WorldWideScience

Sample records for range hopping model

  1. Exact solution of the infinite-range-hopping Bose-Hubbard model

    CERN Document Server

    Bru, J B

    2003-01-01

    The thermodynamic behavior of the Bose-Hubbard model is solved for any temperature and any chemical potential. It is found that there is a range of critical coupling strengths $\\lambda_{c1} < \\lambda_{c2} < \\lambda_{c3} < \\dots $ in this model. For coupling strengths between $\\lambda_{c,k}$ and $% \\lambda_{c,k+1}$, Bose-Einstein condensation is suppressed at densities near the integer values $\\rho = 1, \\dots, k$ with an energy gap. This is known as a Mott insulator phase and was previously shown only for zero temperature. In the context of ultra-cold atoms, this phenomenon was experimentally observed in 2002 \\cite{BoseCondInsulator1} but, in the Bose-Hubbard model, it manifests itself also in the pressure-volume diagram at high pressures. It is suggested that this phenomenon persists for finite-range hopping and might also be experimentally observable.

  2. Effect of long-range hopping on Tc in a two-dimensional Hubbard-Holstein model of the cuprates

    Science.gov (United States)

    Khatami, E.; Macridin, A.; Jarrell, M.

    2008-08-01

    We study the effect of long-range hoppings on Tc for the two-dimensional (2D) Hubbard model with and without Holstein phonons using parameters evaluated from band-structure calculations for cuprates. Employing the dynamical cluster approximation (DCA) with a quantum Monte Carlo (QMC) cluster solver for a 4-site cluster, we observe that without phonons, the long-range hoppings, t' and t″ , generally suppress Tc . We argue that this trend remains valid for larger clusters. In the presence of the Holstein phonons, a finite t' enhances Tc in the under-doped region for the hole-doped system, consistent with local-density approximation (LDA) calculations and experiment. This is interpreted through the suppression of antiferromagnetic (AF) correlations and the interplay between polaronic effects and the antiferromagnetism.

  3. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  4. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  5. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  6. Variable-range electron hopping, conductivity cross-over and space-charge relaxation in C60Br6

    OpenAIRE

    Manesh, Zachariah; Romanini, Michela; Zygouri, Panagiota; Gournis, Dimitrios; Tamarit Mur, José Luis; Barrio Casado, María del; Macovez, Roberto

    2016-01-01

    Dielectric spectroscopy is employed to probe the frequency-dependent conductivity and dipolar dielectric response of solid C60Br6. Below approximately 215 K, charge conduction is electronic and well described by Mott's variable-range polaron hopping model, with effective hopping activation energy Ea varying between 0.12 eV at 125 K and 0.16 eV at 220 K, and most probable hopping range varying between 100 and 125% of the decay length of the localized polaron's wavefunction. Above 215 K a new c...

  7. Field dependence of hopping mobility: Lattice models against spatial disorder

    Science.gov (United States)

    Oelerich, J. O.; Nenashev, A. V.; Dvurechenskii, A. V.; Gebhard, F.; Baranovskii, S. D.

    2017-11-01

    The theoretical description of the effect of the electric field F on the hopping mobility μ belongs to the not-yet-resolved problems related to charge transport in disordered materials. An often proposed solution is to simulate hopping transport via sites placed on regular grids and to fit the results by phenomenological equations. This approach currently dominates the theoretical research of hopping transport in organic disordered semiconductors. We show that the dependence μ (F ) in the case of regular grids can drastically differ from that in systems with spatial disorder. While μ increases with F on lattices, it can decrease in random systems with the same material parameters. Moreover, the material parameters responsible for the dependence μ (F ) on lattices differ from those responsible for μ (F ) in spatially disordered systems, which makes lattice models inappropriate for studying the field dependence of the hopping mobility.

  8. Application of time-hopping UWB range-bit rate performance in the UWB sensor networks

    NARCIS (Netherlands)

    Nascimento, J.R.V. do; Nikookar, H.

    2008-01-01

    In this paper, the achievable range-bit rate performance is evaluated for Time-Hopping (TH) UWB networks complying with the FCC outdoor emission limits in the presence of Multiple Access Interference (MAI). Application of TH-UWB range-bit rate performance is presented for UWB sensor networks.

  9. A Multi-hop Topology Control Based on Inter-node Range Measurement for Wireless Sensor Networks Node Localization

    Directory of Open Access Journals (Sweden)

    Ali Husein ALASIRY

    2011-10-01

    Full Text Available In centralized range-based localization techniques, sufficiency of inter-node range information received by the base station strongly affects node position estimation results. Successful data aggregation is influenced by link stability of each connection of routes, especially in a multi-hop topology model. In general, measuring the inter-node range is only performed for position determination purposes. This research introduces the use of inter-node range measurement information for link selection in a multi-hop route composition in order to increase the rate of data aggregation. Due to irregularity problems of wireless media, two areas of node communication have been considered. The regular communication area is the area in which other nodes are able to perform symmetrical communication to the node without failure. The irregular area is the area in which other nodes are seldom able to communicate. Due to its instability, some existing methods tried to avoid the irregular area completely. The proposed method, named Virtual Boundaries (VBs prioritizes these areas. The regular communication area’s nodes have high priority to be selected as link vertices; however, when there is no link candidate inside this area, nodes within the irregular area will be selected with respect to their range to the parent node. This technique resulted in a more robust multi-hop topology that can reduce isolated node numbers and increase the percentage of data collected by the base station accordingly.

  10. Variable-range hopping conductivity in Lu-doped Bi2Te3

    Science.gov (United States)

    Ivanov, Oleg; Yaprintsev, Maxim

    2018-02-01

    The Seebeck coefficient enhancement due to an increase of density-of-states effective mass of electron has been found in n-type Bi1.9Lu0.1Te3. This enhancement is assumed to be related to forming the narrow and non-parabolic impurity (Lu) band with local maximum of electronic density of states lying near the Fermi level. Minimum in the specific electrical resistivity, ρ, originated from change of conductivity mechanism was observed at temperature Tm ≈ 11 K. Above Tm, the ρ change is due to decrease of electron mobility via acoustic phonon scattering. Below Tm, the variable-range hopping conductivity takes place. The electron hops between the localized states of the impurity energy band occur via tunneling process. Using the temperature and magnetic field dependences of ρ, the localization radius of electron was estimated as ≈6 nm. Two parts in the magnetic field dependence of the electrical resistivity were found at temperature of 2 K. At weak magnetic fields, the ρ change is in agreement with the variable-range hopping conductivity mechanism. At high magnetic fields, the positive and almost linear transverse and longitudinal magnetoresistances were observed at low temperatures. Both variable-range hopping conductivity and positive linear magnetoresistance are characteristics of disordered and inhomogeneous semiconductors.

  11. Exact results on the steady state of a hopping model

    Science.gov (United States)

    Zhang, M. Q.

    1987-03-01

    A hopping model described by Katz, Lebowitz, and Spohn [J. Stat. Phys. 34, 497 (1983)] and by Valles and Marro [J. Stat. Phys. 43, 441 (1986)] is studied analytically for small lattice systems. The dependence of the nonequilibrium steady state on various parameters and transition rate functions is obtained exactly. The results are compared with simulations on large systems.

  12. The mesoscopic conductance of disordered rings, its random matrix theory and the generalized variable range hopping picture

    Energy Technology Data Exchange (ETDEWEB)

    Stotland, Alexander; Peer, Tal; Cohen, Doron [Department of Physics, Ben-Gurion University, Beer-Sheva 84005 (Israel); Budoyo, Rangga; Kottos, Tsampikos [Department of Physics, Wesleyan University, Middletown, CT 06459 (United States)

    2008-07-11

    The calculation of the conductance of disordered rings requires a theory that goes beyond the Kubo-Drude formulation. Assuming 'mesoscopic' circumstances the analysis of the electro-driven transitions shows similarities with a percolation problem in energy space. We argue that the texture and the sparsity of the perturbation matrix dictate the value of the conductance, and study its dependence on the disorder strength, ranging from the ballistic to the Anderson localization regime. An improved sparse random matrix model is introduced to capture the essential ingredients of the problem, and leads to a generalized variable range hopping picture. (fast track communication)

  13. Electrical and thermoelectric transport by variable range hopping in reduced graphene oxide

    Science.gov (United States)

    Park, Min; Hong, Sung Ju; Kim, Kyung Ho; Kang, Hojin; Lee, Minwoo; Jeong, Dae Hong; Park, Yung Woo; Kim, Byung Hoon

    2017-10-01

    This study investigated the transport properties of single-layer reduced graphene oxides (rGOs). The rGOs were prepared by the bubble deposition method followed by thermal reduction. The crossover of the transport mechanism from Efros-Shklovskii (ES) variable range hopping (VRH) between the localized states to Mott-VRH was observed near 70 K using the temperature-dependent conductance. The ES-VRH conduction below 70 K is apparent in the electric field dependence of the field-driven hopping transport in the high-electric field regime. We also figure out that the thermoelectric power is consistent with the 2D Mott VRH above 70 K. We argue that the VRH conduction results from the topological disorders of rGO as confirmed by Raman spectroscopy. This infers that the average distance between defects is approximately 2.0 nm.

  14. Variable range hopping in TiO2 insulating layers for oxide electronic devices

    Directory of Open Access Journals (Sweden)

    Y. L. Zhao

    2012-03-01

    Full Text Available TiO2 thin films are of importance in oxide electronics, e.g., Pt/TiO2/Pt for memristors and Co-TiO2/TiO2/Co-TiO2 for spin tunneling devices. When such structures are deposited at a variety of oxygen pressures, how does TiO2 behave as an insulator? We report the discovery of an anomalous resistivity minimum in a TiO2 film at low pressure (not strongly dependent on deposition temperature. Hall measurements rule out band transport and in most of the pressure range the transport is variable range hopping (VRH though below 20 K it was difficult to differentiate between Mott and Efros-Shklovskii's (ES mechanism. Magnetoresistance (MR of the sample with lowest resistivity was positive at low temperature (for VRH but negative above 10 K indicating quantum interference effects.

  15. Surface hopping modeling of two-dimensional spectra

    NARCIS (Netherlands)

    Tempelaar, Roel; Vegte, Cornelis P. van der; Knoester, Jasper; Jansen, Thomas L.C.

    2013-01-01

    Recently, two-dimensional (2D) electronic spectroscopy has become an important tool to unravel the excited state properties of complex molecular assemblies, such as biological light harvesting systems. In this work, we propose a method for simulating 2D electronic spectra based on a surface hopping

  16. Random free energy barrier hopping model for ac conduction in chalcogenide glasses

    Directory of Open Access Journals (Sweden)

    Ram Murti

    2016-03-01

    Full Text Available The random free energy barrier hopping model is proposed to explain the ac conductivity (σac of chalcogenide glasses. The Coulomb correlation is consistently accounted for in the polarizability and defect distribution functions and the relaxation time is augmented to include the overlapping of hopping particle wave functions. It is observed that ac and dc conduction in chalcogenides are due to same mechanism and Meyer-Neldel (MN rule is the consequence of temperature dependence of hopping barriers. The exponential parameter s is calculated and it is found that s is subjected to sample preparation and measurement conditions and its value can be less than or greater than one. The calculated results for a − Se, As2S3, As2Se3 and As2Te3 are found in close agreement with the experimental data. The bipolaron and single polaron hopping contributions dominates at lower and higher temperatures respectively and in addition to high energy optical phonons, low energy optical and high energy acoustic phonons also contribute to the hopping process. The variations of hopping distance with temperature is also studied. The estimated defect number density and static barrier heights are compared with other existing calculations.

  17. Quantum simulation of correlated-hopping models with fermions in optical lattices

    NARCIS (Netherlands)

    Liberto, M. Di; Creffield, C. E.; Japaridze, G. I.; Smith, C. Morais

    2014-01-01

    By using a modulated magnetic field in a Feshbach resonance for ultracold fermionic atoms in optical lattices, we show that it is possible to engineer a class of models usually referred to as correlated-hopping models. These models differ from the Hubbard model in exhibiting additional

  18. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model.

    Science.gov (United States)

    Dou, Wenjie; Nitzan, Abraham; Subotnik, Joseph E

    2015-02-28

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along--and hops between--diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case of out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.

  19. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    Science.gov (United States)

    Dou, Wenjie; Nitzan, Abraham; Subotnik, Joseph E.

    2015-02-01

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along-and hops between-diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case of out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.

  20. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    Energy Technology Data Exchange (ETDEWEB)

    Dou, Wenjie; Subotnik, Joseph E. [Department of Chemistry, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States); Nitzan, Abraham [School of Chemistry, The Sackler Faculty of Science, Tel Aviv University, Tel Aviv 69978 (Israel)

    2015-02-28

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case of out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.

