At the amino acid level, 22 haplotypes were established with haplotype H7 having the highest frequency (7/34, 20.5 %). In the phylogenetic analysis, two distinct haplotype groups were observed. The first group contained the majority of the haplotypes, whereas the second had fewer haplotypes. The present study found higher genetic polymorphism in the PkRAP-1 gene than the polymorphism level reported in a previous study. This observation may stem from the difference in sample size between the present (n = 30) and the previous (n = 5) study. Synonymous and non-synonymous mutation analysis indicated

Bacillus subtilis RapA phosphatase domain interaction with its substrate, phosphorylated Spo0F, and its inhibitor, the PhrA peptide.

Science.gov (United States)

Diaz, Alejandra R; Core, Leighton J; Jiang, Min; Morelli, Michela; Chiang, Christina H; Szurmant, Hendrik; Perego, Marta

2012-03-01

Rap proteins in Bacillus subtilis regulate the phosphorylation level or the DNA-binding activity of response regulators such as Spo0F, involved in sporulation initiation, or ComA, regulating competence development. Rap proteins can be inhibited by specific peptides generated by the export-import processing pathway of the Phr proteins. Rap proteins have a modular organization comprising an amino-terminal alpha-helical domain connected to a domain formed by six tetratricopeptide repeats (TPR). In this study, the molecular basis for the specificity of the RapA phosphatase for its substrate, phosphorylated Spo0F (Spo0F∼P), and its inhibitor pentapeptide, PhrA, was analyzed in part by generating chimeric proteins with RapC, which targets the DNA-binding domain of ComA, rather than Spo0F∼P, and is inhibited by the PhrC pentapeptide. In vivo analysis of sporulation efficiency or competence-induced gene expression, as well as in vitro biochemical assays, allowed the identification of the amino-terminal 60 amino acids as sufficient to determine Rap specificity for its substrate and the central TPR3 to TPR5 (TPR3-5) repeats as providing binding specificity toward the Phr peptide inhibitor. The results allowed the prediction and testing of key residues in RapA that are essential for PhrA binding and specificity, thus demonstrating how the widespread structural fold of the TPR is highly versatile, using a common interaction mechanism for a variety of functions in eukaryotic and prokaryotic organisms.

Cell motility in chronic lymphocytic leukemia: defective Rap1 and alphaLbeta2 activation by chemokine.

Science.gov (United States)

Till, Kathleen J; Harris, Robert J; Linford, Andrea; Spiller, David G; Zuzel, Mirko; Cawley, John C

2008-10-15

Chemokine-induced activation of alpha4beta1 and alphaLbeta2 integrins (by conformational change and clustering) is required for lymphocyte transendothelial migration (TEM) and entry into lymph nodes. We have previously reported that chemokine-induced TEM is defective in chronic lymphocytic leukemia (CLL) and that this defect is a result of failure of the chemokine to induce polar clustering of alphaLbeta2; engagement of alpha4beta1 and autocrine vascular endothelial growth factor (VEGF) restore clustering and TEM. The aim of the present study was to characterize the nature of this defect in alphaLbeta2 activation and determine how it is corrected. We show here that the alphaLbeta2 of CLL cells is already in variably activated conformations, which are not further altered by chemokine treatment. Importantly, such treatment usually does not cause an increase in the GTP-loading of Rap1, a GTPase central to chemokine-induced activation of integrins. Furthermore, we show that this defect in Rap1 GTP-loading is at the level of the GTPase and is corrected in CLL cells cultured in the absence of exogenous stimuli, suggesting that the defect is the result of in vivo stimulation. Finally, we show that, because Rap1-induced activation of both alpha4beta1 and alphaLbeta2 is defective, autocrine VEGF and chemokine are necessary to activate alpha4beta1 for ligand binding. Subsequently, this binding and both VEGF and chemokine stimulation are all needed for alphaLbeta2 activation for motility and TEM. The present study not only clarifies the nature of the alphaLbeta2 defect of CLL cells but is the first to implicate activation of Rap1 in the pathophysiology of CLL.

Specific T-cell recognition of the merozoite proteins rhoptry-associated protein 1 and erythrocyte-binding antigen 1 of Plasmodium falciparum

DEFF Research Database (Denmark)

Jakobsen, P H; Hviid, L; Theander, T G

1993-01-01

The merozoite proteins merozoite surface protein 1 (MSP-1) and rhoptry-associated protein 1 (RAP-1) and synthetic peptides containing sequences of MSP-1, RAP-1, and erythrocyte-binding antigen 1, induced in vitro proliferative responses of lymphocytes collected from Ghanaian blood donors living i...... by individuals living in an area with a high transmission rate of malaria. Most of the donor plasma samples tested contained immunoglobulin G (IgG) and IgM antibodies recognizing the merozoite proteins, while only a minority showed high IgG reactivity to the synthetic peptides.......The merozoite proteins merozoite surface protein 1 (MSP-1) and rhoptry-associated protein 1 (RAP-1) and synthetic peptides containing sequences of MSP-1, RAP-1, and erythrocyte-binding antigen 1, induced in vitro proliferative responses of lymphocytes collected from Ghanaian blood donors living...

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

Science.gov (United States)

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-10-11

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

Mcm1p binding sites in ARG1 positively regulate Gcn4p binding and SWI/SNF recruitment

OpenAIRE

Yoon, Sungpil; Hinnebusch, Alan G.

2009-01-01

Transcription of the arginine biosynthetic gene ARG1 is activated by Gcn4p, a transcription factor induced by starvation for any amino acid. Previously we showed that Gcn4p binding stimulates the recruitment of Mcm1p and co-activator SWI/SNF to ARG1 in cells via Gcn4p induction through amino acid starvation. Here we report that Gcn4p binding is reduced by point mutations of the Mcm1p binding site and increased by overexpression of Mcm1p. This result suggests that Mcm1p plays a positive role i...

Synergistic regulation of competence development in Bacillus subtilis by two Rap-Phr systems.

Science.gov (United States)

Bongiorni, Cristina; Ishikawa, Shu; Stephenson, Sophie; Ogasawara, Naotake; Perego, Marta

2005-07-01

The 11 Rap proteins of Bacillus subtilis comprise a conserved family of tetratricopeptide (TPR)-containing regulatory proteins. Their activity is inhibited by specific Phr pentapeptides produced from the product of phr genes through an export-import maturation process. We found that one of the proteins, namely RapF, is involved in the regulation of competence to DNA transformation. The ComA response regulator and transcription factor for initiation of competence development is the target of RapF. Specific binding of RapF to the carboxy-terminal DNA-binding domain of ComA inhibits the response regulator's ability to bind its target DNA promoters. The PhrF C-terminal pentapeptide, QRGMI, inhibits RapF activity. The activity of RapF and PhrF in regulating competence development is analogous to the previously described activity of RapC and PhrC (L. J. Core and M. Perego, Mol. Microbiol. 49:1509-1522, 2003). In fact, the RapF and PhrF pair of proteins acts synergistically with RapC and PhrC in the overall regulation of the ComA transcription factor. Since the transcription of the RapC- and RapF-encoding genes is positively regulated by their own target ComA, an autoregulatory circuit must exist for the competence transcription factor in order to modulate its activity.

Cytoplasmic RAP1 mediates cisplatin resistance of non-small cell lung cancer.

Science.gov (United States)

Xiao, Lu; Lan, Xiaoying; Shi, Xianping; Zhao, Kai; Wang, Dongrui; Wang, Xuejun; Li, Faqian; Huang, Hongbiao; Liu, Jinbao

2017-05-18

Cytotoxic chemotherapy agents (e.g., cisplatin) are the first-line drugs to treat non-small cell lung cancer (NSCLC) but NSCLC develops resistance to the agent, limiting therapeutic efficacy. Despite many approaches to identifying the underlying mechanism for cisplatin resistance, there remains a lack of effective targets in the population that resist cisplatin treatment. In this study, we sought to investigate the role of cytoplasmic RAP1, a previously identified positive regulator of NF-κB signaling, in the development of cisplatin resistance in NSCLC cells. We found that the expression of cytoplasmic RAP1 was significantly higher in high-grade NSCLC tissues than in low-grade NSCLC; compared with a normal pulmonary epithelial cell line, the A549 NSCLC cells exhibited more cytoplasmic RAP1 expression as well as increased NF-κB activity; cisplatin treatment resulted in a further increase of cytoplasmic RAP1 in A549 cells; overexpression of RAP1 desensitized the A549 cells to cisplatin, and conversely, RAP1 depletion in the NSCLC cells reduced their proliferation and increased their sensitivity to cisplatin, indicating that RAP1 is required for cell growth and has a key mediating role in the development of cisplatin resistance in NSCLC cells. The RAP1-mediated cisplatin resistance was associated with the activation of NF-κB signaling and the upregulation of the antiapoptosis factor BCL-2. Intriguingly, in the small portion of RAP1-depleted cells that survived cisplatin treatment, no induction of NF-κB activity and BCL-2 expression was observed. Furthermore, in established cisplatin-resistant A549 cells, RAP1 depletion caused BCL2 depletion, caspase activation and dramatic lethality to the cells. Hence, our results demonstrate that the cytoplasmic RAP1-NF-κB-BCL2 axis represents a key pathway to cisplatin resistance in NSCLC cells, identifying RAP1 as a marker and a potential therapeutic target for cisplatin resistance of NSCLC.

Synergistic Regulation of Competence Development in Bacillus subtilis by Two Rap-Phr Systems† ‡

Science.gov (United States)

Bongiorni, Cristina; Ishikawa, Shu; Stephenson, Sophie; Ogasawara, Naotake; Perego, Marta

2005-01-01

The 11 Rap proteins of Bacillus subtilis comprise a conserved family of tetratricopeptide (TPR)-containing regulatory proteins. Their activity is inhibited by specific Phr pentapeptides produced from the product of phr genes through an export-import maturation process. We found that one of the proteins, namely RapF, is involved in the regulation of competence to DNA transformation. The ComA response regulator and transcription factor for initiation of competence development is the target of RapF. Specific binding of RapF to the carboxy-terminal DNA-binding domain of ComA inhibits the response regulator's ability to bind its target DNA promoters. The PhrF C-terminal pentapeptide, QRGMI, inhibits RapF activity. The activity of RapF and PhrF in regulating competence development is analogous to the previously described activity of RapC and PhrC (L. J. Core and M. Perego, Mol. Microbiol. 49:1509-1522, 2003). In fact, the RapF and PhrF pair of proteins acts synergistically with RapC and PhrC in the overall regulation of the ComA transcription factor. Since the transcription of the RapC- and RapF-encoding genes is positively regulated by their own target ComA, an autoregulatory circuit must exist for the competence transcription factor in order to modulate its activity. PMID:15968044

Sequence and organization of the rhoptry-associated-protein-1 (rap-1) locus for the sheep hemoprotozoan Babesia sp. BQ1 Lintan (B. motasi phylogenetic group).

Science.gov (United States)

Niu, Qingli; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence

2013-11-15

Babesiosis is a frequent infection of animals worldwide by tick borne pathogen Babesia, and several species are responsible for ovine babesiosis. Recently, several Babesia motasi-like isolates were described in sheep in China. In this study, we sequenced the multigenic rap-1 gene locus of one of these isolates, Babesia sp. BQ1 Lintan. The RAP-1 proteins are involved in the process of red blood cells invasion and thus represent a potential target for vaccine development. A complex composition and organization of the rap-1 locus was discovered with: (1) the presence of 3 different types of rap-1 sequences (rap-1a, rap-1b and rap-1c); (2) the presence of multiple copies of rap-1a and rap-1b; (3) polymorphism among the rap-1a copies, with two classes (named rap-1a61 and rap-1a67) having a similarity of 95.7%, each class represented by two close variants; (4) polymorphism between rap-1a61-1 and rap-1a61-2 limited to three nucleotide positions; (5) a difference of eight nucleotides between rap-1a67-1 and rap-1a67-2 from position 1270 to the putative stop site of rap-1a67-1 which might produce two putative proteins of slightly different sizes; (6) the ratio of rap-1a copies corresponding to one rap-1a67, one rap-1a61-1 and one rap-1a61-2; (7) the presence of three different intergenic regions separating rap-1a, rap-1b and rap-1c; (8) interspacing of the rap-1a copies with rap-1b copies; and (9) the terminal position of rap-1c in the locus. A 31kb locus composed of 6 rap-1a sequences interspaced with 5 rap-1b sequences and with a terminal rap-1c copy was hypothesized. A strikingly similar sequence composition (rap-1a, rap-1b and rap-1c), as well as strong gene identities and similar locus organization with B. bigemina were found and highlight the conservation of synteny at this locus in this phylogenetic clade. Copyright © 2013 Elsevier B.V. All rights reserved.

Neuronal Rap1 Regulates Energy Balance, Glucose Homeostasis, and Leptin Actions

Directory of Open Access Journals (Sweden)

Kentaro Kaneko

2016-09-01

Full Text Available The CNS contributes to obesity and metabolic disease; however, the underlying neurobiological pathways remain to be fully established. Here, we show that the small GTPase Rap1 is expressed in multiple hypothalamic nuclei that control whole-body metabolism and is activated in high-fat diet (HFD-induced obesity. Genetic ablation of CNS Rap1 protects mice from dietary obesity, glucose imbalance, and insulin resistance in the periphery and from HFD-induced neuropathological changes in the hypothalamus, including diminished cellular leptin sensitivity and increased endoplasmic reticulum (ER stress and inflammation. Furthermore, pharmacological inhibition of CNS Rap1 signaling normalizes hypothalamic ER stress and inflammation, improves cellular leptin sensitivity, and reduces body weight in mice with dietary obesity. We also demonstrate that Rap1 mediates leptin resistance via interplay with ER stress. Thus, neuronal Rap1 critically regulates leptin sensitivity and mediates HFD-induced obesity and hypothalamic pathology and may represent a potential therapeutic target for obesity treatment.

Crystal structure of the C-terminal domain of the RAP74 subunit of human transcription factor IIF

Energy Technology Data Exchange (ETDEWEB)

Kamada, Katsuhiko; De Angelis, Jacqueline; Roeder, Robert G.; Burley, Stephen K. (Rockefeller)

2012-12-13

The x-ray structure of a C-terminal fragment of the RAP74 subunit of human transcription factor (TF) IIF has been determined at 1.02-{angstrom} resolution. The {alpha}/{beta} structure is strikingly similar to the globular domain of linker histone H5 and the DNA-binding domain of hepatocyte nuclear factor 3{gamma} (HNF-3{gamma}), making it a winged-helix protein. The surface electrostatic properties of this compact domain differ significantly from those of bona fide winged-helix transcription factors (HNF-3{gamma} and RFX1) and from the winged-helix domains found within the RAP30 subunit of TFIIF and the {beta} subunit of TFIIE. RAP74 has been shown to interact with the TFIIF-associated C-terminal domain phosphatase FCP1, and a putative phosphatase binding site has been identified within the RAP74 winged-helix domain.

Neuronal Rap1 Regulates Energy Balance, Glucose Homeostasis, and Leptin Actions.

Science.gov (United States)

Kaneko, Kentaro; Xu, Pingwen; Cordonier, Elizabeth L; Chen, Siyu S; Ng, Amy; Xu, Yong; Morozov, Alexei; Fukuda, Makoto

2016-09-13

The CNS contributes to obesity and metabolic disease; however, the underlying neurobiological pathways remain to be fully established. Here, we show that the small GTPase Rap1 is expressed in multiple hypothalamic nuclei that control whole-body metabolism and is activated in high-fat diet (HFD)-induced obesity. Genetic ablation of CNS Rap1 protects mice from dietary obesity, glucose imbalance, and insulin resistance in the periphery and from HFD-induced neuropathological changes in the hypothalamus, including diminished cellular leptin sensitivity and increased endoplasmic reticulum (ER) stress and inflammation. Furthermore, pharmacological inhibition of CNS Rap1 signaling normalizes hypothalamic ER stress and inflammation, improves cellular leptin sensitivity, and reduces body weight in mice with dietary obesity. We also demonstrate that Rap1 mediates leptin resistance via interplay with ER stress. Thus, neuronal Rap1 critically regulates leptin sensitivity and mediates HFD-induced obesity and hypothalamic pathology and may represent a potential therapeutic target for obesity treatment. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Requirement of the Caenorhabditis elegans RapGEF pxf-1 and rap-1 for epithelial integrity

Czech Academy of Sciences Publication Activity Database

Pellis-van Berkel, W.; Verheijen, M. H. G.; Cuppen, E.; Asahina, Masako; de Rooij, J.; Jansen, G.; Plasterk, R. H. A.; Bos, J. L.; Zwartkruis, F. J. T.

2005-01-01

Roč. 16, č. 1 (2005), s. 106-116 ISSN 1059-1524 R&D Projects: GA AV ČR KJB5022303 Institutional research plan: CEZ:AV0Z60220518 Keywords : Rap signaling pathway * epidermis * Caenorhabditis elegans Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.520, year: 2005

E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

International Nuclear Information System (INIS)

Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

2005-01-01

E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

PI3-kinase γ promotes Rap1a-mediated activation of myeloid cell integrin α4β1, leading to tumor inflammation and growth.

Directory of Open Access Journals (Sweden)

Michael C Schmid

Full Text Available Tumor inflammation, the recruitment of myeloid lineage cells into the tumor microenvironment, promotes angiogenesis, immunosuppression and metastasis. CD11b+Gr1lo monocytic lineage cells and CD11b+Gr1hi granulocytic lineage cells are recruited from the circulation by tumor-derived chemoattractants, which stimulate PI3-kinase γ (PI3Kγ-mediated integrin α4 activation and extravasation. We show here that PI3Kγ activates PLCγ, leading to RasGrp/CalDAG-GEF-I&II mediated, Rap1a-dependent activation of integrin α4β1, extravasation of monocytes and granulocytes, and inflammation-associated tumor progression. Genetic depletion of PLCγ, CalDAG-GEFI or II, Rap1a, or the Rap1 effector RIAM was sufficient to prevent integrin α4 activation by chemoattractants or activated PI3Kγ (p110γCAAX, while activated Rap (RapV12 promoted constitutive integrin activation and cell adhesion that could only be blocked by inhibition of RIAM or integrin α4β1. Similar to blockade of PI3Kγ or integrin α4β1, blockade of Rap1a suppressed both the recruitment of monocytes and granulocytes to tumors and tumor progression. These results demonstrate critical roles for a PI3Kγ-Rap1a-dependent pathway in integrin activation during tumor inflammation and suggest novel avenues for cancer therapy.

Ageing management studies of RAPS-1

International Nuclear Information System (INIS)

Bohra, A.K.; Jain, L.K.; Joshi, K.M.

2006-01-01

Unit-l of Rajasthan Atomic Power Station (RAPS-1) is the first nuclear power plant of India with pressurized heavy water reactor. The construction of Unit-l of Rajasthan Atomic Power Station (RAPS-1) was started in the year 1966 in collaboration with Canada. The Unit-1 achieved first criticality on August 1972 and was first synchronized to Grid on November 1972. During initial operation of the Unit, several problems were faced in its various systems and these were addressed by incorporating various engineering changes and procedures. In this unit various major innovative repairs were done like end shield leak repair, OPRD leak repair. Considering the operation of various systems of Unit-1, since year 1971 it was imperative to study ageing degradation mechanisms and mitigating measures were to be taken. Although the ageing management is a continuous process the opportunity of Unit-1 shutdown for upgradations from 30-04-2002 to 08-02-2004 was utilized for inspection and assessment of health of various SSC, which otherwise could not have been done with unit in operational state. This paper contains the following in detail. (1) Ageing management programme, its objectives and scope (2) Methodology of ageing management studies - Replacement and upgradation -Additional inspection programme based on ageing management review - Statistical analysis of ageing degradation occurrence - Estimation of residual life span of cables and relays (3) Criteria for selection of components for ageing management programme (4) Findings of ageing management studies-case studies. The ageing study done for RAPS-1 indicated that appropriate ageing monitoring methods and procedures exist in the station for taking timely mitigating measures. The technological obsoleteness has been overcome by installing new components of latest technology. On overall assessment, the Unit-1 was considered fit for further service. (author)

Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

International Nuclear Information System (INIS)

Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

2005-01-01

Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

Anti-inflammatory and analgesic activity of r.a.p . ( Radix Angelicae ...

African Journals Online (AJOL)

The objective of this paper was to study the anti-inflammatory and analgesic effects of Radix Angelicae Pubescentis (R.A.P) ethanol extracts. Three classic anti-inflammatory models and two analgesic models were used in this research. In anti-inflammatory tests, all the extracts have a certain inhibition on the acute ...

Product (P1) from project 0-6738 : performance studies and future directions for mixes containing RAP and RAS.

Science.gov (United States)

2013-01-01

In recent years both reclaimed asphalt pavement (RAP) and recycled asphalt shingles (RAS) have been widely used in asphalt mixes by the asphalt paving industry in Texas. The use of RAP and RAS can save tax payers money, and it is also good for the...

[Cloning of VH and VL Gene of Human anti-IL1RAP McAb and Construction of Recombinant Chimeric Receptor].

Science.gov (United States)

Yin, Ling-Ling; Ruan, Su-Hong; Tian, Yu; Zhao, Kai; Xu, Kai Lin

2015-10-01

To clone the variable region genes of human anti-IL1RAP (IL-1 receptor accessory protein) monoclonal antibodies (McAb) and to construct IL1RAP chimeric antigen receptors (CARs). The VH and VL DNA of IL1RAP single chain antibodies were amplified by RACE and overlap extension PCR from total RNA extracted from 3H6E10 and 10D8A7 hybridoma and ligated into specific IL1RAP single-chain variable fragments (scFv). CD8α transmembrane domain, CD137 intracellular domain, TCR ζ chain, human CD8α signal peptide and scFv-anti-IL1RAP were cloned into plasmid LV-lac. Recombinant lentiviruses were generated by co-transfection of recombinant plasmid LV-lac, pMD2. G, and psPAX2 helper vectors into 293FT packing cells. The VH and VL genes of 2 human anti-IL1RAP McAb were acquired. The 3H6E10 VH and VL genes consisted of 402 bp and 393 bp encoding 134 and 131 aminoacid residues, respectively; 10D8A7 VH and VL genes consisted of 423 bp and 381 bp encoding 141 and 127 amine acid residues, respectively. Recombinant expression vertors LV-3H6E10 scFv-ICD and LV-10D8A7 scFv-ICD (ICD: CD8α transmembrane domain-CD137 intracellular domain-TCR ζ chain) were constructed. The target fragments were demonstrated by sequencing analysis. Recombinant plasmids were transfected into 293FT cells and lentiviral particles were acquired. Human anti-IL1RAP recombinant receptors are constructed successfully and lay a good foundation for the construction of IL1RAP-CAR killer T cell vaccine.

Specificity versus redundancy in the RAP2.4 transcription factor family of Arabidopsis thaliana: transcriptional regulation of genes for chloroplast peroxidases.

Science.gov (United States)

Rudnik, Radoslaw; Bulcha, Jote Tafese; Reifschneider, Elena; Ellersiek, Ulrike; Baier, Margarete

2017-08-23

The Arabidopsis ERFIb / RAP2.4 transcription factor family consists of eight members with highly conserved DNA binding domains. Selected members have been characterized individually, but a systematic comparison is pending. The redox-sensitive transcription factor RAP2.4a mediates chloroplast-to-nucleus redox signaling and controls induction of the three most prominent chloroplast peroxidases, namely 2-Cys peroxiredoxin A (2CPA) and thylakoid- and stromal ascorbate peroxidase (tAPx and sAPx). To test the specificity and redundancy of RAP2.4 transcription factors in the regulation of genes for chloroplast peroxidases, we compared the DNA-binding sites of the transcription factors in tertiary structure models, analyzed transcription factor and target gene regulation by qRT-PCR in RAP2.4, 2-Cys peroxiredoxin and ascorbate peroxidase T-DNA insertion lines and RAP2.4 overexpressing lines of Arabidopsis thaliana and performed promoter binding studies. All RAP2.4 proteins bound the tAPx promoter, but only the four RAP2.4 proteins with identical DNA contact sites, namely RAP2.4a, RAP2.4b, RAP2.4d and RAP2.4h, interacted stably with the redox-sensitive part of the 2CPA promoter. Gene expression analysis in RAP2.4 knockout lines revealed that RAP2.4a is the only one supporting 2CPA and chloroplast APx expression. Rap2.4h binds to the same promoter region as Rap2.4a and antagonizes 2CPA expression. Like the other six RAP2.4 proteins, Rap2.4 h promotes APx mRNA accumulation. Chloroplast ROS signals induced RAP2.4b and RAP2.4d expression, but these two transcription factor genes are (in contrast to RAP2.4a) insensitive to low 2CP availability, and their expression decreased in APx knockout lines. RAP2.4e and RAP2.4f gradually responded to chloroplast APx availability and activated specifically APx expression. These transcription factors bound, like RAP2.4c and RAP2.4g, the tAPx promoter, but hardly the 2CPA promoter. The RAP2.4 transcription factors form an environmentally and

Neuronal Rap1 regulates energy balance, glucose homeostasis, and leptin actions

OpenAIRE

Kaneko, Kentaro; Xu, Pingwen; Cordonier, Elizabeth L.; Chen, Siyu S.; Ng, Amy; Xu, Yong; Morozov, Alexei; Fukuda, Makoto

2016-01-01

The central nervous system (CNS) contributes to obesity and metabolic disease; however, the underlying neurobiological pathways remain to be fully established. Here we show that the small GTPase Rap1 is expressed in multiple hypothalamic nuclei that control whole-body metabolism and is activated in high-fat diet (HFD)-induced obesity. Genetic ablation of CNS Rap1 protects mice from dietary obesity, glucose imbalance, and insulin resistance in the periphery and from HFD-induced neuropathologic...

Rap1 integrates tissue polarity, lumen formation, and tumorigenicpotential in human breast epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Itoh, Masahiko; Nelson, Celeste M.; Myers, Connie A.; Bissell,Mina J.

2006-09-29

Maintenance of apico-basal polarity in normal breast epithelial acini requires a balance between cell proliferation, cell death, and proper cell-cell and cell-extracellular matrix signaling. Aberrations in any of these processes can disrupt tissue architecture and initiate tumor formation. Here we show that the small GTPase Rap1 is a crucial element in organizing acinar structure and inducing lumen formation. Rap1 activity in malignant HMT-3522 T4-2 cells is appreciably higher than in S1 cells, their non-malignant counterparts. Expression of dominant-negative Rap1 resulted in phenotypic reversion of T4-2 cells, led to formation of acinar structures with correct apico-basal polarity, and dramatically reduced tumor incidence despite the persistence of genomic abnormalities. The resulting acini contained prominent central lumina not observed when other reverting agents were used. Conversely, expression of dominant-active Rap1 in T4-2 cells inhibited phenotypic reversion and led to increased invasiveness and tumorigenicity. Thus, Rap1 acts as a central regulator of breast architecture, with normal levels of activation instructing apical polarity during acinar morphogenesis, and increased activation inducing tumor formation and progression to malignancy.

Strong conservation of rhoptry-associated-protein-1 (RAP-1) locus organization and sequence among Babesia isolates infecting sheep from China (Babesia motasi-like phylogenetic group).

Science.gov (United States)

Niu, Qingli; Valentin, Charlotte; Bonsergent, Claire; Malandrin, Laurence

2014-12-01

Rhoptry-associated-protein 1 (RAP-1) is considered as a potential vaccine candidate due to its involvement in red blood cell invasion by parasites in the genus Babesia. We examined its value as a vaccine candidate by studying RAP-1 conservation in isolates of Babesia sp. BQ1 Ningxian, Babesia sp. Tianzhu and Babesia sp. Hebei, responsible for ovine babesiosis in different regions of China. The rap-1 locus in these isolates has very similar features to those described for Babesia sp. BQ1 Lintan, another Chinese isolate also in the B. motasi-like phylogenetic group, namely the presence of three types of rap-1 genes (rap-1a, rap-1b and rap-1c), multiple conserved rap-1b copies (5) interspaced with more or less variable rap-1a copies (6), and the 3' localization of one rap-1c. The isolates Babesia sp. Tianzhu, Babesia sp. BQ1 Lintan and Ningxian were almost identical (average nucleotide identity of 99.9%) over a putative locus of about 31 Kb, including the intergenic regions. Babesia sp. Hebei showed a similar locus organization but differed in the rap-1 locus sequence, for each gene and intergenic region, with an average nucleotide identity of 78%. Our results are in agreement with 18S rDNA phylogenetic studies performed on these isolates. However, in extremely closely related isolates the rap-1 locus seems more conserved (99.9%) than the 18S rDNA (98.7%), whereas in still closely related isolates the identities are much lower (78%) compared with the 18S rDNA (97.7%). The particularities of the rap-1 locus in terms of evolution, phylogeny, diagnosis and vaccine development are discussed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

Science.gov (United States)

Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

2017-11-15

Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

Rif1 Binding and Control of Chromosome-Internal DNA Replication Origins Is Limited by Telomere Sequestration.

Science.gov (United States)

Hafner, Lukas; Lezaja, Aleksandra; Zhang, Xu; Lemmens, Laure; Shyian, Maksym; Albert, Benjamin; Follonier, Cindy; Nunes, Jose Manuel; Lopes, Massimo; Shore, David; Mattarocci, Stefano

2018-04-24

The Saccharomyces cerevisiae telomere-binding protein Rif1 plays an evolutionarily conserved role in control of DNA replication timing by promoting PP1-dependent dephosphorylation of replication initiation factors. However, ScRif1 binding outside of telomeres has never been detected, and it has thus been unclear whether Rif1 acts directly on the replication origins that it controls. Here, we show that, in unperturbed yeast cells, Rif1 primarily regulates late-replicating origins within 100 kb of a telomere. Using the chromatin endogenous cleavage ChEC-seq technique, we robustly detect Rif1 at late-replicating origins that we show are targets of its inhibitory action. Interestingly, abrogation of Rif1 telomere association by mutation of its Rap1-binding module increases Rif1 binding and origin inhibition elsewhere in the genome. Our results indicate that Rif1 inhibits replication initiation by interacting directly with origins and suggest that Rap1-dependent sequestration of Rif1 increases its effective concentration near telomeres, while limiting its action at chromosome-internal sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Activation of the Small GTPase Rap1 Inhibits Choroidal Neovascularization by Regulating Cell Junctions and ROS Generation in Rats.

Science.gov (United States)

Li, Jiajia; Zhang, Rong; Wang, Caixia; Wang, Xin; Xu, Man; Ma, Jingxue; Shang, Qingli

2018-03-30

Choroidal neovascularization (CNV) is a common vision-threatening complication associated with many  fundus diseases. The retinal pigment epithelial (RPE) cell junction barrier has critical functions in preventing CNV, and oxidative stress can cause compromise of barrier integrity and induce angiogenesis. Rap1, a small guanosine triphosphatase (GTPase), is involved in regulating endothelial and epithelial cell junctions. In this work, we explored the function and mechanism of Rap1 in CNV in vivo. A laser-induced rat CNV model was developed. Rap1 was activated through intravitreal injection of the Rap1 activator 8CPT-2'-O-Me-cAMP (8CPT). At 14 days after laser treatment, CNV size in RPE/choroid flat mounts was measured by fluorescein isothiocyanate-dextran staining. Expression of vascular endothelial growth factor (VEGF) and cell junction proteins in RPE/choroid tissues were analyzed by western blots and quantitative real-time PCR assays. Reactive oxygen species (ROS) in RPE cells were detectedbydichloro-dihydro-fluorescein diacetate assays. The antioxidant apocynin was intraperitoneally injected into rats. Activating Rap1 by 8CPT significantly reduced CNV size and VEGF expression in the rat CNV model. Rap1 activation enhanced protein and mRNA levels of ZO-1 and occludin, two tight junction proteins in the RPE barrier. In addition, reducing ROS generation by injection of apocynin, a NADPH oxidase inhibitor, inhibited CNV formation. Rap1 activation reduced ROS generation and expression of NADPH oxidase 4. Rap1 activation inhibits CNV through regulating barrier integrity and ROS generation of RPE in vivo, and selectively activating Rap1 may be a way to reduce vision loss from CNV.

Molecular characterization of the Babesia caballi rap-1 gene and epidemiological survey in horses in Israel.

Science.gov (United States)

Rapoport, Adi; Aharonson-Raz, Karin; Berlin, Dalia; Tal, Saar; Gottlieb, Yuval; Klement, Eyal; Steinman, Amir

2014-04-01

Equine piroplasmosis imposes great concerns for the equine industry regarding international horse movement, and therefore requires reliable diagnostic tools. Recent studies from South Africa and Jordan, including a preliminary study in Israel, reported extremely low seroprevalence to Babesia caballi (B. caballi) (0-1%) using the acceptable rhoptry-associated protein-1 (RAP-1) cELISA. In accordance with the study from South Africa demonstrating a significant heterogeneity in the rap-1 gene sequence of South African B. caballi isolates, the objectives of this study were to phylogenetically characterize the rap-1 gene of the Israeli isolates and determine the prevalence of B. caballi in horses in Israel. Out of 273 horses tested using the RAP-1 cELISA, only one was sero-positive, while 9.3% were positive on PCR performed on the rap-1 gene. Phylogenetic analysis of the rap-1 gene grouped the Israeli isolates in a cluster together with the South African strains (99% nt identity), but in a separate cluster from the American/Caribbean strains (81-82% nt identity). These findings support the existence of heterogeneity in the RAP-1 amino-acid sequences of the Israeli and South African isolates as compared to that used in the cELISA commercial kit and raise doubts as to the ability of this assay to serve as a sole regulatory test for international horse movement. Risk factor analysis found management and age to significantly associate with prevalence of B. caballi, as higher prevalence was noted in horses held out on pasture and a negative association was recorded with age. In addition, B. caballi was not detected in horses in the steppe-arid and extreme-arid climatic regions as compared to the wetter regions. Findings of this study emphasize the need to combine several detection methods to ameliorate the control and spread of the disease. Copyright © 2014 Elsevier B.V. All rights reserved.

Rap Poetry and Postmodernism

Directory of Open Access Journals (Sweden)

Kirill Molokov

2017-10-01

Full Text Available This article observes several most significant rap albums of this decade within postmodern literature. Today rap culture ceased to be a sort of “outsider” in academic opinion, because of its influences on the culture and art innovations. We study albums as literary objects according to literary aesthetic theories and principles, display the main postmodern features they have, and analyze the role of rap poetry within postmodernism in general. The results suggest that rap poetry is postmodern not only musically, but also lyrically, as an object of literature. The rap music embodies all the postmodern traits and synthesizes them within the syntheses of music and literature and high art and pop culture.

Cobalt production in RAPS-1

International Nuclear Information System (INIS)

Krishnan, P.D.; Purandare, H.D.

1978-01-01

At present in RAPS-1 radioisotope Co 60 is produced by irradiating Co 59 in the adjusters which perform the function of regulation of reactivity, power and xenon override. But the manrem expenditure of the crew handling the charge and discharge of the adjusters is going to be prohibitively high. It is therefore proposed to irradiate Co 59 in the fuel channel positions. The physics optimisation study for such irradiation is presented. The burnup penalty and loss of power are estimated to produce the required quantity of Co 60 after optimising the number of cobalt pencils in a bundle and the positions of the cobalt producing channels in the reactor core. (author)

Two biomarker-directed randomized trials in European and Chinese patients with nonsmall-cell lung cancer: the BRCA1-RAP80 Expression Customization (BREC) studies.