  1. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  2. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid

    2015-11-19

    Carrier sense multiple access (CSMA) protocol is standardized for vehicular communication to ensure a distributed and efficient communication between vehicles. However, several vehicular applications require efficient multi-hop information dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per-hop packet forward progress, per-hop transmission success probability, and spatial frequency reuse (SFR) efficiency imposed by different packet forwarding schemes, namely, most forward with fixed radius (MFR), the nearest with forward progress (NFP), and the random with forward progress (RFP). We also define a new performance metric, denoted as the aggregate packet progress (APP), which is a dimensionless quantity that captures the aforementioned tradeoffs. To this end, the developed model reveals the interplay between the spectrum sensing threshold (th) of the CSMA protocol and the packet forwarding scheme. Our results show that, in contrary to ALOHA networks which always favor NFP, MFR may achieve the highest APP in CSMA networks if th is properly chosen.

  3. Nonadiabatic surface hopping Herman-Kluk semiclassical initial value representation method revisited: applications to Tully's three model systems.

    Science.gov (United States)

    Wu, Yinghua; Herman, Michael F

    2005-10-08

    The nonadiabatic surface hopping Herman-Kluk (HK) semiclassical initial value representation (SC-IVR) method for nonadiabatic problems is reformulated. The method has the same spirit as Tully's surface hopping technique [J. Chem. Phys. 93, 1061 (1990)] and almost keeps the same structure as the original single-surface HK SC-IVR method except that trajectories can hop to other surfaces according to the hopping probabilities and phases, which can be easily integrated along the paths. The method is based on a rather general nonadiabatic semiclassical surface hopping theory developed by Herman [J. Chem. Phys. 103, 8081 (1995)], which has been shown to be accurate to the first order in h and through all the orders of the nonadiabatic coupling amplitude. Our simulation studies on the three model systems suggested by Tully demonstrate that this method is practical and capable of describing nonadiabatic quantum dynamics for various coupling situations in very good agreement with benchmark calculations.

  4. Investigation of hopped frequency waveforms for range and velocity measurements of radar targets

    CSIR Research Space (South Africa)

    Kathree, U

    2015-10-01

    Full Text Available In the field of radar, High Range Resolution (HRR) profiles are often used to improve target tracking accuracy in range and to allow the radar system to produce an image of an object using techniques such as inverse synthetic aperture radar (ISAR...

  5. Poole-Frenkel effect and variable-range hopping conduction in metal/YBCO resistive switching devices

    Science.gov (United States)

    Schulman, A.; Lanosa, L. F.; Acha, C.

    2015-07-01

    Current-voltage (IV) characteristics and the temperature dependence of the contact resistance [R(T)] of Au/YBa2Cu3O7-δ (optimally doped YBCO) interfaces have been studied at different resistance states. These states were produced by resistive switching after accumulating cyclic electrical pulses of increasing number and voltage amplitude. The IV characteristics and the R(T) dependence of the different states are consistent with a Poole-Frenkel (P-F) emission mechanism with trapping-energy levels Et in the 0.06-0.11 eV range. Et remains constant up to a number-of-pulses-dependent critical voltage and increases linearly with a further increase in the voltage amplitude of the pulses. The observation of a P-F mechanism reveals the existence of an oxygen-depleted layer of YBCO near the interface. A simple electrical transport scenario is discussed, where the degree of disorder, the trap energy level, and the temperature range determine an electrical conduction dominated by non-linear effects, either in a P-F emission or in a variable-range hopping regime.

  6. Thermally assisted variable range hopping in Tl4S3Se crystal

    Indian Academy of Sciences (India)

    electrical parameters that are necessary for the construction of electronic devices like absorption layers in solar cells. This proposed model is also used to explain the conduction mechanism and .... The details of this theory are clearly discussed in the study by Abtew et al.9 In the current study, it is sufficient to recall that the ...

  7. Possible half-metallicity and variable range hopping transport in Sb-substituted Fe2TiSn Heusler alloys

    Science.gov (United States)

    Chaudhuri, S.; Bhobe, P. A.; Nigam, A. K.

    2018-01-01

    The investigation of the magnetotransport properties on Fe2 TiSn1-x Sb x with 0 ≤slant x ≤slant 0.6 are presented in this paper. The substitution of Sb in place of Sn decreases the anti-site disorder as evident from x-ray diffraction patterns as well as from transport properties measurement. The much-disputed upturn in low temperature electrical resistivity of Fe2 TiSn has been demonstrated to be a result of weak localization induced by anti-site disorder. With increased Sb substitution (⩾25%) the metallic transport behavior of Fe2 TiSn changes to semiconductor-like. At low temperature, carrier transport in such compositions occurs via the variable range hopping mechanism. Moreover, a systematic increase in the anomalous Hall voltage is observed with increasing Sb-content, attributable to a side jump or Berry phase curvature effect. Electrical resistivity in the entire temperature regime hints towards half metallicity of the system. Our ab initio electronic structure calculations using generalised gradient approximation formalism further supports the results of our magnetotransport study.

  8. Hop-distance relationship analysis with quasi-UDG model for node localization in wireless sensor networks

    Directory of Open Access Journals (Sweden)

    Chen Ping

    2011-01-01

    Full Text Available Abstract In wireless sensor networks (WSNs, location information plays an important role in many fundamental services which includes geographic routing, target tracking, location-based coverage, topology control, and others. One promising approach in sensor network localization is the determination of location based on hop counts. A critical priori of this approach that directly influences the accuracy of location estimation is the hop-distance relationship. However, most of the related works on the hop-distance relationship assume the unit-disk graph (UDG model that is unrealistic in a practical scenario. In this paper, we formulate the hop-distance relationship for quasi-UDG model in WSNs where sensor nodes are randomly and independently deployed in a circular region based on a Poisson point process. Different from the UDG model, quasi-UDG model has the non-uniformity property for connectivity. We derive an approximated recursive expression for the probability of the hop count with a given geographic distance. The border effect and dependence problem are also taken into consideration. Furthermore, we give the expressions describing the distribution of distance with known hop counts for inner nodes and those suffered from the border effect where we discover the insignificance of the border effect. The analytical results are validated by simulations showing the accuracy of the employed approximation. Besides, we demonstrate the localization application of the formulated relationship and show the accuracy improvement in the WSN localization.

  9. Technical strategy of triple jump: differences of inverted pendulum model between hop-dominated and balance techniques.

    Science.gov (United States)

    Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao

    2017-10-24

    The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.

  10. Mechanisms of hop inhibition: hop ionophores.

    Science.gov (United States)

    Behr, Jürgen; Vogel, Rudi F

    2009-07-22

    In this work, the mechanism of hop inhibition toward (beer spoiling) bacteria is revised. The mode of action of iso-alpha-acids was investigated via bilayer lipid membrane (BLM) measurements and growth challenges of hop-sensitive and -resistant Lactobacillus brevis strains in the presence of uncouplers of class I and II or a H(+)/Mn(2+) exchanger. The antibacterial action of iso-alpha-acids as proton ionophores could be confirmed by the BLM measurements; however, the reported ionophore properties, as electroneutral H(+)/Mn(2+) exchangers, could not be verified. Potentiometric measurements indicated the manganese-dependent enhancement of transmembrane charge permeation. The origin of high membrane potentials in the presence of manganese, as well as the strongly elevated membrane conductivity with concomitant increase in effectiveness of an uncoupler, suggest a different origin of charge transfer under these conditions. The mode of antibacterial action of hop ionophores can be described as proton ionophores of class I/II, which are capable transporting protons within a wide range of pH due to their inherent complexity of chemical composition. However, growth challenges in the presence of both types of ionophore classes in combination with the measured unusual high BLM potentials in the presence of manganese and at low pH indicate an additional mechanism of inhibition by hop compounds. The latter may be due to the nature/properties of hop compounds, which are known to be highly reactive substances. As a consequence, hop resistance of bacteria can be described as multiple resistance to a heterogeneous mixture of compounds comprising different known and yet unknown charge transport mechanisms, which were dependent on several factors, for example, compound concentrations, cation composition, and pH value. Thus, only specialists such as some L. brevis strains, which can cope with unusually low intracellular manganese levels, can survive hop stress. Accordingly, cross

  11. The Effect of Next-Nearest Neighbour Hopping in the One, Two, and Three Dimensional Holstein Model

    Science.gov (United States)

    Chandler, Carl J.; Prosko, Christian; Marsiglio, F.

    2016-09-01

    Allowing a single electron to hop to next-nearest neighbours (NNN) in addition to the closest atomic sites in the Holstein model, a modified Trugman method is applied to exactly calculate the effect on the polaronic effective mass in one, two, and three dimensions, building on the previous study of the one-dimensional NNN Holstein model. We also present perturbative calculations and a heuristic scaling factor for the coupling strength and ion frequency to nearly map the NNN Holstein model back onto the original Holstein model. When account is taken of the modified electronic bandwidth near the electron energy, we find that including NNN hopping effectively increases the polaron effective mass.

  12. The Effect of Recombinant HopH Protein of Helicobacter pylori on the VEGF Expression in Metastatic Breast Cancer Model

    Directory of Open Access Journals (Sweden)

    Neda Soleimani

    2018-01-01

    Full Text Available Breast cancer imposes a considerable amount of cancer-related mortality and morbidity among women worldwide. Many efforts are in progress to reduce the disease burden and amongst the bacterial-based products received considerable attention as potential anti-cancer drugs. In the present study, the effect of recombinant pro-inflammatory outer membrane protein (HopH of Helicobacter pylori on the angiogenic factor and tumor development in metastatic breast cancer model was evaluated. The HopH gene was cloned into Pet28a vector, induced by IPTG and expressed and purified by Ni-NTA affinity chromatography. The expressed protein was confirmed by SDS-page. The breast cancer tumor induction was performed using Breast cancer cell line (4T1. The mice were divided into different groups and underwent treatment by recombinant HopH and Herceptin, subsequently. The treatment effectiveness on tumor size was followed, and the expression level of vascular endothelial growth factor was evaluation by real time PCR. The SDS-PAGE analysis confirmed the expression of HopH protein with an approximate 34KD weight. Based on our results, the expression level of VEGF was significantly reduced in HopH-treated mice group comparing to the control and Herceptin group. Our results have shown that the recombinant HopH protein can effectively reduce VEGF expression in breast cancer tumor which was associated with reduction of tumor size. The HopH protein can be considered as a potential anti-cancer agent for future cancer therapeutic studies.

  13. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    Directory of Open Access Journals (Sweden)

    Dong-Gwang Ha

    2016-04-01

    Full Text Available Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs. Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenylamine (TCTA :1,3-bis(3,5-dipyrid-3-yl-phenylbenzene (BmPyPb mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.

  14. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available In Inter-working multi-hop wireless networks, establishing resilient connectivity between source-destination node pairs is a major issue. The issues of connectivity in Multi-hop wireless networks have been studied. However, these analyses focused...

  15. Identification of influential nodes based on temporal-aware modeling of multi-hop neighbor interactions for influence spread maximization

    Science.gov (United States)

    Ullah, Farman; Lee, Sungchang

    2017-11-01

    This paper presents the identification of highly influential nodes based on temporal-aware modeling of multi-hop neighbor interactions to maximize the spread of information in online social networks (OSNs). The objective is to choose a set of influential nodes that have higher temporal multi-hop interactions and more topological connections in large-scale OSNs to maximize information dissemination and minimize spreading time. An influence diffusion process that is solely based on topology is not able to capture the influence spreading efficiently. A temporal multi-hops social interaction based centrality is proposed to choose nodes of higher spreading ability considering the nodes' neighbors and neighbors-of-neighbors temporal modeled interactions and topological connections. The temporal-aware interactions are modeled to find users who are more active recently. First, we model the influence between users considering the temporal interactions of the user and its neighbors. A subset of nodes with a higher influence value and more topological connections with direct neighbors is selected. Secondly, we select the Top- K higher influential spreader nodes from the subset of nodes considering the node neighbors and neighbors-of-neighbors temporal modeled social interactions and topological connections. Finally, the proposed algorithm is evaluated using the epidemic spreading models. The experimental results show that the algorithm is able to extract highly influential nodes that maximize the spread of information and minimize contagion time.