Science.gov (United States)

Moran, T; Wei, J; Cobo, M; Qian, X; Domine, M; Zou, Z; Bover, I; Wang, L; Provencio, M; Yu, L; Chaib, I; You, C; Massuti, B; Song, Y; Vergnenegre, A; Lu, H; Lopez-Vivanco, G; Hu, W; Robinet, G; Yan, J; Insa, A; Xu, X; Majem, M; Chen, X; de Las Peñas, R; Karachaliou, N; Sala, M A; Wu, Q; Isla, D; Zhou, Y; Baize, N; Zhang, F; Garde, J; Germonpre, P; Rauh, S; ALHusaini, H; Sanchez-Ronco, M; Drozdowskyj, A; Sanchez, J J; Camps, C; Liu, B; Rosell, R

2014-11-01

In a Spanish Lung Cancer Group (SLCG) phase II trial, the combination of BRCA1 and receptor-associated protein 80 (RAP80) expression was significantly associated with outcome in Caucasian patients with nonsmall-cell lung cancer (NSCLC). The SLCG therefore undertook an industry-independent collaborative randomized phase III trial comparing nonselected cisplatin-based chemotherapy with therapy customized according to BRCA1/RAP80 expression. An analogous randomized phase II trial was carried out in China under the auspices of the SLCG to evaluate the effect of BRCA1/RAP80 expression in Asian patients. Eligibility criteria included stage IIIB-IV NSCLC and sufficient tumor specimen for molecular analysis. Randomization to the control or experimental arm was 1 : 1 in the SLCG trial and 1 : 3 in the Chinese trial. In both trials, patients in the control arm received docetaxel/cisplatin; in the experimental arm, patients with low RAP80 expression received gemcitabine/cisplatin, those with intermediate/high RAP80 expression and low/intermediate BRCA1 expression received docetaxel/cisplatin, and those with intermediate/high RAP80 expression and high BRCA1 expression received docetaxel alone. The primary end point was progression-free survival (PFS). Two hundred and seventy-nine patients in the SLCG trial and 124 in the Chinese trial were assessable for PFS. PFS in the control and experimental arms in the SLCG trial was 5.49 and 4.38 months, respectively [log rank P = 0.07; hazard ratio (HR) 1.28; P = 0.03]. In the Chinese trial, PFS was 4.74 and 3.78 months, respectively (log rank P = 0.82; HR 0.95; P = 0.82). Accrual was prematurely closed on the SLCG trial due to the absence of clinical benefit in the experimental over the control arm. However, the BREC studies provide proof of concept that an international, nonindustry, biomarker-directed trial is feasible. Thanks to the groundwork laid by these studies, we expect that ongoing further research on alternative biomarkers to

miR-203a is involved in HBx-induced inflammation by targeting Rap1a

Energy Technology Data Exchange (ETDEWEB)

Wu, AiRong [Department of gastroenterology, The First affiliated Hospital of Soochow University, Suzhou 215006 (China); Chen, Huo [Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123 (China); Xu, ChunFang [Department of gastroenterology, The First affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhou, Ji; Chen, Si [Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123 (China); Shi, YuQi [Department of gastroenterology, The First affiliated Hospital of Soochow University, Suzhou 215006 (China); Xu, Jie [Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123 (China); Gan, JianHe, E-mail: j_pzhang@suda.edu.cn [Department of gastroenterology, The First affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhang, JinPing, E-mail: ganjianhe@aliyun.com [Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123 (China)

2016-11-15

Hepatitis B virus (HBV) causes acute and chronic hepatitis, and is one of the major causes of cirrhosis and hepatocellular carcinoma. Accumulating evidence suggests that inflammation is the key factor for liver cirrhosis and hepatocellular carcinoma. MicroRNAs play important roles in many biological processes. Here, we aim to explore the function of microRNAs in the HBX-induced inflammation. First, microarray experiment showed that HBV{sup +} liver samples expressed higher level of miR-203a compared to HBV{sup -} liver samples. To verify these alterations, HBx-coding plasmid was transfected into HepG2 cells to overexpress HBx protein. The real-time PCR results suggested that over-expression of HBx could induce up-regulation of miR-203a. To define how up-regulation of miR-203a can induce liver cells inflammation, we over-expressed miR-203a in HepG2 cells. Annexin V staining and BrdU staining suggested that overexpression of miR-203a significantly increased the cell apoptosis and proliferation, meanwhile, over-expression of miR-203a could lead to a decrease in G0/G1 phase cells and an increase in G2/M phase cells. Some cytokines production including IL-6 and IL-8 were significantly increased, but TGFβ and IFNγ were decreased in miR-203a over-expressed HepG2 cells. Luciferase reporter assay experiments, protein mass-spectrum assay and real-time PCR all together demonstrated that Rap1a was the target gene of miR-203a. Further experiments showed that these alterations were modulated through PI3K/ERK/p38/NFκB pathways. These data suggested that HBV-infection could up-regulate the expression of miR-203a, thus down regulated the expression of Rap1a and affected the PI3K/ERK/p38/NFκB pathways, finally induced the hepatitis inflammation. - Highlights: • HBX induces the over-expression of miR-203a in HepG2 cells. • miR-203a targets Rap1a to induce the inflammation in HepG2 cells. • miR-203a regulates the apoptosis and cell cycles of HepG2 cells. • miR-203a alters

Ultrastructural and biochemical localization of N-RAP at the interface between myofibrils and intercalated disks in the mouse heart.

Science.gov (United States)

Zhang, J Q; Elzey, B; Williams, G; Lu, S; Law, D J; Horowits, R

2001-12-11

N-RAP is a recently discovered muscle-specific protein found at cardiac intercalated disks. Double immunogold labeling of mouse cardiac muscle reveals that vinculin is located immediately adjacent to the fascia adherens region of the intercalated disk membrane, while N-RAP extends approximately 100 nm further toward the interior of the cell. We partially purified cardiac intercalated disks using low- and high-salt extractions followed by density gradient centrifugation. Immunoblots show that this preparation is highly enriched in desmin and junctional proteins, including N-RAP, talin, vinculin, beta1-integrin, N-cadherin, and connexin 43. Electron microscopy and immunolabeling demonstrate that N-RAP and vinculin are associated with the large fragments of intercalated disks that are present in this preparation, which also contains numerous membrane vesicles. Detergent treatment of the partially purified intercalated disks removed the membrane vesicles and extracted vinculin and beta1-integrin. Further separation on a sucrose gradient removed residual actin and myosin and yielded a fraction morphologically similar to fasciae adherentes that was highly enriched in N-RAP, N-cadherin, connexin 43, talin, desmin, and alpha-actinin. The finding that N-RAP copurifies with detergent-extracted intercalated disk fragments even though beta-integrin and vinculin have been completely removed suggests that N-RAP association with the adherens junction region is mediated by the cadherin system. Consistent with this hypothesis, we found that recombinant N-RAP fragments bind alpha-actinin in a gel overlay assay. In addition, immunofluorescence shows that N-RAP remains bound at the ends of isolated, detergent-treated cardiac myofibrils. These results demonstrate that N-RAP remains tightly bound to myofibrils and fasciae adherentes during biochemical purification and may be a key constituent in the mechanical link between these two structures.

DNA-binding proteins regulating pIP501 transfer and replication

Directory of Open Access Journals (Sweden)

Elisabeth Grohmann

2016-08-01

Full Text Available pIP501 is a Gram-positive broad-host-range model plasmid intensively used for studying plasmid replication and conjugative transfer. It is a multiple antibiotic resistance plasmid frequently found in clinical Enterococcus faecalis and Enterococcus faecium isolates. Replication of pIP501 proceeds unidirectionally by a theta mechanism. The minimal replicon of pIP501 is composed of the repR gene encoding the essential rate-limiting replication initiator protein RepR and the origin of replication, oriR, located downstream of repR. RepR is similar to RepE of related streptococcal plasmid pAMβ1, which has been shown to possess RNase activity cleaving free RNA molecules in close proximity of the initiation site of DNA synthesis. Replication of pIP501 is controlled by the concerted action of a small protein, CopR, and an antisense RNA, RNAIII. CopR has a dual role: It acts as transcriptional repressor at the repR promoter and prevents convergent transcription of RNAIII and repR mRNA (RNAII, thereby indirectly increasing RNAIII synthesis. CopR binds asymmetrically as a dimer at two consecutive binding sites upstream of and overlapping with the repR promoter. RNAIII induces transcriptional attenuation within the leader region of the repR mRNA (RNAII. Deletion of either control component causes a 10- to 20-fold increase of plasmid copy number, while simultaneous deletions have no additional effect. Conjugative transfer of pIP501 depends on a type IV secretion system (T4SS encoded in a single operon. Its transfer host-range is considerably broad, as it has been transferred to virtually all Gram-positive bacteria including filamentous streptomycetes and even the Gram-negative Escherichia coli. Expression of the 15 genes encoding the T4SS is tightly controlled by binding of the relaxase TraA, the transfer initiator protein, to the operon promoter, which overlaps with the origin of transfer (oriT. The T4SS operon encodes the DNA-binding proteins TraJ (VirD4

Rap G protein signal in normal and disordered lymphohematopoiesis.

Science.gov (United States)

Minato, Nagahiro

2013-09-10

Rap proteins (Rap1, Rap2a, b, c) are small molecular weight GTPases of the Ras family. Rap G proteins mediate diverse cellular events such as cell adhesion, proliferation, and gene activation through various signaling pathways. Activation of Rap signal is regulated tightly by several specific regulatory proteins including guanine nucleotide exchange factors and GTPase-activating proteins. Beyond cell biological studies, increasing attempts have been made in the past decade to define the roles of Rap signal in specific functions of normal tissue systems as well as in cancer. In the immune and hematopoietic systems, Rap signal plays crucial roles in the development and function of essentially all lineages of lymphocytes and hematopoietic cells, and importantly, deregulated Rap signal may lead to unique pathological conditions depending on the affected cell types, including various types of leukemia and autoimmunity. The phenotypical studies have unveiled novel, even unexpected functional aspects of Rap signal in cells from a variety of tissues, providing potentially important clues for controlling human diseases, including malignancy. © 2013 Elsevier Inc. All rights reserved.

miR-518b Enhances Human Trophoblast Cell Proliferation Through Targeting Rap1b and Activating Ras-MAPK Signal

Directory of Open Access Journals (Sweden)

Ming Liu

2018-03-01

Full Text Available Preeclampsia is a pregnancy-specific complication defined as newly onset gestational hypertension and proteinuria. Deficiency in placental development is considered as the predominant cause of preeclampsia. Our previous study found that the expression of miR-518b increased significantly in the preeclamptic placentas, indicating the potential participation of this small RNA in the occurrence of preeclampsia. In this study, data analysis using multiple databases predicted Rap1b as a candidate target of miR-518b. An evident decrease in Rap1b expression was observed in preeclamptic placentas when compared with the control placentas, which was negatively correlated with the level of miR-518b. Based on the data of in situ hybridization and immunohistochemistry showing that Rap1b exhibited similar localization with miR-518b in villous cytotrophoblast cells and column trophoblasts, we further explored their function in regulating trophoblast cell proliferation. In HTR8/SVneo cells, exogenous transfection of miR-518b reduced the expression of Rap1b, and dual-luciferase reporter assay validated Rap1b as the direct target of miR-518b. The small RNA could increase the BrdU incorporation and the ratio of cells at S phase, and enhance the phosphorylation of Raf-1 and ERK1/2. Such growth-promoting effect could be efficiently reversed by Rap1b overexpression. The data indicate that miR-518b can promote trophoblast cell proliferation via Rap1b–Ras–MAPK pathway, and the aberrant upregulation of miR-518b in preeclamptic placenta may contribute to the excessive trophoblast proliferation. The study provides new evidence to further understand the etiology of preeclampsia.

Microgravity simulation activates Cdc42 via Rap1GDS1 to promote vascular branch morphogenesis during vasculogenesis

Directory of Open Access Journals (Sweden)

Shouli Wang

2017-12-01

Full Text Available Gravity plays an important role in normal tissue maintenance. The ability of stem cells to repair tissue loss in space through regeneration and differentiation remains largely unknown. To investigate the impact of microgravity on blood vessel formation from pluripotent stem cells, we employed the embryoid body (EB model for vasculogenesis and simulated microgravity by clinorotation. We first differentiated mouse embryonic stem cells into cystic EBs containing two germ layers and then analyzed vessel formation under clinorotation. We observed that endothelial cell differentiation was slightly reduced under clinorotation, whereas vascular branch morphogenesis was markedly enhanced. EB-derived endothelial cells migrated faster, displayed multiple cellular processes, and had higher Cdc42 and Rac1 activity when subjected to clinorotation. Genetic analysis and rescue experiments demonstrated that Cdc42 but not Rac1 is required for microgravity-induced vascular branch morphogenesis. Furthermore, affinity pull-down assay and mass spectrometry identified Rap1GDS1 to be a Cdc42 guanine nucleotide exchange factor, which was upregulated by clinorotation. shRNA-mediated knockdown of Rap1GDS1 selectively suppressed Cdc42 activation and inhibited both baseline and microgravity-induced vasculogenesis. This was rescued by ectopic expression of constitutively active Cdc42. Taken together, these results support the notion that simulated microgravity activates Cdc42 via Rap1GDS1 to promote vascular branch morphogenesis.

Neuronal Rap1 regulates energy balance, glucose homeostasis, and leptin actions

Science.gov (United States)

The Central Nervous System (CNS) contributes to obesity and metabolic disease; however, the underlying neurobiological pathways remain to be fully established. Here, we show that the small GTPase Rap1 is expressed in multiple hypothalamic nuclei that control whole-body metabolism and is activated in...

Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

Institute of Scientific and Technical Information of China (English)

HSU Heng; Robert L. CHURCH

2004-01-01

During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

Saccharomyces cerevisiae GTPase complex: Gtr1p-Gtr2p regulates cell-proliferation through Saccharomyces cerevisiae Ran-binding protein, Yrb2p

International Nuclear Information System (INIS)

Wang Yonggang; Nakashima, Nobutaka; Sekiguchi, Takeshi; Nishimoto, Takeharu

2005-01-01

A Gtr1p GTPase, the GDP mutant of which suppresses both temperature-sensitive mutants of Saccharomyces cerevisiae RanGEF/Prp20p and RanGAP/Rna1p, was presently found to interact with Yrb2p, the S. cerevisiae homologue of mammalian Ran-binding protein 3. Gtr1p bound the Ran-binding domain of Yrb2p. In contrast, Gtr2p, a partner of Gtr1p, did not bind Yrb2p, although it bound Gtr1p. A triple mutant: yrb2Δ gtr1Δ gtr2Δ was lethal, while a double mutant: gtr1Δ gtr2Δ survived well, indicating that Yrb2p protected cells from the killing effect of gtr1Δ gtr2Δ. Recombinant Gtr1p and Gtr2p were purified as a complex from Escherichia coli. The resulting Gtr1p-Gtr2p complex was comprised of an equal amount of Gtr1p and Gtr2p, which inhibited the Rna1p/Yrb2 dependent RanGAP activity. Thus, the Gtr1p-Gtr2p cycle was suggested to regulate the Ran cycle through Yrb2p

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

OpenAIRE

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-01-01

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lac...

Unigenic Evolution: A Novel Genetic Method Localizes a Putative Leucine Zipper That Mediates Dimerization of the Saccharomyces Cerevisiae Regulator Gcr1p

Science.gov (United States)

Deminoff, S. J.; Tornow, J.; Santangelo, G. M.

1995-01-01

The GCR1 gene of Saccharomyces cerevisiae encodes a transcriptional activator that complexes with Rap1p and, through UAS(RPG) elements (Rap1p DNA binding sites), stimulates efficient expression of glycolytic and translational component genes. To map the functionally important domains in Gcr1p, we combined multiple rounds of random mutagenesis in vitro with in vivo selection of functional genes to locate conserved, or hypomutable, regions. We name this method unigenic evolution, a statistical analysis of mutations in evolutionary variants of a single gene in an otherwise isogenic background. Examination of the distribution of 315 mutations in 24 variant alleles allowed the localization of four hypomutable regions in GCR1 (A, B, C, and D). Dispensable N-terminal (intronic) and C-terminal portions of the evolved region of GCR1 were included in the analysis as controls and were, as expected, not hypomutable. The analysis of several insertion, deletion, and point mutations, combined with a comparison of the hypomutability and hydrophobicity plots of Gcr1p, suggested that some of the hypomutable regions may individually or in combination correspond to functionally important surface domains. In particular, we determined that region D contains a putative leucine zipper and is necessary and sufficient for Gcr1p homodimerization. PMID:8601472

"Everybody Gotta Have a Dream": Rap-centered Aspirations among Young Black Males Involved in Rap Music Production - A Qualitative Study.

Science.gov (United States)

Foster, B Brian

Youth express diverse desires for their educational and occupational futures. Sometimes these aspirations are directed towards somewhat unconventional careers such as rapping and other types of involvement in rap music production. Although many studies have examined traditional educational and occupational aspirations, less is known about the factors that give rise to rap-centered aspirations and how individuals pursue them, particularly as they transition to early adulthood. Drawing on 54 semi- and unstructured interviews with 29 black young men involved in rap music production, I find that rap-centered aspirations are shaped by a range of factors, most notably feedback regarding one's rap skills, access to recording and production equipment, and the financial means to maintain involvement in rap music production while also ensuring personal and family economic stability. The young men in the study attached different meanings to their aspirations and sometimes recast their motivations for participating in rap music production in response to various social and economic factors.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

Science.gov (United States)

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Apical accumulation of the Sevenless receptor tyrosine kinase during Drosophila eye development is promoted by the small GTPase Rap1.

Science.gov (United States)

Baril, Caroline; Lefrançois, Martin; Sahmi, Malha; Knævelsrud, Helene; Therrien, Marc

2014-08-01

The Ras/MAPK-signaling pathway plays pivotal roles during development of metazoans by controlling cell proliferation and cell differentiation elicited, in several instances, by receptor tyrosine kinases (RTKs). While the internal mechanism of RTK-driven Ras/MAPK signaling is well understood, far less is known regarding its interplay with other co-required signaling events involved in developmental decisions. In a genetic screen designed to identify new regulators of RTK/Ras/MAPK signaling during Drosophila eye development, we identified the small GTPase Rap1, PDZ-GEF, and Canoe as components contributing to Ras/MAPK-mediated R7 cell differentiation. Rap1 signaling has recently been found to participate in assembling cadherin-based adherens junctions in various fly epithelial tissues. Here, we show that Rap1 activity is required for the integrity of the apical domains of developing photoreceptor cells and that reduced Rap1 signaling hampers the apical accumulation of the Sevenless RTK in presumptive R7 cells. It thus appears that, in addition to its role in cell-cell adhesion, Rap1 signaling controls the partitioning of the epithelial cell membrane, which in turn influences signaling events that rely on apico-basal cell polarity. Copyright © 2014 by the Genetics Society of America.

Transcriptional regulation of the p73 gene, a member of the p53 family, by early growth response-1 (Egr-1)

International Nuclear Information System (INIS)

Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong

2007-01-01

To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression

POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

Energy Technology Data Exchange (ETDEWEB)

ANDERSON,C.W.APPELLA,E.

2003-10-23

The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

Rhoptry-associated protein (rap-1) genes in the sheep pathogen Babesia sp. Xinjiang: Multiple transcribed copies differing by 3' end repeated sequences.

Science.gov (United States)

Niu, Qingli; Marchand, Jordan; Yang, Congshan; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence

2015-07-30

Sheep babesiosis occurs mainly in tropical and subtropical areas. The sheep parasite Babesia sp. Xinjiang is widespread in China, and our goal is to characterize rap-1 (rhoptry-associated protein 1) gene diversity and expression as a first step of a long term goal aiming at developing a recombinant subunit vaccine. Seven different rap-1a genes were amplified in Babesia sp. Xinjiang, using degenerate primers designed from conserved motifs. Rap-1b and rap-1c gene types could not be identified. In all seven rap-1a genes, the 5' regions exhibited identical sequences over 936 nt, and the 3' regions differed at 28 positions over 147 nt, defining two types of genes designated α and β. The remaining 3' part varied from 72 to 360 nt in length, depending on the gene. This region consists of a succession of two to ten 36 nt repeats, which explains the size differences. Even if the nucleotide sequences varied, 6 repeats encoded the same stretch of amino acids. Transcription of at least four α and two β genes was demonstrated by standard RT-PCR. Copyright © 2015 Elsevier B.V. All rights reserved.

The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

Science.gov (United States)

Wang, Jinling; de Montellano, Paul R Ortiz

2003-05-30

Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

Functional importance of the DNA binding activity of Candida albicans Czf1p.

Directory of Open Access Journals (Sweden)

Ivana Petrovska

Full Text Available The human opportunistic pathogen Candida albicans undergoes a reversible morphological transition between the yeast and hyphal states in response to a variety of signals. One such environmental trigger is growth within a semisolid matrix such as agar medium. This growth condition is of interest because it may mimic the growth of C. albicans in contact with host tissue during infection. During growth within a semisolid matrix, hyphal growth is positively regulated by the transcriptional regulator Czf1p and negatively by a second key transcriptional regulator, Efg1p. Genetic studies indicate that Czf1p, a member of the zinc-cluster family of transcriptional regulators, exerts its function by opposing the inhibitory influence of Efg1p on matrix-induced filamentous growth. We examined the importance of the two known activities of Czf1p, DNA-binding and interaction with Efg1p. We found that the two activities were separable by mutation allowing us to demonstrate that the DNA-binding activity of Czf1p was essential for its role as a positive regulator of morphogenesis. Surprisingly, however, interactions with Efg1p appeared to be largely dispensable. Our studies provide the first evidence of a key role for the DNA-binding activity of Czf1p in the morphological yeast-to-hyphal transition triggered by matrix-embedded growth.

Ligand binding turns moth pheromone-binding protein into a pH sensor: effect on the Antheraea polyphemus PBP1 conformation.

Science.gov (United States)

Katre, Uma V; Mazumder, Suman; Prusti, Rabi K; Mohanty, Smita

2009-11-13

In moths, pheromone-binding proteins (PBPs) are responsible for the transport of the hydrophobic pheromones to the membrane-bound receptors across the aqueous sensillar lymph. We report here that recombinant Antheraea polyphemus PBP1 (ApolPBP1) picks up hydrophobic molecule(s) endogenous to the Escherichia coli expression host that keeps the protein in the "open" (bound) conformation at high pH but switches to the "closed" (free) conformation at low pH. This finding has bearing on the solution structures of undelipidated lepidopteran moth PBPs determined thus far. Picking up a hydrophobic molecule from the host expression system could be a common feature for lipid-binding proteins. Thus, delipidation is critical for bacterially expressed lipid-binding proteins. We have shown for the first time that the delipidated ApolPBP1 exists primarily in the closed form at all pH levels. Thus, current views on the pH-induced conformational switch of PBPs hold true only for the ligand-bound open conformation of the protein. Binding of various ligands to delipidated ApolPBP1 studied by solution NMR revealed that the protein in the closed conformation switches to the open conformation only at or above pH 6.0 with a protein to ligand stoichiometry of approximately 1:1. Mutation of His(70) and His(95) to alanine drives the equilibrium toward the open conformation even at low pH for the ligand-bound protein by eliminating the histidine-dependent pH-induced conformational switch. Thus, the delipidated double mutant can bind ligand even at low pH in contrast to the wild type protein as revealed by fluorescence competitive displacement assay using 1-aminoanthracene and solution NMR.

Species-Specific Expression of Full-Length and Alternatively Spliced Variant Forms of CDK5RAP2.

Directory of Open Access Journals (Sweden)

John S Y Park

Full Text Available CDK5RAP2 is one of the primary microcephaly genes that are associated with reduced brain size and mental retardation. We have previously shown that human CDK5RAP2 exists as a full-length form (hCDK5RAP2 or an alternatively spliced variant form (hCDK5RAP2-V1 that is lacking exon 32. The equivalent of hCDK5RAP2-V1 has been reported in rat and mouse but the presence of full-length equivalent hCDK5RAP2 in rat and mouse has not been examined. Here, we demonstrate that rat expresses both a full length and an alternatively spliced variant form of CDK5RAP2 that are equivalent to our previously reported hCDK5RAP2 and hCDK5RAP2-V1, repectively. However, mouse expresses only one form of CDK5RAP2 that is equivalent to the human and rat alternatively spliced variant forms. Knowledge of this expression of different forms of CDK5RAP2 in human, rat and mouse is essential in selecting the appropriate model for studies of CDK5RAP2 and primary microcephaly but our findings further indicate the evolutionary divergence of mouse from the human and rat species.

Two sequence motifs from HIF-1α bind to the DNA-binding site of p53

OpenAIRE

Hansson, Lars O.; Friedler, Assaf; Freund, Stefan; Rüdiger, Stefan; Fersht, Alan R.

2002-01-01

There is evidence that hypoxia-inducible factor-1α (HIF-1α) interacts with the tumor suppressor p53. To characterize the putative interaction, we mapped the binding of the core domain of p53 (p53c) to an array of immobilized HIF-1α-derived peptides and found two peptide-sequence motifs that bound to p53c with micromolar affinity in solution. One sequence was adjacent to and the other coincided with the two proline residues of the oxygen-dependent degradation domain (P402 and P564) that act as...

A signaling pathway contributing to platelet storage lesion development: targeting PI3-kinase–dependent Rap1 activation slows storage-induced platelet deterioration

Science.gov (United States)

Schubert, Peter; Thon, Jonathan N.; Walsh, Geraldine M.; Chen, Cindy H.I.; Moore, Edwin D.; Devine, Dana V.; Kast, Juergen

2015-01-01

BACKGROUND The term platelet storage lesion (PSL) describes the structural and biochemical changes in platelets (PLTs) during storage. These are typified by alterations of morphologic features and PLT metabolism leading to reduced functionality and hence reduced viability for transfusion. While the manifestations of the storage lesion are well characterized, the biochemical pathways involved in the initiation of this process are unknown. STUDY DESIGN AND METHODS A complementary proteomic approach has recently been applied to analyze changes in the PLT proteome during storage. By employing stringent proteomic criteria, 12 proteins were identified as significantly and consistently changing in relative concentration over a 7-day storage period. Microscopy, Western blot analysis, flow cytometry, and PLT functionality analyses were used to unravel the involvement of a subset of these 12 proteins, which are connected through integrin signaling in one potential signaling pathway underlying storage lesion development. RESULTS Microscopic analysis revealed changes in localization of glycoprotein IIIa, Rap1, and talin during storage. Rap1 activation was observed to correlate with expression of the PLT activation marker CD62P. PLTs incubated for 7 days with the PI3-kinase inhibitor LY294002 showed diminished Rap1 activation as well as a moderate reduction in integrin αIIbβ3 activation and release of α-granules. Furthermore, this inhibitor seemed to improve PLT integrity and quality during storage as several in vitro probes showed a deceleration of PLT activation. CONCLUSION These results provide the first evidence for a signaling pathway mediating PSL in which PI3-kinase–dependent Rap1 activation leads to integrin αIIbβ3 activation and PLT degranulation. PMID:19497060

MiR-203 involves in neuropathic pain development and represses Rap1a expression in nerve growth factor differentiated neuronal PC12 cells.

Science.gov (United States)

Li, Haixia; Huang, Yuguang; Ma, Chao; Yu, Xuerong; Zhang, Zhiyong; Shen, Le

2015-01-01

Although microRNAs (miRNAs) have been shown to play a role in numerous biological processes, their function in neuropathic pain is not clear. The rat bilateral sciatic nerve chronic constriction injury (bCCI) is an established model of neuropathic pain, so we examined miRNA expression and function in the spinal dorsal horn in bCCI rats. Microarray and real-time polymerase chain reaction were used to examine the expression of miRNA in nerve system of bCCI rats, and the targets of miRNA were predicted by bioinformatic approaches. The function of specific miRNA was estimated through the methods of gene engineering. This study revealed substantially (∼10-fold) decreased miR-203 expression in the spinal dorsal horns but not the dorsal root ganglions, hippocampus, or anterior cingulate cortexes of bCCI rats. Rap1a protein expression was upregulated in bCCI rat spinal dorsal horns. We further verified that miR-203 directly targeted the 3'-untranslated region of the rap1a gene, thereby decreasing rap1a protein expression in neuron-like cells. Rap1a has diverse neuronal functions and their perturbation is responsible for several mental disorders. For example, Rap1a/MEK/ERK is involved in peripheral sensitization. These data suggest a potential role for miR-203 in regulating neuropathic pain development, and Rap1a is a validated target gene in vitro. Results from our study and others indicate the possibility that Rap1a may be involved in pain. We hope that these results can provide support for future research into miR-203 in gene therapy for neuropathic pain.

Mutations in CDK5RAP2 cause Seckel syndrome.

Science.gov (United States)

Yigit, Gökhan; Brown, Karen E; Kayserili, Hülya; Pohl, Esther; Caliebe, Almuth; Zahnleiter, Diana; Rosser, Elisabeth; Bögershausen, Nina; Uyguner, Zehra Oya; Altunoglu, Umut; Nürnberg, Gudrun; Nürnberg, Peter; Rauch, Anita; Li, Yun; Thiel, Christian Thomas; Wollnik, Bernd

2015-09-01

Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by prenatal proportionate short stature, severe microcephaly, intellectual disability, and characteristic facial features. Here, we describe the novel homozygous splice-site mutations c.383+1G>C and c.4005-9A>G in CDK5RAP2 in two consanguineous families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal protein which is known to be essential for centrosomal cohesion and proper spindle formation and has been shown to be causally involved in autosomal recessive primary microcephaly. We establish CDK5RAP2 as a disease-causing gene for Seckel syndrome and show that loss of functional CDK5RAP2 leads to severe defects in mitosis and spindle organization, resulting in cells with abnormal nuclei and centrosomal pattern, which underlines the important role of centrosomal and mitotic proteins in the pathogenesis of the disease. Additionally, we present an intriguing case of possible digenic inheritance in Seckel syndrome: A severely affected child of nonconsanguineous German parents was found to carry heterozygous mutations in CDK5RAP2 and CEP152. This finding points toward a potential additive genetic effect of mutations in CDK5RAP2 and CEP152.

Mutations in CDK5RAP2 cause Seckel syndrome

Science.gov (United States)

Yigit, Gökhan; Brown, Karen E; Kayserili, Hülya; Pohl, Esther; Caliebe, Almuth; Zahnleiter, Diana; Rosser, Elisabeth; Bögershausen, Nina; Uyguner, Zehra Oya; Altunoglu, Umut; Nürnberg, Gudrun; Nürnberg, Peter; Rauch, Anita; Li, Yun; Thiel, Christian Thomas; Wollnik, Bernd

2015-01-01

Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by prenatal proportionate short stature, severe microcephaly, intellectual disability, and characteristic facial features. Here, we describe the novel homozygous splice-site mutations c.383+1G>C and c.4005-9A>G in CDK5RAP2 in two consanguineous families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal protein which is known to be essential for centrosomal cohesion and proper spindle formation and has been shown to be causally involved in autosomal recessive primary microcephaly. We establish CDK5RAP2 as a disease-causing gene for Seckel syndrome and show that loss of functional CDK5RAP2 leads to severe defects in mitosis and spindle organization, resulting in cells with abnormal nuclei and centrosomal pattern, which underlines the important role of centrosomal and mitotic proteins in the pathogenesis of the disease. Additionally, we present an intriguing case of possible digenic inheritance in Seckel syndrome: A severely affected child of nonconsanguineous German parents was found to carry heterozygous mutations in CDK5RAP2 and CEP152. This finding points toward a potential additive genetic effect of mutations in CDK5RAP2 and CEP152. PMID:26436113

A unique nuclear receptor direct repeat 17 (DR17) is present within the upstream region of Schistosoma mansoni female-specific p14 gene

International Nuclear Information System (INIS)

Fantappie, Marcelo Rosado; Furtado, Daniel Rodrigues; Rumjanek, Franklin David; LoVerde, Philip T.

2008-01-01

The eggs produced by sexually mature female Schistosma mansoni are responsible for the pathogenesis of the disease. The eggshell precursor gene p14 is expressed only in the vitelline cells of sexually mature female worms in response to a yet unidentified male stimulus. Herein, we report the identification of a novel nuclear receptor response element in the upstream region of the p14 gene. This element contains the canonical hexameric DNA core motif, 5'-PuGGTCA, composed of an atypically spaced direct repeat (DR17). Schistosome nuclear receptors SmRXR1 and SmNR1 specifically bound to the p14-DR17 element as a heterodimer. SmRXR1, but not SmNR1, bound to the motif as a monomer. Introduction of mutations in the TCA core sequence completely abolished the binding by SmRXR1/SmNR1 heterodimer. This finding supports our hypothesis that the expression of Schistosoma mansonip14 gene is regulated through the nuclear receptor signaling pathway

Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells

Directory of Open Access Journals (Sweden)

Ennion Steven J

2006-03-01

Full Text Available Abstract Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and

Rapid Refresh (RAP) [13 km

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The Rapid Refresh (RAP) numerical weather model took the place of the Rapid Update Cycle (RUC) on May 1, 2012. Run by the National Centers for Environmental...

Rapid Refresh (RAP) [20 km

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The Rapid Refresh (RAP) numerical weather model took the place of the Rapid Update Cycle (RUC) on May 1, 2012. Run by the National Centers for Environmental...

Overview of the remedial action priority system (RAPS)

International Nuclear Information System (INIS)

Whelan, G.; Steelman, B.L.; Strenge, D.L.; Droppo, J.G.

1986-01-01

To provide DOE with a better management tool for prioritizing funding allocations for further site investigations and possible remediations, Pacific Northwest Laboratory developed a more objective, physics-based risk assessment methodology called the Remedial Action Priority System (RAPS). This methodology uses empirically, analytically, and semianalytically based mathematical algorithms and a pathways analysis to predict the potential for contaminant transport from a hazardous waste disposal site to local populations. Four major pathways for contaminant migration are considered in the RAPS methodology: groundwater, overland, surface water, and atmospheric. Using the predications of contaminant transport, simplified exposure assessments are performed for important receptors. The risks associated with the sites can then be calculated relative to other sites for each pathway and for all pathways together. The RAPS methodology addresses many of the typical limitations associated with other ranking systems; it considers: (1) more site information and constituent characteristics associated with the transport pathways; (2) chemical and radioactive wastes; (3) the potential direction of contaminant movement; (4) contaminant retention (e.g., dispersion and decay/degradation), where applicable; (5) population distributions; (6) various routes of exposure (e.g., inhalations, ingestion, and external exposure); (7) contaminant toxicities; (8) duration of exposure of the surrounding population; and (9) contaminant arrival time to sensitive receptors. Because RAPS is based on more site information and constituent characteristics, the scoring system of the RAPS methodology also reduces the subjectivity associated with prioritizing hazardous waste sites. The RAPS methodology requires minimum user knowledge of risk assessment and a minimum amount of input data

pH Modulates the Binding of EGR1 Transcription Factor to DNA

Science.gov (United States)

Mikles, David C.; Bhat, Vikas; Schuchardt, Brett J.; Deegan, Brian J.; Seldeen, Kenneth L.; McDonald, Caleb B.; Farooq, Amjad

2013-01-01

EGR1 transcription factor orchestrates a plethora of signaling cascades involved in cellular homeostasis and its down-regulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with increasing pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as H382 by virtue of the fact that its substitution to non-ionizable residues abolishes pH-dependence of the binding of EGR1 to DNA. Notably, H382 inserts into the major groove of DNA and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, H382 is predominantly conserved across other members of EGR1 family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating protein-DNA interactions central to this family of transcription factors. Collectively, our findings uncover an unexpected but a key step in the molecular recognition of EGR1 family of transcription factors and suggest that they may act as sensors of pH within the intracellular environment. PMID:23718776

The Remedial Action Priority System (RAPS): Mathematical formulations

International Nuclear Information System (INIS)

Whelan, G.; Strenge, D.L.; Droppo, J.G. Jr.; Steelman, B.L.; Buck, J.W.

1987-08-01

The Remedial Action Priority System (RAPS) represents a methodology that prioritizes inactive hazardous and radioactive mixed-waste disposal sites in a scientific and objective manner based on limited site information. This methodology is intended to bridge the technology gap between the initial site evaluation using the Hazard Ranking System (HRS) and the time-consuming process of actual field site characterization, assessment, and remediation efforts. The RAPS methodology provides the US Department of Energy with a management tool for assistance in prioritizing funding and human resource allocations for further investigations and possible remediations at its inactive waste sites. Use of RAPS will help DOE ensure that those sites posing the highest potential risk are addressed first. Chapters 1 through 10 were processed separately for the Energy Data Base

Life extension and replacement management for RAPS type steam generators

International Nuclear Information System (INIS)

Arya, R.C.; Rastogi, A.K.

1996-01-01

The steam generating equipment in first four units of Indian PHWRs Rajasthan Atomic Power Station (RAPS) 1-2 and Madras Atomic Power Station (MAPS) 1-2 are hairpin type and comprise of eight boiler assemblies. Each assembly consists of identical, single pass, inverted and vertical hairpin heat exchangers (10 for RAPS and 11 for MAPS) containing 195 monel-400 U tubes of 12.7 mm dia x 1.242 mm thick. The hot heavy water flows through these tubes and imparts heat to feed, light demineralized water entering the shell at the bottom of preheat leg. The heat is generated on the outer surface of the tubes. Details of studies carried out for life extension and replacement management for RAPS type steam generators are given. 1 fig., 5 tabs

PlexinA2 Forward Signaling through Rap1 GTPases Regulates Dentate Gyrus Development and Schizophrenia-like Behaviors

Directory of Open Access Journals (Sweden)

Xiao-Feng Zhao

2018-01-01

Full Text Available Summary: Dentate gyrus (DG development requires specification of granule cell (GC progenitors in the hippocampal neuroepithelium, as well as their proliferation and migration into the primordial DG. We identify the Plexin family members Plxna2 and Plxna4 as important regulators of DG development. Distribution of immature GCs is regulated by Sema5A signaling through PlxnA2 and requires a functional PlxnA2 GTPase-activating protein (GAP domain and Rap1 small GTPases. In adult Plxna2−/− but not Plxna2-GAP-deficient mice, the dentate GC layer is severely malformed, neurogenesis is compromised, and mossy fibers form aberrant synaptic boutons within CA3. Behavioral studies with Plxna2−/− mice revealed deficits in associative learning, sociability, and sensorimotor gating—traits commonly observed in neuropsychiatric disorder. Remarkably, while morphological defects are minimal in Plxna2-GAP-deficient brains, defects in fear memory and sensorimotor gating persist. Since allelic variants of human PLXNA2 and RAP1 associate with schizophrenia, our studies identify a biochemical pathway important for brain development and mental health. : Zhao et al. find that Sema5A-PlexinA2 forward signaling through Rap1 GTPases is required for progenitor distribution in the developing mouse dentate gyrus. Adult Plxna2−/−, but not Plxna2-GAP-deficient, mice show defects in dentate morphology, neurogenesis, and mossy fiber connectivity. Plxna2−/− and Plxna2-GAP mice exhibit behavioral defects suggestive of neuropsychiatric illness. Keywords: PlexinA2, semaphoring, Rap1, GAP, dentate gyrus, adult neurogenesis, mossy fiber, fear memory, sensorimotor gating, schizophrenia

Development of low-cost open source 3D gel printer "RepRap SWIM-ER"

Science.gov (United States)

Sato, Kei; Basher, Samiul; Ota, Takafumi; Tase, Taishi; Takamatsu, Kyuichiro; Saito, Azusa; Khosla, Ajit; Kawakami, Masaru; Furuawa, Hidemitsu

2017-04-01

Gels are soft and wet materials having low friction, good biocompatibility, and material permeability. It is expected that gel materials will be used as new kinds of industrial materials in the engineering and medical applications. But it cannot build a complicated shape. Soft & Wet Matter Engineering Laboratory developed a 3D gel Printer "SWIM-ER", has enabled modeling of complex shapes of the gel. However, this is expensive. Therefore not all of the gel researchers and the companies have such a device. To solve this problem, we manufacture a low-cost open-source 3D gel printer "RepRap SWIM-ER" from the RepRap. We made the components required to manufacture the "RepRap SWIM-ER" from the 3D printer and chose a light source. In addition, we produced the P-DN gel for RepRap SWIM-ER and conducted the molding test to confirm whether RepRap SWIM-ER can used it.

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

Science.gov (United States)

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Novel Alternative Splice Variants of Mouse Cdk5rap2.

Directory of Open Access Journals (Sweden)

Nadine Kraemer

Full Text Available Autosomal recessive primary microcephaly (MCPH is a rare neurodevelopmental disorder characterized by a pronounced reduction of brain volume and intellectual disability. A current model for the microcephaly phenotype invokes a stem cell proliferation and differentiation defect, which has moved the disease into the spotlight of stem cell biology and neurodevelopmental science. Homozygous mutations of the Cyclin-dependent kinase-5 regulatory subunit-associated protein 2 gene CDK5RAP2 are one genetic cause of MCPH. To further characterize the pathomechanism underlying MCPH, we generated a conditional Cdk5rap2 LoxP/hCMV Cre mutant mouse. Further analysis, initiated on account of a lack of a microcephaly phenotype in these mutant mice, revealed the presence of previously unknown splice variants of the Cdk5rap2 gene that are at least in part accountable for the lack of microcephaly in the mice.

Translating Chicana Rap: Snow Tha Product

Directory of Open Access Journals (Sweden)

Adriana Onita

2017-06-01

Full Text Available This project examines rap lyrics, interviews, and music videos by Chicana artist Snow Tha Product to show how rap has been culturally translated, performed, and appropriated by females in order to “flip the script,” or subvert the dichotomous model of female sexuality that has been imposed upon them. Weaving insights from three academic fields (cultural translation, Chican@ studies, and hip-hop feminism, this paper also aims to creatively expand the definition of translation by positioning rap music as a performative language in its own right, capable of encoding and translating complex cultural issues related to race, gender, and sexuality.

Polymorphisms of ST2-IL18R1-IL18RAP gene cluster: a new risk for autoimmune thyroid diseases.

Science.gov (United States)

Wang, X; Zhu, Y F; Li, D M; Qin, Q; Wang, Q; Muhali, F S; Jiang, W J; Zhang, J A

2016-02-01

Interleukin 33 (IL33) / ST2 pathway and ST2-interlukin18 receptor1-interlukin18 receptor accessory protein (ST2-IL18R1-IL18RAP) gene cluster have been involved in many autoimmune diseases but few report in autoimmune thyroid diseases (AITD). In this study, we investigated whether polymorphisms of IL33, ST2, IL18R1, and IL18RAP are associated with Graves' disease (GD) and Hashimoto's thyroiditis (HT), two major forms of AITD, among a Chinese population. A total of 11 SNPs were explored in a case-control study including 417 patients with GD, 250 HT patients and 301 controls, including rs1929992, rs10975519, rs10208293, rs6543116, rs1041973, rs3732127, rs11465597, rs1035130, rs2293225, rs1035127, rs917997 of IL 33, ST2-IL18R1-IL18RAP gene cluster. Genotyping of these SNPs was performed using matrix-assisted laser desorption / ionization-time-of-flight mass spectrometer (MALDI-TOF-MS) platform from Sequenom. The frequencies of allele A and AA+AG genotype of rs6543116 (ST2) in HT patients were significantly increased compared with those of the controls (P = 0.029/0.021, OR = 1.31/1.62). And in another SNP rs917997, AA+AG genotype presented an increased frequency in HT subjects compared with controls (P = 0.046, OR = 1.53). Furthermore, the haplotype GAGCCCG from ST2-IL18R1-IL18RAP gene cluster (rs6543116, rs1041973, rs1035130, rs3732127, rs1035127, rs2293225, rs917997) was associated with increased susceptibility to GD with an OR of 2.03 (P = 0.022, 95% CI = 1.07-3.86). Some SNPs of ST2-IL18R1-IL18RAP gene cluster might increase the risk of susceptibility of HT and GD in Chinese Han population. © 2015 John Wiley & Sons Ltd.

Involvement of histidine residues in the pH-dependent β-galactoside binding activity of human galectin-1.

Science.gov (United States)

Hiramatsu, Hirotsugu; Takeuchi, Katsuyuki; Takeuchi, Hideo

2013-04-02

The pH dependence of the β-galactoside binding activity of human galectin-1 (hGal-1) was investigated by fluorescence spectroscopy using lactose as a ligand. The obtained binding constant Kb was 2.94 ± 0.10 mM(-1) at pH 7.5. The Kb value decreased at acidic pH with a midpoint of transition at pH 6.0 ± 0.1. To elucidate the molecular mechanism of the pH dependence, we investigated the structures of hGal-1 and its two His mutants (H44Q and H52Q) using fluorescence, circular dichroism, UV absorption, and UV resonance Raman spectroscopy. Analysis of the spectra has shown that the pKa values of His44 and His52 are 5.7 ± 0.2 and 6.3 ± 0.1, respectively. The protonation of His52 below pH 6.3 induces a small change in secondary structure and partly reduces the galactoside binding activity. On the other hand, the protonation of His44 below pH 5.7 exerts a cation-π interaction with Trp68 and largely diminishes the galactoside binding activity. With reference to the literature X-ray structures at pH 7.0 and 5.6, protonated His52 is proposed to move slightly away from the galactoside-binding region with a partial unfolding of the β-strand containing His52. On the other hand, protonated His44 becomes unable to form a hydrogen bond with galactoside and additionally induces a reorientation and/or displacement of Trp68 through cation-π interaction, leading to a loosening of the galactoside-binding pocket. These structural changes associated with His protonation are likely to be the origin of the pH dependence of the galactoside binding activity of hGal-1.

Rap Music Genres and Deviant Behaviors in French-Canadian Adolescents

Science.gov (United States)

Miranda, Dave; Claes, Michel

2004-01-01

This study investigated the links between the preference for 4 rap music genres (American rap, French rap, hip hop/soul, and gangsta/hardcore rap) and 5 types of deviant behaviors in adolescence (violence, theft, street gangs, mild drug use, and hard drug use). The effects of peers' deviancy, violent media, and importance given to lyrics were…

NGF-Dependent neurite outgrowth in PC12 cells overexpressing the Src homology 2-domain protein shb requires activation of the Rap1 pathway

NARCIS (Netherlands)

Lu, L.; Annerén, C.; Reedquist, K. A.; Bos, J. L.; Welsh, M.

2000-01-01

The Src homology 2 (SH2) domain adaptor protein Shb has been shown to transmit NGF- and FGF-2-dependent differentiation signals in PC12 cells. To study if this involves signaling through the small GTPase Rap1, Rap1 activity was assessed in Shb-overexpressing PC12 cells. We demonstrate that NGF and

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

Science.gov (United States)

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

Microstructure of shear-induced thixoformed Al- 4.5Cu-1.5Mg alloy via RAP and SSTT processes

Directory of Open Access Journals (Sweden)

Siamak Nikzad

2017-07-01

Full Text Available In this research, the effect of the thixoforming temperature on the microstructure and mechanical properties was investigated in the thixoforming of the feedstock produced by the RAP (recrystallization and partial melting and SSTT (semi-solid thermal transformation processes for Al-4.5Cu-1.5Mg alloy. In the RAP process, the percentage reduction in area was approximately 35%. Thixoforming was done at 610, 620, and 630 °C. Globular microstructure was observed at all temperatures and conditions. The minimum average globule size was 39 μm, and it was obtained in the thixoforming of the feedstock produced by the RAP process in the section of 4 mm in diameter at 620 ° C after applying shear. Its corresponding compressive strength was -877.44 MPa. The maximum average globule size was 136 μm, and it was obtained in the thixoforming of the feedstock produced by the SSTT process in the section of 10 mm in diameter at 630 °C before applying shear. Its corresponding compressive strength was -769.18 MPa. The finest and most spherical globules, as well as the highest compressive strength were obtained at 620 °C in both RAP and SSTT states.

Molas Baju Wara: Hybridity in Manggarai Rap Music

Directory of Open Access Journals (Sweden)

Ans. Prawati Yuliantari

2017-06-01

Full Text Available Rap music which has been popular since 2007 in Manggarai region, East Nusa Tenggara, Indonesia, gave rise to rap hybrid phenomenon. The mixture between American rap music formats and local elements of Manggarai attracted the attention of young people in the region. One of the local songs that feature hybridity in rap Manggarai is "Molas Baju Wara" created by Lipooz, one of the pioneers of rap in Ruteng, the capital city of Manggarai district. To discuss this phenomenon, the concept of hybridity in cultural territory proposed by James Lull is adopted. This concept is used particularly to analyze the forms of hybridity reflected in " Molas Baju Wara" and the ways they are used in showing the social and cultural conditions of Manggarai. "Molas Baju Wara" was selected as the object of study because the song is clearly showing the characteristics of hybridity in music. The study shows that hybridity could be perceived in Manggarai rap music specifically in the use of local musical instruments like drums, cajon, and tambourine as a substitute for percussive sounds of drums, boombox, or turn-table which are commonly used by rap musicians in their home country, the U.S.A. In addition, there are elements of local sound such as the sound of rain that represents Ruteng as the rain city. Hybridity characteristics can also be found in the use of Manggarai vernacular in the whole lyrics as well as the narration of local themes and certain sites that represent Ruteng.

Identification of binding domains in the herpes simplex virus type 1 small capsid protein pUL35 (VP26).

Science.gov (United States)

Apcarian, Arin; Cunningham, Anthony L; Diefenbach, Russell J

2010-11-01

In this study, fragments of the small capsid protein pUL35 (VP26) from herpes simplex virus type 1 (HSV-1) were generated to identify binding domains for a number of known ligands. Analysis of the binding of dynein light chain subunits, DYNLT1 and DYNLT3, as well the HSV-1 structural proteins pUL19 (VP5) and pUL37 was then undertaken using the LexA yeast two-hybrid assay. The N-terminal half of pUL35, in particular residues 30-43, was identified as a common region for the binding of DYNLT1 and DYNLT3. Additional distinct regions in the C terminus of pUL35 also contribute to the binding of DYNLT1 and DYNLT3. In contrast, only the C-terminal half of pUL35 was found to mediate the binding of pUL19 and pUL37 through distinct regions. The relevance of this information to the role of pUL35 in viral transport and assembly is discussed.

Enantioselective kappa opioid binding sites on the macrophage cell line, P388d sub 1

Energy Technology Data Exchange (ETDEWEB)

Carr, D.J.J.; Blalock, J.E. (Univ. of Alabama, Birmingham (USA)); DeCosta, B.R.; Jacobson, A.E.; Rice, K.C. (NIDDK, NIH, Bethesda, MD (USA))

1991-01-01

A kappa opioid binding site has been characterized on the macrophage cell line, P388d{sub 1}, using the kappa selective affinity ligand, ({sup 3H}(1S,2S)-(-)-trans-2-isothiocyanato-N-methyl-N-(2-(1-phrrolidinyl) cyclohexyl) benzeneacetamide ((-)BD166). The kappa site has a relative molecular mass (Mr) of 38,000 under nonreducing conditions and 42,000 under reducing conditions. Moreover, it exhibits enantioselectivity in that 1S,2S-(-)-trans-3,4-dichloro-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl) benzeneacetamide ((-)-U-50,488) blocks ({sup 3}H)95{alpha},7{alpha},8{beta})-(-)-N-methyl-N-(7-(1- pyrrolidinyl)-1-oxaspiro-(4,5)-dec-8-yl)benzeneacetamide (U-69,593) binding to P388d{sub 1} cells with an IC{sub 50} = 7.0 nM whereas 1R,2R-(+)-trans-3,4-dichloro-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl) benzeneacetamide ((+)U-50,488) blocks ({sup 3}H)U-69,593 binding to P388d{sub 1} cells with an IC{sub 50} = 700 nM.

A hierarchical coarse-grained (all-atom to all residue) approach to peptides (P1, P2) binding with a graphene sheet

Science.gov (United States)

Pandey, Ras; Kuang, Zhifeng; Farmer, Barry; Kim, Sang; Naik, Rajesh

2012-02-01

Recently, Kim et al. [1] have found that peptides P1: HSSYWYAFNNKT and P2: EPLQLKM bind selectively to graphene surfaces and edges respectively which are critical in modulating both the mechanical as well as electronic transport properties of graphene. Such distinctions in binding sites (edge versus surface) observed in electron micrographs were verified by computer simulation by an all-atomic model that captures the pi-pi bonding. We propose a hierarchical approach that involves input from the all-atom Molecular Dynamics (MD) study (with atomistic detail) into a coarse-grained Monte Carlo simulation to extend this study further to a larger scale. The binding energy of a free amino acid with the graphene sheet from all-atom simulation is used in the interaction parameter for the coarse-grained approach. Peptide chain executes its stochastic motion with the Metropolis algorithm. We investigate a number of local and global physical quantities and find that peptide P1 is likely to bind more strongly to graphene sheet than P2 and that it is anchored by three residues ^4Y^5W^6Y. [1] S.N. Kim et al J. Am. Chem. Soc. 133, 14480 (2011).

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

Science.gov (United States)

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

Insulin-like growth factor binding protein-2: contributions of the C-terminal domain to insulin-like growth factor-1 binding.

Science.gov (United States)

Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A

2006-03-01

Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.

Rapping dyslexia : learning rhythm, rhyme and flow in dyslectic children

NARCIS (Netherlands)

Tittarelli, M.; Marti, P.; Peppoloni, D.

2014-01-01

The paper presents a design case that draws inspiration from rap music as a way to tell stories rhythmically, with simple instruments for accompaniment. Rhythm, rhymes and flow are key features of rap music. In this study, we attempted to apply rap principles and dynamics to a very specific field of

LHC rap: a global phenomenon

CERN Multimedia

2008-01-01

Do you think the LHC is super duper fly? Does it make you want to compose some slick rhymes and bust out some killer beats? It did for one CERN rapper, and the results have become a YouTube smash hit! Katie McAlpine will sing for the CMS party on 24 September, and for the ATLAS Fest on 4 October.The Large Hadron Rap, to give it its full name, is the brainchild of AlpineKat, AKA Katie McAlpine, who is currently working for ATLAS e-News and outreach. To date, the YouTube video rap has been viewed more than 2.5 million times, to say nothing of the media coverage. Featured in newspapers around the world, including the New York Times in the US, The Telegraph in the UK and Geneva’s very own Matin Bleu, the rap is officially a sensation! Katie wrote the inspired (and pretty accurate) physics lyrics during her commute on the number 56 bus between Geneva and CERN. After obtaining permission to film in the experiment caverns and tunnel,...

ATP-binding motifs play key roles in Krp1p, kinesin-related protein 1, function for bi-polar growth control in fission yeast

International Nuclear Information System (INIS)

Rhee, Dong Keun; Cho, Bon A; Kim, Hyong Bai

2005-01-01

Kinesin is a microtubule-based motor protein with various functions related to the cell growth and division. It has been reported that Krp1p, kinesin-related protein 1, which belongs to the kinesin heavy chain superfamily, localizes on microtubules and may play an important role in cytokinesis. However, the function of Krp1p has not been fully elucidated. In this study, we overexpressed an intact form and three different mutant forms of Krp1p in fission yeast constructed by site-directed mutagenesis in two ATP-binding motifs or by truncation of the leucine zipper-like motif (LZiP). We observed hyper-extended microtubules and the aberrant nuclear shape in Krp1p-overexpressed fission yeast. As a functional consequence, a point mutation of ATP-binding domain 1 (G89E) in Krp1p reversed the effect of Krp1p overexpression in fission yeast, whereas the specific mutation in ATP-binding domain 2 (G238E) resulted in the altered cell polarity. Additionally, truncation of the leucine zipper-like domain (LZiP) at the C-terminal of Krp1p showed a normal nuclear division. Taken together, we suggest that krp1p is involved in regulation of cell-polarized growth through ATP-binding motifs in fission yeast

Volumetric Analysis and Performance of Hot Mix Asphalt with Variable Rap Content

Directory of Open Access Journals (Sweden)

Arshad Ahmad Kamil

2017-01-01

Full Text Available Incorporating Reclaimed Asphalt Pavement (RAP to the asphalt concrete mixture for highway construction offer many benefits including energy consumption, conservation of natural resources and preservation of the environment to associated emissions. This paper presents a study on performance of Hot Mix Asphalt with variable RAP content. The study is carried out to evaluate the Marshall Properties and Performance of RAP-Asphalt mixes using conventional asphaltic concrete mix AC14. Marshall Mix Design Method was used to produce control mix (0% RAP and RAP-Asphalt mixes samples which consist of 15% RAP, 25% RAP and 35% RAP in accordance with Specifications for Road Works of Public Works Department, Malaysia. The Marshall Properties analysis was performed to ensure compliance with Marshall Requirements, The resilient modulus test was performed to measure the stiffness of the mixes while Modified Lottman test was conducted to evaluate the moisture susceptibility of these mixes. The results obtained showed that there were no substantial difference in Marshall Properties, moisture susceptibility and indirect tensile strength between RAP-Asphalt mixes with the control mix. The test results indicated that recycled mixes performed as good as the performance of conventional HMA in terms of moisture susceptibility and resilient modulus. It is recommended that further research be carried out for asphalt mixes containing more than 35% of RAP material.

Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

Science.gov (United States)

Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

2001-07-01

The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

Molecular modeling study on the allosteric inhibition mechanism of HIV-1 integrase by LEDGF/p75 binding site inhibitors.

Directory of Open Access Journals (Sweden)

Weiwei Xue

Full Text Available HIV-1 integrase (IN is essential for the integration of viral DNA into the host genome and an attractive therapeutic target for developing antiretroviral inhibitors. LEDGINs are a class of allosteric inhibitors targeting LEDGF/p75 binding site of HIV-1 IN. Yet, the detailed binding mode and allosteric inhibition mechanism of LEDGINs to HIV-1 IN is only partially understood, which hinders the structure-based design of more potent anti-HIV agents. A molecular modeling study combining molecular docking, molecular dynamics simulation, and binding free energy calculation were performed to investigate the interaction details of HIV-1 IN catalytic core domain (CCD with two recently discovered LEDGINs BI-1001 and CX14442, as well as the LEDGF/p75 protein. Simulation results demonstrated the hydrophobic domain of BI-1001 and CX14442 engages one subunit of HIV-1 IN CCD dimer through hydrophobic interactions, and the hydrophilic group forms hydrogen bonds with HIV-1 IN CCD residues from other subunit. CX14442 has a larger tert-butyl group than the methyl of BI-1001, and forms better interactions with the highly hydrophobic binding pocket of HIV-1 IN CCD dimer interface, which can explain the stronger affinity of CX14442 than BI-1001. Analysis of the binding mode of LEDGF/p75 with HIV-1 IN CCD reveals that the LEDGF/p75 integrase binding domain residues Ile365, Asp366, Phe406 and Val408 have significant contributions to the binding of the LEDGF/p75 to HIV1-IN. Remarkably, we found that binding of BI-1001 and CX14442 to HIV-1 IN CCD induced the structural rearrangements of the 140 s loop and oration displacements of the side chains of the three conserved catalytic residues Asp64, Asp116, and Glu152 located at the active site. These results we obtained will be valuable not only for understanding the allosteric inhibition mechanism of LEDGINs but also for the rational design of allosteric inhibitors of HIV-1 IN targeting LEDGF/p75 binding site.

Performance Evaluation of Hot Mix Asphalt with Different Proportions of RAP Content

Science.gov (United States)

Kamil Arshad, Ahmad; Awang, Haryati; Shaffie, Ekarizan; Hashim, Wardati; Rahman, Zanariah Abd

2018-03-01

Reclaimed Asphalt Pavement (RAP) is old asphalt pavement that has been removed from a road by milling or full depth removal. The use of RAP in hot mix asphalt (HMA) eliminates the need to dispose old asphalt pavements and conserves asphalt binders and aggregates, resulting in significant cost savings and benefits to society. This paper presents a study on HMA with different RAP proportions carried out to evaluate the volumetric properties and performance of asphalt mixes containing different proportions of RAP. Marshall Mix Design Method was used to produce control mix (0% RAP) and asphalt mixes containing 15% RAP, 25% RAP and 35% RAP in accordance with Specifications for Road Works of Public Works Department, Malaysia for AC14 dense graded asphalt gradation. Volumetric analysis was performed to ensure that the result is compliance with specification requirements. The resilient modulus test was performed to measure the stiffness of the mixes while the Modified Lottman test was conducted to evaluate the moisture susceptibility of these mixes. The Hamburg wheel tracking test was used to evaluate the rutting performance of these mixes. The results obtained showed that there were no substantial difference in Marshall Properties, moisture susceptibility, resilient modulus and rutting resistance between asphalt mixes with RAP and the control mix. The test results indicated that recycled mixes performed as good as the performance of conventional HMA in terms of moisture susceptibility and resilient modulus. It is recommended that further research be carried out for asphalt mixes containing more than 35% RAP material.

Performance Evaluation of Hot Mix Asphalt with Different Proportions of RAP Content

Directory of Open Access Journals (Sweden)

Kamil Arshad Ahmad

2018-01-01

Full Text Available Reclaimed Asphalt Pavement (RAP is old asphalt pavement that has been removed from a road by milling or full depth removal. The use of RAP in hot mix asphalt (HMA eliminates the need to dispose old asphalt pavements and conserves asphalt binders and aggregates, resulting in significant cost savings and benefits to society. This paper presents a study on HMA with different RAP proportions carried out to evaluate the volumetric properties and performance of asphalt mixes containing different proportions of RAP. Marshall Mix Design Method was used to produce control mix (0% RAP and asphalt mixes containing 15% RAP, 25% RAP and 35% RAP in accordance with Specifications for Road Works of Public Works Department, Malaysia for AC14 dense graded asphalt gradation. Volumetric analysis was performed to ensure that the result is compliance with specification requirements. The resilient modulus test was performed to measure the stiffness of the mixes while the Modified Lottman test was conducted to evaluate the moisture susceptibility of these mixes. The Hamburg wheel tracking test was used to evaluate the rutting performance of these mixes. The results obtained showed that there were no substantial difference in Marshall Properties, moisture susceptibility, resilient modulus and rutting resistance between asphalt mixes with RAP and the control mix. The test results indicated that recycled mixes performed as good as the performance of conventional HMA in terms of moisture susceptibility and resilient modulus. It is recommended that further research be carried out for asphalt mixes containing more than 35% RAP material.

Special AT rich-binding1 protein (SATB1) in malignant T cells

DEFF Research Database (Denmark)

Fredholm, Simon; Willerslev-Olsen, Andreas; Met, Özcan

2018-01-01

Deficient expression of Suppressor Special AT-rich Binding-1 (SATB1) hampers thymocyte development and results in inept T cell lineages. Recent data implicate dysregulated SATB1 expression in the pathogenesis of mycosis fungoides (MF), the most frequent variant of cutaneous T cell lymphoma (CTCL......) whereas increased SATB1 expression had the opposite effect indicating that the mir-155 target SATB1 is a repressor of IL-5 and IL-9 in malignant T cells. In accordance, inhibition of STAT5, and its upstream activator Janus Kinase-3 (Jak3), triggered increased SATB1 expression and a concomitant suppression...

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Remote Area Power Supply (RAPS) load and resource profiles.

Energy Technology Data Exchange (ETDEWEB)

Giles, Lauren (Energetics, Inc., Washington, DC); Skolnik, Edward G. (Energetics, Inc., Washington, DC); Marchionini, Brian (Energetics, Inc., Washington, DC); Fall, Ndeye K. (Energetics, Inc., Washington, DC)

2007-07-01

In 1997, an international team interested in the development of Remote Area Power Supply (RAPS) systems for rural electrification projects around the world was organized by the International Lead Zinc Research Organization (ILZRO) with the support of Sandia National Laboratories (SNL). The team focused on defining load and resource profiles for RAPS systems. They identified single family homes, small communities, and villages as candidates for RAPS applications, and defined several different size/power requirements for each. Based on renewable energy and resource data, the team devised a ''strawman'' series of load profiles. A RAPS system typically consists of a renewable and/or conventional generator, power conversion equipment, and a battery. The purpose of this report is to present data and information on insolation levels and load requirements for ''typical'' homes, small communities, and larger villages around the world in order to facilitate the development of robust design practices for RAPS systems, and especially for the storage battery component. These systems could have significant impact on areas of the world that would otherwise not be served by conventional electrical grids.

ATP binding to p97/VCP D1 domain regulates selective recruitment of adaptors to its proximal N-domain.

Directory of Open Access Journals (Sweden)

Wei Sheng Chia

Full Text Available p97/Valosin-containing protein (VCP is a member of the AAA-ATPase family involved in many cellular processes including cell division, intracellular trafficking and extraction of misfolded proteins in endoplasmic reticulum-associated degradation (ERAD. It is a homohexamer with each subunit containing two tandem D1 and D2 ATPase domains and N- and C-terminal regions that function as adaptor protein binding domains. p97/VCP is directed to its many different functional pathways by associating with various adaptor proteins. The regulation of the recruitment of the adaptor proteins remains unclear. Two adaptor proteins, Ufd1/Npl4 and p47, which bind exclusively to the p97/VCP N-domain and direct p97/VCP to either ERAD-related processes or homotypic fusion of Golgi fragments, were studied here. Surface plasmon resonance biosensor-based assays allowed the study of binding kinetics in real time. In competition experiments, it was observed that in the presence of ATP, Ufd1/Npl4 was able to compete more effectively with p47 for binding to p97/VCP. By using non-hydrolysable ATP analogues and the hexameric truncated p97/N-D1 fragment, it was shown that binding rather than hydrolysis of ATP to the proximal D1 domain strengthened the Ufd1/Npl4 association with the N-domain, thus regulating the recruitment of either Ufd1/Npl4 or p47. This novel role of ATP and an assigned function to the D1 AAA-ATPase domain link the multiple functions of p97/VCP to the metabolic status of the cell.

ATP binding to p97/VCP D1 domain regulates selective recruitment of adaptors to its proximal N-domain.

Science.gov (United States)

Chia, Wei Sheng; Chia, Diana Xueqi; Rao, Feng; Bar Nun, Shoshana; Geifman Shochat, Susana

2012-01-01

p97/Valosin-containing protein (VCP) is a member of the AAA-ATPase family involved in many cellular processes including cell division, intracellular trafficking and extraction of misfolded proteins in endoplasmic reticulum-associated degradation (ERAD). It is a homohexamer with each subunit containing two tandem D1 and D2 ATPase domains and N- and C-terminal regions that function as adaptor protein binding domains. p97/VCP is directed to its many different functional pathways by associating with various adaptor proteins. The regulation of the recruitment of the adaptor proteins remains unclear. Two adaptor proteins, Ufd1/Npl4 and p47, which bind exclusively to the p97/VCP N-domain and direct p97/VCP to either ERAD-related processes or homotypic fusion of Golgi fragments, were studied here. Surface plasmon resonance biosensor-based assays allowed the study of binding kinetics in real time. In competition experiments, it was observed that in the presence of ATP, Ufd1/Npl4 was able to compete more effectively with p47 for binding to p97/VCP. By using non-hydrolysable ATP analogues and the hexameric truncated p97/N-D1 fragment, it was shown that binding rather than hydrolysis of ATP to the proximal D1 domain strengthened the Ufd1/Npl4 association with the N-domain, thus regulating the recruitment of either Ufd1/Npl4 or p47. This novel role of ATP and an assigned function to the D1 AAA-ATPase domain link the multiple functions of p97/VCP to the metabolic status of the cell.

Assessment of transferring Sr-90 and Cs-137 in products of processing of seeds raps for getting raps' oil and biodiesel

International Nuclear Information System (INIS)

Yatsino, T.S.; Mironov, V.P.

2009-01-01

The objects of research are soil assays, seeds of raps, straw and the stalks selected on polluted radio nuclides of territory. The work purpose is to measure specific activity of strontium and cesium in assays, to calculate factors of transition Sr 90 and Sr 137 in products of processing of seeds of raps. (authors)

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

Science.gov (United States)

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

pH modulates the binding of early growth response protein 1 transcription factor to DNA.

Science.gov (United States)

Mikles, David C; Bhat, Vikas; Schuchardt, Brett J; Deegan, Brian J; Seldeen, Kenneth L; McDonald, Caleb B; Farooq, Amjad

2013-08-01

The transcription factor early growth response protein (EGR)1 orchestrates a plethora of signaling cascades involved in cellular homeostasis, and its downregulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with an increase in pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as His382 by virtue of the fact that its replacement by nonionizable residues abolishes the pH dependence of the binding of EGR1 to DNA. Notably, His382 inserts into the major groove of DNA, and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, His382 is mainly conserved across other members of the EGR family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating the protein-DNA interactions that are central to this family of transcription factors. Collectively, our findings reveal an unexpected but a key step in the molecular recognition of the EGR family of transcription factors, and suggest that they may act as sensors of pH within the intracellular environment. © 2013 FEBS.

Changing images of violence in Rap music lyrics: 1979-1997.

Science.gov (United States)

Herd, Denise

2009-12-01

Rap music has been at the center of concern about the potential harmful effects of violent media on youth social behavior. This article explores the role of changing images of violence in rap music lyrics from the 1970s to the 1990s. The results indicate that there has been a dramatic and sustained increase in the level of violence in rap music. The percentage of songs mentioning violence increased from 27 per cent during 1979-1984 to 60 per cent during 1994-1997. In addition, portrayals of violence in later songs are viewed in a more positive light as shown by their increased association with glamor, wealth, masculinity, and personal prowess. Additional analyses revealed that genre, specifically gangster rap, is the most powerful predictor of the increased number of violent references in songs. The discussion suggests that violence in rap music has increased in response to the complex interplay of changing social conditions such as the elevated levels of youth violence in the 1980s and changing commercial practices within the music industry.

Structural basis for the ligand-binding specificity of fatty acid-binding proteins (pFABP4 and pFABP5) in gentoo penguin.

Science.gov (United States)

Lee, Chang Woo; Kim, Jung Eun; Do, Hackwon; Kim, Ryeo-Ok; Lee, Sung Gu; Park, Hyun Ho; Chang, Jeong Ho; Yim, Joung Han; Park, Hyun; Kim, Il-Chan; Lee, Jun Hyuck

2015-09-11

Fatty acid-binding proteins (FABPs) are involved in transporting hydrophobic fatty acids between various aqueous compartments of the cell by directly binding ligands inside their β-barrel cavities. Here, we report the crystal structures of ligand-unbound pFABP4, linoleate-bound pFABP4, and palmitate-bound pFABP5, obtained from gentoo penguin (Pygoscelis papua), at a resolution of 2.1 Å, 2.2 Å, and 2.3 Å, respectively. The pFABP4 and pFABP5 proteins have a canonical β-barrel structure with two short α-helices that form a cap region and fatty acid ligand binding sites in the hydrophobic cavity within the β-barrel structure. Linoleate-bound pFABP4 and palmitate-bound pFABP5 possess different ligand-binding modes and a unique ligand-binding pocket due to several sequence dissimilarities (A76/L78, T30/M32, underlining indicates pFABP4 residues) between the two proteins. Structural comparison revealed significantly different conformational changes in the β3-β4 loop region (residues 57-62) as well as the flipped Phe60 residue of pFABP5 than that in pFABP4 (the corresponding residue is Phe58). A ligand-binding study using fluorophore displacement assays shows that pFABP4 has a relatively strong affinity for linoleate as compared to pFABP5. In contrast, pFABP5 exhibits higher affinity for palmitate than that for pFABP4. In conclusion, our high-resolution structures and ligand-binding studies provide useful insights into the ligand-binding preferences of pFABPs based on key protein-ligand interactions. Copyright © 2015 Elsevier Inc. All rights reserved.

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

Science.gov (United States)

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Radiological Assistance Program (RAP) Regions

Data.gov (United States)

Department of Homeland Security — The U.S. Department of Energy (DOE) created the Radiological Assistance Program (RAP) in the 1950s to make DOE resources and expertise available to organizations...