  16. Anderson localization in one-dimensional quasiperiodic lattice models with nearest- and next-nearest-neighbor hopping

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Longyan, E-mail: lygong@njupt.edu.cn [Information Physics Research Center and Department of Applied Physics, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China); Institute of Signal Processing and Transmission, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China); National Laboratory of Solid State Microstructures, Nanjing University, Nanjing 210093 (China); Feng, Yan; Ding, Yougen [Information Physics Research Center and Department of Applied Physics, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China); Institute of Signal Processing and Transmission, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China)

    2017-02-12

    Highlights: • Quasiperiodic lattice models with next-nearest-neighbor hopping are studied. • Shannon information entropies are used to reflect state localization properties. • Phase diagrams are obtained for the inverse bronze and golden means, respectively. • Our studies present a more complete picture than existing works. - Abstract: We explore the reduced relative Shannon information entropies SR for a quasiperiodic lattice model with nearest- and next-nearest-neighbor hopping, where an irrational number is in the mathematical expression of incommensurate on-site potentials. Based on SR, we respectively unveil the phase diagrams for two irrationalities, i.e., the inverse bronze mean and the inverse golden mean. The corresponding phase diagrams include regions of purely localized phase, purely delocalized phase, pure critical phase, and regions with mobility edges. The boundaries of different regions depend on the values of irrational number. These studies present a more complete picture than existing works.

  17. Study of the one-dimensional Holstein model with next-nearest-neighbor hopping

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Monodeep; Das, A N [Theoretical Condensed Matter Physics Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Chakrabarti, Atisdipankar [RKMVC College, Rahara, 24 Parganas (North), West Bengal (India)

    2011-01-19

    We present the effect of next-nearest-neighbor hopping on Holstein polarons. The energy and wavefunction of the ground state and first excited state are obtained by using a conjugate-gradient technique on the variational Hilbert space of the electron-phonon (e-ph) system. We increase the size of the variational space systematically to obtain high accuracy. With the converged wavefunction at our disposal we obtain various physical quantities and correlation functions to get a holistic insight into the physics of e-ph interaction. Our study reveals that the effect of next-nearest-neighbor hopping is most prominent at the physically interesting crossover regime of the e-ph coupling and in the adiabatic regime. We have also performed analytical strong coupling second order perturbation with a Lang-Firsov (LF) phonon basis to account for some features in the strong coupling regime.

  18. Aharonov-Bohm effect in a helical ring with long-range hopping: Effects of Rashba spin-orbit interaction and disorder

    Science.gov (United States)

    Dutta, Paramita; Saha, Arijit; Jayannavar, A. M.

    2016-11-01

    We study the Aharonov-Bohm effect in a two-terminal helical ring with long-range hopping in the presence of Rashba spin-orbit interaction. We explore how the spin polarization behavior changes depending on the applied magnetic flux and the incoming electron energy. The most interesting feature that we articulate in this system is that zero-energy crossings appear in the energy spectra at Φ =0 and also at integer multiples of half-flux quantum values (n Φ0/2 ,n being an integer) of the applied magnetic flux. We investigate the transport properties of the ring using Green's function formalism and find that the zero-energy transmission peaks corresponding to those zero-energy crossings vanish in the presence of Rashba spin-orbit interaction. We also incorporate static random disorder in our system and show that the zero-energy crossings and transmission peaks are not immune to disorder even in the absence of Rashba spin-orbit interaction. The latter prevents the possibility of these helical states in the ring behaving like topological insulator edge states.

  19. Role of band states and trap states in the electrical properties of organic semiconductors: Hopping versus mobility edge model

    KAUST Repository

    Mehraeen, Shafigh

    2013-05-01

    We compare the merits of a hopping model and a mobility edge model in the description of the effect of charge-carrier concentration on the electrical conductivity, carrier mobility, and Fermi energy of organic semiconductors. We consider the case of a composite electronic density of states (DOS) that consists of a superposition of a Gaussian DOS and an exponential DOS. Using kinetic Monte Carlo simulations, we apply the two models in order to interpret the recent experimental data reported for n-doped C60 films. While both models are capable of reproducing the experimental data very well and yield qualitatively similar characteristic parameters for the density of states, some discrepancies are found at the quantitative level. © 2013 American Physical Society.

  20. Mass-spring-damper modelling of the human body to study running and hopping--an overview.

    Science.gov (United States)

    Nikooyan, A A; Zadpoor, A A

    2011-12-01

    Several mass-spring-damper models have been developed to study the response of the human body to the collision with the ground during hopping, trotting, or running. The mass, spring, and damper elements represent the masses, stiffness properties, and damping properties of hard and soft tissues. The masses that models are composed of are connected to each other via springs and dampers. The present paper reviews the various types of mass-spring-damper models including one-body and multi-body models. The models are further categorized as being either passive or active. In passive models, the mechanical properties (stiffness and damping) of soft tissues remain constant regardless of the type of footwear, ground stiffness, etc. In active models, the mechanical properties adapt to external loads. The governing equations of motion of all models as well as their parameters are presented. The specific ways that the models take account of the shoe-ground interactions are discussed as well. The methods used for determination of different modelling parameters are briefly surveyed. The advantages and disadvantages of the different types of mass-spring-damper models are also discussed. The paper concludes with a brief discussion of possible future research trends in the area of mass-spring-damper modelling.

  1. Hopping in a Molecular Wire

    Directory of Open Access Journals (Sweden)

    R. Marco

    2004-12-01

    Full Text Available We utilize the Hubbard model approach in analyzing the effect of the hopping parameter in the transport properties of a two-atom molecular device (Kostyrko & Bulka, 2003. The system consists of a molecule with two identical atoms connecting two metal electrodes. In this model, two important and realistic energy parameters are considered which affects the transport properties. The first is the kinetic energy required to “hop” from one atomic site to the next. We call this parameter the hopping term denoted by t, in arbitrary units of energy. The next is an on-site Coulombic repulsion, U, between two electrons on the same atomic site.

  2. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  3. Small polaron hopping transport along DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Triberis, G P [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece); Simserides, C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece); Leibniz Institute for Neurobiology, Special Laboratory for Non-Invasive Brain Imaging, Brenneckestrasse 6, D-39118 Magdeburg (Germany); Karavolas, V C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece)

    2005-05-04

    We present a small polaron hopping model for interpreting the strong temperature (T) dependence of the electrical conductivity, {sigma}, observed at high (h) temperatures along DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. Percolation-theoretical considerations lead to analytical expressions for the high temperature multiphonon-assisted small polaron hopping conductivity, the hopping distance and their temperature dependence. The experimental data for lambda phage DNA ({lambda}-DNA) and poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behaviour (ln{sigma}{sup h}{proportional_to}T{sup -2/3}). Moreover, our model leads to realistic values of the maximum hopping distances, supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbours of the DNA molecular 'wire'. The low temperature case is also investigated.

  4. Using seafaring simulations and shortest-hop trajectories to model the prehistoric colonization of Remote Oceania.

    Science.gov (United States)

    Montenegro, Álvaro; Callaghan, Richard T; Fitzpatrick, Scott M

    2016-10-24

    The prehistoric colonization of islands in Remote Oceania that began ∼3400 B.P. represents what was arguably the most expansive and ambitious maritime dispersal of humans across any of the world's seas or oceans. Though archaeological evidence has provided a relatively clear picture of when many of the major island groups were colonized, there is still considerable debate as to where these settlers originated from and their strategies/trajectories used to reach habitable land that other datasets (genetic, linguistic) are also still trying to resolve. To address these issues, we have harnessed the power of high-resolution climatic and oceanographic datasets in multiple seafaring simulation platforms to examine major pulses of colonization in the region. Our analysis, which takes into consideration currents, land distribution, wind periodicity, the influence of El Niño Southern Oscillation (ENSO) events, and "shortest-hop" trajectories, demonstrate that (i) seasonal and semiannual climatic changes were highly influential in structuring ancient Pacific voyaging; (ii) western Micronesia was likely settled from somewhere around the Maluku (Molucca) Islands; (iii) Samoa was the most probable staging area for the colonization of East Polynesia; and (iv) although there are major differences in success rates depending on time of year and the occurrence of ENSO events, settlement of Hawai'i and New Zealand is possible from the Marquesas or Society Islands, the same being the case for settlement of Easter Island from Mangareva or the Marquesas.

  5. Nerve Conduction Through Dendrites via Proton Hopping.

    Science.gov (United States)

    Kier, Lemont B

    2017-01-01

    In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Musculoskeletal modelling deconstructs the paradoxical effects of elastic ankle exoskeletons on plantar-flexor mechanics and energetics during hopping

    OpenAIRE

    Farris, Dominic James; Hicks, Jennifer L.; Delp, Scott L.; Sawicki, Gregory S.

    2014-01-01

    Experiments have shown that elastic ankle exoskeletons can be used to reduce ankle joint and plantar-flexor muscle loading when hopping in place and, in turn, reduce metabolic energy consumption. However, recent experimental work has shown that such exoskeletons cause less favourable soleus (SO) muscle–tendon mechanics than is observed during normal hopping, which might limit the capacity of the exoskeleton to reduce energy consumption. To directly link plantar-flexor mechanics and energy con...

  7. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

    Science.gov (United States)

    Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

    2010-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

  8. A Jackson network model and threshold policy for joint optimization of energy and delay in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-11-20

    This paper studies the joint optimization problem of energy and delay in a multi-hop wireless network. The optimization variables are the transmission rates, which are adjustable according to the packet queueing length in the buffer. The optimization goal is to minimize the energy consumption of energy-critical nodes and the packet transmission delay throughout the network. In this paper, we aim at understanding the well-known decentralized algorithms which are threshold based from a different research angle. By using a simplified network model, we show that we can adopt the semi-open Jackson network model and study this optimization problem in closed form. This simplified network model further allows us to establish some significant optimality properties. We prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate. We also prove that the threshold-type policy is optimal, i.e., when the number of packets in the buffer is larger than a threshold, transmit with the maximal rate (power); otherwise, no transmission. With these optimality properties, we develop a heuristic algorithm to iteratively find the optimal threshold. Finally, we conduct some simulation experiments to demonstrate the main idea of this paper.

  9. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  10. Hopping conductivity of a one-dimensional bond-percolation model in a constant field: Exact solution

    Science.gov (United States)

    Khantha, M.; Balakrishnan, V.

    1984-04-01

    The recent work of Odagaki and Lax on the ac hopping conductivity in a one-dimensional bond-percolation model is generalized to include a constant applied field. The corresponding biased random-walk problem on a finite chain of arbitrary length and with properly terminated ends is solved analytically. The solution is extended to include all continuous-time random walks. (It is thus directly applicable, for instance, to spectral diffusion with asymmetric transfer rates and memory effects.) The diffusivity (and thence the conductivity and relative permittivity) on a chain of N sites is obtained exactly, in closed form. A configuration averaging over N yields the diffusivity and relative permittivity for the randomly interrupted infinite chain. Our analytic results are valid at all frequencies, and are in a form amenable to extensive numerical computation. This is done, and the noteworthy features of the results are displayed graphically. All the known results in the field-free case are recovered as special cases of the expressions presented here.

  11. Hopping Robot with Wheels

    Science.gov (United States)

    Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

    2003-01-01

    A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

  12. Universal properties of high-temperature superconductors from real-space pairing: Role of correlated hopping and intersite Coulomb interaction within the t -J -U model

    Science.gov (United States)

    Zegrodnik, Michał; Spałek, Józef

    2017-08-01

    We study the effect of the correlated hopping term and the intersite Coulomb interaction term on principal features of the d -wave superconducting (SC) state, in both the electron- and hole-doped regimes within the t -J -U model. In our analysis, we use the approach based on the diagrammatic expansion of the Gutzwiller wave function (DE-GWF), which allows us to go beyond the renormalized mean-field theory (RMFT). We show that the correlated hopping term enhances the pairing at the electron-doped side of the phase diagram. Moreover, the so-called non-BCS regime (which manifests itself by the negative kinetic energy gain at the transition to the SC phase) is narrowed down with the increasing magnitude of the correlated hopping ˜K . Also, the doping dependencies of the nodal Fermi velocity and Fermi momentum, as well as the average number of double occupancies, are analyzed with reference to the experimental data for selected values of the parameter K . For the sake of completeness, the influence of the intersite Coulomb repulsion on the obtained results is provided. Additionally, selected results concerning the Hubbard-model case are also presented. A complete model with all two-site interactions is briefly discussed in Appendix for reference.