The non-receptor tyrosine kinase Lyn controls neutrophil adhesion by recruiting the CrkL–C3G complex and activating Rap1 at the leading edge

Science.gov (United States)

He, Yuan; Kapoor, Ashish; Cook, Sara; Liu, Shubai; Xiang, Yang; Rao, Christopher V.; Kenis, Paul J. A.; Wang, Fei

2011-01-01

Establishing new adhesions at the extended leading edges of motile cells is essential for stable polarity and persistent motility. Despite recent identification of signaling pathways that mediate polarity and chemotaxis in neutrophils, little is known about molecular mechanisms governing cell–extracellular-matrix (ECM) adhesion in these highly polarized and rapidly migrating cells. Here, we describe a signaling pathway in neutrophils that is essential for localized integrin activation, leading edge attachment and persistent migration during chemotaxis. This pathway depends upon Gi-protein-mediated activation and leading edge recruitment of Lyn, a non-receptor tyrosine kinase belonging to the Src kinase family. We identified the small GTPase Rap1 as a major downstream effector of Lyn to regulate neutrophil adhesion during chemotaxis. Depletion of Lyn in neutrophil-like HL-60 cells prevented chemoattractant-induced Rap1 activation at the leading edge of the cell, whereas ectopic expression of Rap1 largely rescued the defects induced by Lyn depletion. Furthermore, Lyn controls spatial activation of Rap1 by recruiting the CrkL–C3G protein complex to the leading edge. Together, these results provide novel mechanistic insights into the poorly understood signaling network that controls leading edge adhesion during chemotaxis of neutrophils, and possibly other amoeboid cells. PMID:21628423

Polymorphisms A387P in thrombospondin-4 and N700S in thrombospondin-1 perturb calcium binding sites.

Science.gov (United States)

Stenina, Olga I; Ustinov, Valentin; Krukovets, Irene; Marinic, Tina; Topol, Eric J; Plow, Edward F

2005-11-01

Recent genetic studies have associated members of the thrombospondin (TSP) gene family with premature cardiovascular disease. The disease-associated polymorphisms lead to single amino acid changes in TSP-4 (A387P) and TSP-1 (N700S). These substitutions reside in adjacent domains of these highly homologous proteins. Secondary structural predictive programs and the homology of the domains harboring these amino acid substitutions to those in other proteins pointed to potential alterations of putative Ca2+ binding sites that reside in close proximity to the polymorphic amino acids. Since Ca2+ binding is critical for the structure and function of TSP family members, direct evidence for differences in Ca2+ binding by the polymorphic forms was sought. Using synthetic peptides and purified recombinant variant fragments bearing the amino acid substitutions, we measured differences in Tb3+ luminescence as an index of Ca2+ binding. The Tb3+ binding constants placed the TSP-1 region affected by N700S polymorphism among other high-affinity Ca2+ binding sites. The affinity of Ca2+ binding was lower for peptides (3.5-fold) and recombinant fragments (10-fold) containing the S700 vs. the N700 form. In TSP-4, the P387 form acquired an additional Ca2+ binding site absent in the A387 form. The results of our study suggest that both substitutions (A387P in TSP-4 and N700S in TSP-1) alter Ca2+ binding properties. Since these substitutions exert the opposite effects on Ca2+ binding, a decrease in TSP-1 and an increase in TSP-4, the two TSP variants are likely to influence cardiovascular functions in distinct but yet pathogenic ways.

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

Science.gov (United States)

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

Evidence for Dual Binding Sites for 1,1,1-Trichloro-2,2-bis(p-chlorophenyl)ethane (DDT) in Insect Sodium Channels*

Science.gov (United States)

Du, Yuzhe; Nomura, Yoshiko; Zhorov, Boris S.; Dong, Ke

2016-01-01

1,1,1-Trichloro-2,2-bis(p-chlorophenyl)ethane (DDT), the first organochlorine insecticide, and pyrethroid insecticides are sodium channel agonists. Although the use of DDT is banned in most of the world due to its detrimental impact on the ecosystem, indoor residual spraying of DDT is still recommended for malaria control in Africa. Development of resistance to DDT and pyrethroids is a serious global obstacle for managing disease vectors. Mapping DDT binding sites is necessary for understanding mechanisms of resistance and modulation of sodium channels by structurally different ligands. The pioneering model of the housefly sodium channel visualized the first receptor for pyrethroids, PyR1, in the II/III domain interface and suggested that DDT binds within PyR1. Previously, we proposed the second pyrethroid receptor, PyR2, at the I/II domain interface. However, whether DDT binds to both pyrethroid receptor sites remains unknown. Here, using computational docking of DDT into the Kv1.2-based mosquito sodium channel model, we predict that two DDT molecules can bind simultaneously within PyR1 and PyR2. The bulky trichloromethyl group of each DDT molecule fits snugly between four helices in the bent domain interface, whereas two p-chlorophenyl rings extend into two wings of the interface. Model-driven mutagenesis and electrophysiological analysis confirmed these propositions and revealed 10 previously unknown DDT-sensing residues within PyR1 and PyR2. Our study proposes a dual DDT-receptor model and provides a structural background for rational development of new insecticides. PMID:26637352

p32, a novel binding partner of Mcl-1, positively regulates mitochondrial Ca{sup 2+} uptake and apoptosis

Energy Technology Data Exchange (ETDEWEB)

Xiao, Kang [Division of Life Science, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (China); Wang, Yinyin; Chang, Zhijie [School of Medicine, Tsinghua University, Beijing (China); Lao, Yuanzhi, E-mail: laurence_ylao@163.com [School of Pharmacy, Shanghai University of Traditional Chinese Medicine, Shanghai (China); Chang, Donald C., E-mail: bochang@ust.hk [Division of Life Science, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (China)

2014-08-22

Highlights: • p32 binds to Mcl-1. • p32 affects apoptosis. • p32 and Mcl-1 regulate mitochondrial Ca{sup 2+}. - Abstract: Mcl-1 is a major anti-apoptotic Bcl-2 family protein. It is well known that Mcl-1 can interact with certain pro-apoptotic Bcl-2 family proteins in normal cells to neutralize their pro-apoptotic functions, thus prevent apoptosis. In addition, it was recently found that Mcl-1 can also inhibit mitochondrial calcium uptake. The detailed mechanism, however, is still not clear. Based on Yeast Two-Hybrid screening and co-immunoprecipitation, we identified a mitochondrial protein p32 (C1qbp) as a novel binding partner of Mcl-1. We found that p32 had a number of interesting properties: (1) p32 can positively regulate UV-induced apoptosis in HeLa cells. (2) Over-expressing p32 could significantly promote mitochondrial calcium uptake, while silencing p32 by siRNA suppressed it. (3) In p32 knockdown cells, Ruthenium Red treatment (an inhibitor of mitochondrial calcium uniporter) showed no further suppressive effect on mitochondrial calcium uptake. In addition, in Ruthenium Red treated cells, Mcl-1 also failed to suppress mitochondrial calcium uptake. Taken together, our findings suggest that p32 is part of the putative mitochondrial uniporter that facilitates mitochondrial calcium uptake. By binding to p32, Mcl-1 can interfere with the uniporter function, thus inhibit the mitochondrial Ca{sup 2+} uploading. This may provide a novel mechanism to explain the anti-apoptotic function of Mcl-1.

Chance Encounters: Rap Music as a Relational and Pedagogical Resource in Clinical Pastoral Education.

Science.gov (United States)

Gilmore, Jeremy

2018-03-01

Music has long been regarded as a valuable tool for educators. Over the last three decades, rap music has grown to become a global phenomenon. However, due to historical and cultural factors, rap music is often underutilized in Clinical Pastoral Education. This article discusses the social significance of rap music, highlights how rap music informed my supervision of a clinical pastoral education student, and examines Chance the Rapper's mixtape Coloring Book as a case study on the utilization of rap music as a relational and pedagogical resource in spiritual education.

Role of LAMP1 Binding and pH Sensing by the Spike Complex of Lassa Virus.

Science.gov (United States)

Cohen-Dvashi, Hadas; Israeli, Hadar; Shani, Orly; Katz, Aliza; Diskin, Ron

2016-11-15

To effectively infect cells, Lassa virus needs to switch in an endosomal compartment from its primary receptor, α-dystroglycan, to a protein termed LAMP1. A unique histidine triad on the surface of the receptor-binding domain from the glycoprotein spike complex of Lassa virus is important for LAMP1 binding. Here we investigate mutated spikes that have an impaired ability to interact with LAMP1 and show that although LAMP1 is important for efficient infectivity, it is not required for spike-mediated membrane fusion per se Our studies reveal important regulatory roles for histidines from the triad in sensing acidic pH and preventing premature spike triggering. We further show that LAMP1 requires a positively charged His230 residue to engage with the spike complex and that LAMP1 binding promotes membrane fusion. These results elucidate the molecular role of LAMP1 binding during Lassa virus cell entry and provide new insights into how pH is sensed by the spike. Lassa virus is a devastating disease-causing agent in West Africa, with a significant yearly death toll and severe long-term complications associated with its infection in survivors. In recent years, we learned that Lassa virus needs to switch receptors in a pH-dependent manner to efficiently infect cells, but neither the molecular mechanisms that allow switching nor the actual effects of switching were known. Here we investigate the activity of the viral spike complex after abrogation of its ability to switch receptors. These studies inform us about the role of switching receptors and provide new insights into how the spike senses acidic pH. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Literature review : performance of RAP/RAS mixes and new direction.

Science.gov (United States)

2014-04-01

In the last several years reclaimed asphalt pavement (RAP) and recycled asphalt shingles (RAS) have been : widely used in asphalt mixes in Texas. The use of RAP/RAS can significantly reduce the initial cost of : asphalt mixtures, conserve energy, and...

An N-terminal Region of Mot-2 Binds to p53 In Vitro

Directory of Open Access Journals (Sweden)

Sunil C. Kaul

2001-01-01

Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

Frequency of helicobacter pylori (hp) infection in children with recurrent abdominal pain (rap)

International Nuclear Information System (INIS)

Mahmud, S.; Ali, S.

2015-01-01

To study the frequency of Helicobacter Pylori (HP) infection among children with recurrent abdominal pain (RAP) Study Design: Cross-sectional comparative study. Place and Duration of Study: Military Hospital (MH), Rawalpindi from December 2011 to February 2012. Patients and Methods: One hundred children of either gender aged 2 to 12 years presenting with RAP were tested for HP at Paediatric OPD MH, Rawalpindi who consented to participate in the study. Those children who tested positive for Helicobacter Pylori Stool Antigen Test (HPSAT) were labeled as those having Hp infection. The stool assay was performed using the HpSAT kit and the socio-demographic and clinical profiles of children were associated. Results: Out of 100 children included in the study HpSAT was positive in 38% children. Frequency of Hp infection was significantly associated with source of drinking water (p = 0.014), socioeconomic status (p = 0.001) and positive family history of yspepsia (p= 0.023). While age and gender have no significant association with HP infection. Conclusion: Hp infection is very common in children presenting with RAP in our Paediatric OPD. Children with family history of dyspepsia, from low socioeconomic class and those drinking filtered water are at greater risk for HP infection. It is recommended that children from other populations in our country should also be tested in their medical health facilities in order to have a wider analysis of this problem in our setup. (author)

Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs

Science.gov (United States)

Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan

2013-01-01

Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563

Fatigue Durability Analysis of Collecting Rapping System in Electrostatic Precipitators under Impact Loading

Directory of Open Access Journals (Sweden)

Ali Akbar Lotfi Neyestanak

2014-01-01

Full Text Available Due to the importance of collecting rapping system in electrostatic precipitators (ESP and controlling the relevant damage under impact loading, fatigue durability of this system is analyzed in the present study based on the numerical and experimental results considering fatigue damage growth and vibration acceleration in the collecting system because of the successive impact of rapping hammers. By microscopic examination of the fracture surface of rapping hammer, beach marks obviously show typical fatigue failure in the rapping hammer arm. In addition, the microscopic examination of the cross section of the collecting plates indicates the corrosion voids which cause crack and eventually fatigue failure. The finite element method is applied to determine both the stress and concentration positions of dynamic stress on the rapping system under impact loading. The paper results can be utilized in system optimization and new material selection for the system by evaluating rapping system durability.

Activation of G protein-coupled estrogen receptor 1 induces coronary artery relaxation via Epac/Rap1-mediated inhibition of RhoA/Rho kinase pathway in parallel with PKA.

Directory of Open Access Journals (Sweden)

Xuan Yu

Full Text Available Previously, we reported that cAMP/PKA signaling is involved in GPER-mediated coronary relaxation by activating MLCP via inhibition of RhoA pathway. In the current study, we tested the hypothesis that activation of GPER induces coronary artery relaxation via inhibition of RhoA/Rho kinase pathway by cAMP downstream targets, exchange proteins directly activated by cAMP (Epac as well as PKA. Our results show that Epac inhibitors, brefeldin A (BFA, 50 μM, or ESI-09 (20 μM, or CE3F4 (100 μM, all partially inhibited porcine coronary artery relaxation response to the selective GPER agonist, G-1 (0.3-3 μM; while concurrent administration of BFA and PKI (5 μM, a PKA inhibitor, almost completely blocked the relaxation effect of G-1. The Epac specific agonist, 8-CPT-2Me-cAMP (007, 1-100 μM, induced a concentration-dependent relaxation response. Furthermore, the activity of Ras-related protein 1 (Rap1 was up regulated by G-1 (1 μM treatment of porcine coronary artery smooth muscle cells (CASMCs. Phosphorylation of vasodilator-stimulated phosphoprotein (p-VASP was elevated by G-1 (1 μM treatment, but not by 007 (50 μM; and the effect of G-1 on p-VASP was blocked by PKI, but not by ESI-09, an Epac antagonist. RhoA activity was similarly down regulated by G-1 and 007, whereas ESI-09 restored most of the reduced RhoA activity by G-1 treatment. Furthermore, G-1 decreased PGF2α-induced p-MYPT1, which was partially reversed with either ESI-09 or PKI; whereas, concurrent administration of ESI-09 and PKI totally prevented the inhibitory effect of G-1. The inhibitory effects of G-1 on p- MLC levels in CASMCs were mostly restored by either ESI-09 or PKI. These results demonstrate that activation of GPER induces coronary artery relaxation via concurrent inhibition of RhoA/Rho kinase by Epac/Rap1 and PKA. GPER could be a potential drug target for preventing and treating cardiovascular diseases.

Rap Music Use, Perceived Peer Behavior, and Sexual Initiation Among Ethnic Minority Youth.

Science.gov (United States)

Johnson-Baker, Kimberly A; Markham, Christine; Baumler, Elizabeth; Swain, Honora; Emery, Susan

2016-03-01

Research shows that rap music use is associated with risky sexual behavior in ethnic minority youth; however, it is unknown whether rap music use impacts sexual initiation specifically and, if so, which factors mediate this impact. Thus, we investigated the longitudinal relationship between hours spent listening to rap music in seventh grade and sexual initiation in ninth grade. We also examined the role of perceived peer sexual behavior as a potential mediator of this relationship. We analyzed data from students (n = 443) enrolled in a school-based randomized controlled trial of a sexual health education curriculum collected at baseline and at 18-month follow-up. Rap music use and perceived peer sexual behavior were assessed in seventh grade, whereas sexual initiation was assessed in ninth grade. Univariate, multivariate, and mediation analyses were conducted. At baseline, rap music use was significantly associated with race/ethnicity, parental music rules, and sexual behavior, but not with gender or parental education. Rap music use was a significant predictor of sexual initiation on univariate analysis but not multivariate analysis. Mediation analysis showed that the association between hours spent listening to rap music and sexual initiation was significantly mediated by perceived peer sexual behavior. Rap music use in early adolescence significantly impacts sexual initiation in late adolescence, partially mediated by perceived peer sexual behavior. More research is needed to understand how rap music influences perceptions of peer sexual behavior, which, in turn, influence early sexual initiation. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

Science.gov (United States)

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

The PCNA-associated factor KIAA0101/p15PAF binds the potential tumor suppressor product p33ING1b

International Nuclear Information System (INIS)

Simpson, Fiona; Lammerts van Bueren, Kelly; Butterfield, Natalie; Bennetts, Jennifer S.; Bowles, Josephine; Adolphe, Christelle; Simms, Lisa A.; Young, Joanne; Walsh, Michael D.; Leggett, Barbara; Fowles, Lindsay F.; Wicking, Carol

2006-01-01

The KIAA0101/p15 PAF /OEATC-1 protein was initially isolated in a yeast two-hybrid screen for proliferating cell nuclear antigen (PCNA) binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21 WAF . PCNA is involved in DNA replication and damage repair. Using polyclonal antisera raised against a p15 PAF fusion protein, we have shown that in a range of mammalian tumor and non-tumor cell lines the endogenous p15 PAF protein localises to the nucleus and the mitochondria. Under normal conditions no co-localisation with PCNA could be detected, however following exposure to UV it was possible to co-immunoprecipitate p15 PAF and PCNA from a number of cell lines, suggesting a UV-enhanced association of the two proteins. Overexpression of p15 PAF in mammalian cells was also found to protect cells from UV-induced cell death. Based on similarities between the behaviour of p15 PAF and the potential tumor suppressor product p33ING1b, we have further shown that these two proteins interact in the same complex in cell cultures. This suggests that p15 PAF forms part of a larger protein complex potentially involved in the regulation of DNA repair, apoptosis and cell cycle progression

Evidence for Dual Binding Sites for 1,1,1-Trichloro-2,2-bis(p-chlorophenyl)ethane (DDT) in Insect Sodium Channels.

Science.gov (United States)

Du, Yuzhe; Nomura, Yoshiko; Zhorov, Boris S; Dong, Ke

2016-02-26

1,1,1-Trichloro-2,2-bis(p-chlorophenyl)ethane (DDT), the first organochlorine insecticide, and pyrethroid insecticides are sodium channel agonists. Although the use of DDT is banned in most of the world due to its detrimental impact on the ecosystem, indoor residual spraying of DDT is still recommended for malaria control in Africa. Development of resistance to DDT and pyrethroids is a serious global obstacle for managing disease vectors. Mapping DDT binding sites is necessary for understanding mechanisms of resistance and modulation of sodium channels by structurally different ligands. The pioneering model of the housefly sodium channel visualized the first receptor for pyrethroids, PyR1, in the II/III domain interface and suggested that DDT binds within PyR1. Previously, we proposed the second pyrethroid receptor, PyR2, at the I/II domain interface. However, whether DDT binds to both pyrethroid receptor sites remains unknown. Here, using computational docking of DDT into the Kv1.2-based mosquito sodium channel model, we predict that two DDT molecules can bind simultaneously within PyR1 and PyR2. The bulky trichloromethyl group of each DDT molecule fits snugly between four helices in the bent domain interface, whereas two p-chlorophenyl rings extend into two wings of the interface. Model-driven mutagenesis and electrophysiological analysis confirmed these propositions and revealed 10 previously unknown DDT-sensing residues within PyR1 and PyR2. Our study proposes a dual DDT-receptor model and provides a structural background for rational development of new insecticides. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

RNA Binding of T-cell Intracellular Antigen-1 (TIA-1) C-terminal RNA Recognition Motif Is Modified by pH Conditions*

Science.gov (United States)

Cruz-Gallardo, Isabel; Aroca, Ángeles; Persson, Cecilia; Karlsson, B. Göran; Díaz-Moreno, Irene

2013-01-01

T-cell intracellular antigen-1 (TIA-1) is a DNA/RNA-binding protein that regulates critical events in cell physiology by the regulation of pre-mRNA splicing and mRNA translation. TIA-1 is composed of three RNA recognition motifs (RRMs) and a glutamine-rich domain and binds to uridine-rich RNA sequences through its C-terminal RRM2 and RRM3 domains. Here, we show that RNA binding mediated by either isolated RRM3 or the RRM23 construct is controlled by slight environmental pH changes due to the protonation/deprotonation of TIA-1 RRM3 histidine residues. The auxiliary role of the C-terminal RRM3 domain in TIA-1 RNA recognition is poorly understood, and this work provides insight into its binding mechanisms. PMID:23902765

The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

Science.gov (United States)

Harakeh, Zeena; Bogt, Tom F M Ter

2018-02-16

Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

Mapping the structural and dynamical features of multiple p53 DNA binding domains: insights into loop 1 intrinsic dynamics.

Directory of Open Access Journals (Sweden)

Suryani Lukman

Full Text Available The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD. In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs. Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3. Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart. Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1 a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2 possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site.

Influence of slope and gradation on rip rap stability and degradation mechanisms

International Nuclear Information System (INIS)

Lefebvre, G.; Rohan, K.; Belfahdel, M. B.

1997-01-01

A major investigation was undertaken at the La Grande hydroelectric complex with some 220 dikes and dams to study rip rap stability and repair. Degradation mechanisms were also studied under laboratory conditions to verify the main field study conclusions and to test different repair techniques. The result of both laboratory and field observation was that rip rap gradation has only marginal effect on slope stability and degradation mechanisms. On the other hand, the inclusion of even a small fraction of fine blocks (as little as 10 per cent) into the rip rap was shown to be very detrimental to the stability of steep rip rap but only marginally effective on flat slopes. 15 refs., 8 figs

3D printing with RepRap cookbook

CERN Document Server

Salinas, Richard

2014-01-01

A systematic guide consisting of over 100 recipes which focus on helping you understand the process of 3D printing using RepRap machines. The book aims at providing professionals with a series of working recipes to help make their fuzzy notions into real, saleable projects/objects using 3D printing technology. This book is for novice designers and artists who own a RepRap-based 3D printer, have fundamental knowledge of its working, and who desire to gain better mastery of the printing process. For the more experienced user, it will provide a handy visual resource, with side-by-side comparisons

Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

International Nuclear Information System (INIS)

Besançon, Roger; Puisieux, Alain; Valsesia-Wittmann, Sandrine; Locher, Clara; Delloye-Bourgeois, Céline; Furhman, Lydie; Tutrone, Giovani; Bertrand, Christophe; Jallas, Anne-Catherine; Garin, Elisabeth

2009-01-01

The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCN Δ1b ) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCN Δ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCN Δ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCN Δ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCN Δ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCN Δ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

Binding of alpha2ML1 to the low density lipoprotein receptor-related protein 1 (LRP1 reveals a new role for LRP1 in the human epidermis.

Directory of Open Access Journals (Sweden)

Marie-Florence Galliano

Full Text Available BACKGROUND: The multifunctional receptor LRP1 has been shown to bind and internalize a large number of protein ligands with biological importance such as the pan-protease inhibitor alpha2-macroglobulin (alpha2M. We recently identified Alpha2ML1, a new member of the alpha2M gene family, expressed in epidermis. alpha2ML1 might contribute to the regulation of desquamation through its inhibitory activity towards proteases of the chymotrypsin family, notably KLK7. The expression of LRP1 in epidermis as well as its ability to internalize alpha2ML1 was investigated. METHODS AND PRINCIPAL FINDINGS: In human epidermis, LRP1 is mainly expressed within the granular layer of the epidermis, which gathers the most differentiated keratinocytes, as shown by immunohistochemistry and immunofluorescence using two different antibodies. By using various experimental approaches, we show that the receptor binding domain of alpha2ML1 (RBDl is specifically internalized into the macrophage-like cell line RAW and colocalizes with LRP1 upon internalization. Coimmunoprecipitation assays demonstrate that RBDl binds LRP1 at the cell surface. Addition of RAP, a universal inhibitor of ligand binding to LRP1, prevents RBDl binding at the cell surface as well as internalization into RAW cells. Silencing Lrp1 expression with specific siRNA strongly reduces RBDl internalization. CONCLUSIONS AND SIGNIFICANCE: Keratinocytes of the upper differentiated layers of epidermis express LRP1 as well as alpha2ML1. Our study also reveals that alpha2ML1 is a new ligand for LRP1. Our findings are consistent with endocytosis by LRP1 of complexes formed between alpha2ML1 and proteases. LRP1 may thus control desquamation by regulating the biodisponibility of extracellular proteases.

Characterization of fatty acid binding by the P2 myelin protein

International Nuclear Information System (INIS)

Gudaitis, P.G.; Weise, M.J.

1987-01-01

In recent years, significant sequence homology has been found between the P2 protein of peripheral myelin and intracellular retinoid- and fatty acid-binding proteins. They have found that salt extracts of bovine intradural nerve roots contain the P2 basic protein in association with free fatty acid. Preliminary results from quantitative analyses showed a ratio of 0.4-1.1 fatty acid (mainly oleate and palmitate) per P2 molecule. P2/ligand interactions were partially characterized using ( 3 H)-oleate in gel permeation assays and binding studies using lipidex to separated bound and free fatty acid. Methyloleate was found to displace ( 3 H)-oleate from P2, indicating that ligand binding interactions are predominantly hydrophobic in nature. On the other hand, myristic acid and retinol did not inhibit the binding of oleate to the protein, results consistent with a decided affinity for long chain fatty acids but not for the retinoids. The binding between P2 and oleic acid showed an apparent Kd in the micromolar range, a value comparable to those found for other fatty acid-binding proteins. From these results they conclude that P2 shares not only structural homology with certain fatty acid binding proteins but also an ability to bind long chain fatty acids. Although the significance of these similarities is not yet clear, they may, by analogy, expect P2 to have a role in PNS lipid metabolism

Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

Science.gov (United States)

Emdin, Christopher

2010-01-01

The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

Homologous regions of Fen1 and p21Cip1 compete for binding to the same site on PCNA: a potential mechanism to co-ordinate DNA replication and repair.

Science.gov (United States)

Warbrick, E; Lane, D P; Glover, D M; Cox, L S

1997-05-15

Following genomic damage, the cessation of DNA replication is co-ordinated with onset of DNA repair; this co-ordination is essential to avoid mutation and genomic instability. To investigate these phenomena, we have analysed proteins that interact with PCNA, which is required for both DNA replication and repair. One such protein is p21Cip1, which inhibits DNA replication through its interaction with PCNA, while allowing repair to continue. We have identified an interaction between PCNA and the structure specific nuclease, Fen1, which is involved in DNA replication. Deletion analysis suggests that p21Cip1 and Fen1 bind to the same region of PCNA. Within Fen1 and its homologues a small region (10 amino acids) is sufficient for PCNA binding, which contains an 8 amino acid conserved PCNA-binding motif. This motif shares critical residues with the PCNA-binding region of p21Cip1. A PCNA binding peptide from p21Cip1 competes with Fen1 peptides for binding to PCNA, disrupts the Fen1-PCNA complex in replicating cell extracts, and concomitantly inhibits DNA synthesis. Competition between homologous regions of Fen1 and p21Cip1 for binding to the same site on PCNA may provide a mechanism to co-ordinate the functions of PCNA in DNA replication and repair.

TIM-1 glycoprotein binds the adhesion receptor P-selectin and mediates T cell trafficking during inflammation and autoimmunity

Science.gov (United States)

Angiari, Stefano; Donnarumma, Tiziano; Rossi, Barbara; Dusi, Silvia; Pietronigro, Enrica; Zenaro, Elena; Della Bianca, Vittorina; Toffali, Lara; Piacentino, Gennj; Budui, Simona; Rennert, Paul; Xiao, Sheng; Laudanna, Carlo; Casasnovas, Jose M.; Kuchroo, Vijay K.; Constantin, Gabriela

2014-01-01

SUMMARY Selectins play a central role in leukocyte trafficking by mediating tethering and rolling on vascular surfaces. Here we have reported that T cell immunoglobulin and mucin domain 1 (TIM-1) is a P-selectin ligand. We have shown that human and murine TIM-1 binds to P-selectin, and that TIM-1 mediates tethering and rolling of T helper-1 (Th1) and Th17, but not Th2 and regulatory T cells on P-selectin. Th1 and Th17 cells lacking the TIM-1 mucin domain showed reduced rolling in thrombin-activated mesenteric venules and inflamed brain microcirculation. Inhibition of TIM-1 had no effect on naive T cell homing, but reduced T cell recruitment in a skin hypersensitivity model and blocked experimental autoimmune encephalomyelitis. Uniquely, the TIM-1 IgV domain was also required for P-selectin binding. Our data demonstrate that TIM-1 is a major P-selectin ligand with a specialized role in T cell trafficking during inflammatory responses and the induction of autoimmune disease. PMID:24703780

Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

Science.gov (United States)

Lawson, Carl J

2015-12-01

The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

YB1/p32, a nuclear Y-box binding protein 1, is a novel regulator of myoblast differentiation that interacts with Msx1 homeoprotein

Energy Technology Data Exchange (ETDEWEB)

Song, Young Joon [Department of Biological Sciences, College of Natural Science, Inha University, 253 Yonghyun-dong, Nam-Gu, Incheon, Korea, 402-751 (Korea, Republic of); Lee, Hansol, E-mail: hlee@inha.ac.kr [Department of Biological Sciences, College of Natural Science, Inha University, 253 Yonghyun-dong, Nam-Gu, Incheon, Korea, 402-751 (Korea, Republic of)

2010-02-15

Precisely controlled cellular differentiation is essential for the proper development of vertebrate embryo and deregulated differentiation is a major cause of many human congenital diseases as well as cancer. Msx1 is a member of the homeoprotein family implicated in these processes, which inhibits the differentiation of skeletal muscle and other cell types, presumably by regulating transcription of target genes through interaction with other cellular factors. We presently show that YB1/p32, a nuclear Y-box binding protein 1, interacts with Msx1 homeoprotein and functions as a regulator of C2C12 myoblast differentiation. We demonstrate that YB1/p32 functionally interacts with Msx1 through its N-terminal region and colocalizes with Msx1 at the nuclear periphery. Moreover, we find that YB1/p32 is competent for inhibition of C2C12 myoblast differentiation, which is correlated with its activity as a negative regulator of MyoD gene expression and binding to the MyoD core enhancer region (CER). Furthermore, YB1/p32 cooperates with Msx1 in transcriptional repression and knocking down the expression of endogenous YB1 attenuates the effects of Msx1. Taken together, our study has uncovered a new function of YB1/p32, a regulator of skeletal muscle differentiation.

YB1/p32, a nuclear Y-box binding protein 1, is a novel regulator of myoblast differentiation that interacts with Msx1 homeoprotein

International Nuclear Information System (INIS)

Song, Young Joon; Lee, Hansol

2010-01-01

Precisely controlled cellular differentiation is essential for the proper development of vertebrate embryo and deregulated differentiation is a major cause of many human congenital diseases as well as cancer. Msx1 is a member of the homeoprotein family implicated in these processes, which inhibits the differentiation of skeletal muscle and other cell types, presumably by regulating transcription of target genes through interaction with other cellular factors. We presently show that YB1/p32, a nuclear Y-box binding protein 1, interacts with Msx1 homeoprotein and functions as a regulator of C2C12 myoblast differentiation. We demonstrate that YB1/p32 functionally interacts with Msx1 through its N-terminal region and colocalizes with Msx1 at the nuclear periphery. Moreover, we find that YB1/p32 is competent for inhibition of C2C12 myoblast differentiation, which is correlated with its activity as a negative regulator of MyoD gene expression and binding to the MyoD core enhancer region (CER). Furthermore, YB1/p32 cooperates with Msx1 in transcriptional repression and knocking down the expression of endogenous YB1 attenuates the effects of Msx1. Taken together, our study has uncovered a new function of YB1/p32, a regulator of skeletal muscle differentiation.

Binding of the sphingolipid S1P to hTERT stabilizes telomerase at the nuclear periphery by allosterically mimicking protein phosphorylation†

Science.gov (United States)

Selvam, Shanmugam P.; De Palma, Ryan M.; Oaks, Joshua J.; Oleinik, Natalia; Peterson, Yuri K.; Stahelin, Robert V.; Skordalakes, Emmanuel; Ponnusamy, Suriyan; Garrett-Mayer, Elizabeth; Smith, Charles D.; Ogretmen, Besim

2015-01-01

During DNA replication, the enzyme telomerase maintains the ends of chromosomes, called telomeres. Shortened telomeres trigger cell senescence, and cancer cells often have increased telomerase activity to promote their ability to proliferate indefinitely. The catalytic subunit, human telomerase reverse transcriptase (hTERT), is stabilized by phosphorylation. Here, we found that the lysophospholipid sphingosine 1-phosphate (S1P), generated by sphingosine kinase 2 (SK2), bound hTERT at the nuclear periphery in human and mouse fibroblasts. Docking predictions and mutational analyses revealed that binding occurred between a hydroxyl group (C′3-OH) in S1P and Asp684 in hTERT. Inhibiting or depleting SK2 or mutating the S1P binding site decreased the stability of hTERT in cultured cells and promoted senescence and loss of telomere integrity. S1P binding inhibited the interaction of hTERT with MKRN1, an E3 ubiquitin ligase that tags hTERT for degradation. Murine Lewis lung carcinoma (LLC) cells formed smaller tumors in mice lacking SK2 than in wild-type mice, and knocking down SK2 in LLC cells before implantation into mice suppressed their growth. Pharmacologically inhibiting SK2 decreased the growth of subcutaneous A549 lung cancer cell-derived xenografts in mice, and expression of wild-type hTERT, but not an S1P-binding mutant, restored tumor growth. Thus, our data suggest that S1P binding to hTERT allosterically mimicks phosphorylation, promoting telomerase stability and hence telomere maintenance, cell proliferation, and tumor growth PMID:26082434

Entre ritmo e poesia: rap e literatura oral urbana

Directory of Open Access Journals (Sweden)

Marcus Rogerio Salgado

2015-11-01

Full Text Available O objetivo do presente artigo é um estudo do rap enquanto manifestação de literatura oral urbana e forma de oralidade tecnológica. Para tanto, o artigo passará em revista as relações entre literatura e palavra falada/cantada, assim como as possibilidades de interface estética entre a literatura e a música que estão em questão quando tratamos do rap.

An upstream activation element exerting differential transcriptional activation on an archaeal promoter

DEFF Research Database (Denmark)

Peng, Nan; Xia, Qiu; Chen, Zhengjun

2009-01-01

S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

Anthropogenic phosphorus (P) inputs to a river basin and their impacts on P fluxes along its upstream-downstream continuum

Science.gov (United States)

Zhang, Wangshou; Swaney, Dennis; Hong, Bongghi; Howarth, Robert

2017-04-01

Phosphorus (P) originating from anthropogenic sources as a pollutant of surface waters has been an environmental issue for decades because of the well-known role of P in eutrophication. Human activities, such as food production and rapid urbanization, have been linked to increased P inputs which are often accompanied by corresponding increases in riverine P export. However, uneven distributions of anthropogenic P inputs along watersheds from the headwaters to downstream reaches can result in significantly different contributions to the riverine P fluxes of a receiving water body. So far, there is still very little scientific understanding of anthropogenic P inputs and their impacts on riverine flux in river reaches along the upstream to downstream continuum. Here, we investigated P budgets in a series of nested watersheds draining into Hongze Lake of China, and developed a simple empirical function to describe the relationship between anthropogenic inputs and riverine TP fluxes. The results indicated that an average of 1.1% of anthropogenic P inputs are exported into rivers, with most of the remainder retained in the watershed landscape over the period studied. Fertilizer application was the main contributor of P loading to the lake (55% of total loads), followed by legacy P stock (30%), food and feed P inputs (12%) and non-food P inputs (4%). From 60% to 89% of the riverine TP loads generated from various locations within this basin were ultimately transported into the receiving lake of the downstream, with an average rate of 1.86 tons P km-1 retaining in the main stem of the inflowing river annually. Our results highlight that in-stream processes can significantly buffer the riverine P loading to the downstream receiving lake. An integrated P management strategy considering the influence of anthropogenic inputs and hydrological interactions is required to assess and optimize P management for protecting fresh waters.

Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Tang, Wenxing; Bhatt, Avni [University of Florida, Department of Biochemistry and Molecular Biology, College of Medicine (United States); Smith, Adam N. [University of Florida, Department of Chemistry, College of Liberal Arts and Sciences (United States); Crowley, Paula J.; Brady, L. Jeannine, E-mail: jbrady@dental.ufl.edu [University of Florida, Department of Oral Biology, College of Dentistry (United States); Long, Joanna R., E-mail: jrlong@ufl.edu [University of Florida, Department of Biochemistry and Molecular Biology, College of Medicine (United States)

2016-02-15

The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ∼57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin.

Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy

International Nuclear Information System (INIS)

Tang, Wenxing; Bhatt, Avni; Smith, Adam N.; Crowley, Paula J.; Brady, L. Jeannine; Long, Joanna R.

2016-01-01

The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ∼57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin

Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy.

Science.gov (United States)

Tang, Wenxing; Bhatt, Avni; Smith, Adam N; Crowley, Paula J; Brady, L Jeannine; Long, Joanna R

2016-02-01

The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ~57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin.

Source localization using recursively applied and projected (RAP) MUSIC

Energy Technology Data Exchange (ETDEWEB)

Mosher, J.C. [Los Alamos National Lab., NM (United States); Leahy, R.M. [Univ. of Southern California, Los Angeles, CA (United States). Signal and Image Processing Inst.

1998-03-01

A new method for source localization is described that is based on a modification of the well known multiple signal classification (MUSIC) algorithm. In classical MUSIC, the array manifold vector is projected onto an estimate of the signal subspace, but errors in the estimate can make location of multiple sources difficult. Recursively applied and projected (RAP) MUSIC uses each successively located source to form an intermediate array gain matrix, and projects both the array manifold and the signal subspace estimate into its orthogonal complement. The MUSIC projection is then performed in this reduced subspace. Using the metric of principal angles, the authors describe a general form of the RAP-MUSIC algorithm for the case of diversely polarized sources. Through a uniform linear array simulation, the authors demonstrate the improved Monte Carlo performance of RAP-MUSIC relative to MUSIC and two other sequential subspace methods, S and IES-MUSIC.

Datin, a yeast poly(dA:dT)-binding protein, behaves as an activator of the wild-type ILV1 promoter and interacts synergistically with Reb1p

DEFF Research Database (Denmark)

Moreira, José Manuel Alfonso; Remacle, J E; Kielland-Brandt, Morten

1998-01-01

A cis-acting element required for GCN4-independent basal-level transcription of ILV1 was previously identified in our laboratories as a binding site for the REB1 protein (Reb1p). Further deletion analysis of the ILV1 promoter region identified a second element also required for GCN4-independent...... basal-level ILV1 expression. This second element is an A.T-rich tract (26 As out of 32 nucleotides) situated 15 bp downstream of the Reb1p-binding site. Deletion of both the Reblp site and the poly(dA:dT) element totally eliminates basal activity of the ILV1 promoter. We show that the two elements act...... synergistically to control ILV1 expression and that the synergistic effect is distance dependent. We demonstrate that (i) datin (Dat1p), the only known poly (dA:dT)-binding protein in yeast, specifically binds to the ILV1 poly(dA:dT) element in vitro; (ii) Dat1p functions as a trans-activating factor in the ILV1...

Major grass pollen allergen Lol p 1 binds to diesel exhaust particles: implications for asthma and air pollution.

Science.gov (United States)

Knox, R B; Suphioglu, C; Taylor, P; Desai, R; Watson, H C; Peng, J L; Bursill, L A

1997-03-01

Grass pollen allergens are known to be present in the atmosphere in a range of particle sizes from whole pollen grains (approx. 20 to 55 microns in diameter) to smaller size fractions Lol p 1, immunogold labelling with specific monoclonal antibodies and a high voltage transmission electron-microscopic imaging technique. DECP are visualized as small carbon spheres, each 30-60 nm in diameter, forming fractal aggregates about 1-2 microns in diameter. Here we test our hypothesis and show by in vitro experiments that the major grass pollen allergen, Lol p 1, binds to one defined class of fine particles, DECP. DECP are in the respirable size range, can bind to the major grass pollen allergen Lol p 1 under in vitro conditions and represent a possible mechanism by which allergens can become concentrated in polluted air and thus trigger attacks of asthma.

Investigation on performances of asphalt mixtures made with Reclaimed Asphalt Pavement: Effects of interaction between virgin and RAP bitumen

Directory of Open Access Journals (Sweden)

Luca Noferini

2017-07-01

Full Text Available According to most recent surveys, the European area produced 265 mil tonnes of asphalt for road applications in 2014. In the same year, the amount of available RAP was more than 50 mil tonnes. The use of RAP in new blended mixes reduces the need of neat bitumen, making RAP recycling economically attractive. Despite the economic and environmental benefits, road authorities tend to limit the use of RAP in asphalt mixes due to uncertainty about field performances. The present study focuses on the interaction between neat and RAP bitumen in asphalt mixes made with different RAP content. The effects of RAP on physical and rheological properties of the final bituminous blend were investigated. This study is part of a wider research, where a specific type of asphalt mixture was produced with different RAP contents being 10%, 20% and 30% by mass of the mix. Bitumen was extracted and recovered from asphalt mixes, then it was subjected to the following laboratory tests: standard characterization, dynamic viscosity and rheological analysis with DSR. Findings showed that the effects of RAP bitumen on the final blend varied in proportion to RAP content. A threshold value of RAP content was found, below which bitumen was not subjected to significant changes in physical and rheological properties. Practical implications on production methods and paving of RAP mixes are also proposed. Keywords: Reclaimed Asphalt Pavement (RAP, Recycling, Bitumen blending, Bitumen rheology

The upstream open reading frame of cyclin-dependent kinase inhibitor 1A mRNA negatively regulates translation of the downstream main open reading frame

Energy Technology Data Exchange (ETDEWEB)

Kim, Kyoung Mi; Cho, Hana [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Kim, Yoon Ki, E-mail: yk-kim@korea.ac.kr [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of)

2012-08-03

Highlights: Black-Right-Pointing-Pointer CDKN1A mRNA is a bona fide NMD substrate. Black-Right-Pointing-Pointer The uORF of CDKN1A mRNA is efficiently translated. Black-Right-Pointing-Pointer Translation of downstream main ORF is negatively regulated by translation of uORF in CDKN1A mRNA. -- Abstract: The first round of translation occurs on mRNAs bound by nuclear cap-binding complex (CBC), which is composed of nuclear cap-binding protein 80 and 20 (CBP80/20). During this round of translation, aberrant mRNAs are recognized and downregulated in abundance by nonsense-mediated mRNA decay (NMD), which is one of the mRNA quality control mechanisms. Here, our microarray analysis reveals that the level of cyclin-dependent kinase inhibitor 1A (CDKN1A; also known as Waf1/p21) mRNAs increases in cells depleted of cellular NMD factors. Intriguingly, CDKN1A mRNA contains an upstream open reading frame (uORF), which is a NMD-inducing feature. Using chimeric reporter constructs, we find that the uORF of CDKN1A mRNA negatively modulates translation of the main downstream ORF. These findings provide biological insights into the possible role of NMD in diverse biological pathways mediated by CDKN1A.

Expression analysis and biological characterization of Babesia sp. BQ1 (Lintan) (Babesia motasi-like) rhoptry-associated protein 1 and its potential use in serodiagnosis via ELISA.

Science.gov (United States)

Niu, Qingli; Liu, Zhijie; Yang, Jifei; Yu, Peifa; Pan, Yuping; Zhai, Bintao; Luo, Jianxun; Moreau, Emmanuelle; Guan, Guiquan; Yin, Hong

2016-05-31

In China, ovine babesiosis is one of the most important tick-borne haemoparasitic diseases of small ruminants. It has a significant economic impact, and several Babesia motasi-like isolates have been recently shown to be responsible for ovine babesiosis in this country. Full-length and C-terminal-truncated forms of the rap-1a61-1 gene of Babesia sp. BQ1 (Lintan) were cloned into the pET-30a plasmid and subsequently expressed as His-fusion proteins. The resulting recombinant RAP-1a proteins (rRAP-1a61-1 and rRAP-1a61-1/CT) were purified and evaluated as diagnostic antigens using Western blot analysis and ELISA. The native Babesia sp. BQ1 (Lintan) RAP-1 protein was recognized using Western blots and IFAT by antibodies that were raised in rabbits against rRAP-1a61-1/CT. The specificity, sensitivity and positive threshold values for rRAP-1a61-1/CT in ELISA were evaluated. Cross-reactivity was observed between rRAP-1a61-1/CT and positive sera for Babesia sp. BQ1 (Lintan), Babesia sp. BQ1 (Ningxian) and Babesia sp. Tianzhu isolates obtained from infected sheep. At one week post-inoculation, a significant increase was observed in the amount of antibodies produced against RAP-1a, and high levels of antibodies against RAP-1a were observed for 3 months (at 84 days p.i.). A total of 3198 serum samples were collected from small ruminants in 54 different regions in 23 provinces of China. These samples were tested using ELISA based on the rRAP-1a61-1/CT protein. The results indicated that the average positive rate was 36.02 %. The present study suggests that rRAP-1a61-1/CT might be a potential diagnostic antigen for detecting several isolates of B. motasi-like parasites infection.

HSF1 stress response pathway regulates autophagy receptor SQSTM1/p62-associated proteostasis

Science.gov (United States)

Watanabe, Yoshihisa; Tsujimura, Atsushi; Taguchi, Katsutoshi; Tanaka, Masaki

2017-01-01

ABSTRACT Proteostasis is important for protecting cells from harmful proteins and is mainly controlled by the HSF1 (heat shock transcription factor 1) stress response pathway. This pathway facilitates protein refolding by molecular chaperones; however, it is unclear whether it functions in autophagy or inclusion formation. The autophagy receptor SQSTM1/p62 is involved in selective autophagic clearance and inclusion formation by harmful proteins, and its phosphorylation at S349, S403, and S407 is required for binding to substrates. Here, we demonstrate that casein kinase 1 phosphorylates the SQSTM1 S349 residue when harmful proteins accumulate. Investigation of upstream factors showed that both SQSTM1 S349 and SQSTM1 S403 residues were phosphorylated in an HSF1 dependent manner. Inhibition of SQSTM1 phosphorylation suppressed inclusion formation by ubiquitinated proteins and prevented colocalization of SQSTM1 with aggregation-prone proteins. Moreover, HSF1 inhibition impaired aggregate-induced autophagosome formation and elimination of protein aggregates. Our findings indicate that HSF1 triggers SQSTM1-mediated proteostasis. PMID:27846364

HSF1 stress response pathway regulates autophagy receptor SQSTM1/p62-associated proteostasis.

Science.gov (United States)

Watanabe, Yoshihisa; Tsujimura, Atsushi; Taguchi, Katsutoshi; Tanaka, Masaki

2017-01-02

Proteostasis is important for protecting cells from harmful proteins and is mainly controlled by the HSF1 (heat shock transcription factor 1) stress response pathway. This pathway facilitates protein refolding by molecular chaperones; however, it is unclear whether it functions in autophagy or inclusion formation. The autophagy receptor SQSTM1/p62 is involved in selective autophagic clearance and inclusion formation by harmful proteins, and its phosphorylation at S349, S403, and S407 is required for binding to substrates. Here, we demonstrate that casein kinase 1 phosphorylates the SQSTM1 S349 residue when harmful proteins accumulate. Investigation of upstream factors showed that both SQSTM1 S349 and SQSTM1 S403 residues were phosphorylated in an HSF1 dependent manner. Inhibition of SQSTM1 phosphorylation suppressed inclusion formation by ubiquitinated proteins and prevented colocalization of SQSTM1 with aggregation-prone proteins. Moreover, HSF1 inhibition impaired aggregate-induced autophagosome formation and elimination of protein aggregates. Our findings indicate that HSF1 triggers SQSTM1-mediated proteostasis.

Linear Interaction Energy Based Prediction of Cytochrome P450 1A2 Binding Affinities with Reliability Estimation.

Directory of Open Access Journals (Sweden)

Luigi Capoferri

Full Text Available Prediction of human Cytochrome P450 (CYP binding affinities of small ligands, i.e., substrates and inhibitors, represents an important task for predicting drug-drug interactions. A quantitative assessment of the ligand binding affinity towards different CYPs can provide an estimate of inhibitory activity or an indication of isoforms prone to interact with the substrate of inhibitors. However, the accuracy of global quantitative models for CYP substrate binding or inhibition based on traditional molecular descriptors can be limited, because of the lack of information on the structure and flexibility of the catalytic site of CYPs. Here we describe the application of a method that combines protein-ligand docking, Molecular Dynamics (MD simulations and Linear Interaction Energy (LIE theory, to allow for quantitative CYP affinity prediction. Using this combined approach, a LIE model for human CYP 1A2 was developed and evaluated, based on a structurally diverse dataset for which the estimated experimental uncertainty was 3.3 kJ mol-1. For the computed CYP 1A2 binding affinities, the model showed a root mean square error (RMSE of 4.1 kJ mol-1 and a standard error in prediction (SDEP in cross-validation of 4.3 kJ mol-1. A novel approach that includes information on both structural ligand description and protein-ligand interaction was developed for estimating the reliability of predictions, and was able to identify compounds from an external test set with a SDEP for the predicted affinities of 4.6 kJ mol-1 (corresponding to 0.8 pKi units.

As mensagens sobre drogas no rap: como sobreviver na periferia Messages about drugs from rap: how to survive in the periferia

Directory of Open Access Journals (Sweden)

Vinícius Gonçalves Bento da Silva

2004-12-01

Full Text Available O objetivo é analisar as mensagens sobre drogas nas letras de rap de grupos com representatividade e influência entre jovens da periferia de São Paulo. O rap é um gênero musical que faz parte de um movimento cultural - o hip hop -, que difunde uma visão social de mundo, principalmente nas periferias das grandes cidades. Por meio da Análise de Discurso estudaram-se 11 letras de 9 grupos. O tema marcante é a vida na periferia retratada pelo tráfico e consumo de drogas, pela violência e pela discriminação. O uso de drogas é compreendido por alguns grupos como conseqüência do modo de produção, e por outros, pelas características individuais, pela influência da família e dos amigos. As propostas para o enfrentamento e para a superação dos problemas estão voltadas à responsabilização do sujeito que, através de um esforço pessoal, não se envolveria com o tráfico e consumo de drogas consideradas perigosas e destrutivas como o crack e a cocaína. O fortalecimento de laços familiares e de amizade e a educação são também vistos como saídas para os problemas advindos do envolvimento com as drogas. As propostas invocam um discurso que, além de denunciar a situação dos jovens da periferia, propõe mecanismos de proteção para criar uma alternativa de "vida possível" - de convivência com a violência, com o tráfico e consumo de drogas.The objective was to analyze the messages about drugs of the rap lyrics from representative and influential groups among the youth living in the periferias of São Paulo. It understands that rap is a kind of music that is part of cultural movement - the hip hop - that disseminates a particular set of ideas, mainly in the periferias of the big cities. Through Discourse Analysis 11 lyrics of 9 rap groups were taken as a sample. The outstanding theme of the lyrics is the situation of the segregated areas of the city, including the presence of drug trafficking and consumption, as well as

Sequence similarity between the erythrocyte binding domain 1 of the Plasmodium vivax Duffy binding protein and the V3 loop of HIV-1 strain MN reveals binding residues for the Duffy Antigen Receptor for Chemokines

Directory of Open Access Journals (Sweden)

Garry Robert F

2011-01-01

Full Text Available Abstract Background The surface glycoprotein (SU, gp120 of the human immunodeficiency virus (HIV must bind to a chemokine receptor, CCR5 or CXCR4, to invade CD4+ cells. Plasmodium vivax uses the Duffy Binding Protein (DBP to bind the Duffy Antigen Receptor for Chemokines (DARC and invade reticulocytes. Results Variable loop 3 (V3 of HIV-1 SU and domain 1 of the Plasmodium vivax DBP share a sequence similarity. The site of amino acid sequence similarity was necessary, but not sufficient, for DARC binding and contained a consensus heparin binding site essential for DARC binding. Both HIV-1 and P. vivax can be blocked from binding to their chemokine receptors by the chemokine, RANTES and its analog AOP-RANTES. Site directed mutagenesis of the heparin binding motif in members of the DBP family, the P. knowlesi alpha, beta and gamma proteins abrogated their binding to erythrocytes. Positively charged residues within domain 1 are required for binding of P. vivax and P. knowlesi erythrocyte binding proteins. Conclusion A heparin binding site motif in members of the DBP family may form part of a conserved erythrocyte receptor binding pocket.

Human T-lymphotropic virus type 1 Tax protein complexes with P-TEFb and competes for Brd4 and 7SK snRNP/HEXIM1 binding.

Science.gov (United States)

Cho, Won-Kyung; Jang, Moon Kyoo; Huang, Keven; Pise-Masison, Cynthia A; Brady, John N

2010-12-01

Positive transcription elongation factor b (P-TEFb) plays an important role in stimulating RNA polymerase II elongation for viral and cellular gene expression. P-TEFb is found in cells in either an active, low-molecular-weight (LMW) form or an inactive, high-molecular-weight (HMW) form. We report here that human T-lymphotropic virus type 1 (HTLV-1) Tax interacts with the cyclin T1 subunit of P-TEFb, forming a distinct Tax/P-TEFb LMW complex. We demonstrate that Tax can play a role in regulating the amount of HMW complex present in the cell by decreasing the binding of 7SK snRNP/HEXIM1 to P-TEFb. This is seen both in vitro using purified Tax protein and in vivo in cells transduced with Tax expression constructs. Further, we find that a peptide of cyclin T1 spanning the Tax binding domain inhibits the ability of Tax to disrupt HMW P-TEFb complexes. These results suggest that the direct interaction of Tax with cyclin T1 can dissociate P-TEFb from the P-TEFb/7SK snRNP/HEXIM1 complex for activation of the viral long terminal repeat (LTR). We also show that Tax competes with Brd4 for P-TEFb binding. Chromatin immunoprecipitation (ChIP) assays demonstrated that Brd4 and P-TEFb are associated with the basal HTLV-1 LTR, while Tax and P-TEFb are associated with the activated template. Furthermore, the knockdown of Brd4 by small interfering RNA (siRNA) activates the HTLV-1 LTR promoter, which results in an increase in viral expression and production. Our studies have identified Tax as a regulator of P-TEFb that is capable of affecting the balance between its association with the large inactive complex and the small active complex.

Rap Music Literacy: A Case Study of Millennial Audience Reception to Rap Lyrics Depicting Independent Women

Science.gov (United States)

Moody-Ramirez, Mia; Scott, Lakia M.

2015-01-01

Using a feminist lens and a constructivist approach as the theoretical framework, we used rap lyrics and videos to help college students explore mass media's representation of the "independent" Black woman and the concept of "independence" in general. Students must be able to formulate their own concept of independence to…

P-shell hyperon binding energies

International Nuclear Information System (INIS)

Koetsier, D.; Amos, K.

1991-01-01

A shell model for lambda hypernuclei has been used to determine the binding energy of the hyperon in nuclei throughout the p shell. Conventional (Cohen and Kurath) potential energies for nucleon-nucleon interactions were used with hyperon-nucleon interactions taken from Nijmegen one boson exchange potentials. The hyperon binding energies calculated from these potentials compare well with measured values. 7 refs., 2 figs

O rap radical e a "nova classe média"

Directory of Open Access Journals (Sweden)

Ricardo Indig Teperman

2015-04-01

Full Text Available Este artigo discute a recente alteração na posição relativa do rap e dos rappers no campo da produção cultural no Brasil. O grupo Racionais MCs, tão central no campo do rap nacional que acaba por determinar a tendência hegemônica do gênero, vem se afastando do posicionamento revolucionário que marcou seus primeiros anos. Proponho que o aumento do poder de consumo e a democratização do acesso à tecnologia e à educação são aspectos que marcam a experiência da nova geração do rap (a chamada "nova escola", personificada em Emicida, e que provocaram o reposicionamento do Racionais. Recupero uma formulação de Antonio Candido para propor que essa nova posição pode ser considerada "radical".

External radiation monitoring in TAPS and RAPS environs (1980-81) using TLD

International Nuclear Information System (INIS)

Basu, A.S.; Nambi, K.S.V.; Sunta, C.M.

1983-01-01

Results of environmental external radiation monitoring using quarterly integrated TLD measurements are presented for environments of the Tarapur Atomic Power Station (TAPS) and the Rajasthan Atomic Power Station (RAPS) for the two year monitoring period (1980-81). The data fit into the unimodal log-normal distribution except for locations where gaseous radioactivity escaping from the plant makes a significant contribution. The average natural radiation background in TAPS and RAPS environment is estimated to be 59.6 +- 4.7 mR yr -1 and 65.1 +- 9.8 mR yr -1 respectively. Contribution from the plant superimposed over the natural level leads frequently to bi-normal distribution. The effect of stack-released gaseous radioactivity is seen in locations within 1.6 km of TAPS: for example Ghivoli village registered an excess of 9.3 mR yr -1 over the natural background. The quarterly background values indicate minor temporal and spatial variations which can be attributed to changes in natural as well as stack released radioactivity. (author)

A Histidine pH sensor regulates activation of the Ras-specific guanine nucleotide exchange factor RasGRP1.

Science.gov (United States)

Vercoulen, Yvonne; Kondo, Yasushi; Iwig, Jeffrey S; Janssen, Axel B; White, Katharine A; Amini, Mojtaba; Barber, Diane L; Kuriyan, John; Roose, Jeroen P

2017-09-27

RasGRPs are guanine nucleotide exchange factors that are specific for Ras or Rap, and are important regulators of cellular signaling. Aberrant expression or mutation of RasGRPs results in disease. An analysis of RasGRP1 SNP variants led to the conclusion that the charge of His 212 in RasGRP1 alters signaling activity and plasma membrane recruitment, indicating that His 212 is a pH sensor that alters the balance between the inactive and active forms of RasGRP1. To understand the structural basis for this effect we compared the structure of autoinhibited RasGRP1, determined previously, to those of active RasGRP4:H-Ras and RasGRP2:Rap1b complexes. The transition from the autoinhibited to the active form of RasGRP1 involves the rearrangement of an inter-domain linker that displaces inhibitory inter-domain interactions. His 212 is located at the fulcrum of these conformational changes, and structural features in its vicinity are consistent with its function as a pH-dependent switch.

Structural and functional analysis of cyclin D1 reveals p27 and substrate inhibitor binding requirements.

Science.gov (United States)

Liu, Shu; Bolger, Joshua K; Kirkland, Lindsay O; Premnath, Padmavathy N; McInnes, Campbell

2010-12-17

An alternative strategy for inhibition of the cyclin dependent kinases (CDKs) in antitumor drug discovery is afforded through the substrate recruitment site on the cyclin positive regulatory subunit. Critical CDK substrates such as the Rb and E2F families must undergo cyclin groove binding before phosphorylation, and hence inhibitors of this interaction also block substrate specific kinase activity. This approach offers the potential to generate highly selective and cell cycle specific CDK inhibitors and to reduce the inhibition of transcription mediated through CDK7 and 9, commonly observed with ATP competitive compounds. While highly potent peptide and small molecule inhibitors of CDK2/cyclin A, E substrate recruitment have been reported, little information has been generated on the determinants of inhibitor binding to the cyclin groove of the CDK4/cyclin D1 complex. CDK4/cyclin D is a validated anticancer drug target and continues to be widely pursued in the development of new therapeutics based on cell cycle blockade. We have therefore investigated the structural basis for peptide binding to its cyclin groove and have examined the features contributing to potency and selectivity of inhibitors. Peptidic inhibitors of CDK4/cyclin D of pRb phosphorylation have been synthesized, and their complexes with CDK4/cyclin D1 crystal structures have been generated. Based on available structural information, comparisons of the cyclin grooves of cyclin A2 and D1 are presented and provide insights into the determinants for peptide binding and the basis for differential binding and inhibition. In addition, a complex structure has been generated in order to model the interactions of the CDKI, p27(KIP)¹, with cyclin D1. This information has been used to shed light onto the endogenous inhibition of CDK4 and also to identify unique aspects of cyclin D1 that can be exploited in the design of cyclin groove based CDK inhibitors. Peptidic and nonpeptidic compounds have been

Expression, purification, crystallization and structure of human adipocyte lipid-binding protein (aP2)

International Nuclear Information System (INIS)

Marr, Eric; Tardie, Mark; Carty, Maynard; Brown Phillips, Tracy; Wang, Ing-Kae; Soeller, Walt; Qiu, Xiayang; Karam, George

2006-01-01

The crystal structure of human adipocyte lipid-binding protein (aP2) with a bound palmitate is reported at 1.5 Å resolution. Human adipocyte lipid-binding protein (aP2) belongs to a family of intracellular lipid-binding proteins involved in the transport and storage of lipids. Here, the crystal structure of human aP2 with a bound palmitate is described at 1.5 Å resolution. Unlike the known crystal structure of murine aP2 in complex with palmitate, this structure shows that the fatty acid is in a folded conformation and that the loop containing Phe57 acts as a lid to regulate ligand binding by excluding solvent exposure to the central binding cavity

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects.

Science.gov (United States)

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-06-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L) of 192% over wild type (1.3 g/L). The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement.

Lipotoxicity induces hepatic protein inclusions through TBK1-mediated p62/SQSTM1 phosphorylation.

Science.gov (United States)

Cho, Chun-Seok; Park, Hwan-Woo; Ho, Allison; Semple, Ian A; Kim, Boyoung; Jang, Insook; Park, Haeli; Reilly, Shannon; Saltiel, Alan R; Lee, Jun Hee

2017-12-18

Obesity commonly leads to hepatic steatosis, which often provokes lipotoxic injuries to hepatocytes that cause non-alcoholic steatohepatitis (NASH). NASH in turn is associated with the accumulation of insoluble protein aggregates that are composed of ubiquitinated proteins and ubiquitin adaptor p62/sequestosome 1 (SQSTM1). The formation of p62 inclusions in hepatocytes is the critical marker that distinguishes simple fatty liver from NASH and predicts a poor prognostic outcome for subsequent liver carcinogenesis. However, the molecular mechanism by which lipotoxicity induces protein aggregation is currently unknown. Here we show that upon saturated fatty acid-induced lipotoxicity, Tank-binding protein kinase 1 (TBK1) is activated and phosphorylates p62. The TBK1-mediated p62 phosphorylation is important for lipotoxicity-induced aggregation of ubiquitinated proteins and the formation of large protein inclusions in hepatocytes. In addition, cyclic GMP-AMP synthase (cGAS) and stimulator of interferon genes (STING), upstream regulators of TBK1, are involved in the lipotoxic activation of TBK1 and subsequent p62 phosphorylation in hepatocytes. Furthermore, TBK1 inhibition prevented formation of the ubiquitin-p62 aggregates, not only in cultured hepatocytes, but also in mouse models of obesity and NASH. These results suggest that lipotoxic activation of TBK1 and subsequent p62 phosphorylation are critical steps in the NASH pathology of protein inclusion accumulation in hepatocytes. This mechanism can provide an explanation for how hypernutrition and obesity promote the development of severe liver pathologies, such as steatohepatitis and liver cancer, by facilitating the formation of p62 inclusions. This article is protected by copyright. All rights reserved. © 2017 by the American Association for the Study of Liver Diseases.

Configuration interaction calculations of positron binding to Be(3P )

International Nuclear Information System (INIS)

Bromley, M.W.J.; Mitroy, J.

2006-01-01

The configuration interaction method is applied to investigate the possibility of positron binding to the metastable beryllium (1s 2 2s2p 3 P ) state. The largest calculation obtained an estimated energy that was unstable by 0.00014 Hartree with respect to the Ps + Be + (2s) lowest dissociation channel. It is likely that positron binding to parent states with non-zero angular momentum is inhibited by centrifugal barriers

Changes in the prevalence of alcohol in rap music lyrics 1979-2009.

Science.gov (United States)

Herd, Denise

2014-02-01

This study examines the prevalence and context of alcohol references in rap music lyrics from 1979 through 2009. Four hundred nine top-ranked rap music songs released were sampled from Billboard magazine rating charts. Songs were analyzed using systematic content analysis and were coded for alcohol beverage types and brand names, drinking behaviors, drinking contexts, attitudes towards alcohol, and consequences of drinking. Trends were analyzed using regression analyses. The results of the study reveal significant increases in the presence of alcohol in rap songs; a decline in negative attitudes towards alcohol; decreases in consequences attributed to alcohol; increases in the association of alcohol with glamour and wealth, drugs, and nightclubs; and increases in references to liquor and champagne.

Loss of the xeroderma pigmentosum group B protein binding site impairs p210 BCR/ABL1 leukemogenic activity

International Nuclear Information System (INIS)

Pannucci, N L; Li, D; Sahay, S; Thomas, E K; Chen, R; Tala, I; Hu, T; Ciccarelli, B T; Megjugorac, N J; Adams III, H C; Rodriguez, P L; Fitzpatrick, E R; Lagunoff, D; Williams, D A; Whitehead, I P

2013-01-01

Previous studies have demonstrated that p210 BCR/ABL1 interacts directly with the xeroderma pigmentosum group B (XPB) protein, and that XPB is phosphorylated on tyrosine in cells that express p210 BCR/ABL1. In the current study, we have constructed a p210 BCR/ABL1 mutant that can no longer bind to XPB. The mutant has normal kinase activity and interacts with GRB2, but can no longer phosphorylate XPB. Loss of XPB binding is associated with reduced expression of c-MYC and reduced transforming potential in ex-vivo clonogenicity assays, but does not affect nucleotide excision repair in lymphoid or myeloid cells. When examined in a bone marrow transplantation (BMT) model for chronic myelogenous leukemia, mice that express the mutant exhibit attenuated myeloproliferation and lymphoproliferation when compared with mice that express unmodified p210 BCR/ABL1. Thus, the mutant-transplanted mice show predominantly neutrophilic expansion and altered progenitor expansion, and have significantly extended lifespans. This was confirmed in a BMT model for B-cell acute lymphoblastic leukemia, wherein the majority of the mutant-transplanted mice remain disease free. These results suggest that the interaction between p210 BCR/ABL1 and XPB can contribute to disease progression by influencing the lineage commitment of lymphoid and myeloid progenitors

Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus.

Science.gov (United States)

Mutso, Margit; Morro, Ainhoa Moliner; Smedberg, Cecilia; Kasvandik, Sergo; Aquilimeba, Muriel; Teppor, Mona; Tarve, Liisi; Lulla, Aleksei; Lulla, Valeria; Saul, Sirle; Thaa, Bastian; McInerney, Gerald M; Merits, Andres; Varjak, Margus

2018-04-27

Infection by Chikungunya virus (CHIKV) of the Old World alphaviruses (family Togaviridae) in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP) (nsP1, nsp2, nsP3 and nsP4) that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD) of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV) harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

Glucose 6P binds and activates HlyIIR to repress Bacillus cereus haemolysin hlyII gene expression.

Directory of Open Access Journals (Sweden)

Elisabeth Guillemet

Full Text Available Bacillus cereus is a Gram-positive spore-forming bacterium causing food poisoning and serious opportunistic infections. These infections are characterized by bacterial accumulation despite the recruitment of phagocytic cells. We have previously shown that B. cereus Haemolysin II (HlyII induces macrophage cell death by apoptosis. In this work, we investigated the regulation of the hlyII gene. We show that HlyIIR, the negative regulator of hlyII expression in B. cereus, is especially active during the early bacterial growth phase. We demonstrate that glucose 6P directly binds to HlyIIR and enhances its activity at a post-transcriptional level. Glucose 6P activates HlyIIR, increasing its capacity to bind to its DNA-box located upstream of the hlyII gene, inhibiting its expression. Thus, hlyII expression is modulated by the availability of glucose. As HlyII induces haemocyte and macrophage death, two cell types that play a role in the sequestration of nutrients upon infection, HlyII may induce host cell death to allow the bacteria to gain access to carbon sources that are essential components for bacterial growth.

Analysis of the usage of rubberized asphalt in hot mix asphalt using Reclaimed Asphalt Pavement (RAP)

Science.gov (United States)

Dwidarma Nataadmadja, Adelia; Prahara, Eduardi; Sumbung, Pierre Christian

2017-12-01

There has been an increasing demand in using more environmentally friendly materials in pavement construction. One of the alternative materials that have been widely used is the Reclaimed Asphalt Pavement (RAP) aggregates. The RAP aggregates are derived from the crushed and screened pavement materials that contain asphalt and aggregates. This material is usually combined with natural aggregates and virgin asphalt binder to construct a new pavement. There have been numerous positive feedbacks in using this material although RAP aggregates also have certain weaknesses, such as questionable interaction between virgin and recycled materials and increased stiffness of RAP binder. Moreover, there has been a push on using rubber as an additive to asphalt binder to improve the welfare of rubber farmers. This research combines the usage of both latex and RAP as the ingredients to design hot mix asphalt (HMA) as latex could help in improving the flexibility of HMA and the interaction between the virgin and recycled materials. The main objective of this research is to find a suitable percentage of RAP aggregates to be used in HMA with certain percentage of latex as the binder additive.

Binding of complement proteins C1q and C4bp to serum amyloid P component (SAP) in solid contra liquid phase

DEFF Research Database (Denmark)

Sørensen, Inge Juul; Nielsen, EH; Andersen, Ove

1996-01-01

Serum amyloid P component (SAP), a member of the conserved pentraxin family of plasma proteins, binds calcium dependently to its ligands. The authors investigated SAPs interaction with the complement proteins C4b binding protein (C4bp) and C1q by ELISA, immunoelectrophoresis and electron microscopy....... Binding of these proteins to SAP was demonstrated when SAP was immobilized using F(ab')2 anti-SAP, but not when SAP reacted with these proteins in liquid phase; thus the binding to human SAP was markedly phase state dependent. Presaturation of solid phase SAP with heparin, which binds SAP with high...... affinity, did not interfere with the subsequent binding of C4bp or C1q to SAP. In contrast, collagen I and IV showed partial competition with the binding of C1q to SAP. Using fresh serum, immobilized native SAP bound C4bp whereas binding of C1q/C1 could not be demonstrated. Altogether the results indicate...

Binding of influenza A virus NS1 protein to the inter-SH2 domain of p85 suggests a novel mechanism for phosphoinositide 3-kinase activation.

Science.gov (United States)

Hale, Benjamin G; Batty, Ian H; Downes, C Peter; Randall, Richard E

2008-01-18

Influenza A virus NS1 protein stimulates host-cell phosphoinositide 3-kinase (PI3K) signaling by binding to the p85beta regulatory subunit of PI3K. Here, in an attempt to establish a mechanism for this activation, we report further on the functional interaction between NS1 and p85beta. Complex formation was found to be independent of NS1 RNA binding activity and is mediated by the C-terminal effector domain of NS1. Intriguingly, the primary direct binding site for NS1 on p85beta is the inter-SH2 domain, a coiled-coil structure that acts as a scaffold for the p110 catalytic subunit of PI3K. In vitro kinase activity assays, together with protein binding competition studies, reveal that NS1 does not displace p110 from the inter-SH2 domain, and indicate that NS1 can form an active heterotrimeric complex with PI3K. In addition, it was established that residues at the C terminus of the inter-SH2 domain are essential for mediating the interaction between p85beta and NS1. Equivalent residues in p85alpha have previously been implicated in the basal inhibition of p110. However, such p85alpha residues were unable to substitute for those in p85beta with regards NS1 binding. Overall, these data suggest a model by which NS1 activates PI3K catalytic activity by masking a normal regulatory element specific to the p85beta inter-SH2 domain.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

Science.gov (United States)

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Thermodynamics between RAP/RAS and virgin aggregates during asphalt concrete production : a literature review.

Science.gov (United States)

2015-09-01

In hot-mix asphalt (HMA) plants, virgin aggregates are heated and dried separately before being mixed with : RAP/RAS and virgin asphalt binder. RAP/RAS materials are not heated or dried directly by a burner to avoid : burning of aged binder coating o...

Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus

Directory of Open Access Journals (Sweden)

Margit Mutso

2018-04-01

Full Text Available Infection by Chikungunya virus (CHIKV of the Old World alphaviruses (family Togaviridae in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP (nsP1, nsp2, nsP3 and nsP4 that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

Directory of Open Access Journals (Sweden)

Ana Maria Salazar-Bryam

2017-06-01

Full Text Available This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1 was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L of 192% over wild type (1.3 g/L. The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement. Keywords: Biotechnology, Microbiology

End-joining inhibition at telomeres requires the translocase and polySUMO-dependent ubiquitin ligase Uls1.