  13. KDT501, a derivative from hops, normalizes glucose metabolism and body weight in rodent models of diabetes.

    Directory of Open Access Journals (Sweden)

    Veera R Konda

    Full Text Available AIMS/HYPOTHESIS: We developed KDT501, a novel substituted 1,3-cyclopentadione chemically derived from hop extracts, and evaluated it in various in vitro and in vivo models of diabetes and insulin sensitivity. METHODS: KDT501 was evaluated for anti-inflammatory effects in monocyte/macrophage cells; agonistic activity for peroxisome proliferator-activated receptors (PPAR; lipogenesis and gene expression profile in human subcutaneous adipocytes. Body composition, glucose, insulin sensitivity, and lipids were assessed in diet-induced obesity (DIO mice and Zucker Diabetic Fatty (ZDF rats after oral administration. RESULTS: KDT501 mediated lipogenesis in 3T3L1 and human subcutaneous adipocytes; however, the gene expression profile of KDT501 differed from that of the full PPARγ agonist rosiglitazone, suggesting that KDT501 has pleiotropic biological activities. In addition, KDT501 showed only modest, partial PPARγ agonist activity and exhibited anti-inflammatory effects in monocytes/macrophages that were not observed with rosiglitazone. In a DIO mouse model, oral administration of KDT501 significantly reduced fed blood glucose, glucose/insulin AUC following an oral glucose bolus, and body fat. In ZDF rats, oral administration of KDT501 significantly reduced fed glucose, fasting plasma glucose, and glucose AUC after an oral glucose bolus. Significant, dose-dependent reductions of plasma hemoglobin A1c, weight gain, total cholesterol, and triglycerides were also observed in animals receiving KDT501. CONCLUSION: These results indicate that KDT501 produces a unique anti-diabetic profile that is distinct in its spectrum of pharmacological effects and biological mechanism from both metformin and pioglitazone. KDT501 may thus constitute a novel therapeutic agent for the treatment of Type 2 diabetes and associated conditions.

  14. Steerable Hopping Six-Legged Robot

    Science.gov (United States)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that

  15. A Boltzmann-weighted hopping model of charge transport in organic semicrystalline films

    KAUST Repository

    Kwiatkowski, Joe J.

    2011-01-01

    We present a model of charge transport in polycrystalline electronic films, which considers details of the microscopic scale while simultaneously allowing realistically sized films to be simulated. We discuss the approximations and assumptions made by the model, and rationalize its application to thin films of directionally crystallized poly(3-hexylthiophene). In conjunction with experimental data, we use the model to characterize the effects of defects in these films. Our findings support the hypothesis that it is the directional crystallization of these films, rather than their defects, which causes anisotropic mobilities. © 2011 American Institute of Physics.

  16. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  17. Exploiting elasticity: Modeling the influence of neural control on mechanics and energetics of ankle muscle-tendons during human hopping.

    Science.gov (United States)

    Robertson, Benjamin D; Sawicki, Gregory S

    2014-07-21

    We present a simplified Hill-type model of the human triceps surae-Achilles tendon complex working on a gravitational-inertial load during cyclic contractions (i.e. vertical hopping). Our goal was to determine the role that neural control plays in governing muscle, or contractile element (CE), and tendon, or series elastic element (SEE), mechanics and energetics within a compliant muscle-tendon unit (MTU). We constructed a 2D parameter space consisting of many combinations of stimulation frequency and magnitude (i.e. neural control strategies). We compared the performance of each control strategy by evaluating peak force and average positive mechanical power output for the system (MTU) and its respective components (CE, SEE), force-length (F-L) and -velocity (F-V) operating point of the CE during active force production, average metabolic rate for the CE, and both MTU and CE apparent efficiency. Our results suggest that frequency of stimulation plays a primary role in governing whole-MTU mechanics. These include the phasing of both activation and peak force relative to minimum MTU length, average positive power, and apparent efficiency. Stimulation amplitude was primarily responsible for governing average metabolic rate and within MTU mechanics, including peak force generation and elastic energy storage and return in the SEE. Frequency and amplitude of stimulation both played integral roles in determining CE F-L operating point, with both higher frequency and amplitude generally corresponding to lower CE strains, reduced injury risk, and elimination of the need for passive force generation in the CE parallel elastic element (PEE). Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Model-driven harmonic parameterization of the cortical surface: HIP-HOP.

    Science.gov (United States)

    Auzias, G; Lefèvre, J; Le Troter, A; Fischer, C; Perrot, M; Régis, J; Coulon, O

    2013-05-01

    In the context of inter subject brain surface matching, we present a parameterization of the cortical surface constrained by a model of cortical organization. The parameterization is defined via an harmonic mapping of each hemisphere surface to a rectangular planar domain that integrates a representation of the model. As opposed to previous landmark-based registration methods we do not match folds between individuals but instead optimize the fit between cortical sulci and specific iso-coordinate axis in the model. This strategy overcomes some limitation to sulcus-based registration techniques such as topological variability in sulcal landmarks across subjects. Experiments on 62 subjects with manually traced sulci are presented and compared with the result of the Freesurfer software. The evaluation involves a measure of dispersion of sulci with both angular and area distortions. We show that the model-based strategy can lead to a natural, efficient and very fast (less than 5 min per hemisphere) method for defining inter subjects correspondences. We discuss how this approach also reduces the problems inherent to anatomically defined landmarks and open the way to the investigation of cortical organization through the notion of orientation and alignment of structures across the cortex.

  19. Stationary Currents in Particle Systems with Constrained Hopping Rates

    Science.gov (United States)

    Cirillo, Emilio N. M.; Colangeli, Matteo; Muntean, Adrian

    2016-04-01

    We study the effect on the stationary currents of constraints affecting the hopping rates in stochastic particle systems. In the framework of zero range processes with drift within a finite volume, we discuss how the current is reduced by the presence of the constraint and deduce exact formulae, fully explicit in some cases. The model discussed here has been introduced by Cirillo et al. (Does communication enhance pedestrians transport in the dark? To appear in C. R. Mécanique 344 (2016), 19-23) and is relevant for the description of pedestrian motion in elongated dark corridors, where the constraint on the hopping rates can be related to limitations on the interaction distance among pedestrians, but finds also applications in the modeling of various transport phenomena.

  20. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  1. Design of the influenza virus inhibitors targeting the PA endonuclease using 3D-QSAR modeling, side-chain hopping, and docking.

    Science.gov (United States)

    Yan, Zhihui; Zhang, Lijie; Fu, Haiyang; Wang, Zhonghua; Lin, Jianping

    2014-01-15

    With the emergence of drug resistance and the structural determination of the PA N-terminal domain (PAN), influenza endonucleases have become an attractive target for antiviral therapies for influenza infection. Here, we combined 3D-QSAR with side-chain hopping and molecular docking to produce novel structures as endonuclease inhibitors. First, a new molecular library was generated with side-chain hopping on an existing template molecule, L-742001, using an in-house fragment library that targets bivalent-cation-binding proteins. Then, the best 3D-QSAR model (AAAHR.500), with q(2)=0.76 and r(2)=0.97 from phase modeling, was constructed from 23 endonuclease inhibitors and validated with 17 test compounds. The AAAHR.500 model was then used to select effective candidates from the new molecular library. Combining 3D-QSAR with docking using Glide and Autodock, 13 compounds were considered the most likely candidate inhibitors. Docking studies showed that the binding modes of these compounds were consistent with the crystal structures of known inhibitors. These compounds could serve as potential endonuclease inhibitors for further biological activity tests. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Effects of prophylactic ankle and knee braces on leg stiffness during hopping

    Directory of Open Access Journals (Sweden)

    Hobara H

    2017-04-01

    Full Text Available Hiroaki Hobara, Satoru Hashizume, Yoshiyuki Kobayashi Human Informatics Research Institute, National Institute of Advanced Industrial Science and Technology, Tokyo, Japan Abstract: During human movement, the leg can be represented as a mechanical spring, with its stiffness potentially contributing to sports performance and injury prevention. Although many individuals perform athletic activities with joint stabilizers, little is known about the effects of prophylactic lower extremity braces on leg stiffness. The objective of this study was to investigate the effect of ankle and/or knee braces on leg stiffness measured during one-legged ­hopping at a range of frequencies. Thirteen male participants performed one-legged hopping with their dominant leg at frequencies of 2.2, 2.6, and 3.0 Hz. All participants were randomly tested under the following four brace conditions: 1 no brace (control, 2 prophylactic ankle brace, 3 prophylactic knee brace, and 4 prophylactic ankle and knee braces. Based on a spring–mass model, leg stiffness was calculated using data from an accelerometer. It was found that leg stiffness increased with increasing hopping frequency for each brace condition. However, there were no significant differences in leg stiffness among the four brace conditions at the three hopping frequencies. Since some level of leg stiffness is needed for optimal athletic performance and training, these results suggest that ankle and knee braces do not significantly interfere with dynamic hopping activities. Keywords: spring–mass model, injury prevention, compensatory strategy

  3. Effects of prophylactic ankle and knee braces on leg stiffness during hopping.

    Science.gov (United States)

    Hobara, Hiroaki; Hashizume, Satoru; Kobayashi, Yoshiyuki

    2017-01-01

    During human movement, the leg can be represented as a mechanical spring, with its stiffness potentially contributing to sports performance and injury prevention. Although many individuals perform athletic activities with joint stabilizers, little is known about the effects of prophylactic lower extremity braces on leg stiffness. The objective of this study was to investigate the effect of ankle and/or knee braces on leg stiffness measured during one-legged hopping at a range of frequencies. Thirteen male participants performed one-legged hopping with their dominant leg at frequencies of 2.2, 2.6, and 3.0 Hz. All participants were randomly tested under the following four brace conditions: 1) no brace (control), 2) prophylactic ankle brace, 3) prophylactic knee brace, and 4) prophylactic ankle and knee braces. Based on a spring-mass model, leg stiffness was calculated using data from an accelerometer. It was found that leg stiffness increased with increasing hopping frequency for each brace condition. However, there were no significant differences in leg stiffness among the four brace conditions at the three hopping frequencies. Since some level of leg stiffness is needed for optimal athletic performance and training, these results suggest that ankle and knee braces do not significantly interfere with dynamic hopping activities.

  4. Two-legged hopping in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Matthew F. Moran

    2013-03-01

    Full Text Available Sensory processing deficits are common within autism spectrum disorders (ASD. Deficits have a heterogeneous dispersion across the spectrum and multimodal processing tasks are thought to magnify integration difficulties. Two-legged hopping in place in sync with an auditory cue (2.3, 3.0 Hz was studied in a group of six individuals with expressive language impaired ASD (ELI-ASD and an age-matched control group. Vertical ground reaction force data were collected and discrete Fourier transforms were utilized to determine dominant hopping cadence. Effective leg stiffness was computed through a mass-spring model representation. The ELI-ASD group were unsuccessful in matching their hopping cadence (2.21±0.30 hops•sec-1, 2.35±0.41 hops•sec-1 to either auditory cue with greater deviations at the 3.0 Hz cue. In contrast, the control group was able to match hopping cadence (2.35±0.06 hops•sec-1, 3.02±0.10 hops•sec-1 to either cue via an adjustment of effective leg stiffness. The ELI-ASD group demonstrated a varied response with an interquartile range (IQR in excess of 0.5 hops•sec-1 as compared to the control group with an IQR < 0.03 hops•sec-1. Several sensorimotor mechanisms could explain the inability of participants with ELI-ASD to modulate motor output to match an external auditory cue. These results suggest that a multimodal gross motor task can (1 discriminate performance among a group of individuals with severe autism, and (2 could be a useful quantitative tool for evaluating motor performance in individuals with ASD individuals.

  5. Model for Using Hip-Hop Music for Small Group HIV/AIDS Prevention Counseling with African American Adolescents and Young Adults.

    Science.gov (United States)

    Stephens, Torrance; Braithwaite, Ronald L.; Taylor, Sandra E.

    1998-01-01

    Presents a HIV/AIDS preventive counseling protocol developed for use with African American young adults that makes use of hip-hop music. Contends that an increased understanding of the relationships that many African American young adults have with hip-hop music may be used by disease prevention personnel to educate these populations about…

  6. Off-diagonal long-range order in generalized Hubbard models

    NARCIS (Netherlands)

    Michielsen, Kristel; Raedt, Hans De

    1997-01-01

    We present stochastic diagonalization results for the ground-state energy and the largest eigenvalue of the two-fermion density matrix of the BCS reduced Hamiltonian, the Hubbard model, and the Hubbard model with correlated hopping. The system-size dependence of this eigenvalue is used to study the

  7. A review of models of vertical, leg, and knee stiffness in adults for running, jumping or hopping tasks.

    Science.gov (United States)

    Serpell, Benjamin G; Ball, Nick B; Scarvell, Jennie M; Smith, Paul N

    2012-01-01

    The 'stiffness' concept originates from Hooke's law which states that the force required to deform an object is related to a spring constant and the distance that object is deformed. Research into stiffness in the human body is undergoing unprecedented popularity; possibly because stiffness has been associated with sporting performance and some lower limb injuries. However, some inconsistencies surrounding stiffness measurement exists bringing into question the integrity of some research related to stiffness. The aim of this study was to review literature which describes how vertical, leg and knee stiffness has been measured in adult populations while running, jumping or hopping. A search of the entire MEDLINE, PubMed and SPORTDiscus databases and an iterative reference check was performed. Sixty-seven articles were retrieved; 21 measured vertical stiffness, 51 measured leg stiffness, and 22 measured knee stiffness. Thus, some studies measured several 'types' of stiffness. Vertical stiffness was typically the quotient of ground reaction force and centre of mass displacement. For leg stiffness it was and change in leg length, and for the knee it was the quotient of knee joint moments and change in joint angle. Sample size issues and measurement techniques were identified as limitations to current research.

  8. Holstein polarons and triplet bipolarons with NNN hopping

    Science.gov (United States)

    Chakraborty, Monodeep; Taraphder, A.; Berciu, Mona

    2017-05-01

    We study the ground state of 1D Holstein single polaron with next nearest neighbour electron hopping (NNN), employing a variational approximation based on exact diagonalization. Our investigation reveals that, depending upon the sign and magnitude of the NNN hopping integral with respect to nearest neighbour hopping, the polaron band minima may occur at non-zero kGS. We compare the present scenario with the SSH polarons, where a similar feature is also observed, albeit, due to very different mechanism. Our initial investigation of triplet bipolarons, in presence of an attractive extended Hubbard interactions, further substantiates the differences between the present model and the SSH model.

  9. Hyphenated 3D-QSAR statistical model-scaffold hopping analysis for the identification of potentially potent and selective sigma-2 receptor ligands.

    Science.gov (United States)

    Floresta, Giuseppe; Rescifina, Antonio; Marrazzo, Agostino; Dichiara, Maria; Pistarà, Venerando; Pittalà, Valeria; Prezzavento, Orazio; Amata, Emanuele

    2017-10-20

    A 3D quantitative structure-activity relationship (3D-QSAR) model for predicting the σ2 receptor affinity has been constructed with the aim of providing a useful tool for the identification, design, and optimization of novel σ2 receptor ligands. The model has been built using a set of 500 selective σ2 receptor ligands recovered from the sigma-2 receptor selective ligand database (S2RSLDB) and developed with the software Forge. The present model showed high statistical quality as confirmed by its robust predictive potential and satisfactory descriptive capability. The drawn up 3D map allows for a prompt visual comprehension of the electrostatic, hydrophobic, and shaping features underlying σ2 receptor ligands interaction. A theoretic approach for the generation of new lead compounds with optimized σ2 receptor affinity has been performed by means of scaffold hopping analysis. Obtained results further confirmed the validity of our model being some of the identified moieties have already been successfully employed in the development of potent σ2 receptor ligands. For the first time is herein reported a 3D-QSAR model which includes a number of chemically diverse σ2 receptor ligands and well accounts for the individual ligands affinities. These features will ensure prospectively advantageous applications to speed up the identification of new potent and selective σ2 receptor ligands. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  10. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  11. Musculoskeletal modeling of human lower limb during normal walking, one-legged forward hopping and side jumping: Comparison of measured EMG and predicted muscle activity patterns.

    Science.gov (United States)

    Wibawa, A D; Verdonschot, N; Halbertsma, J P K; Burgerhof, J G M; Diercks, R L; Verkerke, G J

    2016-11-07

    This study focused on comparing muscle activities predicted by the Musculoskeletal Modeling System with EMG from ten healthy subjects who performed normal walking, one-legged forward hopping and side jumping. Eight EMG electrodes measured the activity of eight right leg muscles. Specific thresholds per muscle were applied on the EMG prior comparison. These thresholds were determined by equalizing the duration of EMG to AMS muscle activity. Three graph variables, number of onsets, offsets and hills were used to quantify the level of agreement by using Cohen׳s kappa analysis. The Pearson correlation coefficient was also calculated as a result comparison. Overall, visual inspection showed comparable activity patterns. However, when quantifying them some differences became apparent. The mean level of agreement of all tests was EMG pattern. Those differences can be attributed to inevitable modeling limitation within the AMS framework like miscalculating the knee net moment, absence of co-contraction, simplified knee joint. Moreover, the delay between EMG and AMS has a clear effect on the comparison and this delay is obviously missing in the model. Despite those differences, this study can serve as a baseline measurement allowing progress in scientific work in order to reduce uncertainties with the aim to generate more reliable and robust musculoskeletal models in a valid manner. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  13. Hops (Humulus lupulus L. Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

    Directory of Open Access Journals (Sweden)

    Michael D. Flythe

    2017-08-01

    Full Text Available Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L. produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid. Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1 the ionophore-like mechanism of action and spectrum of activity and (2 the literature available on the plant due to its use in brewing.

  14. BER estimation for multi-hop RoFSO QAM or PSK OFDM communication systems over gamma gamma or exponentially modeled turbulence channels

    Science.gov (United States)

    Nistazakis, H. E.; Stassinakis, A. N.; Sheikh Muhammad, S.; Tombras, G. S.

    2014-12-01

    The optical wireless and in particular the radio-on-free-space-optical (RoFSO) communication systems are gaining popularity due to their high date rates, license free spectrum and adequate reliability at installation and operational costs which are much lower than comparable technologies. One significant disadvantage of these systems concerns the randomly time varying characteristics of the propagation path mainly caused by the atmospheric turbulence. In this work, we study the BER performance of a multi-hop RoFSO system which is using an orthogonal frequency division multiplexing (OFDM) scheme, with either quadrature amplitude modulation (QAM) or phase shift keying format (PSK), over atmospheric turbulence channels modeled with the gamma gamma or the negative exponential distribution. The individual RoFSO parts of the whole optical link are connected to each other by using regenerators relay nodes. The dominant impairments which are the most significant and have been taken into account are the atmospheric turbulence, the path losses, the nonlinear responsivity of the laser diode and the inter-modulation distortion effect. For this setup, we derive closed form mathematical expressions for the estimation of the BER performance for each individual OFDM RoFSO link and for the whole relayed optical communication system, as well. Finally, the corresponding numerical results, for common link's parameters, are presented.

  15. Results from HOPS: A multiwavelength census of Orion protostars

    Science.gov (United States)

    Fischer, W. J.; Megeath, S. T.; Stutz, A. M.; Tobin, J. J.; Ali, B.; Stanke, T.; Osorio, M.; Furlan, E.; HOPS Team; Orion Protostar Survey

    2013-02-01

    Surveys with the Spitzer and Herschel space observatories are now enabling the discovery and characterization of large samples of protostars in nearby molecular clouds, providing the observational basis for a detailed understanding of star formation in diverse environments. We are pursuing this goal with the Herschel Orion Protostar Survey (HOPS), which targets 328 Spitzer-identified protostars in the Orion molecular clouds, the largest star-forming region in the nearest 500 pc. The sample encompasses all phases of protostellar evolution and a wide range of formation environments, from dense clusters to relative isolation. With a grid of radiative transfer models, we fit the 1-870 μm spectral energy distributions (SEDs) of the protostars to estimate their envelope densities, cavity opening angles, inclinations, and total luminosities. After correcting the bolometric luminosities and temperatures of the sources for foreground extinction and inclination, we find a spread of several orders of magnitude in luminosity at all evolutionary states, a constant median luminosity over the more evolved stages, and a possible deficit of high-inclination, rapidly infalling envelopes among the Spitzer-identified sample. We have detected over 100 new sources in the Herschel images; some of them may fill this deficit. We also report results from modeling the pre- and post-outburst 1-870 μm SEDs of V2775 Ori (HOPS 223), a known FU Orionis outburster in the sample. It is the least luminous FU Ori star with a protostellar envelope.

  16. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  17. Low Power Multi-Hop Networking Analysis in Intelligent Environments

    Directory of Open Access Journals (Sweden)

    Josu Etxaniz

    2017-05-01

    Full Text Available Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links and scatternets (multi-hop networks. As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  18. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  19. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  20. A shared-care model of obesity treatment for 3–10 year old children: Protocol for the HopSCOTCH randomised controlled trial

    Directory of Open Access Journals (Sweden)

    Wake Melissa

    2012-03-01

    Full Text Available Abstract Background Despite record rates of childhood obesity, effective evidence-based treatments remain elusive. While prolonged tertiary specialist clinical input has some individual impact, these services are only available to very few children. Effective treatments that are easily accessible for all overweight and obese children in the community are urgently required. General practitioners are logical care providers for obese children but high-quality trials indicate that, even with substantial training and support, general practitioner care alone will not suffice to improve body mass index (BMI trajectories. HopSCOTCH (the Shared Care Obesity Trial in Children will determine whether a shared-care model, in which paediatric obesity specialists co-manage obesity with general practitioners, can improve adiposity in obese children. Design Randomised controlled trial nested within a cross-sectional BMI survey conducted across 22 general practices in Melbourne, Australia. Participants Children aged 3–10 years identified as obese by Centers for Disease Control criteria at their family practice, and randomised to either a shared-care intervention or usual care. Intervention A single multidisciplinary obesity clinic appointment at Melbourne’s Royal Children’s Hospital, followed by regular appointments with the child’s general practitioner over a 12 month period. To support both specialist and general practice consultations, web-based shared-care software was developed to record assessment, set goals and actions, provide information to caregivers, facilitate communication between the two professional groups, and jointly track progress. Outcomes Primary - change in BMI z-score. Secondary - change in percentage fat and waist circumference; health status, body satisfaction and global self-worth. Discussion This will be the first efficacy trial of a general-practitioner based, shared-care model of childhood obesity management. If effective

  1. Communication: Global flux surface hopping in Liouville space

    Science.gov (United States)

    Wang, Linjun; Sifain, Andrew E.; Prezhdo, Oleg V.

    2015-11-01

    Recent years have witnessed substantial progress in the surface hopping (SH) formulation of non-adiabatic molecular dynamics. A generalization of the traditional fewest switches SH (FSSH), global flux SH (GFSH) utilizes the gross population flow between states to derive SH probabilities. The Liouville space formulation of FSSH puts state populations and coherences on equal footing, by shifting the hopping dynamics from Hilbert to Liouville space. Both ideas have shown superior results relative to the standard FSSH in Hilbert space, which has been the most popular approach over the past two and a half decades. By merging the two ideas, we develop GFSH in Liouville space. The new method is nearly as straightforward as the standard FSSH, and carries comparable computational expense. Tested with a representative super-exchange model, it gives the best performance among all existing techniques in the FSSH series. The obtained numerical results match almost perfectly the exact quantum mechanical solutions. Moreover, the results are nearly invariant under the choice of a basis state representation for SH, in contrast to the earlier techniques which exhibit notable basis set dependence. Unique to the developed approach, this property is particularly encouraging, because exact quantum dynamics is representation independent. GFSH in Liouville space significantly improves accuracy and applicability of SH for a broad range of chemical and physical processes.

  2. Mountain range specific analog weather forecast model for ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Earth System Science; Volume 117; Issue 5. Mountain range specific ... Mountain range specific analog weather forecast model is developed utilizing surface weather observations of reference stations in each mountain range in northwest Himalaya (NW-Himalaya).The model searches past ...

  3. Characteristics of compounds in hops using cyclic voltammetry, UV-VIS, FTIR and GC-MS analysis.

    Science.gov (United States)

    Masek, Anna; Chrzescijanska, Ewa; Kosmalska, Anna; Zaborski, Marian

    2014-08-01

    The article presents the antioxidant properties of the extracts of hop EI and EII, by the electrochemical methods on a platinum electrode and comparative analysis of the composition of the extracts of hops using UV-VIS, FTIR and GC-MS methods. The hops extract EI, was obtained from the waste of the hops cone. The hops extract EII, was obtained from the hops cone itself. Hops contain a wide range of polyphenolic compounds with antioxidant properties divided in various chemical classes. Flavonoids and other polyphenolic compounds contained in hops show antioxidant capacity because of the presence of hydroxyl groups in various configurations and numbers within their molecules. The electrochemical properties and antioxidant capacity of hop samples were determined to select the most effective antioxidant. Based on the cyclic and pulse voltammograms, it was observed that hop extract EI contains polyphenols that are oxidised at a less positive potential than extract EII, i.e., it shows better antioxidant capacity. From the analysis of the UV-VIS and FTIR spectra and the GC-MS analysis, it was observed that extract EI contains less phenyl compounds than EII. In addition to flavonoids, EII contains hop acids and chlorophyll. The solutions of hop extracts show very good antioxidant capacities; therefore, they can effectively inhibit or slow negative oxidation reactions and scavenge free radicals and reactive oxygen species (ROS). Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Chiral Topological Superconductors Enhanced by Long-Range Interactions

    Science.gov (United States)

    Viyuela, Oscar; Fu, Liang; Martin-Delgado, Miguel Angel

    2018-01-01

    We study the phase diagram and edge states of a two-dimensional p -wave superconductor with long-range hopping and pairing amplitudes. New topological phases and quasiparticles different from the usual short-range model are obtained. When both hopping and pairing terms decay with the same exponent, one of the topological chiral phases with propagating Majorana edge states gets significantly enhanced by long-range couplings. On the other hand, when the long-range pairing amplitude decays more slowly than the hopping, we discover new topological phases where propagating Majorana fermions at each edge pair nonlocally and become gapped even in the thermodynamic limit. Remarkably, these nonlocal edge states are still robust, remain separated from the bulk, and are localized at both edges at the same time. The inclusion of long-range effects is potentially applicable to recent experiments with magnetic impurities and islands in 2D superconductors.