Science.gov (United States)

Lescasse, Rachel; Pobiega, Sabrina; Callebaut, Isabelle; Marcand, Stéphane

2013-03-20

In eukaryotes, permanent inhibition of the non-homologous end joining (NHEJ) repair pathway at telomeres ensures that chromosome ends do not fuse. In budding yeast, binding of Rap1 to telomere repeats establishes NHEJ inhibition. Here, we show that the Uls1 protein is required for the maintenance of NHEJ inhibition at telomeres. Uls1 protein is a non-essential Swi2/Snf2-related translocase and a Small Ubiquitin-related Modifier (SUMO)-Targeted Ubiquitin Ligase (STUbL) with unknown targets. Loss of Uls1 results in telomere-telomere fusions. Uls1 requirement is alleviated by the absence of poly-SUMO chains and by rap1 alleles lacking SUMOylation sites. Furthermore, Uls1 limits the accumulation of Rap1 poly-SUMO conjugates. We propose that one of Uls1 functions is to clear non-functional poly-SUMOylated Rap1 molecules from telomeres to ensure the continuous efficiency of NHEJ inhibition. Since Uls1 is the only known STUbL with a translocase activity, it can be the general molecular sweeper for the clearance of poly-SUMOylated proteins on DNA in eukaryotes.

RNA-binding properties and RNA chaperone activity of human peroxiredoxin 1

International Nuclear Information System (INIS)

Kim, Ji-Hee; Lee, Jeong-Mi; Lee, Hae Na; Kim, Eun-Kyung; Ha, Bin; Ahn, Sung-Min; Jang, Ho Hee; Lee, Sang Yeol

2012-01-01

Highlights: ► hPrx1 has RNA-binding properties. ► hPrx1 exhibits helix-destabilizing activity. ► Cold stress increases hPrx1 level in the nuclear fraction. ► hPrx1 enhances the viability of cells exposed to cold stress. -- Abstract: Human peroxiredoxin 1 (hPrx1), a member of the peroxiredoxin family, detoxifies peroxide substrates and has been implicated in numerous biological processes, including cell growth, proliferation, differentiation, apoptosis, and redox signaling. To date, Prx1 has not been implicated in RNA metabolism. Here, we investigated the ability of hPrx1 to bind RNA and act as an RNA chaperone. In vitro, hPrx1 bound to RNA and DNA, and unwound nucleic acid duplexes. hPrx1 also acted as a transcription anti-terminator in an assay using an Escherichia coli strain containing a stem–loop structure upstream of the chloramphenicol resistance gene. The overall cellular level of hPrx1 expression was not increased at low temperatures, but the nuclear level of hPrx1 was increased. In addition, hPrx1 overexpression enhanced the survival of cells exposed to cold stress, whereas hPrx1 knockdown significantly reduced cell survival under the same conditions. These findings suggest that hPrx1 may perform biological functions as a RNA-binding protein, which are distinctive from known functions of hPrx1 as a reactive oxygen species scavenger.

Differential expression of upstream stimulatory factor (USF 2 variants in eutopic endometria from women with endometriosis: estradiol regulation

Directory of Open Access Journals (Sweden)

Jazmin Castro

2015-01-01

Full Text Available BACKGROUND: Endometriosis, pro-inflammatory and invasive benign disease estrogen dependent, abnormally express in endometria the enzyme P450Arom, positively regulated by steroid factor-1 (SF-1. Our objective was to study the nuclear protein contents of upstream stimulating factor 2 (USF2a and USF2b, a positive regulator of SF-1, throughout the menstrual cycle in eutopic endometria from women with and without (control endometriosis and the involvement of nuclear estrogen receptors (ER and G-coupled protein estrogen receptor (GPER-1 RESULTS: Upstream stimulating factor 2 protein contents were higher in mid (USF2b and late (USF2a and USF2b secretory phase in eutopic endometria from endometriosis than control (p < 0.05. In isolated control epithelial cells incubated with E2 and PGE2, to resemble the endometriosis condition, the data showed: (a significant increase of USF2a and USF2b nuclear protein contents when treated with E2, PPT (specific agonist for ERa or G1 (specific agonist for GPER1; (b no increase in USF2 binding to SF-1 E-Box/DNA consensus sequence in E2-treated cells; (c USF2 variants protein contents were not modified by PGE2; (d SF-1 nuclear protein content was significantly higher than basal when treated with PGE2, E2 or G1, stimulation unaffected by ICI (nuclear ER antagonist; and (e increased (p < 0.05 cytosolic protein contents of P450Arom when treated with PGE2, E2, PPT or G1 compared to basal, effect that was additive with E2 + PGE2 together. Nevertheless, in endometriosis cells, the high USF2, SF-1 and P450Arom protein contents in basal condition were unmodified CONCLUSION: These data strongly suggest that USF2 variants and P450Arom are regulated by E2 through ERa and GPER1, whereas SF-1 through GPER1, visualized by the response of the cells obtained from control endometria, being unaffected the endogenously stimulated cells from endometriosis origin. The lack of E2 stimulation on USF2/SF-1 E-Box/DNA-sequence binding and the

From Rage to Rap and Prison to Print:

Directory of Open Access Journals (Sweden)

Josephine Metcalf

2009-11-01

Full Text Available 1. IntroductionBy the late 1980s, while thousands of former gang members were either dead or incarcerated, their legacy and the gang subculture was being celebrated and commodified through gangsta rap music and videos, film and fashion. In the early 1990s this lucrative cultural trend sparked interest from potential authors and publishers. Such literary attention was partially fuelled by a public fascination with life in the ghettos following the 1992 Los Angeles (LA riots, resulting in a ne...

Catalytic transitions in the human MDR1 P-glycoprotein drug binding sites.

Science.gov (United States)

Wise, John G

2012-06-26

Multidrug resistance proteins that belong to the ATP-binding cassette family like the human P-glycoprotein (ABCB1 or Pgp) are responsible for many failed cancer and antiviral chemotherapies because these membrane transporters remove the chemotherapeutics from the targeted cells. Understanding the details of the catalytic mechanism of Pgp is therefore critical to the development of inhibitors that might overcome these resistances. In this work, targeted molecular dynamics techniques were used to elucidate catalytically relevant structures of Pgp. Crystal structures of homologues in four different conformations were used as intermediate targets in the dynamics simulations. Transitions from conformations that were wide open to the cytoplasm to transition state conformations that were wide open to the extracellular space were studied. Twenty-six nonredundant transitional protein structures were identified from these targeted molecular dynamics simulations using evolutionary structure analyses. Coupled movement of nucleotide binding domains (NBDs) and transmembrane domains (TMDs) that form the drug binding cavities were observed. Pronounced twisting of the NBDs as they approached each other as well as the quantification of a dramatic opening of the TMDs to the extracellular space as the ATP hydrolysis transition state was reached were observed. Docking interactions of 21 known transport ligands or inhibitors were analyzed with each of the 26 transitional structures. Many of the docking results obtained here were validated by previously published biochemical determinations. As the ATP hydrolysis transition state was approached, drug docking in the extracellular half of the transmembrane domains seemed to be destabilized as transport ligand exit gates opened to the extracellular space.

Localization of substance P binding sites in submucous plexus of guinea pig ileum, using whole-mount autoradiography

International Nuclear Information System (INIS)

Burcher, E.; Bornstein, J.C.

1988-01-01

Whole mounts of guinea pig ileum submucosa were incubated with radiolabeled tachykinins, and binding sites were visualized using autoradiography. Very dense specific binding for [ 125 I]-Bolton-Hunter substance P (BHSP) was observed over ganglia of the submucous plexus, with weaker binding over internodal strands. Dense specific binding was also seen over occasional strands of circular muscle, with weak binding over clumps of mucosa. Although very weak binding was seen over some large blood vessels, no binding was associated with smaller blood vessels. Localization of binding was absent in whole-mounts coincubated with 1 microM substance P, used to define nonspecific binding. Localization of BHSP-specific binding was also abolished in whole-mounts coincubated with 1 nM substance P, but not with 1 nM neurokinin B, suggesting that binding was probably to an NK-1 tachykinin receptor. In whole-mounts incubated in [ 125 I]-iodohistidyl neurokinin A (INKA) or [ 125 I]-Bolton-Hunter neurokinin B (BHNKB), no specific binding over ganglia was observed. These binding sites for BHSP are probably identical with the neuronal substance P receptors mediating mucosal ion transport

Two rare deletions upstream of the NRXN1 gene (2p16.3) affecting the non-coding mRNA AK127244 segregate with diverse psychopathological phenotypes in a family

DEFF Research Database (Denmark)

Duong, L. T. T.; Hoeffding, L. K.; Petersen, K. B.

2015-01-01

127244 in addition to the pathogenic 15q11.2 deletion in distinct family members. The two deletions upstream of the NRXN1 gene were found to segregate with psychiatric disorders in the family and further similar deletions have been observed in patients diagnosed with autism spectrum disorder. Thus, we...... susceptibility. In this study, we describe a family affected by a wide range of psychiatric disorders including early onset schizophrenia, schizophreniform disorder, and affective disorders. Microarray analysis identified two rare deletions immediately upstream of the NRXN1 gene affecting the non-coding mRNA AK...... suggest that non-coding regions upstream of the NRXN1 gene affecting AK127244 might (as NRXN1) contain susceptibility regions for a wide spectrum of neuropsychiatric disorders. (C) 2015 Elsevier Masson SAS. All rights reserved....

NF-κB suppresses HIF-1α response by competing for P300 binding

International Nuclear Information System (INIS)

Mendonca, Daniela B.S.; Mendonca, Gustavo; Aragao, Francisco J.L.; Cooper, Lyndon F.

2011-01-01

Research highlights: → p65 completely blocked HIF-1α activity at the HRE on different cell lines. → p65 caused minor changes in HIF-1α and HIF-1α target genes mRNA expression. → p65 reduced transcription of VEGF promoter. → p65 competes with HIF-1α for p300. -- Abstract: Hypoxia has emerged as a key determinant of osteogenesis. HIF-1α is the transcription factor mediating hypoxia responses that include induction of VEGF and related bone induction. Inflammatory signals antagonize bone repair via the NF-κB pathway. The present investigation explored the functional relationship of hypoxia (HIF-1α function) and inflammatory signaling (NF-κB) in stem like and osteoprogenitor cell lines. The potential interaction between HIF-1α and NF-κB signaling was explored by co-transfection studies in hFOB with p65, HIF-1α and 9x-HRE-luc or HIF-1α target genes reporter plasmids. Nuclear cross-talk was directly tested using the mammalian Gal4/VP16 two-hybrid, and confirmed by co-immunoprecipitation/western blotting assays. The results show that inflammatory stimulation (TNF-α treatment) causes a marked inhibition of HIF-1α function at the HRE in all cell lines studied. Also, co-transfection with p65 expression vector leads to reduced hVEGFp transcription after DFO-induced hypoxia. However, TNF-α treatment had little effect on HIF-1α mRNA levels. The functional interaction of Gal4-HIF-1α and VP16-p300 fusion proteins is effectively blocked by expression of p65 in a dose dependent manner. It was concluded that NF-κB-mediated inflammatory signaling is able to block HIF-1α transactivation at HRE-encoding genes by direct competition for p300 binding at the promoter. Inflammation may influence the stem cell niche and tissue regeneration by influencing cellular responses to hypoxia.

Changes in the prevalence of alcohol use in rap song lyrics, 1979-97.

Science.gov (United States)

Herd, Denise

2005-09-01

This paper explores the role of changing images of drinking and alcoholic beverage use in rap music from its beginnings in the United States in the late 1970s to the late 1990s. A sample of 341 rap music song lyrics released from 1979 to 1997 were selected using Billboard and Gavin rating charts. Song lyrics were coded for music genres, alcohol beverage types and brand names, drinking behaviors, drinking contexts, intoxication, attitudes towards alcohol and consequences of drinking. From 1979 to 1997, songs with references to alcohol increased fivefold (from 8 to 44%); those exhibiting positive attitudes rose from 43% to 73%; and brand name mentions increased from 46% to 71%. There were also significant increases in songs mentioning champagne and liquor (mainly expensive brand names) when comparing songs released after 1994 with those from previous years. In addition, there were significant increases in references to alcohol to signify glamour and wealth, and using alcohol with drugs and for recreational purposes. The findings also showed that alcohol use in rap music was much more likely to result in positive than negative consequences. Many of these findings are consistent with the idea that rap music has been profoundly affected by commercial forces and the marketing of alcoholic beverages. In addition, it is possible that the increase in references to alcoholic beverages in rap music, particularly spirits, is a reflection of a broader advertising culture which increasingly associates African Americans with alcohol use.

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

Metric Ambiguity and Flow in Rap Music: A Corpus-Assisted Study of Outkast's "Mainstream" (1996

Directory of Open Access Journals (Sweden)

Mitchell Ohriner

2017-01-01

Full Text Available Recent years have seen the rise of musical corpus studies, primarily detailing harmonic tendencies of tonal music. This article extends this scholarship by addressing a new genre (rap music and a new parameter of focus (rhythm. More specifically, I use corpus methods to investigate the relation between metric ambivalence in the instrumental parts of a rap track (i.e., the beat and an emcee's rap delivery (i.e., the flow. Unlike virtually every other rap track, the instrumental tracks of Outkast's "Mainstream" (1996 simultaneously afford hearing both a four-beat and a three-beat metric cycle. Because three-beat durations between rhymes, phrase endings, and reiterated rhythmic patterns are rare in rap music, an abundance of them within a verse of "Mainstream" suggests that an emcee highlights the three-beat cycle, especially if that emcee is not prone to such durations more generally. Through the construction of three corpora, one representative of the genre as a whole, and two that are artist specific, I show how the emcee T-Mo Goodie's expressive practice highlights the rare three-beat affordances of the track.

The role of upstream sequences in selecting the reading frame on tmRNA

Directory of Open Access Journals (Sweden)

Dewey Jonathan D

2008-06-01

Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

Determination of usable residual asphalt binder in RAP.

Science.gov (United States)

2009-01-01

For current recycled mix designs, the Illinois Department of Transportation (IDOT) assumes 100% contribution of : working binder from Recycled Asphalt Pavement (RAP) materials when added to Hot Mix Asphalt (HMA). However, it is : unclear if this assu...

A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1

International Nuclear Information System (INIS)

Sebastian, J.; Sancar, G.B.

1991-01-01

The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

Science.gov (United States)

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

The relationship between transcription initiation RNAs and CCCTC-binding factor (CTCF localization

Directory of Open Access Journals (Sweden)

Taft Ryan J

2011-08-01

Full Text Available Abstract Background Transcription initiation RNAs (tiRNAs are nuclear localized 18 nucleotide RNAs derived from sequences immediately downstream of RNA polymerase II (RNAPII transcription start sites. Previous reports have shown that tiRNAs are intimately correlated with gene expression, RNA polymerase II binding and behaviors, and epigenetic marks associated with transcription initiation, but not elongation. Results In the present work, we show that tiRNAs are commonly found at genomic CCCTC-binding factor (CTCF binding sites in human and mouse, and that CTCF sites that colocalize with RNAPII are highly enriched for tiRNAs. To directly investigate the relationship between tiRNAs and CTCF we examined tiRNAs originating near the intronic CTCF binding site in the human tumor suppressor gene, p21 (cyclin-dependent kinase inhibitor 1A gene, also known as CDKN1A. Inhibition of CTCF-proximal tiRNAs resulted in increased CTCF localization and increased p21 expression, while overexpression of CTCF-proximal tiRNA mimics decreased CTCF localization and p21 expression. We also found that tiRNA-regulated CTCF binding influences the levels of trimethylated H3K27 at the alternate upstream p21 promoter, and affects the levels of alternate p21 (p21alt transcripts. Extending these studies to another randomly selected locus with conserved CTCF binding we found that depletion of tiRNA alters nucleosome density proximal to sites of tiRNA biogenesis. Conclusions Taken together, these data suggest that tiRNAs modulate local epigenetic structure, which in turn regulates CTCF localization.

RAP2.4a Is Transported through the Phloem to Regulate Cold and Heat Tolerance in Papaya Tree (Carica papaya cv. Maradol: Implications for Protection Against Abiotic Stress.

Directory of Open Access Journals (Sweden)

Luis Figueroa-Yañez

Full Text Available Plants respond to stress through metabolic and morphological changes that increase their ability to survive and grow. To this end, several transcription factor families are responsible for transmitting the signals that are required for these changes. Here, we studied the transcription factor superfamily AP2/ERF, particularly, RAP2.4 from Carica papaya cv. Maradol. We isolated four genes (CpRap2.4a, CpRAap2.4b, CpRap2.1 and CpRap2.10, and an in silico analysis showed that the four genes encode proteins that contain a conserved APETALA2 (AP2 domain located within group I and II transcription factors of the AP2/ERF superfamily. Semiquantitative PCR experiments indicated that each CpRap2 gene is differentially expressed under stress conditions, such as extreme temperatures. Moreover, genetic transformants of tobacco plants overexpressing CpRap2.4a and CpRap2.4b genes show a high level of tolerance to cold and heat stress compared to non-transformed plants. Confocal microscopy analysis of tobacco transgenic plants showed that CpRAP2.4a and CpRAP2.4b proteins were mainly localized to the nuclei of cells from the leaves and roots and also in the sieve elements. Moreover, the movement of CpRap2.4a RNA in tobacco grafting was analyzed. Our results indicate that CpRap2.4a and CpRap2.4b RNA in the papaya tree have a functional role in the response to stress conditions such as exposure to extreme temperatures via direct translation outside the parental RNA cell.

O rap dos Racionais MC\\'s em sala de aula como via de emancipação de jovens na periferia de São Paulo: análises de oficinas musicais com ênfase no rap

OpenAIRE

Raquel Mendonça Martins

2015-01-01

A presente dissertação de mestrado teve o propósito de pesquisar em que medida a estética multifacetada do rap pode ser utilizada nos processos de formação de adolescentes pobres e moradores das periferias, em sua maioria, afrodescendentes. Ao identificar no rap um potencial de ruptura e de resistência frente às formas atuais de discriminação racial - tanto em seus aspectos musicais, quanto narrativos - foram realizadas oficinas de música com ênfase no rap, envolvendo jovens entre treze e qui...

Configuration interaction calculations of positron binding to Be({sup 3}P )

Energy Technology Data Exchange (ETDEWEB)

Bromley, M.W.J. [Department of Physics, San Diego State University, San Diego, CA 92182 (United States)]. E-mail: mbromley@physics.sdsu.edu; Mitroy, J. [Faculty of Technology, Charles Darwin University, Darwin, NT 0909 (Australia)]. E-mail: jxm107@rsphysse.anu.edu.au

2006-06-15

The configuration interaction method is applied to investigate the possibility of positron binding to the metastable beryllium (1s{sup 2}2s2p {sup 3}P ) state. The largest calculation obtained an estimated energy that was unstable by 0.00014 Hartree with respect to the Ps + Be{sup +}(2s) lowest dissociation channel. It is likely that positron binding to parent states with non-zero angular momentum is inhibited by centrifugal barriers.

Molecular characterization of a novel human hybrid-type receptor that binds the alpha2-macroglobulin receptor-associated protein

DEFF Research Database (Denmark)

Jacobsen, Linda; Madsen, P; Moestrup, S K

1996-01-01

the corresponding cDNA. The gene, designated SORL1, maps to chromosome 11q 23/24 and encodes a 2214-residue type 1 receptor containing a furin cleavage site immediately preceding the N terminus determined in the purified protein. The receptor, designated sorLA-1, has a short cytoplasmic tail containing a tyrosine...... density lipoprotein receptor gene family receptors, and 3) six tandemly arranged fibronectin type III repeats also found in certain neural adhesion proteins. sorLA-1 may therefore be classified as a hybrid receptor. Northern blotting revealed specific mRNA transcripts in brain, spinal cord, and testis......The 39-40-kDa receptor-associated protein (RAP) binds to the members of the low density lipoprotein receptor gene family and functions as a specialized endoplasmic reticulum/Golgi chaperone. Using RAP affinity chromatography, we have purified a novel approximately 250-kDa brain protein and isolated...

Analysis of the finescale timing of repeated signals: does shell rapping in hermit crabs signal stamina?

Science.gov (United States)

Briffa; Elwood

2000-01-01

Hermit crabs, Pagurus bernhardus, sometimes exchange shells after a period of shell rapping, when the initiating or attacking crab brings its shell rapidly and repeatedly into contact with the shell of the noninitiator or defender in a series of bouts. Bouts are separated by pauses, and raps within bouts are separated by very short periods called 'gaps'. Since within-contest variation is missed when signals are studied by averaging performance rates over entire contests, we analysed the fine within-bout structure of this repeated, aggressive signal. We found that the pattern is consistent with high levels of fatigue in initiators. The duration of the gaps between individual raps increased both within bouts and from bout to bout, and we conclude that this activity is costly to perform. Furthermore, long pauses between bouts is correlated with increased vigour of rapping in the subsequent bout, which suggests that the pause allows for recovery from fatigue induced by rapping. These between-bout pauses may be assessed by noninitiators and provide a signal of stamina. Copyright 2000 The Association for the Study of Animal Behaviour.

Identification and functional analysis of a second RBF-2 binding site within the HIV-1 promoter

International Nuclear Information System (INIS)

Dahabieh, Matthew S.; Ooms, Marcel; Malcolm, Tom; Simon, Viviana; Sadowski, Ivan

2011-01-01

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutations in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

Energy Technology Data Exchange (ETDEWEB)

Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

2011-12-15

We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

Addiction and Lifestyles in Contemporary Europe: Reframing Addictions Project (ALICE RAP). Final Evaluation Report Deliverable 21.1, Work Package 21

OpenAIRE

Mittelmark, Maurice B.

2016-01-01

At the onset of the ALICE RAP project, the following objectives, description of work, and main tasks were agreed for Work Package 21: 1. To evaluate the overall functioning of the collaborative research project, using a state-of-art systems model of partnership functioning. 2. To document the interactions and linkages between project inputs, throughputs and outputs as the project unfolds over five years. 3. To facilitate structured discussions involving all pa...

Different papillomaviruses have different repertoires of transcription factor binding sites: convergence and divergence in the upstream regulatory region

Directory of Open Access Journals (Sweden)

Alonso Ángel

2006-03-01

Full Text Available Abstract Background Papillomaviruses (PVs infect stratified squamous epithelia in warm-blooded vertebrates and have undergone a complex evolutionary process. The control of the expression of the early ORFs in PVs depends on the binding of cellular and viral transcription factors to the upstream regulatory region (URR of the virus. It is believed that there is a core of transcription factor binding sites (TFBS common to all PVs, with additional individual differences, although most of the available information focuses only on a handful of viruses. Results We have studied the URR of sixty-one PVs, covering twenty different hosts. We have predicted the TFBS present in the URR and analysed these results by principal component analysis and genetic algorithms. The number and nature of TFBS in the URR might be much broader than thus far described, and different PVs have different repertoires of TFBS. Conclusion There are common fingerprints in the URR in PVs that infect primates, although the ancestors of these viruses diverged a long time ago. Additionally, there are obvious differences between the URR of alpha and beta PVs, despite these PVs infect similar histological cell types in the same host, i.e. human. A thorough analysis of the TFBS in the URR might provide crucial information about the differential biology of cancer-associated PVs.

Rap-rimas afetivas da periferia: reflexões na perspectiva sócio-histórica Rap-affective rhymes of the periphery: reflections in the social-historical perspective

Directory of Open Access Journals (Sweden)

Jaison Hinkel

2007-01-01

Full Text Available Considerando a dimensão afetiva como constitutiva do agir e do pensar humano, e reconhecendo que sua presença é uma constante no Rap, este artigo busca investigar como a afetividade é expressa nas músicas de quatro grupos de Rap nacional. A partir da análise das músicas, pode-se considerar que estas expressam as vivências advindas de uma ordem social baseada na inclusão social perversa. Há instantes em que a tônica está no sentimento da vergonha, culpa, humilhação, tristeza, revolta e medo que assola os moradores da periferia. Em contrapartida, há propostas de enfrentamento desta condição, expressando a importância da união, irmandade, humildade, esperança, amor, alegria e solidariedade. Assim, nestas canções, a afetividade expressa tanto a denúncia do sofrimento ético-político, como a possibilidade de aumentar a potência de ação do sujeito para a superação da condição de padecimento humano, indicando a música, especialmente o Rap, como temática importante na compreensão psicossocial do sujeito em contextos de exclusão social.Considering the affectionate dimension as the constituent of act and of human thought, and recognizing that his presence is a constant one in the Rap, this article seeks to investigate like the affection is espress in the music of four groups of Rap national. Starting from the analysis of the music, we can consider that these express the resulting experiences of a social order based on the perverse social inclusion. There are instants in that to tonic is in the feeling of the shame, blame, humiliation, sorrow, revolt and fear that devastates the inhabitants of the periphery. In compensation, there is proposals to face of this condition, expressing the importance of the union, fraternity, humility, hope, love, joy and solidarity. Like this, in these songs, the so much express affection the denunciation of the ethical-political suffering, as the possibility of potency the action of the

Understanding TR binding to pMHC complexes: how does a TR scan many pMHC complexes yet preferentially bind to one.

Directory of Open Access Journals (Sweden)

Javed Mohammed Khan

Full Text Available Understanding the basis of the binding of a T cell receptor (TR to the peptide-MHC (pMHC complex is essential due to the vital role it plays in adaptive immune response. We describe the use of computed binding (free energy (BE, TR paratope, pMHC epitope, molecular surface electrostatic potential (MSEP and calculated TR docking angle (θ to analyse 61 TR/pMHC crystallographic structures to comprehend TR/pMHC interaction. In doing so, we have successfully demonstrated a novel/rational approach for θ calculation, obtained a linear correlation between BE and θ without any "codon" or amino acid preference, provided an explanation for TR ability to scan many pMHC ligands yet specifically bind one, proposed a mechanism for pMHC recognition by TR leading to T cell activation and illustrated the importance of the peptide in determining TR specificity, challenging the "germline bias" theory.

Whats the Rap about Ecstasy? Popular Music Lyrics and Drug Trends among American Youth

Science.gov (United States)

Diamond, Sarah; Bermudez, Rey; Schensul, Jean

2006-01-01

Trends in ecstasy use in America during the past decade were reflected in mainstream, American rap-music lyrics between 1996 and 2003. Drawing on communication and cultural studies theory, this article provides a content analysis of 69 rap songs mentioning the club drug ecstasy. The songs are coded according to whether they contain positive, mixed…

Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a ...

Indian Academy of Sciences (India)

RESEARCH ARTICLE. Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a child ... whereby genes are expressed in a parent-of-origin dependent manner. One of the ... lity, neurodevelopmental delay, features of attention deficit hyperactivity .... Received 16 December 2015; accepted 8 January 2016. Unedited ...

Kinase Associated-1 Domains Drive MARK/PAR1 Kinases to Membrane Targets by Binding Acidic Phospholipids

Energy Technology Data Exchange (ETDEWEB)

Moravcevic, Katarina; Mendrola, Jeannine M.; Schmitz, Karl R.; Wang, Yu-Hsiu; Slochower, David; Janmey, Paul A.; Lemmon, Mark A. (UPENN-MED)

2011-09-28

Phospholipid-binding modules such as PH, C1, and C2 domains play crucial roles in location-dependent regulation of many protein kinases. Here, we identify the KA1 domain (kinase associated-1 domain), found at the C terminus of yeast septin-associated kinases (Kcc4p, Gin4p, and Hsl1p) and human MARK/PAR1 kinases, as a membrane association domain that binds acidic phospholipids. Membrane localization of isolated KA1 domains depends on phosphatidylserine. Using X-ray crystallography, we identified a structurally conserved binding site for anionic phospholipids in KA1 domains from Kcc4p and MARK1. Mutating this site impairs membrane association of both KA1 domains and intact proteins and reveals the importance of phosphatidylserine for bud neck localization of yeast Kcc4p. Our data suggest that KA1 domains contribute to coincidence detection, allowing kinases to bind other regulators (such as septins) only at the membrane surface. These findings have important implications for understanding MARK/PAR1 kinases, which are implicated in Alzheimer's disease, cancer, and autism.

Effects of using nursing home residents to serve as group activity leaders: lessons learned from the RAP project.

Science.gov (United States)

Skrajner, Michael J; Haberman, Jessica L; Camp, Cameron J; Tusick, Melanie; Frentiu, Cristina; Gorzelle, Gregg

2014-03-01

Previous research has demonstrated that persons with early to moderate stage dementia are capable of leading small group activities for persons with more advanced dementia. In this study, we built upon this previous work by training residents in long-term care facilities to fill the role of group activity leaders using a Resident-Assisted Programming (RAP) training regimen. There were two stages to the program. In the first stage, RAP training was provided by researchers. In the second stage, RAP training was provided to residents by activities staff members of long-term care facilities who had been trained by researchers. We examine the effects of RAP implemented by researchers and by activities staff member on long-term care resident with dementia who took part in these RAP activities. We also examined effects produced by two types of small group activities: two Montessori-based activities and an activity which focuses on persons with more advanced dementia, based on the work of Jitka Zgola. Results demonstrate that levels of positive engagement seen in players during RAP (resident-led activities) were typically higher than those observed during standard activities programming led by site staff. In general, Montessori-Based Dementia Programming® produced more constructive engagement than Zgola-based programming (ZBP), though ZBP did increase a positive form of engagement involving observing activities with interest. In addition, RAP implemented by activities staff members produced effects that were, on the whole, similar to those produced when RAP was implemented by researchers. Implications of these findings for providing meaningful social roles for persons with dementia residing in long-term care, and suggestions for further research in this area, are discussed.

The chromatin remodelling factor BRG1 is a novel binding partner of the tumor suppressor p16INK4a

Directory of Open Access Journals (Sweden)

Mann Graham J

2009-01-01

Full Text Available Abstract Background CDKN2A/p16INK4a is frequently altered in human cancers and it is the most important melanoma susceptibility gene identified to date. p16INK4a inhibits pRb phosphorylation and induces cell cycle arrest, which is considered its main tumour suppressor function. Nevertheless, additional activities may contribute to the tumour suppressor role of p16INK4a and could help explain its specific association with melanoma predisposition. To identify such functions we conducted a yeast-two-hybrid screen for novel p16INK4a binding partners. Results We now report that p16INK4a interacts with the chromatin remodelling factor BRG1. We investigated the cooperative roles of p16INK4a and BRG1 using a panel of cell lines and a melanoma cell model with inducible p16INK4a expression and BRG1 silencing. We found evidence that BRG1 is not required for p16INK4a-induced cell cycle inhibition and propose that the p16INK4a-BRG1 complex regulates BRG1 chromatin remodelling activity. Importantly, we found frequent loss of BRG1 expression in primary and metastatic melanomas, implicating this novel p16INK4a binding partner as an important tumour suppressor in melanoma. Conclusion This data adds to the increasing evidence implicating the SWI/SNF chromatin remodelling complex in tumour development and the association of p16INK4a with chromatin remodelling highlights potentially new functions that may be important in melanoma predisposition and chemoresistance.

Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

DEFF Research Database (Denmark)

Savelyeva, I.; Dobbelstein, M.

2011-01-01

to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

Feeling the beat: the meaning of rap music for ethnically diverse Midwestern college students--a phenomenological study.

Science.gov (United States)

Iwamoto, Derek K; Creswell, John; Caldwell, Leon

2007-01-01

Despite its national and international appeal, rap is considered one of the most controversial of music genres. Given the political charge it generates, rap music has spawned research across the social and health sciences. The majority of the research has investigated its impact on African Americans. Further, the research has tended to focus on negative aspects of the music; there has been a dearth of in-depth qualitative studies that explore how rap impacts the listener. Our phenomenological study explores that impact on ethnically diverse college students. Results indicate a profound psychological and educational effect and the discussion goes on to highlight the potential and innovative ways rap music can be utilized with adolescents in fields such as education, risk reduction programs, and counseling psychology.

Molecular characterization and chromosomal assignment of equine cartilage derived retinoic acid sensitive protein (CD-RAP)/melanoma inhibitory activity (MIA)

DEFF Research Database (Denmark)

Berg, Lise Charlotte; Mata, Xavier; Thomsen, Preben Dybdahl

2008-01-01

Cartilage-derived retinoic acid sensitive protein (CD-RAP) also known as melanoma inhibitory activity (MIA) has already been established as a marker for chondrocyte differentiation and a number of cancerous condition sin humans. Studies have also shown that CD-RAP/MIA is a potential marker of joint......RNA in articular cartilage and chondrocytes from horses with no signs of joint disease. The expression decreased as the cells dedifferentiated in monolayer culture. We also identified an equine CD-RAP/MIA splioce variant similar to that reported in humans. The CD_RAP/MIA protein was detected in equine synovial...... fluid, serum and culture medium from chondrocyte cultures. In conclusion, CD-RAP/MIA is expressed in equine cartilage and chondrocytes, and the protein can be detected in equine serum, synovial fluid and in culture medium from chondrocyte cultures. The equine gene and resulting protein share great...

Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

DEFF Research Database (Denmark)

Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

1988-01-01

Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

Yeast hexokinase: substrate-induced association--dissociation reactions in the binding of glucose to hexokinase P-II.

Science.gov (United States)

Hoggett, J G; Kellett, G L

1976-06-15

A method is described for the purification of native hexokinases P-I and P-II from yeast using preparative isoelectric focussing to separate the isozymes. The binding of glucose to hexokinase P-II, and the effect of this on the monomer--dimer association--dissociation reaction have been investigated quantitatively by a combination of titrations of intrinsic protein fluorescence and equilibrium ultracentrifugation. Association constants for the monomer-dimer reaction decreased with increasing pH, ionic strength and concentration of glucose. Saturating concentrations of glucose did not bring about complete dissociation of the enzyme showing that both sites were occupired in the dimer. At pH 8.0 and high ionic strength, where the enzyme existed as monomer, the dissociation constant of the enzyme-glucose complex was 3 X 10(-4) mol 1(-1) and was independent of the concentration of enzyme. Binding to the dimeric form at low pH and ionic strength (I=0.02 mol 1(-1), pH less than 7.5) was also independent of enzyme concentration (in the range 10-1000 mug ml-1) but was much weaker. The process could be described by a single dissociation constant, showing that the two available sites on the dimer were equivalent and non-cooperative; values of the intrinsic dissociation constant varied from 2.5 X 10(-3) mol 1(-1) at pH 7.0 to 6 X 10(-3) at pH 6.5. Under intermediate conditions (pH 7.0, ionic strength=0.15 mol 1(-1)), where monomer and dimer coexisted, the binding of glucose showed weak positive cooperatively (Hill coefficient 1.2); in addition, the binding was dependent upon the concentration of enzyme in the direction of stronger binding at lower concentrations. The results show that the phenomenon of half-sites reactivity observed in the binding of glucose to crystalline hexokinase P-II does not occur in solution; the simplest explanation of our finding the two sites to be equivalent is that the dimer results from the homologous association of two identical subunits.

Phosphorylated 4E binding protein 1: a hallmark of cell signaling that correlates with survival in ovarian cancer.