  5. Generalized adiabatic polaron hopping: Meyer-Neldel compensation and Poole-Frenkel behavior.

    Science.gov (United States)

    Emin, David

    2008-04-25

    The commonly employed adiabatic treatment of polaron hopping is extended to treat the continuous alteration of a carrier wave function with the atoms' movements and a carrier's long-range interaction with a polar surrounding. These features, respectively, introduce carrier-induced softening of the atoms' vibrations and a hopping activation energy that depends on hopping distance. The Meyer-Neldel compensation effect results from carrier-induced softening of vibrations. Poole-Frenkel behavior emerges for electric-field driven polaron hopping in ionic and polar media.

  6. Model for using hip-hop music for small group HIV/AIDS prevention counseling with African American adolescents and young adults.

    Science.gov (United States)

    Stephens, T; Braithwaite, R L; Taylor, S E

    1998-10-01

    Currently little attention has been directed, with the exception of peer education efforts, to constructively develop new and innovative ways to promote HIV/AIDS primary prevention among African American (AA) adolescents and young adults. With this in mind, the aim of this conceptual effort is to present a HIV/AIDS preventive counseling protocol developed for use with AA young adults that makes use of hip-hop music, a form of music popularized by young AAs. The author contend that an increased understanding of the relationships that many AA young adults have with hip-hop music may be used by disease prevention personnel to educate these populations about protective factors for HIV. Making use of hip-hop music is one strategy for integrating counseling in prevention and health maintenance. The overall implications of using hip-hop music in health promotion are unlimited. First, this method makes use of cultural relevant materials to address the educational and health needs of the target community. Second, it is grounded in an approach that serves to stimulate cooperative learning based on peer developed content. Moreover, the use of this medium can be applied to other health promotion activities such as violence/harm reduction and substance abuse prevention, upon reviews of songs for appropriate content. The authors contend that such an approach holds heuristic value in dealing with HIV/AIDS prevention among AA young adults. Additional testing of the intervention is warranted in the refinement of this innovative intervention.

  7. Scaffold hopping for identification of novel D(2) antagonist based on 3D pharmacophore modelling of illoperidone analogs.

    Science.gov (United States)

    Dash, Radha Charan; Bhosale, Sharad H; Shelke, Suhas M; Suryawanshi, Mugdha R; Kanhed, Ashish M; Mahadik, Kakasaheb R

    2012-05-01

    The dopamine D(2) receptor is involved in the etiology of a number of disorders, such as Parkinson's disease, Huntington's Chorea, tardive dyskinesia and schizophrenia. Antagonism of D(2) receptors is implicated in the treatment of various psychiatric disorders. In order to understand essential structural features required for D(2) antagonism, this research article elaborates on the generation of a four-point 3D pharmacophore model which was extracted from a series of 45 novel 3-[[(aryloxy)alkyl]piperidinyl]-1,2-benzisoxazole derivatives. The best pharmacophore model generated consisted of four PRRR features: a positively charged group (P), and three aromatic rings (R). Based on the model generated, a statistically valid 3D-QSAR with good predictability (Q(2) = 0.756) was derived. For the validation of the pharmacophore hypothesis, active compounds were docked against the 3D structure of the D(2) receptor which was constructed through homology modeling. Further, the derived pharmacophore was used as a query to search the Zinc 'clean drug-like' database. Hits retrieved were passed progressively through filters, such as fitness score, predicted activity and docking scores. The resulting hits present new scaffolds with a strong potential for D(2) antagonist.

  8. Influence of the constituent alpha acids of Ukrainian varieties of hops and hop preparations on quality indicators of mash and beer

    Directory of Open Access Journals (Sweden)

    L. Protsenko

    2015-05-01

    Full Text Available Introduction. The aim of the study is to establish the dependence of the bitterness of mash and the beer intoxication on the quality and quantity of the homologues of alpha acids in the Ukrainian varieties of hops, and on the content of cohumulone in alpha acids in particular. Materials and methods.Aromatic and bitter hop sorts of Ukrainian selection with different content of cohumulone in alpha-acids were investigated and so was the beer, made of these components. High performance liquid chromatography (HPLC was used to determine the amount and composition of bitter hop substances and their transformation products in the brewing process; also there were spectrophotometric methods for quality control of bitterness of hopped mash and finished beer in use. Results and discussion. The composition of bitter substances of aromatic and bitter hop sorts of Ukrainian selection was analyzed and so the beer, made of them. It was noted that the alpha-acids of the analyzed sorts incorporate a wide range of cohumulone content rated from 16.7% in the Kumyr sort to 44,1% in the Ruslan sort. The dependences between the quality and quantity of the bitter hop sorts and bitterness and quality of hopped mash and beer were established. The content of cohumulone in alphaacids of hops has to be less than 28% to obtain quality bitter beer. The role of the beta-acid compoundsin the formation of bitter mash, hopped with aroma hop varieties with a ratio of beta to alpha acids acids around one, is much more important compared to the bitter varieties. Conclusions. The conducted researches show that in applying the bitter hops with different compositon of alphaacids for mash intoxication, this usage is more effective in the sorts that have a large content of cohumulone.

  9. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  10. Modelling the effect of climate change on species ranges

    NARCIS (Netherlands)

    Nagelkerke, C.J.; Alkemade, J.R.M.

    2003-01-01

    Three main types of models can be used to understand and predict climate-related range shifts. Equilibrium models predict potential future distributions from the current climate envelope of a species, but do not take migration constraints into account. They show that future range changes can be

  11. A Range-Based Multivariate Model for Exchange Rate Volatility

    NARCIS (Netherlands)

    B. Tims (Ben); R.J. Mahieu (Ronald)

    2003-01-01

    textabstractIn this paper we present a parsimonious multivariate model for exchange rate volatilities based on logarithmic high-low ranges of daily exchange rates. The multivariate stochastic volatility model divides the log range of each exchange rate into two independent latent factors, which are

  12. Building accurate geometric models from abundant range imaging information

    Science.gov (United States)

    Diegert, Carl F.; Sackos, John T.; Nellums, Robert O.

    1997-08-01

    We define two simple metrics for accuracy of models built from range imaging information. We apply the metric to a model built from a recent range image taken at the laser radar Development and Evaluation Facility, Eglin AFB, using a scannerless range imager (SRI) from Sandia National Laboratories. We also present graphical displays of the residual information produced as a byproduct of this measurement, and discuss mechanisms that these data suggest for further improvement in the performance of this already impressive SRI.

  13. Climate-driven range extension of Amphistegina (protista, foraminiferida: models of current and predicted future ranges.

    Directory of Open Access Journals (Sweden)

    Martin R Langer

    Full Text Available Species-range expansions are a predicted and realized consequence of global climate change. Climate warming and the poleward widening of the tropical belt have induced range shifts in a variety of marine and terrestrial species. Range expansions may have broad implications on native biota and ecosystem functioning as shifting species may perturb recipient communities. Larger symbiont-bearing foraminifera constitute ubiquitous and prominent components of shallow water ecosystems, and range shifts of these important protists are likely to trigger changes in ecosystem functioning. We have used historical and newly acquired occurrence records to compute current range shifts of Amphistegina spp., a larger symbiont-bearing foraminifera, along the eastern coastline of Africa and compare them to analogous range shifts currently observed in the Mediterranean Sea. The study provides new evidence that amphisteginid foraminifera are rapidly progressing southwestward, closely approaching Port Edward (South Africa at 31°S. To project future species distributions, we applied a species distribution model (SDM based on ecological niche constraints of current distribution ranges. Our model indicates that further warming is likely to cause a continued range extension, and predicts dispersal along nearly the entire southeastern coast of Africa. The average rates of amphisteginid range shift were computed between 8 and 2.7 km year(-1, and are projected to lead to a total southward range expansion of 267 km, or 2.4° latitude, in the year 2100. Our results corroborate findings from the fossil record that some larger symbiont-bearing foraminifera cope well with rising water temperatures and are beneficiaries of global climate change.

  14. Climate-driven range extension of Amphistegina (protista, foraminiferida): models of current and predicted future ranges.

    Science.gov (United States)

    Langer, Martin R; Weinmann, Anna E; Lötters, Stefan; Bernhard, Joan M; Rödder, Dennis

    2013-01-01

    Species-range expansions are a predicted and realized consequence of global climate change. Climate warming and the poleward widening of the tropical belt have induced range shifts in a variety of marine and terrestrial species. Range expansions may have broad implications on native biota and ecosystem functioning as shifting species may perturb recipient communities. Larger symbiont-bearing foraminifera constitute ubiquitous and prominent components of shallow water ecosystems, and range shifts of these important protists are likely to trigger changes in ecosystem functioning. We have used historical and newly acquired occurrence records to compute current range shifts of Amphistegina spp., a larger symbiont-bearing foraminifera, along the eastern coastline of Africa and compare them to analogous range shifts currently observed in the Mediterranean Sea. The study provides new evidence that amphisteginid foraminifera are rapidly progressing southwestward, closely approaching Port Edward (South Africa) at 31°S. To project future species distributions, we applied a species distribution model (SDM) based on ecological niche constraints of current distribution ranges. Our model indicates that further warming is likely to cause a continued range extension, and predicts dispersal along nearly the entire southeastern coast of Africa. The average rates of amphisteginid range shift were computed between 8 and 2.7 km year(-1), and are projected to lead to a total southward range expansion of 267 km, or 2.4° latitude, in the year 2100. Our results corroborate findings from the fossil record that some larger symbiont-bearing foraminifera cope well with rising water temperatures and are beneficiaries of global climate change.

  15. Mott and Efros-Shklovskii hopping conductions in porous silicon nanostructures

    Science.gov (United States)

    Islam, Md. Nazrul; Ram, Sanjay K.; Kumar, Satyendra

    2009-05-01

    Electrical conductivity of electrochemically etched porous silicon was studied over a wide temperature range from 15 to 450 K. Applicability of various electrical transport mechanisms has been critically analyzed. While the conductivity data above room temperature shows extended state conduction, lowering the temperature leads to Berthelot-type conduction (180-280 K). Further, Mott's hopping (in the range 140-180 K) and Efros-Shklovskii hopping (below 120 K) conduction are found to be operating in lower temperature ranges. A clear crossover from Mott to Efros-Shklovskii variable range hopping transport is observed at low temperatures.

  16. Computational Analysis of Residue Interaction Networks and Coevolutionary Relationships in the Hsp70 Chaperones: A Community-Hopping Model of Allosteric Regulation and Communication.

    Directory of Open Access Journals (Sweden)

    Gabrielle Stetz

    2017-01-01

    allostery, we introduced a community-hopping model of allosteric communication. Atomistic reconstruction of signaling pathways in the DnaK structures captured a direction-specific mechanism and molecular details of signal transmission that are fully consistent with the mutagenesis experiments. The results of our study reconciled structural and functional experiments from a network-centric perspective by showing that global properties of the residue interaction networks and coevolutionary signatures may be linked with specificity and diversity of allosteric regulation mechanisms.

  17. Computational Analysis of Residue Interaction Networks and Coevolutionary Relationships in the Hsp70 Chaperones: A Community-Hopping Model of Allosteric Regulation and Communication.

    Science.gov (United States)

    Stetz, Gabrielle; Verkhivker, Gennady M

    2017-01-01

    introduced a community-hopping model of allosteric communication. Atomistic reconstruction of signaling pathways in the DnaK structures captured a direction-specific mechanism and molecular details of signal transmission that are fully consistent with the mutagenesis experiments. The results of our study reconciled structural and functional experiments from a network-centric perspective by showing that global properties of the residue interaction networks and coevolutionary signatures may be linked with specificity and diversity of allosteric regulation mechanisms.

  18. THE EFFECTS OF BRAIN-LESIONS ON THE HOPPING REACTION IN NEWBORN AND ADULT-RABBITS - A MODEL FOR STUDYING AGE-DEPENDENT RECOVERY

    NARCIS (Netherlands)

    VANHOF, MW; HOBBELEN, JF; GRAMSBERGEN, A

    1990-01-01

    In 5 groups of rabbits (0-1, 2-3, 4-5, 6-7 and 12-13 weeks old) the left frontal, parieto-temporal and occipital cortex were removed. Beginning two weeks after the operations the hopping reaction was tested during 15 weeks. It was found in the groups operated 0-1, 2-3 and 4-5 weeks after birth, that

  19. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  20. Benchmarking novel approaches for modelling species range dynamics.

    Science.gov (United States)

    Zurell, Damaris; Thuiller, Wilfried; Pagel, Jörn; Cabral, Juliano S; Münkemüller, Tamara; Gravel, Dominique; Dullinger, Stefan; Normand, Signe; Schiffers, Katja H; Moore, Kara A; Zimmermann, Niklaus E

    2016-08-01

    Increasing biodiversity loss due to climate change is one of the most vital challenges of the 21st century. To anticipate and mitigate biodiversity loss, models are needed that reliably project species' range dynamics and extinction risks. Recently, several new approaches to model range dynamics have been developed to supplement correlative species distribution models (SDMs), but applications clearly lag behind model development. Indeed, no comparative analysis has been performed to evaluate their performance. Here, we build on process-based, simulated data for benchmarking five range (dynamic) models of varying complexity including classical SDMs, SDMs coupled with simple dispersal or more complex population dynamic models (SDM hybrids), and a hierarchical Bayesian process-based dynamic range model (DRM). We specifically test the effects of demographic and community processes on model predictive performance. Under current climate, DRMs performed best, although only marginally. Under climate change, predictive performance varied considerably, with no clear winners. Yet, all range dynamic models improved predictions under climate change substantially compared to purely correlative SDMs, and the population dynamic models also predicted reasonable extinction risks for most scenarios. When benchmarking data were simulated with more complex demographic and community processes, simple SDM hybrids including only dispersal often proved most reliable. Finally, we found that structural decisions during model building can have great impact on model accuracy, but prior system knowledge on important processes can reduce these uncertainties considerably. Our results reassure the clear merit in using dynamic approaches for modelling species' response to climate change but also emphasize several needs for further model and data improvement. We propose and discuss perspectives for improving range projections through combination of multiple models and for making these approaches

  1. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  2. Model-based uncertainty in species range prediction

    DEFF Research Database (Denmark)

    Pearson, R. G.; Thuiller, Wilfried; Bastos Araujo, Miguel

    2006-01-01

    , with predicted changes in range size by 2030 differing in both magnitude and direction (e.g. from 92% loss to 322% gain). We explain differences with reference to two characteristics of the modelling techniques: data input requirements (presence/absence vs. presence-only approaches) and assumptions made by each......, identify key reasons why model output may differ and discuss the implications that model uncertainty has for policy-guiding applications. Location The Western Cape of South Africa. Methods We applied nine of the most widely used modelling techniques to model potential distributions under current...... algorithm when extrapolating beyond the range of data used to build the model. The effects of these factors should be carefully considered when using this modelling approach to predict species ranges. Main conclusions We highlight an important source of uncertainty in assessments of the impacts of climate...

  3. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  4. Short-range correlations in modified planar rotator model

    Science.gov (United States)

    Žukovič, M.; Hristopulos, D. T.

    2015-09-01

    We introduce a model inspired from statistical physics that is shown to display flexible short-range spatial correlations which are potentially useful in geostatistical modeling. In particular, we consider a suitably modified planar rotator or XY model, traditionally used for modeling continuous spin systems in magnetism, and we demonstrate that it can capture spatial correlations typically present in geostatistical data. The empirical study of the spin configurations produced by Monte Carlo simulations at various temperatures and stages in the nonequilibrium regime shows that their spatial variability can be modeled by the flexible class of Matern covariance functions. The correlation range and the smoothness of these functions vary significantly in the parameter space that consists of the temperature and the simulation time. We briefly discuss the potential of the model for efficient and automatic prediction of spatial data with short-range correlations, such as commonly encountered in geophysical and environmental applications.

  5. Chicano Hip-Hop as Interethnic Contact Zone

    Science.gov (United States)

    McFarland, Pancho

    2008-01-01

    Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

  6. Medium Range Forecast (MRF) and Nested Grid Model (NGM)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Nested Grid Model (NGM) and Medium Range Forecast (MRF) Archive is historical digital data set DSI-6140, archived at the NOAA National Centers for Environmental...

  7. Towards Process-based Range Modeling of Many Species.

    Science.gov (United States)

    Evans, Margaret E K; Merow, Cory; Record, Sydne; McMahon, Sean M; Enquist, Brian J

    2016-11-01

    Understanding and forecasting species' geographic distributions in the face of global change is a central priority in biodiversity science. The existing view is that one must choose between correlative models for many species versus process-based models for few species. We suggest that opportunities exist to produce process-based range models for many species, by using hierarchical and inverse modeling to borrow strength across species, fill data gaps, fuse diverse data sets, and model across biological and spatial scales. We review the statistical ecology and population and range modeling literature, illustrating these modeling strategies in action. A variety of large, coordinated ecological datasets that can feed into these modeling solutions already exist, and we highlight organisms that seem ripe for the challenge. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Soil Compressibility Models for a Wide Stress Range

    KAUST Repository

    Chong, Song-Hun

    2016-03-03

    Soil compressibility models with physically correct asymptotic void ratios are required to analyze situations that involve a wide stress range. Previously suggested models and other functions are adapted to satisfy asymptotic void ratios at low and high stress levels; all updated models involve four parameters. Compiled consolidation data for remolded and natural clays are used to test the models and to develop correlations between model parameters and index properties. Models can adequately fit soil compression data for a wide range of stresses and soil types; in particular, models that involve the power of the stress σ\\'β display higher flexibility to capture the brittle response of some natural soils. The use of a single continuous function avoids numerical discontinuities or the need for ad hoc procedures to determine the yield stress. The tangent stiffness-readily computed for all models-should not be mistaken for the small-strain constant-fabric stiffness. © 2016 American Society of Civil Engineers.

  9. Unsupervised Model Building Of 3D Objects Using Range Information

    Science.gov (United States)

    Laurendeau, Denis; Poussart, Denis

    1986-10-01

    This paper presents a method for building the model of a 3D object from a range image provided by a fast range finder. The model is an adjacency graph describing the connectivity properties of neighbouring regions (facets) of the object. Each region is obtained from the segmentation scheme based on the analysis of the hemispheric histogram. The histogram organizes the surface orientation information. The model is built in an unsupervised manner and provides a compact description of the object. The model builder could be integrated in an automatic 3D object recognition system.

  10. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  11. Basin Hopping Graph

    DEFF Research Database (Denmark)

    Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

    2014-01-01

    basins when the direct transitions between them are “energetically favorable”. Edge weights endcode the corresponding saddle heights and thus measure the difficulties of these favorable transitions. BHGs can be approximated accurately and efficiently for RNA molecules well beyond the length range...

  12. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    Science.gov (United States)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  13. Conformal Invariance in the Long-Range Ising Model

    CERN Document Server

    Paulos, Miguel F; van Rees, Balt C; Zan, Bernardo

    2016-01-01

    We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to conformal invariance. We however show that several correlation functions, computed to second order in the epsilon expansion, are nontrivially consistent with conformal invariance. We proceed to give a proof of conformal invariance to all orders in the epsilon expansion, based on the description of the long-range Ising model as a defect theory in an auxiliary higher-dimensional space. A detailed review of conformal invariance in the d-dimensional short-range Ising model is also included and may be of independent interest.

  14. Conformal invariance in the long-range Ising model

    Directory of Open Access Journals (Sweden)

    Miguel F. Paulos

    2016-01-01

    Full Text Available We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to conformal invariance. We however show that several correlation functions, computed to second order in the epsilon expansion, are nontrivially consistent with conformal invariance. We proceed to give a proof of conformal invariance to all orders in the epsilon expansion, based on the description of the long-range Ising model as a defect theory in an auxiliary higher-dimensional space. A detailed review of conformal invariance in the d-dimensional short-range Ising model is also included and may be of independent interest.

  15. Conformal invariance in the long-range Ising model

    Energy Technology Data Exchange (ETDEWEB)

    Paulos, Miguel F. [CERN, Theory Group, Geneva (Switzerland); Rychkov, Slava, E-mail: slava.rychkov@lpt.ens.fr [CERN, Theory Group, Geneva (Switzerland); Laboratoire de Physique Théorique de l' École Normale Supérieure (LPTENS), Paris (France); Faculté de Physique, Université Pierre et Marie Curie (UPMC), Paris (France); Rees, Balt C. van [CERN, Theory Group, Geneva (Switzerland); Zan, Bernardo [Institute of Physics, Universiteit van Amsterdam, Amsterdam (Netherlands)

    2016-01-15

    We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to conformal invariance. We however show that several correlation functions, computed to second order in the epsilon expansion, are nontrivially consistent with conformal invariance. We proceed to give a proof of conformal invariance to all orders in the epsilon expansion, based on the description of the long-range Ising model as a defect theory in an auxiliary higher-dimensional space. A detailed review of conformal invariance in the d-dimensional short-range Ising model is also included and may be of independent interest.

  16. Discrete-time model reduction in limited frequency ranges

    Science.gov (United States)

    Horta, Lucas G.; Juang, Jer-Nan; Longman, Richard W.

    1991-01-01

    A mathematical formulation for model reduction of discrete time systems such that the reduced order model represents the system in a particular frequency range is discussed. The algorithm transforms the full order system into balanced coordinates using frequency weighted discrete controllability and observability grammians. In this form a criterion is derived to guide truncation of states based on their contribution to the frequency range of interest. Minimization of the criterion is accomplished without need for numerical optimization. Balancing requires the computation of discrete frequency weighted grammians. Close form solutions for the computation of frequency weighted grammians are developed. Numerical examples are discussed to demonstrate the algorithm.

  17. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  18. Fundamentals of beer and hop chemistry

    OpenAIRE

    De Keukeleire, Denis

    2000-01-01

    Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is pla...

  19. Morphological and control criteria for self-stable underwater hopping.

    Science.gov (United States)

    Calisti, Marcello; Laschi, Cecilia

    2017-10-04

    This paper presents the self-stabilisation features of a hopping gait during underwater legged locomotion. We used a bio-inspired fundamental model of this gait, the underwater spring-loaded inverted pendulum model, to numerically derive quantitative (dimension of the basin of attraction, Floquet multipliers, mean horizontal speed) and qualitative (shape of the basin) features which characterise the self-stability of the system. Furthermore, we compared the results obtained with a terrestrial self-stable running model (i.e. the spring-loaded inverted pendulum with swing-leg retraction) to highlight the role of water-related components in relation to dynamic legged locomotion. The analysis revealed fundamental morphological and actuation parameters that could be used to design self-stabilising underwater hopping machines, as well as elucidating their role with respect to stability and speed. Underwater hopping is a simple and reliable locomotion, as it does not require complex control feedback to reject significant disturbances. Thanks to its high self-stabilising property, underwater hopping appears to be a reliable alternative locomotion for underwater robots. © 2017 IOP Publishing Ltd.

  20. Conformal invariance in the long-range Ising model

    NARCIS (Netherlands)

    Paulos, M.F.; Rychkov, S.; van Rees, B.C.; Zan, B.

    We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to

  1. Reconceptualizing Academic Advising Using the Full Range Leadership Model

    Science.gov (United States)

    Barbuto, John E., Jr.; Story, Joana S.; Fritz, Susan M.; Schinstock, Jack L.

    2009-01-01

    Developmental and prescriptive advising styles have been the focus of the academic advising literature for the past 35 years. Academic advising scholars have called for a new paradigm in the field. Drawing from leadership theory, a new model for academic advising is proposed. Full range advising encompasses laissez-faire, management-by-exception,…

  2. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  3. Free energy basin-hopping

    Science.gov (United States)

    Sutherland-Cash, K. H.; Wales, D. J.; Chakrabarti, D.

    2015-04-01

    A global optimisation scheme is presented using basin-hopping with the acceptance criterion based on approximate free energy for the corresponding local minima of the potential energy. The method is illustrated for atomic and colloidal clusters and peptides to examine how the predicted global free energy minimum changes with temperature. Using estimates for the local free energies based on harmonic vibrational densities of states provides a computationally effective framework for predicting trends in structure at finite temperature. The resulting scheme represents a powerful tool for exploration of energy landscapes throughout molecular science.