Science.gov (United States)

Castellvi, Josep; Garcia, Angel; Rojo, Federico; Ruiz-Marcellan, Carmen; Gil, Antonio; Baselga, Jose; Ramon y Cajal, Santiago

2006-10-15

Growth factor receptors and cell signaling factors play a crucial role in human carcinomas and have been studied in ovarian tumors with varying results. Cell signaling involves multiple pathways and a myriad of factors that can be mutated or amplified. Cell signaling is driven through the mammalian target of rapamycin (mTOR) and extracellular regulated kinase (ERK) pathways and by some downstream molecules, such as 4E binding protein 1 (4EBP1), eukaryotic initiation factor 4E, and p70 ribosomal protein S6 kinase (p70S6K). The objectives of this study were to analyze the real role that these pathways play in ovarian cancer, to correlate them with clinicopathologic characteristics, and to identify the factors that transmit individual proliferation signals and are associated with pathologic grade and prognosis, regardless specific oncogenic alterations upstream. One hundred twenty-nine ovarian epithelial tumors were studied, including 20 serous cystadenomas, 7 mucinous cystadenomas, 11 serous borderline tumors, 16 mucinous borderline tumors, 29 serous carcinomas, 16 endometrioid carcinomas, 15 clear cell carcinomas, and 15 mucinous carcinomas. Tissue microarrays were constructed, and immunohistochemistry for the receptors epidermal growth factor receptor (EGFR) and c-erb-B2 was performed and with phosphorylated antibodies for protein kinase B (AKT), 4EBP1, p70S6K, S6, and ERK. Among 129 ovarian neoplasms, 17.8% were positive for c-erb-B2, 9.3% were positive for EGFR, 47.3% were positive for phosphorylated AKT (p-AKT), 58.9% were positive for p-ERK, 41.1% were positive for p-4EBP1, 26.4% were positive for p70S6K, and 15.5% were positive for p-S6. Although EGFR, p-AKT, and p-ERK expression did not differ between benign, borderline, or malignant tumors, c-erb-B2, p-4EBP1, p-p70S6K, and p-S6 were expressed significantly more often in malignant tumors. Only p-4EBP1 expression demonstrated prognostic significance (P = .005), and only surgical stage and p-4EBP1 expression

Identification of target genes of the p16INK4A-pRB-E2F pathway

DEFF Research Database (Denmark)

Vernell, Richard; Helin, Kristian; Müller, Heiko

2003-01-01

as physiological targets of the pRB pathway, and the further characterization of these genes should provide insights into how this pathway controls proliferation. We show that Gibbs sampling detects enrichment of several sequence motifs, including E2F consensus binding sites, in the upstream regions of these genes...

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Science.gov (United States)

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Impaired TIP60-mediated H4K16 acetylation accounts for the aberrant chromatin accumulation of 53BP1 and RAP80 in Fanconi anemia pathway-deficient cells.

Science.gov (United States)

Renaud, Emilie; Barascu, Aurelia; Rosselli, Filippo

2016-01-29

To rescue collapsed replication forks cells utilize homologous recombination (HR)-mediated mechanisms to avoid the induction of gross chromosomal abnormalities that would be generated by non-homologous end joining (NHEJ). Using DNA interstrand crosslinks as a replication barrier, we investigated how the Fanconi anemia (FA) pathway promotes HR at stalled replication forks. FA pathway inactivation results in Fanconi anemia, which is associated with a predisposition to cancer. FANCD2 monoubiquitination and assembly in subnuclear foci appear to be involved in TIP60 relocalization to the chromatin to acetylates histone H4K16 and prevents the binding of 53BP1 to its docking site, H4K20Me2. Thus, FA pathway loss-of-function results in accumulation of 53BP1, RIF1 and RAP80 at damaged chromatin, which impair DNA resection at stalled replication fork-associated DNA breaks and impede HR. Consequently, DNA repair in FA cells proceeds through the NHEJ pathway, which is likely responsible for the accumulation of chromosome abnormalities. We demonstrate that the inhibition of NHEJ or deacetylase activity rescue HR in FA cells. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Evaluation of the RapID-ANA system for identification of anaerobic bacteria of veterinary origin.

Science.gov (United States)

Adney, W S; Jones, R L

1985-12-01

This study evaluated the ability of the RapID-ANA system (Innovative Diagnostic Systems, Inc., Atlanta, Ga.) to accurately identify a spectrum of freshly isolated veterinary anaerobes. A total of 183 isolates were tested and included 7 Actinomyces spp., 53 Bacteroides spp., 32 Clostridium spp., 2 Eubacterium spp., 65 Fusobacterium spp., 1 Peptococcus spp., 22 Peptostreptococcus spp., and 1 Propionibacterium spp. All isolates were initially identified by conventional biochemical testing and gas-liquid chromatography of short-chain fatty acid metabolites. Additional tests were performed as required by the RapID-ANA system. Of these isolates, 81.4% were correctly identified to the genus level, including 59.6% to the species level, 14.2% were incorrectly identified at the genus level, and 4.4% were not identified. Initially, 20.2% of the strains were not identified because the microcodes were not in the code book. The majority of the incorrect identifications were caused by the misidentification of Fusobacterium spp. as Bacteroides spp. Errors also occurred when veterinary anaerobes not included in the data base were assigned an identification from the existing data base. The RapID-ANA system appears to be a promising new method for rapid identification of veterinary anaerobes; however, further evaluation with an extended data base is needed before the system can accurately identify all clinically significant anaerobes.

Nitrogen-responsive Regulation of GATA Protein Family Activators Gln3 and Gat1 Occurs by Two Distinct Pathways, One Inhibited by Rapamycin and the Other by Methionine Sulfoximine*

Science.gov (United States)

Georis, Isabelle; Tate, Jennifer J.; Cooper, Terrance G.; Dubois, Evelyne

2011-01-01

Nitrogen availability regulates the transcription of genes required to degrade non-preferentially utilized nitrogen sources by governing the localization and function of transcription activators, Gln3 and Gat1. TorC1 inhibitor, rapamycin (Rap), and glutamine synthetase inhibitor, methionine sulfoximine (Msx), elicit responses grossly similar to those of limiting nitrogen, implicating both glutamine synthesis and TorC1 in the regulation of Gln3 and Gat1. To better understand this regulation, we compared Msx- versus Rap-elicited Gln3 and Gat1 localization, their DNA binding, nitrogen catabolite repression-sensitive gene expression, and the TorC1 pathway phosphatase requirements for these responses. Using this information we queried whether Rap and Msx inhibit sequential steps in a single, linear cascade connecting glutamine availability to Gln3 and Gat1 control as currently accepted or alternatively inhibit steps in two distinct parallel pathways. We find that Rap most strongly elicits nuclear Gat1 localization and expression of genes whose transcription is most Gat1-dependent. Msx, on the other hand, elicits nuclear Gln3 but not Gat1 localization and expression of genes that are most Gln3-dependent. Importantly, Rap-elicited nuclear Gln3 localization is absolutely Sit4-dependent, but that elicited by Msx is not. PP2A, although not always required for nuclear GATA factor localization, is highly required for GATA factor binding to nitrogen-responsive promoters and subsequent transcription irrespective of the gene GATA factor specificities. Collectively, our data support the existence of two different nitrogen-responsive regulatory pathways, one inhibited by Msx and the other by rapamycin. PMID:22039046

Nitrogen-responsive regulation of GATA protein family activators Gln3 and Gat1 occurs by two distinct pathways, one inhibited by rapamycin and the other by methionine sulfoximine.

Science.gov (United States)

Georis, Isabelle; Tate, Jennifer J; Cooper, Terrance G; Dubois, Evelyne

2011-12-30

Nitrogen availability regulates the transcription of genes required to degrade non-preferentially utilized nitrogen sources by governing the localization and function of transcription activators, Gln3 and Gat1. TorC1 inhibitor, rapamycin (Rap), and glutamine synthetase inhibitor, methionine sulfoximine (Msx), elicit responses grossly similar to those of limiting nitrogen, implicating both glutamine synthesis and TorC1 in the regulation of Gln3 and Gat1. To better understand this regulation, we compared Msx- versus Rap-elicited Gln3 and Gat1 localization, their DNA binding, nitrogen catabolite repression-sensitive gene expression, and the TorC1 pathway phosphatase requirements for these responses. Using this information we queried whether Rap and Msx inhibit sequential steps in a single, linear cascade connecting glutamine availability to Gln3 and Gat1 control as currently accepted or alternatively inhibit steps in two distinct parallel pathways. We find that Rap most strongly elicits nuclear Gat1 localization and expression of genes whose transcription is most Gat1-dependent. Msx, on the other hand, elicits nuclear Gln3 but not Gat1 localization and expression of genes that are most Gln3-dependent. Importantly, Rap-elicited nuclear Gln3 localization is absolutely Sit4-dependent, but that elicited by Msx is not. PP2A, although not always required for nuclear GATA factor localization, is highly required for GATA factor binding to nitrogen-responsive promoters and subsequent transcription irrespective of the gene GATA factor specificities. Collectively, our data support the existence of two different nitrogen-responsive regulatory pathways, one inhibited by Msx and the other by rapamycin.

La influencia de la Web 2.0 y sus condicionantes técnicos en la producción del videoclip de rap español

Directory of Open Access Journals (Sweden)

Olga HEREDERO-DÍAZ

2017-07-01

Full Text Available El videoclip es un producto audiovisual definido a partir de sus fines, generalmente comerciales, pero también un ejercicio de expresión y experimentación artística. Tomando como punto de partida la transformación del modo de distribución y consumo del videoclip por la democratización del acceso a Internet del público juvenil, el objetivo principal de esta investigación será describir los cambios que han tenido lugar en la producción del videoclip de rap español de los últimos cinco años debido a la influencia de la Web 2.0 y sus condicionantes técnicos. A partir del análisis de los videoclips difundidos a través de la sección de rap del programa Ritmo Urbano de La 2 de RTVE durante sus cinco temporadas en antena (desde 2011 hasta 2016, se concluye que a día de hoy el vídeo musical de rap es un género que se produce mayoritariamente para Internet, lo que en el caso del videoclip de rap español ha supuesto una mayor autonomía y libertad creativa para los artistas, al tiempo que una merma en el estándar de calidad de la imagen y del sonido de las piezas finales que su público objetivo consume.

C/EBPβ (CCAAT/enhancer-binding protein β) mediates progesterone production through transcriptional regulation in co-operation with SF-1 (steroidogenic factor-1).

Science.gov (United States)

Mizutani, Tetsuya; Ju, Yunfeng; Imamichi, Yoshitaka; Osaki, Tsukasa; Yazawa, Takashi; Kawabe, Shinya; Ishikane, Shin; Matsumura, Takehiro; Kanno, Masafumi; Kamiki, Yasue; Kimura, Kohei; Minamino, Naoto; Miyamoto, Kaoru

2014-06-15

The transcription factor SF-1 (steroidogenic factor-1) is a master regulator of steroidogenesis. Previously, we have found that SF-1 induces the differentiation of mesenchymal stem cells into steroidogenic cells. To elucidate the molecular mechanisms of SF-1-mediated functions, we attempted to identify protein components of the SF-1 nuclear protein complex in differentiated cells. SF-1 immunoaffinity chromatography followed by MS/MS analysis was performed, and 24 proteins were identified. Among these proteins, we focused on C/EBPβ (CCAAT/enhancer-binding protein β), which is an essential transcription factor for ovulation and luteinization, as the transcriptional mechanisms of C/EBPβ working together with SF-1 are poorly understood. C/EBPβ knockdown attenuated cAMP-induced progesterone production in granulosa tumour-derived KGN cells by altering STAR (steroidogenic acute regulatory protein), CYP11A1 (cytochrome P450, family 11, subfamily A, polypeptide 1) and HSD3B2 (hydroxy-δ-5-steroid dehydrogenase, 3β- and steroid δ-isomerase 2) expression. EMSA and ChIP assays revealed novel C/EBPβ-binding sites in the upstream regions of the HSD3B2 and CYP11A1 genes. These interactions were enhanced by cAMP stimulation. Luciferase assays showed that C/EBPβ-responsive regions were found in each promoter and C/EBPβ is involved in the cAMP-induced transcriptional activity of these genes together with SF-1. These results indicate that C/EBPβ is an important mediator of progesterone production by working together with SF-1, especially under tropic hormone-stimulated conditions.

Cell adhesion to fibrillin-1: identification of an Arg-Gly-Asp-dependent synergy region and a heparin-binding site that regulates focal adhesion formation

DEFF Research Database (Denmark)

Bax, Daniel V; Mahalingam, Yashithra; Cain, Stuart

2007-01-01

We have defined the molecular basis of cell adhesion to fibrillin-1, the major structural component of extracellular microfibrils that are associated with elastic fibres. Using human dermal fibroblasts, and recombinant domain swap fragments containing the Arg-Gly-Asp motif, we have demonstrated...... a requirement for upstream domains for integrin-alpha(5)beta(1)-mediated cell adhesion and migration. An adjacent heparin-binding site, which supports focal adhesion formation, was mapped to the fibrillin-1 TB5 motif. Site-directed mutagenesis revealed two arginine residues that are crucial for heparin binding...

P1 plasmid replication: initiator sequestration is inadequate to explain control by initiator-binding sites.

OpenAIRE

Pal, S K; Chattoraj, D K

1988-01-01

The unit-copy plasmid replicon mini-P1 consists of an origin, a gene for an initiator protein, RepA, and a control locus, incA. Both the origin and the incA locus contain repeat sequences that bind RepA. It has been proposed that the incA repeats control replication by sequestering the rate-limiting RepA initiator protein. Here we show that when the concentration of RepA was increased about fourfold beyond its normal physiological level from an inducible source in trans, the copy number of a ...

Hybrid Texts: Fifth Graders, Rap Music, and Writing

Science.gov (United States)

Christianakis, Mary

2011-01-01

Consistent with a sociocritical frame and the analytic tools of hybridity theory, this article explicates how urban fifth-grade children made language hybrids using rap and poetry to participate in classroom literacy. Ethnographic data from a yearlong study illustrate two key findings. First, standards-based and canon-driven writing models…

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

Science.gov (United States)

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development.

Directory of Open Access Journals (Sweden)

Archana D Siddam

2018-03-01

Full Text Available Opacification of the ocular lens, termed cataract, is a common cause of blindness. To become transparent, lens fiber cells undergo degradation of their organelles, including their nuclei, presenting a fundamental question: does signaling/transcription sufficiently explain differentiation of cells progressing toward compromised transcriptional potential? We report that a conserved RNA-binding protein Celf1 post-transcriptionally controls key genes to regulate lens fiber cell differentiation. Celf1-targeted knockout mice and celf1-knockdown zebrafish and Xenopus morphants have severe eye defects/cataract. Celf1 spatiotemporally down-regulates the cyclin-dependent kinase (Cdk inhibitor p27Kip1 by interacting with its 5' UTR and mediating translation inhibition. Celf1 deficiency causes ectopic up-regulation of p21Cip1. Further, Celf1 directly binds to the mRNA of the nuclease Dnase2b to maintain its high levels. Together these events are necessary for Cdk1-mediated lamin A/C phosphorylation to initiate nuclear envelope breakdown and DNA degradation in fiber cells. Moreover, Celf1 controls alternative splicing of the membrane-organization factor beta-spectrin and regulates F-actin-crosslinking factor Actn2 mRNA levels, thereby controlling fiber cell morphology. Thus, we illustrate new Celf1-regulated molecular mechanisms in lens development, suggesting that post-transcriptional regulatory RNA-binding proteins have evolved conserved functions to control vertebrate oculogenesis.

Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

Directory of Open Access Journals (Sweden)

Monica M Horvath

2007-07-01

Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

Quantitative Characterization of E-selectin Interaction with Native CD44 and P-selectin Glycoprotein Ligand-1 (PSGL-1) Using a Real Time Immunoprecipitation-based Binding Assay

KAUST Repository

Abu Samra, Dina Bashir Kamil; Al Kilani, Alia; Hamdan, Samir; Sakashita, Kosuke; Gadhoum, Samah Z.; Merzaban, Jasmeen

2015-01-01

Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Quantitative Characterization of E-selectin Interaction with Native CD44 and P-selectin Glycoprotein Ligand-1 (PSGL-1) Using a Real Time Immunoprecipitation-based Binding Assay

KAUST Repository

Abu Samra, Dina Bashir Kamil

2015-06-29

Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Re-active Passive (RAP) Devices for Control of Noise Transmission through a Panel

Science.gov (United States)

Carneal, James P.; Giovanardi, Marco; Fuller, Chris R.; Palumbo, Daniel L.

2008-01-01

Re-Active Passive (RAP) devices have been developed to control low frequency (transmission through a panel. These devices use a combination of active, re-active, and passive technologies packaged into a single unit to control a broad frequency range utilizing the strength of each technology over its best suited frequency range. The RAP device uses passive constrained layer damping to cover the relatively high frequency range (>200 Hz), reactive distributed vibration absorber) to cover the medium frequency range (75 to 250 Hz), and active control for controlling low frequencies (transmission through a panel mounted in a transmission loss test facility. Experimental results are presented for the bare panel, and combinations of passive treatment, reactive treatment, and active control. Results indicate that three RAP devices were able to increase the overall broadband (15-1000 Hz) transmission loss by 9.4 dB. These three devices added a total of 285 grams to the panel mass of 6.0 kg, or approximately 5%, not including control electronics.

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

Science.gov (United States)

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p

Computational scheme for pH-dependent binding free energy calculation with explicit solvent.

Science.gov (United States)

Lee, Juyong; Miller, Benjamin T; Brooks, Bernard R

2016-01-01

We present a computational scheme to compute the pH-dependence of binding free energy with explicit solvent. Despite the importance of pH, the effect of pH has been generally neglected in binding free energy calculations because of a lack of accurate methods to model it. To address this limitation, we use a constant-pH methodology to obtain a true ensemble of multiple protonation states of a titratable system at a given pH and analyze the ensemble using the Bennett acceptance ratio (BAR) method. The constant pH method is based on the combination of enveloping distribution sampling (EDS) with the Hamiltonian replica exchange method (HREM), which yields an accurate semi-grand canonical ensemble of a titratable system. By considering the free energy change of constraining multiple protonation states to a single state or releasing a single protonation state to multiple states, the pH dependent binding free energy profile can be obtained. We perform benchmark simulations of a host-guest system: cucurbit[7]uril (CB[7]) and benzimidazole (BZ). BZ experiences a large pKa shift upon complex formation. The pH-dependent binding free energy profiles of the benchmark system are obtained with three different long-range interaction calculation schemes: a cutoff, the particle mesh Ewald (PME), and the isotropic periodic sum (IPS) method. Our scheme captures the pH-dependent behavior of binding free energy successfully. Absolute binding free energy values obtained with the PME and IPS methods are consistent, while cutoff method results are off by 2 kcal mol(-1) . We also discuss the characteristics of three long-range interaction calculation methods for constant-pH simulations. © 2015 The Protein Society.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

OpenAIRE

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-01-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P...

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Directory of Open Access Journals (Sweden)

Feng-Yu Wang

Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Structural study of LEDGF/p75 binding partners

Czech Academy of Sciences Publication Activity Database

Těšina, Petr; Čermáková, Kateřina; Procházková, Kateřina; Hořejší, Magdalena; Christ, F.; De Rijck, J.; Veverka, Václav; Řezáčová, Pavlína

2013-01-01

Roč. 20, č. 1 (2013), s. 12-12 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : LEDGF/p75 * HIV * integrase-binding domain Subject RIV: EB - Genetics ; Molecular Biology

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

Directory of Open Access Journals (Sweden)

Asita Elengoe

2015-01-01

Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

The LHCb Upstream Tracker Project

CERN Document Server

Steinkamp, Olaf

2015-01-01

The LHCb detector performs searches for New Physics in CP-violating observables and rare heavy-quark decays at the LHC. A comprehensive upgrade is planned for the long shutdown of the LHC in 2018/19. A goal of this upgrade is to abolish hardware triggers and read out the full detector at 40 MHz. This requires to replace the existing TT station upstream of the LHCb magnet by a new silicon micro-strip detector, the Upstream Tracker (UT). The UT will have a new front-end chip compatible with 40 MHz readout, silicon sensors with improved radiation hardness, finer readout granularity, and improved acceptance coverage at small polar angles. The outer region of each detection layer will be covered by p-in-n sensors with 10 cm long strips and a pitch of about 180 mum, while n-in-p sensors with half the pitch and strip length will be employed in the regions of highest particle density close to the beam pipe. The innermost sensors will have a circular cutout to optimize the forward acceptance. The front-end chip is bei...

Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2016-05-28

The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

Aspirin and salicylate bind to immunoglobulin heavy chain binding protein (BiP) and inhibit its ATPase activity in human fibroblasts.

Science.gov (United States)

Deng, W G; Ruan, K H; Du, M; Saunders, M A; Wu, K K

2001-11-01

Salicylic acid (SA), an endogenous signaling molecule of plants, possesses anti-inflammatory and anti-neoplastic actions in human. Its derivative, aspirin, is the most commonly used anti-inflammatory and analgesic drug. Aspirin and sodium salicylate (salicylates) have been reported to have multiple pharmacological actions. However, it is unclear whether they bind to a cellular protein. Here, we report for the first time the purification from human fibroblasts of a approximately 78 kDa salicylate binding protein with sequence identity to immunoglobulin heavy chain binding protein (BiP). The Kd values of SA binding to crude extract and to recombinant BiP were 45.2 and 54.6 microM, respectively. BiP is a chaperone protein containing a polypeptide binding site recognizing specific heptapeptide sequence and an ATP binding site. A heptapeptide with the specific sequence displaced SA binding in a concentration-dependent manner whereas a control heptapeptide did not. Salicylates inhibited ATPase activity stimulated by this specific heptapeptide but did not block ATP binding or induce BiP expression. These results indicate that salicylates bind specifically to the polypeptide binding site of BiP in human cells that may interfere with folding and transport of proteins important in inflammation.

Zebrafish hoxd4a acts upstream of meis1.1 to direct vasculogenesis, angiogenesis and hematopoiesis.

Directory of Open Access Journals (Sweden)

Aseervatham Anusha Amali

Full Text Available Mice lacking the 4th-group paralog Hoxd4 display malformations of the anterior vertebral column, but are viable and fertile. Here, we report that zebrafish embryos having decreased function of the orthologous hoxd4a gene manifest striking perturbations in vasculogenesis, angiogenesis and primitive and definitive hematopoiesis. These defects are preceded by reduced expression of the hemangioblast markers scl1, lmo2 and fli1 within the posterior lateral plate mesoderm (PLM at 13 hours post fertilization (hpf. Epistasis analysis revealed that hoxd4a acts upstream of meis1.1 but downstream of cdx4 as early as the shield stage in ventral-most mesoderm fated to give rise to hemangioblasts, leading us to propose that loss of hoxd4a function disrupts hemangioblast specification. These findings place hoxd4a high in a genetic hierarchy directing hemangioblast formation downstream of cdx1/cdx4 and upstream of meis1.1. An additional consequence of impaired hoxd4a and meis1.1 expression is the deregulation of multiple Hox genes implicated in vasculogenesis and hematopoiesis which may further contribute to the defects described here. Our results add to evidence implicating key roles for Hox genes in their initial phase of expression early in gastrulation.

Performance evaluation of reactor operated zircaloy-2 pressure tubes of RAPS-1

International Nuclear Information System (INIS)

Chatterjee, S.; Ramadasan, E.; Balakrishnan, K.S.; Bahl, J.K.

1992-01-01

Detailed post irradiation examination was carried out on pressure tube sections from E-10, F-9 and F-10 locations of RAPS-1 after an in-reactor residence equivalent to 3.6 effective full power years. The F-10 pressure tube was studied in detail on sections obtained from one end to the other, whereas in the case of E-9 and F-9 pressure tubes only the end sections were examined. The studies carried out were visual examination, metallography, hydrogen i.e. H(D) analysis and mechanical testing at 300 C. Microstructural observations revealed uniform and random hydride/deuteride platelet distribution and absence of blisters or hydride segregation. The H(D) content in the F-10 pressure tube was found to vary in the range 6-12 ppm. The typical H(D) content in the three tubes was around 1 ppm. The H(D) pick-up evaluated from the observed oxide layer thickness was 8 ppm. Longitudinal tensile specimens fabricated from the F-10 pressure tube section and tested at 300 C exhibited increase in yield strength and tensile strength of 39% and 30% respectively. The residual uniform elongation was typically 1.8%. The observed changes in the tensile properties were found to be lower than those reported on unstressed specimens irradiated to similar neutron fluences. The observed hydrogen content and tensile properties obtained in F-10 pressure tube would not be detrimental under normal reactor operating conditions. (author). 10 refs., 4 figs., 2 tabs., 1 annexure

Direct labelling of the human P2X7 receptor and identification of positive and negative cooperativity of binding.

Science.gov (United States)

Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P

2007-05-01

The P2X(7) receptor exhibits complex pharmacological properties. In this study, binding of a [(3)H]-labelled P2X(7) receptor antagonist to human P2X(7) receptors has been examined to further understand ligand interactions with this receptor. The P2X(7) receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.1(3,7)]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X(7) receptors. Binding of [(3)H]-compound-17 was higher in membranes prepared from cells expressing P2X(7) receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X(7) receptors. Binding was reversible, saturable and modulated by P2X(7) receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. These data demonstrate that human P2X(7) receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X(7) receptor complex enhances subsequent binding to other P2X(7) subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X(7) receptor.

Upstream transcription factor 1 (USF1) in risk of type 2 diabetes: association study in 2000 Dutch Caucasians

NARCIS (Netherlands)

Meex, S.J.; Vliet-Ostaptchouk, J.V.; Kallen, van der C.J.H.; Greevenbroek, M.M.; Schalkwijk, C.G.; Feskens, E.J.M.; Blaak, E.E.; Wijmenga, C.; Hofker, M.H.; Stehouwer, C.D.; Bruin, T.W.

2008-01-01

Type 2 diabetes shares substantial genetic and phenotypic overlap with familial combined hyperlipidemia. Upstream stimulatory factor 1 (USF1), a well-established susceptibility gene for familial combined hyperlipidemia, is postulated to be such a shared genetic determinant. We evaluated two

Inhibitor of DNA binding 1 (Id1) induces differentiation and proliferation of mouse embryonic carcinoma P19CL6 cells

International Nuclear Information System (INIS)

Meng, Qingzhen; Jia, Zhuqing; Wang, Weiping; Li, Binhong; Ma, Kangtao; Zhou, Chunyan

2011-01-01

Highlights: → Id1 was upregulated during the cardiac differentiation process of P19CL6 cells. → Id1 upregulated expression of cardiac specific genes Gata4, α-MHC and ISL1. → Id1 promoted proliferation of P19CL6 cells. → Overexpression of Id1 increased activity of TOP flash. → Wnt3a or LiCl treatment promoted Id1 expression in P19CL6 cells. -- Abstract: The inhibitor of DNA binding (Id) family of genes encodes negative regulators of basic helix-loop-helix transcription factors and has been implicated in such diverse cellular processes as differentiation, proliferation, apoptosis and migration. Id knockout mouse embryos display multiple cardiac defects but the specific role of Id1 in cardiac differentiation is unclear. In the present study, we investigated the function of Id1 in DMSO-induced P19CL6 cells, a widely-accepted cell model of cardiac differentiation. We found that Id1 was upregulated during the cardiac differentiation of P19CL6 cells. The expression of cardiac specific marker genes, Gata4, α-MHC and ISL1, was upregulated in P19CL6 cells stably transfected with Id1 (P19CL6-Id1) during cardiac differentiation. The overexpression of Id1 reduced the number of cells in G1 phase and increased the cell population in G2, M and S phases, while knockdown of Id1 increased the number of cells in G1 phase from 48.6 ± 2.51% to 62.2 ± 1.52% at day 0 of cardiac induction, and from 52.5 ± 3.41% to 63.7 ± 1.02% at day 3 after cardiac induction, indicating that Id1 promoted proliferation of P19CL6 cells. Luciferase assays showed that the activity of TOP flash was higher in P19CL6-Id1 cells than wildtype P19CL6 cells, while Id1 expression was also upregulated in P19CL6 cells treated with Wnt3a or LiCl. This indicates that there may be positive feedback between Id1 and Wnt signaling which plays an important role in cardiac differentiation.

Open-Source Wax RepRap 3-D Printer for Rapid Prototyping Paper-Based Microfluidics.

Science.gov (United States)

Pearce, J M; Anzalone, N C; Heldt, C L

2016-08-01

The open-source release of self-replicating rapid prototypers (RepRaps) has created a rich opportunity for low-cost distributed digital fabrication of complex 3-D objects such as scientific equipment. For example, 3-D printable reactionware devices offer the opportunity to combine open hardware microfluidic handling with lab-on-a-chip reactionware to radically reduce costs and increase the number and complexity of microfluidic applications. To further drive down the cost while improving the performance of lab-on-a-chip paper-based microfluidic prototyping, this study reports on the development of a RepRap upgrade capable of converting a Prusa Mendel RepRap into a wax 3-D printer for paper-based microfluidic applications. An open-source hardware approach is used to demonstrate a 3-D printable upgrade for the 3-D printer, which combines a heated syringe pump with the RepRap/Arduino 3-D control. The bill of materials, designs, basic assembly, and use instructions are provided, along with a completely free and open-source software tool chain. The open-source hardware device described here accelerates the potential of the nascent field of electrochemical detection combined with paper-based microfluidics by dropping the marginal cost of prototyping to nearly zero while accelerating the turnover between paper-based microfluidic designs. © 2016 Society for Laboratory Automation and Screening.

Inhibitory Effects of Neochamaejasmin B on P-Glycoprotein in MDCK-hMDR1 Cells and Molecular Docking of NCB Binding in P-Glycoprotein

Directory of Open Access Journals (Sweden)

Lanying Pan

2015-02-01

Full Text Available Stellera chamaejasme L. (Thymelaeaceae is widely distributed in Mongolia, Tibet and the northern parts of China. Its roots are commonly used as “Langdu”, which is embodied in the Pharmacopoeia of the P.R. China (2010 as a toxic Traditional Chinese Medicine. It is claimed to have antivirus, antitumor and antibacterial properties in China and other Asian countries. Studies were carried out to characterize the inhibition of neochamaejasmin B (NCB on P-glycoprotein (P-gp, ABCB1, MDR1. Rhodamine-123 (R-123 transport and accumulation studies were performed in MDCK-hMDR1 cells. ABCB1 (MDR1 mRNA gene expression and P-gp protein expression were analyzed. Binding selectivity studies based on molecular docking were explored. R-123 transport and accumulation studies in MDCK-hMDR1 cells indicated that NCB inhibited the P-gp-mediated efflux in a concentration-dependent manner. RT-PCR and Western blot demonstrated that the P-gp expression was suppressed by NCB. To investigate the inhibition type of NCB on P-gp, Ki and Ki’ values were determined by double-reciprocal plots in R-123 accumulation studies. Since Ki was greater than Ki’, the inhibition of NCB on P-gp was likely a mixed type of competitive and non-competitive inhibition. The results were confirmed by molecular docking in our current work. The docking data indicated that NCB had higher affinity to P-gp than to Lig1 ((S-5,7-dihydroxy-2-(4-hydroxyphenylchroman-4-one.

B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

International Nuclear Information System (INIS)

Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong

2011-01-01

The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.

Decreased expression of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1) in radiation-induced mouse hepatocellular carcinoma

Energy Technology Data Exchange (ETDEWEB)

Teishima, Jun [Hiroshima Univ. (Japan). Research Inst. for Radiation Biology and Medicine

2002-04-01

Insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1) is a member of the IGFBP family, which was called IGFBP-7 or mac25 previously. Decreased expression of IGFBP-rP1 has been shown in breast cancer and prostatic cancer, and tumor suppressive effects of IGFBP-rP1 have been reported in prostatic cancer and osteosarcoma cell lines. In the present study, we investigated whether expression levels of IGFBP-rP1 were related to the development and the growth of radiation-induced hepatomas of B6C3F1 mice. In northern blot analysis, decreased expressions of IGFBP-rP1 gene were shown in radiation-induced mouse hepatomas compared to normal livers. In hepatoma cell lines established from these hepatomas, decreased expressions of IGFBP-rP1 were strongly related to the grade of anchorage-independent growth. In cell lines which were transfected with IGFBP-rP1cDNA, the doubling time of cell growth was increased, and the number and the size of colony formation in soft agar culture were decreased. In tumor formation assay by injecting these cells to B6C3F1 mice subcutaneously, the volume of tumors were decreased. Furthermore, the decreased expression of IGFBP-rP1 gene was observed in human hepatomas by northern blot analysis. These results may suggest that the suppression of IGFBP-rP1 is related to development and progression of mouse and human hepatomas. (author)

TGF-beta1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements.

Science.gov (United States)

Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D

2009-02-01

TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding.

Science.gov (United States)

Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian

2017-01-01

Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.

Rap as the language of conflict in hip-hop subculture

Directory of Open Access Journals (Sweden)

Т М Кожелупенко

2008-12-01

Full Text Available This article is devoted to such notions of sociolinguistics as subculture and the language of conflict. These aspects are studied by the example of the rapidly developing hip-hop subculture and rap-texts as its main component.

Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

Science.gov (United States)

Brierley, I; Hoggett, J G

1992-07-01

The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

A meta-analysis of genome-wide association scans identifies IL18RAP, PTPN2, TAGAP, and PUS10 as shared risk loci for Crohn's disease and celiac disease.

Directory of Open Access Journals (Sweden)

Eleonora A M Festen

2011-01-01

Full Text Available Crohn's disease (CD and celiac disease (CelD are chronic intestinal inflammatory diseases, involving genetic and environmental factors in their pathogenesis. The two diseases can co-occur within families, and studies suggest that CelD patients have a higher risk to develop CD than the general population. These observations suggest that CD and CelD may share common genetic risk loci. Two such shared loci, IL18RAP and PTPN2, have already been identified independently in these two diseases. The aim of our study was to explicitly identify shared risk loci for these diseases by combining results from genome-wide association study (GWAS datasets of CD and CelD. Specifically, GWAS results from CelD (768 cases, 1,422 controls and CD (3,230 cases, 4,829 controls were combined in a meta-analysis. Nine independent regions had nominal association p-value <1.0 x 10⁻⁵ in this meta-analysis and showed evidence of association to the individual diseases in the original scans (p-value < 1 x 10⁻² in CelD and < 1 x 10⁻³ in CD. These include the two previously reported shared loci, IL18RAP and PTPN2, with p-values of 3.37 x 10⁻⁸ and 6.39 x 10⁻⁹, respectively, in the meta-analysis. The other seven had not been reported as shared loci and thus were tested in additional CelD (3,149 cases and 4,714 controls and CD (1,835 cases and 1,669 controls cohorts. Two of these loci, TAGAP and PUS10, showed significant evidence of replication (Bonferroni corrected p-values <0.0071 in the combined CelD and CD replication cohorts and were firmly established as shared risk loci of genome-wide significance, with overall combined p-values of 1.55 x 10⁻¹⁰ and 1.38 x 10⁻¹¹ respectively. Through a meta-analysis of GWAS data from CD and CelD, we have identified four shared risk loci: PTPN2, IL18RAP, TAGAP, and PUS10. The combined analysis of the two datasets provided the power, lacking in the individual GWAS for single diseases, to detect shared loci with a

Feeling the Beat: The Meaning of Rap Music for Ethnically Diverse Midwestern College Students--A Phenomenological Study

Science.gov (United States)

Iwamoto, Derek K.; Creswell, John; Caldwell, Leon

2007-01-01

Despite its national and international appeal, rap is considered one of the most controversial of music genres. Given the political charge it generates, rap music has spawned research across the social and health sciences. The majority of the research has investigated its impact on African Americans. Further, the research has tended to focus on…

O negro drama do rap: entre a lei do cão e a lei da selva

Directory of Open Access Journals (Sweden)

Bruno Zeni

2004-04-01

Full Text Available NESTE texto são feitas algumas considerações que partem de interesses e preocupações pessoais do autor a respeito do rap, tais como a elaboração das letras, a relação entre essa manifestação e o universo da pobreza e da prisão, o diálogo do ritmo com a tradição da música e da literatura brasileiras. São discutidas ainda algumas das questões estéticas e éticas relacionadas ao rap feito em São Paulo.IN THIS text I set out some considerations that stem from keen personal interests and concerns regarding rap - e.g., the production of lyrics, the relationship between such manifestations and the universe of poverty and imprisonment, and the dialogue between this rhythm and the broader tradition of Brazilian music and literature. I discuss some aesthetic and ethical issues related to the variety of rap that I am most intimately involved with, namely, the one made in São Paulo.

RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application.

Science.gov (United States)

D'Antonio, Mattia; D'Onorio De Meo, Paolo; Pallocca, Matteo; Picardi, Ernesto; D'Erchia, Anna Maria; Calogero, Raffaele A; Castrignanò, Tiziana; Pesole, Graziano

2015-01-01

The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export

Novel tetra-peptide insertion in Gag-p6 ALIX-binding motif in HIV-1 subtype C associated with protease inhibitor failure

Science.gov (United States)

Neogi, Ujjwal; RAO, Shwetha D; BONTELL, Irene; VERHEYEN, Jens; RAO, Vasudev R; GORE, Sagar C; SONI, Neelesh; SHET, Anita; SCHÜLTER, Eugen; EKSTRAND, Maria L.; WONDWOSSEN, Amogne; KAISER, Rolf; MADHUSUDHAN, Mallur S.; PRASAD, Vinayaka R; SONNERBORG, Anders

2014-01-01

A novel tetra-peptide insertion was identified in Gag-p6 ALIX-binding region which is appears in protease inhibitor (PI) failure Indian HIV-1C sequences (Odds Ratio 17.1, p<0.001) but naturally present in half of untreated Ethiopian sequences. The insertion will probably restore the ALIX mediated virus release pathway, which is lacking in HIV-1C. The clinical importance of such insertion need to be evaluated in HIV-1C dominating regions were PI-drugs are being scaled up as second line treatment options. PMID:25102091

‘When i rap, i feel more like myself’

DEFF Research Database (Denmark)

Vitus, Kathrine

2016-01-01

This article analyzes the relationship between subjectivity and ideology in a short film, Rapper Girl, produced by young women living in multiethnic Copenhagen, and develops the concept of the ‘RapX fantasy’. Through Jacques Rancière’s and Slavoj Žižek’s theoretical lenses, the article explores how...

RAPS: an innovative active pixel for particle detection integrated in CMOS technology

International Nuclear Information System (INIS)

Passeri, Daniele; Placidi, Pisana; Verducci, Leonardo; Ciampolini, Paolo; Matrella, Guido; Marras, Alessandro; Bilei, G.M.

2004-01-01

In this paper we discuss some design, implementation and test issues, with respect to the development of the RAPS01 chip in the framework of the Radiation Active Pixel Sensors (RAPS) INFN project. The project aimed at verifying feasibility of smart, high-resolution pixel arrays with a fully standard, submicron CMOS technology for particle detection purposes. Layout optimization of the pixel, including sensitive element and local read and amplification circuits has been carried out. Different basic pixel schemes and read-out options have been proposed and devised. Chip fabrication has been completed and test phase is now under way: to this purpose a suitable test environment has been devised and test strategies have been planned

The host-binding domain of the P2 phage tail spike reveals a trimeric iron-binding structure

International Nuclear Information System (INIS)

Yamashita, Eiki; Nakagawa, Atsushi; Takahashi, Junichi; Tsunoda, Kin-ichi; Yamada, Seiko; Takeda, Shigeki

2011-01-01

The C-terminal domain of a bacteriophage P2 tail-spike protein, gpV, was crystallized and its structure was solved at 1.27 Å resolution. The refined model showed a triple β-helix structure and the presence of iron, calcium and chloride ions. The adsorption and infection of bacteriophage P2 is mediated by tail fibres and tail spikes. The tail spikes on the tail baseplate are used to irreversibly adsorb to the host cells. Recently, a P2 phage tail-spike protein, gpV, was purified and it was shown that a C-terminal domain, Ser87–Leu211, is sufficient for the binding of gpV to host Escherichia coli membranes [Kageyama et al. (2009 ▶), Biochemistry, 48, 10129–10135]. In this paper, the crystal structure of the C-terminal domain of P2 gpV is reported. The structure is a triangular pyramid and looks like a spearhead composed of an intertwined β-sheet, a triple β-helix and a metal-binding region containing iron, calcium and chloride ions

Diaspora portoricaine et musique rap à New-York : entre latinité et culture africaine américaine Puerto Rican diaspora and rap music in New-York city: between “latininad” and African American culture

Directory of Open Access Journals (Sweden)

Stéphane Partel

2012-05-01

Full Text Available Le rap a atteint un succès sans précédent auprès des jeunes urbains aux Etats-Unis et dans les grandes mégalopoles du monde entier. Ce genre musical, figure de proue du hip-hop, s’est affirmé dès les années 1970 comme un moyen d’expression diasporique reflétant les expériences, les rapports complexes et les interactions culturelles entre Africains Américains, Jamaïcains et Portoricains de la diaspora vivant à New York. Cependant, le positionnement des artistes issus de la diaspora portoricaine a été peu étudié. Nourri de séjours d’observation participante et de recherches réalisés entre 2005 et 2008, ainsi que de la fréquentation assidue des concerts du collectif artistique portoricain The Terror Squad auxquels l’auteur a pu assister, cet article se propose doncd’analyser le rôle central des artistes issus de la diaspora portoricaine de New York à travers l’étude du rap, élément le plus médiatisé du hip-hop. Il devient ainsi possible de mieux entrevoir les tensions, convergences et interactions culturelles qui régissent les rapports complexes qui s’établissent entre la latinité des Portoricains et la culture africaine-américaine urbaine depuis plus d’une trentaine d’années dans le milieu du rap.Rap music has achieved unprecedented success among urban youth in the United States and in big cities around the world. As a key element of hip-hop this musical style has been asserting its strength since the 1970s as a reflection of the diasporic experience and the complex cultural interactions between African Americans, Jamaicans and Puerto Ricans of the diaspora living in New York. However, scant research has been conducted on the role of Puerto Rican artists of the diaspora living in New York. Therefore, based on field trips and participant observation undertaken between 2005 and 2008 and the concerts of the Puerto Rican rap group The Terror Squad that the author was able to attend frequently, the

The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

Science.gov (United States)

Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

2010-01-01

Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

Science.gov (United States)

Williams, K P; Shoelson, S E

1993-03-15

Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

Laboratory testing and economic analysis of high RAP warm mixed asphalt.

Science.gov (United States)

2009-03-24

This report contains laboratory testing, economic analysis, literature review, and information obtained from multiple producers throughout the state of Mississippi regarding the use of high RAP (50 % to 100%) mixtures containing warm mix additives. T...

Cofilin is a pH sensor for actin free barbed end formation: role of phosphoinositide binding.

Science.gov (United States)

Frantz, Christian; Barreiro, Gabriela; Dominguez, Laura; Chen, Xiaoming; Eddy, Robert; Condeelis, John; Kelly, Mark J S; Jacobson, Matthew P; Barber, Diane L

2008-12-01

Newly generated actin free barbed ends at the front of motile cells provide sites for actin filament assembly driving membrane protrusion. Growth factors induce a rapid biphasic increase in actin free barbed ends, and we found both phases absent in fibroblasts lacking H(+) efflux by the Na-H exchanger NHE1. The first phase is restored by expression of mutant cofilin-H133A but not unphosphorylated cofilin-S3A. Constant pH molecular dynamics simulations and nuclear magnetic resonance (NMR) reveal pH-sensitive structural changes in the cofilin C-terminal filamentous actin binding site dependent on His133. However, cofilin-H133A retains pH-sensitive changes in NMR spectra and severing activity in vitro, which suggests that it has a more complex behavior in cells. Cofilin activity is inhibited by phosphoinositide binding, and we found that phosphoinositide binding is pH-dependent for wild-type cofilin, with decreased binding at a higher pH. In contrast, phosphoinositide binding by cofilin-H133A is attenuated and pH insensitive. These data suggest a molecular mechanism whereby cofilin acts as a pH sensor to mediate a pH-dependent actin filament dynamics.

Migrant Rap in the Periphery: Performing Politics of Belonging

Science.gov (United States)

Leppänen, Sirpa; Westinen, Elina

2017-01-01

Focusing on a YouTube performance by an emergent Finnish Somali rapper and the audience responses it has generated, this paper looks at ways in which rap music engages with the issue of belonging. Drawing on recent theorizations of belonging as a multi-dimensional, contingent and fluid process, along with sociolinguistic work on globalization and…

Behavioral and histological outcomes following neonatal HI injury in a preterm (P3) and term (P7) rodent model.

Science.gov (United States)

Alexander, M; Garbus, H; Smith, A L; Rosenkrantz, T S; Fitch, R H

2014-02-01

Hypoxia-ischemia (HI) occurs when blood and/or oxygen delivery to the brain is compromised. HI injuries can occur in infants born prematurely (HI populations, brain injury is associated with subsequent behavioral deficits. Neonatal HI injury can be modeled in rodents (e.g., the Rice-Vannucci method, via cautery of right carotid followed by hypoxia). When this injury is induced early in life (between postnatal day (P)1-5), neuropathologies typical of human preterm HI are modeled. When injury is induced later (P7-12), neuropathologies typical of those seen in HI term infants are modeled. The current study sought to characterize the similarities/differences between outcomes following early (P3) and late (P7) HI injury in rats. Male rats with HI injury on P3 or P7, as well as sham controls, were tested on a variety of behavioral tasks in both juvenile and adult periods. Results showed that P7 HI rats displayed deficits on motor learning, rapid auditory processing (RAP), and other learning/memory tasks, as well as a reduction in volume in various neuroanatomical structures. P3 HI animals showed only transient deficits on RAP tasks in the juvenile period (but not in adulthood), yet robust deficits on a visual attention task in adulthood. P3 HI animals did not show any significant reductions in brain volume that we could detect. These data suggest that: (1) behavioral deficits following neonatal HI are task-specific depending on timing of injury; (2) P3 HI rats showed transient deficits on RAP tasks; (3) the more pervasive behavioral deficits seen following P7 HI injury were associated with substantial global tissue loss; and (4) persistent deficits in attention in P3 HI subjects might be linked to neural connectivity disturbances rather than a global loss of brain volume, given that no such pathology was found. These combined findings can be applied to our understanding of differing long-term outcomes following neonatal HI injury in premature versus term infants

Autophagy Stimulus Promotes Early HuR Protein Activation and p62/SQSTM1 Protein Synthesis in ARPE-19 Cells by Triggering Erk1/2, p38MAPK, and JNK Kinase Pathways

Directory of Open Access Journals (Sweden)

Nicoletta Marchesi

2018-01-01

Full Text Available RNA-binding protein dysregulation and altered expression of proteins involved in the autophagy/proteasome pathway play a role in many neurodegenerative disease onset/progression, including age-related macular degeneration (AMD. HuR/ELAVL1 is a master regulator of gene expression in human physiopathology. In ARPE-19 cells exposed to the proteasomal inhibitor MG132, HuR positively affects at posttranscriptional level p62 expression, a stress response gene involved in protein aggregate clearance with a role in AMD. Here, we studied the early effects of the proautophagy AICAR + MG132 cotreatment on the HuR-p62 pathway. We treated ARPE-19 cells with Erk1/2, AMPK, p38MAPK, PKC, and JNK kinase inhibitors in the presence of AICAR + MG132 and evaluated HuR localization/phosphorylation and p62 expression. Two-hour AICAR + MG132 induces both HuR cytoplasmic translocation and threonine phosphorylation via the Erk1/2 pathway. In these conditions, p62 mRNA is loaded on polysomes and its translation in de novo protein is favored. Additionally, for the first time, we report that JNK can phosphorylate HuR, however, without modulating its localization. Our study supports HuR’s role as an upstream regulator of p62 expression in ARPE-19 cells, helps to understand better the early events in response to a proautophagy stimulus, and suggests that modulation of the autophagy-regulating kinases as potential therapeutic targets for AMD may be relevant.

In vitro gibberellin A1 binding in Zea mays L

International Nuclear Information System (INIS)

Keith, B.; Rappaport, L.

1987-01-01

The first and second leaf sheaths of Zea mays L. cv Golden Jubilee were extracted and the extract centrifuged at 100,000g to yield a supernatant or cytosol fraction. Binding of [ 3 H]gibberellin A 1 (GA 1 ) to a soluble macromolecular component present in the cytosol was demonstrated at 4 0 C by Sephadex G-200 chromatography. The binding component was of high molecular weight (HMW) and greater than 500 kilodaltons. The HMW component was shown to be a protein and the 3 H-activity bound to this protein was largely [ 3 H]GA 1 and not a metabolite. Binding was pH sensitive but only a small percentage (20%) appeared to be exchangeable on addition of unlabeled GA 1 . Both biologically active and inactive GAs and non-GAs were able to inhibit GA 1 binding. [ 3 H]GA 1 binding to an intermediate molecular weight (IMW) fraction (40-100 kilodaltons) was also detected, provided cytosol was first desalted using Sephadex G-200 chromatography. Gel filtration studies suggest that the HMW binding component is an aggregate derived from the IMW fraction. The HMW binding fraction can be separated into two components using anion exchange chromatography

Oct-1 potentiates CREB-driven cyclin D1 promoter activation via a phospho-CREB- and CREB binding protein-independent mechanism.

Science.gov (United States)

Boulon, Séverine; Dantonel, Jean-Christophe; Binet, Virginie; Vié, Annick; Blanchard, Jean-Marie; Hipskind, Robert A; Philips, Alexandre

2002-11-01

Cyclin D1, the regulatory subunit for mid-G(1) cyclin-dependent kinases, controls the expression of numerous cell cycle genes. A cyclic AMP-responsive element (CRE), located upstream of the cyclin D1 mRNA start site, integrates mitogenic signals that target the CRE-binding factor CREB, which can recruit the transcriptional coactivator CREB-binding protein (CBP). We describe an alternative mechanism for CREB-driven cyclin D1 induction that involves the ubiquitous POU domain protein Oct-1. In the breast cancer cell line MCF-7, overexpression of Oct-1 or its POU domain strongly increases transcriptional activation of cyclin D1 and GAL4 reporter genes that is specifically dependent upon CREB but independent of Oct-1 DNA binding. Gel retardation and chromatin immunoprecipitation assays confirm that POU forms a complex with CREB bound to the cyclin D1 CRE. In solution, CREB interaction with POU requires the CREB Q2 domain and, notably, occurs with CREB that is not phosphorylated on Ser 133. Accordingly, Oct-1 also potently enhances transcriptional activation mediated by a Ser133Ala CREB mutant. Oct-1/CREB synergy is not diminished by the adenovirus E1A 12S protein, a repressor of CBP coactivator function. In contrast, E1A strongly represses CBP-enhanced transactivation by CREB phosphorylated on Ser 133. Our observation that Oct-1 potentiates CREB-dependent cyclin D1 transcriptional activity independently of Ser 133 phosphorylation and E1A-sensitive coactivator function offers a new paradigm for the regulation of cyclin D1 induction by proliferative signals.

Triazoles inhibit cholesterol export from lysosomes by binding to NPC1.

Science.gov (United States)

Trinh, Michael N; Lu, Feiran; Li, Xiaochun; Das, Akash; Liang, Qiren; De Brabander, Jef K; Brown, Michael S; Goldstein, Joseph L

2017-01-03

Niemann-Pick C1 (NPC1), a membrane protein of lysosomes, is required for the export of cholesterol derived from receptor-mediated endocytosis of LDL. Lysosomal cholesterol export is reportedly inhibited by itraconazole, a triazole that is used as an antifungal drug [Xu et al. (2010) Proc Natl Acad Sci USA 107:4764-4769]. Here we show that posaconazole, another triazole, also blocks cholesterol export from lysosomes. We prepared P-X, a photoactivatable cross-linking derivative of posaconazole. P-X cross-linked to NPC1 when added to intact cells. Cross-linking was inhibited by itraconazole but not by ketoconazole, an imidazole that does not block cholesterol export. Cross-linking of P-X was also blocked by U18666A, a compound that has been shown to bind to NPC1 and inhibit cholesterol export. P-X also cross-linked to purified NPC1 that was incorporated into lipid bilayer nanodiscs. In this in vitro system, cross-linking of P-X was inhibited by itraconazole, but not by U18666A. P-X cross-linking was not prevented by deletion of the N-terminal domain of NPC1, which contains the initial binding site for cholesterol. In contrast, P-X cross-linking was reduced when NPC1 contained a point mutation (P691S) in its putative sterol-sensing domain. We hypothesize that the sterol-sensing domain has a binding site that can accommodate structurally different ligands.

(LBA-and-WRM)-based DBA scheme for multi-wavelength upstream transmission supporting 10 Gbps and 1 Gbps in MAN

Science.gov (United States)

Zhang, Yuchao; Gan, Chaoqin; Gou, Kaiyu; Xu, Anni; Ma, Jiamin

2018-01-01

DBA scheme based on Load balance algorithm (LBA) and wavelength recycle mechanism (WRM) for multi-wavelength upstream transmission is proposed in this paper. According to 1 Gbps and 10 Gbps line rates, ONUs are grouped into different VPONs. To facilitate wavelength management, resource pool is proposed to record wavelength state. To realize quantitative analysis, a mathematical model describing metro-access network (MAN) environment is presented. To 10G-EPON upstream, load balance algorithm is designed to ensure load distribution fairness for 10G-OLTs. To 1G-EPON upstream, wavelength recycle mechanism is designed to share remained wavelengths. Finally, the effectiveness of the proposed scheme is demonstrated by simulation and analysis.

Rap Therapy? An Innovative Approach to Groupwork with Urban Adolescents.

Science.gov (United States)

DeCarlo, Alonzo

2001-01-01

Describes a study in which young, urban African American adolescents with behavior problems participated in weekly group sessions that used rap music to promote the development of appropriate social skills related to morality, identity, judgement, decision making, anger management, impulse control, and crime and punishment. Overall, student…

In silico binding affinity studies of N-9 substituted 6-(4-(4-propoxyphenylpiperazin-1-yl-9H-purine derivatives-Target for P70-S6K1 & PI3K-δ kinases

Directory of Open Access Journals (Sweden)

Manjunath G. Sunagar

2018-03-01

Full Text Available P70-S6K1 & PI3K-δ kinases are identified to be involved in many physiological processes associated with cancer, therefore many of the inhibitors being designed to target these kinases are in clinical trials. In the current study we have exploited the N-9 substituted 6-(4-(4-propoxyphenyl piperazin-1-yl-9H-purine derivatives for their inhibitory properties with the above kinases. We have used an in silico docking study with seventeen purine derivatives for their binding affinity calculations. The binding affinities of these small molecules with P70-S6K1 & PI3K-δ were performed using AutoDock Vina. Among all the compounds, PP16 showed highest binding affinity of −14.7 kcal/mol with P70-S6K1 kinase & −17.2 kcal/mol with PI3K-δ kinases as compared to the molecules under clinical trials (PF-4708671 & IC-87114. Docking studies revealed that N-9 coumarine substituted purine derivative could be one of the potential ligands for the inhibition of P70-S6K1 & PI3K-δ kinases. Hence, this compound can be further investigated by in vitro and in vivo experiments for further validation.

Physics evaluation for testino. of RAPS and TAPS fuel pins in CIRUS pressurised water loop

International Nuclear Information System (INIS)

John, Benjamin; Paul, O.P.K.

1976-01-01

Relevant calculations carried out to assess the reactivity effect, heat generation and other parameters for testing of RAPS and TAPS fuel pins in the Cirus pressurised water loop are summarised. The Cirus neutron flux level being low, in order to simulate the RAPS design heat rating of ∫ Kdtheta = 40 w/cm, the required plutonium enrichment in mixed plutonium uranium oxide fuel pin was worked out. The results showed that a PuO 2 enrichment of 1.5 wt percent would be necessary to meet the above requirement. The analysis for the TAPS pin indicated that the desired heat flux of 115w/cm 2 cannot be obtained in the Cirus loop with either a 7 pin cluster geometry, or with a single pin with the enrichment level as used in TAPS pin. Lattice code DUMLAC and the core simulation code AECLHEX were used for these studies. (author)

Two distinct affinity binding sites for IL-1 on human cell lines

International Nuclear Information System (INIS)

Bensimon, C.; Wakasugi, N.; Tagaya, Y.; Takakura, K.; Yodoi, J.; Tursz, T.; Wakasugi, H.

1989-01-01

We used two human cell lines, NK-like YT-C3 and an EBV-containing B cell line, 3B6, as models to study the receptor(s) for IL-1. Two distinct types of saturable binding sites were found on both cell lines at 37 degrees C. Between 1 pM and 100 pM of 125I-IL-1-alpha concentration, saturable binding sites were detected on the YT-C3 cells with a K of 4 x 10(-11) M. The K found for the IL-1-alpha binding sites on 3B6 cells was 7.5 x 10(-11) M. An additional binding curve was detected above 100 pM on YT-C3 cells with a K of 7 x 10(-9) M and on 3B6 cells with a K of 5 x 10(-9) M. Scatchard plot analysis revealed 600 sites/cell with high affinity binding and 7000 sites/cell with low affinity for YT-C3 cells and 300 sites/cell with high affinity binding and 6000 sites/cell with low affinity for 3B6 cells. At 37 degrees C, the internalization of 125I-labeled IL-1 occurred via both high and low affinity IL-1R on both YT-C3 and 3B6 cells, whereas the rates of internalization for high affinity binding sites on YT-C3 cells were predominant in comparison to that of low affinity binding sites. In chemical cross-linking studies of 125 I-IL-1-alpha to 3B6 and YT-C3 cells, two protein bands were immunoprecipitated with Mr around 85 to 90 kDa leading to an estimation of the Mr of the IL-1R around 68 to 72 kDa. In similar experiments, the Mr found for the IL-1R expressed on the murine T cell line EL4 was slightly higher (around 80 kDa). Whether these distinct affinity binding sites are shared by a single molecule or by various chains remains to be elucidated

A novel-type phosphatidylinositol phosphate-interactive, Ca-binding protein PCaP1 in Arabidopsis thaliana: stable association with plasma membrane and partial involvement in stomata closure.

Science.gov (United States)

Nagata, Chisako; Miwa, Chika; Tanaka, Natsuki; Kato, Mariko; Suito, Momoe; Tsuchihira, Ayako; Sato, Yori; Segami, Shoji; Maeshima, Masayoshi

2016-05-01

The Ca(2+)-binding protein-1 (PCaP1) of Arabidopsis thaliana is a new type protein that binds to phosphatidylinositol phosphates and Ca(2+)-calmodulin complex as well as free Ca(2+). Although biochemical properties, such as binding to ligands and N-myristoylation, have been revealed, the intracellular localization, tissue and cell specificity, integrity of membrane association and physiological roles of PCaP1 are unknown. We investigated the tissue and intracellular distribution of PCaP1 by using transgenic lines expressing PCaP1 linked with a green fluorescence protein (GFP) at the carboxyl terminus of PCaP1. GFP fluorescence was obviously detected in most tissues including root, stem, leaf and flower. In these tissues, PCaP1-GFP signal was observed predominantly in the plasma membrane even under physiological stress conditions but not in other organelles. The fluorescence was detected in the cytosol when the 25-residue N-terminal sequence was deleted from PCaP1 indicating essential contribution of N-myristoylation to the plasma membrane anchoring. Fluorescence intensity of PCaP1-GFP in roots was slightly decreased in seedlings grown in medium supplemented with high concentrations of iron for 1 week and increased in those grown with copper. In stomatal guard cells, PCaP1-GFP was strictly, specifically localized to the plasma membrane at the epidermal-cell side but not at the pore side. A T-DNA insertion mutant line of PCaP1 did not show marked phenotype in a life cycle except for well growth under high CO2 conditions. However, stomata of the mutant line did not close entirely even in high osmolarity, which usually induces stomata closure. These results suggest that PCaP1 is involved in the stomatal movement, especially closure process, in leaves and response to excessive copper in root and leaf as a mineral nutrient as a physiological role.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

Science.gov (United States)

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

Energy Technology Data Exchange (ETDEWEB)

Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)

2008-05-01

The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.

RAP-2A Computer code for transients analysis in fast reactors

International Nuclear Information System (INIS)

Iftode, I.; Popescu, C.; Turcu, I.; Biro, L.

1975-10-01

The RAP-2A computer code is designed for analyzing thermohydraulic transients and/or steady state problems for large LMFBR cores. Physical and mathematical models, main input-output data, the flow chart of the code and a sample problem are given. RAP-2A calculates the power and the thermoydraulic transients initiated by a flow or reactivity changes, from a normal operating state of the reactor up to core disassembly. In this analysis a representative fuel pin is considered: a one-group space-independent (point) kinetics model to describe the neutron kinetics and a one-dimensional model describing the heat transfer (radial in the fuel and axial in the coolant) are used. Mechanical deformations due to temperature gradient, pressure losses, fuel melting, etc., are also calculated. The code is written in FORTRAN-4 language and is running on a IBM-370/135 computer

CC1, a novel crenarchaeal DNA binding protein.

Science.gov (United States)

Luo, Xiao; Schwarz-Linek, Uli; Botting, Catherine H; Hensel, Reinhard; Siebers, Bettina; White, Malcolm F

2007-01-01

The genomes of the related crenarchaea Pyrobaculum aerophilum and Thermoproteus tenax lack any obvious gene encoding a single-stranded DNA binding protein (SSB). SSBs are essential for DNA replication, recombination, and repair and are found in all other genomes across the three domains of life. These two archaeal genomes also have only one identifiable gene encoding a chromatin protein (the Alba protein), while most other archaea have at least two different abundant chromatin proteins. We performed a biochemical screen for novel nucleic acid binding proteins present in cell extracts of T. tenax. An assay for proteins capable of binding to a single-stranded DNA oligonucleotide resulted in identification of three proteins. The first protein, Alba, has been shown previously to bind single-stranded DNA as well as duplex DNA. The two other proteins, which we designated CC1 (for crenarchaeal chromatin protein 1), are very closely related to one another, and homologs are restricted to the P. aerophilum and Aeropyrum pernix genomes. CC1 is a 6-kDa, monomeric, basic protein that is expressed at a high level in T. tenax. This protein binds single- and double-stranded DNAs with similar affinities. These properties are consistent with a role for CC1 as a crenarchaeal chromatin protein.

Mapping Substance P Binding Sites on the Neurokinin-1 Receptor Using Genetic Incorporation of a Photoreactive Amino Acid

DEFF Research Database (Denmark)

Valentin-Hansen, Louise; Park, Minyoung; Huber, Thomas

2014-01-01

that the binding site for SP includes multiple domains in the N-terminal (Nt) segment and the second extracellular loop (ECLII) of NK1. To map precisely the NK1 residues that interact with SP, we applied a novel receptor-based targeted photocross-linking approach. We used amber codon suppression to introduce...... the photoreactive unnatural amino acid p-benzoyl-l-phenylalanine (BzF) at 11 selected individual positions in the Nt tail (residues 11-21) and 23 positions in the ECLII (residues 170(C-10)-193(C+13)) of NK1. The 34 NK1 variants were expressed in mammalian HEK293 cells and retained the ability to interact...

Binding behaviors of p-sulfonatocalix[4]arene with gemini guests.

Science.gov (United States)

Zhao, Hong-Xia; Guo, Dong-Sheng; Liu, Yu

2013-02-14

A dozen of homoditopic cations, possessing different spacer lengths and rigidities, as well as sizes, shapes, and charges of terminal groups, were synthesized as candidate gemini guests for the complexation of p-sulfonatocalix[4]arenes (SC4A). The 12 gemini guests are divided into five species according to the different terminal groups: imidazolium (G1-G3), pyridinium (G4-G6), quinolinium (G7), viologen (G8-G11), and 1,4-diazabicyclo[2.2.2]octane (DBO, G12). Their binding structures and stoichiometries with SC4A were examined by NMR spectroscopy, which is helpful to construct diverse highly ordered assemblies. The obtained results show that the length of the linkers, as well as the charge numbers on the end groups have a pronounced effect on the binding stoichiometry, whereas the size and shape of the terminal groups have no significant influence. Furthermore, both the stability constants and thermodynamic parameters of SC4A with the terminal subunits were determined by the isothermal titration calorimetry experiments, which are valuable to understand the binding behavior, giving quantitatively deep insight.

Meeting the challenge : capturing the upstream

International Nuclear Information System (INIS)

Bogle, E.W.

1998-01-01

The challenge facing the exploration and production sector of the petroleum industry to capture and hold onto the upstream was the main focus of this paper. The exploration and production (E and P) business was described as being highly complex, characterized by constant change and increasing competition. Some of the dynamic changes which have occurred in the Western Canada Basin (WCB) during the last five years and how they relate to the international playing field were reviewed. Significant changes to the production ranking profile as a result of acquisitions, and basin reserve endowment and maturity are the two major factors affecting current and future dynamics of upstream WCB E and P activity. Competitive pressures, contractor relationships, infrastructure access and controls, environmental issues are some of the other factors. Taking these factors into account, Talisman Energy Inc. has used its growth in the WCB to leverage its international activities, diversifying to less mature, but proven hydrocarbon basins. The company's international exploration strategy is designed to be adaptive and flexible and is guided by focus on a limited number of core areas with proven source rock and existing production, achievement of a set production level within a five-year time frame, ensuring strong relationships with host governments and partners, and selecting areas where a multiple of opportunity types are available. In general, for any upstream company it is important to recognize that the more predictable traditional order has given way to a market-driven environment where the rules change almost daily, and success depends on the ability to adapt to change.14 figs

Posttranscriptional regulation of the karyogamy gene by Kem1p/Xrn1p exoribonuclease and Rok1p RNA helicase of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Kim, Jaehee; Jeon, Soonmee; Yang, Yun-Seok; Kim, Jinmi

2004-01-01

The major biochemical activities ascribed to Kem1p/Xrn1p of Saccharomyces cerevisiae are 5'-3' exoribonuclease functioning in RNA turnover and a microtubule-binding protein. Mutational analysis has shown that Kem1p/Xrn1p participates in microtubule-related functions such as nuclear fusion (karyogamy) during mating, chromosome transmission, and spindle pole body duplication. Here, evidence is presented that Kem1p plays a specific role in nuclear fusion by affecting, at the posttranscriptional level, the pheromone induction of the karyogamy-specific transcription factor Kar4p and the expression of Rok1p, a putative RNA helicase. We found that Rok1p itself also affects the pheromone induction of Kar4p and thereby participates in nuclear fusion. Analysis of the active-site mutations, xrn1-D206A or D208A, shows that nuclear fusion as well as the Rok1p synthesis do not require the exoribonuclease activity of Kem1p. Our data provide an important insight into the gene-specific regulatory function mediated by the general RNA-modulating enzymes

Rap como identidade cultural negra e periférica: a aversão de rappers brasileiros a Rede Globo

OpenAIRE

Júnior, Francisco Carlos Guerra de Mendonça

2014-01-01

Dissertação de Mestrado em Comunicação e Jornalismo, apresentada à Faculdade de Letras da Universidade de Coimbra. O rap (rhythm and poetry – ritmo e poesia) é a vertente musical do movimento hip hop, que surgiu nos Estados Unidos na década de 1960. Além do rap, o hip hop conta com MC´s (Mestres de Cerimônia), os DJ´s (disc-joqueys), a dança (break dance) e a pintura (grafith). O rap passou a ser um método utilizado para conscientizar a população sobre os problemas vivenciados pelos negros...

Remote ultrasonic characterisation of an irradiated pressure tube from RAPS-II

Energy Technology Data Exchange (ETDEWEB)

Gangotra, S; Muralidhar, S; Raut, S D; Ouseph, P M; Ghosh, J K; Sahoo, K C [Bhabha Atomic Research Centre, Bombay (India). Radiometallurgy Div.

1994-12-31

The Rajasthan Atomic Power Station Unit-2 (RAPS-2) has reached a stage of operation where the contacting pressure tubes are suspect to failure as a result of irradiation creep and displacement of the garter springs, the hot pressure tube coming in contact with the cold calandria tube. To study and assess the safety of these pressure tubes, two channels believed to be in contact with the calandria tubes, have been removed from the reactor for detailed full length post irradiation examination. Some of the test results are presented. 2 refs., 3 figs., 1 tab.

The PDZ domain of the guanine nucleotide exchange factor PDZGEF directs binding to phosphatidic acid during brush border formation.

Directory of Open Access Journals (Sweden)

Sarah V Consonni

Full Text Available PDZGEF is a guanine nucleotide exchange factor for the small G protein Rap. It was recently found that PDZGEF contributes to establishment of intestinal epithelial polarity downstream of the kinase Lkb1. By binding to phosphatidic acid enriched at the apical membrane, PDZGEF locally activates Rap2a resulting in induction of brush border formation via a pathway that includes the polarity players TNIK, Mst4 and Ezrin. Here we show that the PDZ domain of PDZGEF is essential and sufficient for targeting PDZGEF to the apical membrane of polarized intestinal epithelial cells. Inhibition of PLD and consequently production of phosphatidic acid inhibitis targeting of PDZGEF to the plasma membrane. Furthermore, localization requires specific positively charged residues within the PDZ domain. We conclude that local accumulation of PDZGEF at the apical membrane during establishment of epithelial polarity is mediated by electrostatic interactions between positively charged side chains in the PDZ domain and negatively charged phosphatidic acid.

Immunological and biological properties of recombinant Lol p 1.

Science.gov (United States)

Boutin, Y; Lamontagne, P; Boulanger, J; Brunet, C; Hébert, J

1997-03-01

Current forms of allergy diagnosis and therapies are based on the use of natural allergenic extracts. Despite strong evidence that higher therapeutic efficacy may be achieved with purified allergens, the purification of multiple allergic components from extracts is a fastidious and sometimes an impossible task. However, the use of recombinant allergens may be an alternative to overcome this problem. In this study, we compared the immunological properties of recombinant (r) Lol p 1 with those of the natural protein. We cloned directly the gene encoding Lol p 1 from genomic DNA of ryegrass pollen. This gene was subcloned into the expression vector pMAL-c and expressed as fusion protein. Subsequently, rLol p 1 was cleaved from maltose-binding protein using factor Xa. Using binding inhibition and proliferative assays, we assessed the immunological properties of the recombinant allergens. The capacity of rLol p 1 to trigger basophil histamine release and to elicit a skin reaction was also assessed and compared to those of its natural counterpart. We found that the Lol p 1 gene has no introns since we amplified this gene directly from genomic DNA. We demonstrated that the binding sites of anti-Lol p 1 monoclonal antibody, specific human IgG and IgE antibody are well conserved on rLol p 1 as no difference in the binding inhibition profile was observed when using either natural or recombinant protein. At the T-cell level, rLol p 1 elicited a T-cell response in mice comparable to that observed with the natural protein. In addition, we demonstrated that the biological characteristics of rLol p 1 were comparable to those of the natural counterpart, in that rLol p 1 elicited a skin wheal reaction and induced basophil histamine release in grass-allergic patients only. The data indicate that natural Lol p 1 and rLol p 1 shared identical immunological and biological properties.

Vitek 2 ANC card versus BBL Crystal Anaerobe and RapID ANA II for identification of clinical anaerobic bacteria.

Science.gov (United States)

Blairon, Laurent; Maza, Mengi L; Wybo, Ingrid; Piérard, Denis; Dediste, Anne; Vandenberg, Olivier

2010-08-01

The Vitek 2 Anaerobe and Corynebacterium Identification Card (ANC) was recently evaluated in a multicentre study. In the present work, this system was compared with the BBL Crystal Anaerobe and RapID ANA II panels. These kits were tested using 196 strains of anaerobes that had been previously identified by gas-liquid chromatography. Identification to the species or to the genus level was 75.0%, 81.1% and 70.9% for Crystal, RapID and Vitek, respectively. Vitek ANC failed to provide any identification in 20.4% of the strains, but it had fewer misidentifications than RapID. The confidence factors provided on the results report of each kit were not always correlated with a lower risk of major errors, with the exception of Vitek 2 in which a confidence factor higher than 0.86 excluded the risk of misidentification in more than 87% of isolates. The lower rate of identification by the Vitek and Crystal panels is mostly due the lower ability of these systems to identify the Clostridia. Overall, the three panels are comparable but need improvement to a better accuracy. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

Science.gov (United States)

Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

2016-04-07

The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.