  4. High temperature electrical conductivity due to small polaron hopping motion in DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Triberis, G P [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Karavolas, V C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Simserides, C D [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Leibniz Institute for Neurobiology, Special Lab for Non-Invasing Brain Imaging, Brenneckestr. 6, D-39118 Magdeburg (Germany)

    2005-01-01

    We present a small polaron hopping model to interpret the high-temperature electrical conductivity measured along the DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. The experimental data for the lambda phage DNA ({lambda}-DNA) and the poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behavior leading to realistic values of the maximum hopping distances supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbors of the DNA molecular 'wire'.

  5. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  6. Sclerotinia wilt of Hop (Humulus lupulus) caused by Sclerotinia sclerotiorum in the Pacific Northwest U.S.

    Science.gov (United States)

    Sclerotinia sclerotiorum is a widespread, destructive pathogen with an exceptionally broad host range. During June 2011, wilted hop plants (Humulus lupulus cv. Nugget) were observed in a hop yard in Marion County, Oregon. Some affected plants had upward curled leaves with necrotic margins, whereas o...

  7. Hops

    Science.gov (United States)

    ... by mouth for medicinal uses. Special precautions & warnings: Pregnancy and breast-feeding: There is not enough reliable ... that are changed by the liver include theophylline, omeprazole, clozapine, progesterone, lansoprazole, flutamide, oxaliplatin, erlotinib, and caffeine. ...

  8. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  9. Biomechanical differences between incline and plane hopping.

    Science.gov (United States)

    Kannas, Theodoros M; Kellis, Eleftherios; Amiridis, Ioannis G

    2011-12-01

    Kannas, TM, Kellis, E, and Amiridis, IG. Biomechanical differences between incline and plane hopping. J Strength Cond Res 25(12): 3334-3341, 2011-The need for the generation of higher joint power output during performance of dynamic activities led us to investigate the force-length relationship of the plantar flexors during consecutive stretch-shortening cycles of hopping. The hypothesis of this study was that hopping (consecutive jumps with the knee as straight as possible) on an inclined (15°) surface might lead to a better jumping performance compared with hopping on a plane surface (0°). Twelve active men performed 3 sets of 10 consecutive hops on both an incline and plane surface. Ground reaction forces; ankle and knee joint kinematics; electromyographic (EMG) activity from the medial gastrocnemius (MG), soleus (Sol) and tibialis anterior (TA); and architectural data from the MG were recorded. The results showed that participants jumped significantly higher (p plane surface (27.52 ± 4.97 cm). No differences in temporal characteristics between the 2 types of jumps were observed. Incline hopping induced significantly greater ankle dorsiflexion and knee extension at takeoff compared with plane hopping (p propulsion phase were significantly higher during incline compared with that during plane hopping (p plane surface.

  10. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  11. Protein sliding and hopping kinetics on DNA

    CERN Document Server

    DeSantis, Michael C; Wang, Y M

    2010-01-01

    Using Monte-Carlo simulations, we deconvolved the sliding and hopping kinetics of GFP-LacI proteins on elongated DNA from their experimentally observed seconds-long diffusion trajectories. Our simulations suggest the following results: (1) in each diffusion trajectory, a protein makes on average hundreds of alternating slides and hops with a mean sliding time of several tens of ms; (2) sliding dominates the root mean square displacement of fast diffusion trajectories, whereas hopping dominates slow ones; (3) flow and variations in salt concentration have limited effects on hopping kinetics, while in vivo DNA configuration is not expected to influence sliding kinetics; furthermore, (4) the rate of occurrence for hops longer than 200 nm agrees with experimental data for EcoRV proteins.

  12. Ising model with long range correlated disorder on hierarchical lattices

    Science.gov (United States)

    Andrade, Roberto F. S.; Cason, Daniel

    2010-01-01

    A next-neighbor Ising model with disordered but long range correlated coupling constants is investigated. The model is built on a hierarchical lattice and the correlation strength depends on a tuning parameter α . The results are obtained within a transfer-matrix framework, which allows for the evaluation of the properties of individual samples. Collective behavior is computed by averaging over a large number of independent realizations. The dependence of the thermodynamic and magnetic functions with respect to the temperature is investigated for each value of α . Phase diagrams in the (α,T) plane are constructed for two distinct versions of the model, indicating the existence of regions of paramagnetic and ordered phases. Critical values αc , below which the system always assumes the paramagnetic phase, are found for both versions.

  13. Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    1996-01-01

    A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation pa...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

  14. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  15. Simulation of Frequency Hopping Communication System Based On MATLAB

    OpenAIRE

    Xu Xiaoping; Wang Weiqi; Yi Lan; Rong Jie; Wang Anqi

    2016-01-01

    In today’s information age, how to carry out the accurate information communication is a crucial issue in the field of communication, which is widely used in civil and military fields. Frequency hopping communication system is a typical spectrum communication system, it is in military communication, mobile communication, computer wireless data transmission and wireless LAN and other fields have a very wide range of applications, has become the current short wave communication is one of the im...

  16. A spread spectrum system with frequency hopping and sequentially balanced modulation. II - Operation in jamming and multipath

    Science.gov (United States)

    Mathis, R. F.; Pawula, R. F.

    1980-10-01

    The performance of a spread spectrum system which incorporates frequency hopping, sequentially balanced modulation, phase-comparison tone ranging, and pseudoorthogonal block coding of BPSK data with maximum likelihood of soft decision decoding, is evaluated in jamming environments and multipath. The jamming models considered include partial-band noise jamming, comb-type partial-band noise jamming, multitone jamming, and comb-type multitone jamming. Specular multipath with broad-band noise are shown to be the most serious form of interference. Bit-error probability and ranging accuracy curves are presented.

  17. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. The diurnal temperature range in the CMIP5 models

    Science.gov (United States)

    Lindvall, Jenny; Svensson, Gunilla

    2015-01-01

    This paper analyzes the diurnal temperature range (DTR) over land in simulations of the recent past and in future projections by 20 models participating in the Coupled Model Intercomparison Project phase 5 (CMIP5). The annually averaged DTR is evaluated for the present-day climate using two gridded datasets (HadGHCND and CRU). The DTR varies substantially between different CMIP5 models, particularly in the subtropics, and is generally underestimated. In future projections of the high emission scenario RCP8.5, the models disagree on both the sign and the magnitude of the change in DTR. Still, a majority of the models project a globally averaged reduction in the DTR, with an increase over Europe, a decrease over the Sahara desert and a substantial decrease in DTR at high latitudes in winter. The general DTR reduction is partly linked to the enhancement of the downwelling clear sky longwave radiation due to greenhouse gases. At high latitudes in winter, the decrease in DTR seems to be enforced by an increase in cloudiness, but in most other regions counteracted by decreases in cloud fraction. Changes in the hydrological cycle and in the clear sky shortwave radiation also impact the DTR. The DTR integrates many processes and neither the model differences in the DTR nor in the change in DTR can be attributed to a single parameter. Which variables that impact the model discrepancies vary both regionally and seasonally. However, clouds seem to matter in most regions and seasons and the evaporative fraction is important in summer.

  19. Effect of Drive Row Ground Covers on Hop (Rosales: Cannabaceae) Yard Arthropod Pests in Vermont, USA.

    Science.gov (United States)

    Calderwood, L; Cubins, J; Vesty, D; Darby, H

    2017-04-01

    Alternatives to pesticides are necessary for the management of hop (Humulus lupulus L.) arthropod pests. The three major arthropod pests in northeastern US hop production include two-spotted spider mite, Tetranychus urticae Koch, hop aphid Phorodon humuli (Schrank), and potato leafhopper, Empoasca fabae Harris. This 3-yr study (2012-2014) in Vermont investigated the effect of flowering ground covers on arthropod pest abundance. Hop cultivars 'Nugget' and 'Cascade' were evaluated under a strip-split plot experimental design. Ground cover treatments included 1) Control: mowed red clover (Trifolium pratense) and resident weeds, 2) Clover: red clover, and 3) Diverse: common yarrow (Achillea millefolium), beebalm (Monarda fistulosa), red clover, and annual sunflower (Helianthus annuus). Natural enemies were grouped by associated pest and indicated by our mixed model to be strong predictors of the number of hop aphid and potato leafhopper on hop plants. In year two, ground cover treatment had a significant effect on two-spotted spider mite abundance where fewer two-spotted spider mite were observed on hop plants in Diverse plots. The established, un-mowed Clover treatment was preferred by potato leafhopper over Diverse ground cover and hop plants. This revealed the potential for clover ground cover to serve as a trap crop for potato leafhopper management in northeastern hop yards. Our findings are evidence that ground covers implemented for conservation biological control may serve more specific pest management functions instead of or in addition to boosting top-down pest pressure. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Mixed quantum-classical equilibrium: Surface hopping.

    Science.gov (United States)

    Schmidt, J R; Parandekar, Priya V; Tully, John C

    2008-07-28

    We re-examine the analysis of the equilibrium limits of the fewest switches surface hopping algorithm for mixed quantum-classical dynamics. In contrast with previously reported results, we show that surface hopping does not, in general, exactly yield Boltzmann equilibrium, but that in practice the observed deviations are quite small. We also demonstrate that surface hopping does approach the exact equilibrium distribution in both the limits of small adiabatic splitting and/or strong nonadiabatic coupling. We verify these analytical results with numerical simulations for a simple two-level quantum system connected to a bath of classical particles.

  1. Cooperative MIMO technology in multiple hops wireless sensor networks

    Science.gov (United States)

    Yuan, Lina; Chen, Huajun; Gong, Jing

    2017-03-01

    The limited lifetime is one of the important factors restricted wireless sensor networks (WSNs), when possible, wireless nodes often operate with small batteries, while battery replacement is a very difficult and expensive. So the nodes must work long hours in the case of no battery replacement. Therefore, in WSNs, minimizing energy consumption is an important design consideration, at the same time, the transmission strategies of energy efficiency must be used for data forwarding. This paper, using cooperative multiple input multiple output(MIMO) technology combined with multiple hops technology, has put forward a new transmission model, i.e., the MIMO-MISO(multi-input multi-output)/MIMO-MIMO model. Simulation results demonstrate the proposed MIMO-MISO/MIMO-MIMO to minimize energy consumption of each node every node for multi-hop WSNs, to save a great deal of energy for a larger transmission distance, which makes the life of the entire network be extended.

  2. Charge Carrier Hopping Dynamics in Homogeneously Broadened PbS Quantum Dot Solids.

    Science.gov (United States)

    Gilmore, Rachel H; Lee, Elizabeth M Y; Weidman, Mark C; Willard, Adam P; Tisdale, William A

    2017-02-08

    Energetic disorder in quantum dot solids adversely impacts charge carrier transport in quantum dot solar cells and electronic devices. Here, we use ultrafast transient absorption spectroscopy to show that homogeneously broadened PbS quantum dot arrays (σhom(2):σinh(2) > 19:1, σinh/kBT quantum dot batches are sufficiently monodisperse (δ ≲ 3.3%). The homogeneous line width is found to be an inverse function of quantum dot size, monotonically increasing from ∼25 meV for the largest quantum dots (5.8 nm diameter/0.92 eV energy) to ∼55 meV for the smallest (4.1 nm/1.3 eV energy). Furthermore, we show that intrinsic charge carrier hopping rates are faster for smaller quantum dots. This finding is the opposite of the mobility trend commonly observed in device measurements but is consistent with theoretical predictions. Fitting our data to a kinetic Monte Carlo model, we extract charge carrier hopping times ranging from 80 ps for the smallest quantum dots to over 1 ns for the largest, with the same ethanethiol ligand treatment. Additionally, we make the surprising observation that, in slightly polydisperse (δ ≲ 4%) quantum dot solids, structural disorder has a greater impact than energetic disorder in inhibiting charge carrier transport. These findings emphasize how small improvements in batch size dispersity can have a dramatic impact on intrinsic charge carrier hopping behavior and will stimulate further improvements in quantum dot device performance.

  3. Short-Range Correlation Models in Electronic Structure Theory

    Science.gov (United States)

    Goldey, Matthew Bryant

    Correlation methods within electronic structure theory focus on recovering the exact electron-electron interaction from the mean-field reference. For most chemical systems, including dynamic correlation, the correlation of the movement of electrons proves to be sufficient, yet exact methods for capturing dynamic correlation inherently scale polynomially with system size despite the locality of the electron cusp. This work explores a new family of methods for enhancing the locality of dynamic correlation methodologies with an aim toward improving accuracy and scalability. The introduction of range-separation into ab initio wavefunction methods produces short-range correlation methodologies, which can be supplemented with much faster approximate methods for long-range interactions. First, I examine attenuation of second-order Moller-Plesset perturbation theory (MP2) in the aug-cc-pVDZ basis. MP2 treats electron correlation at low computational cost, but suffers from basis set superposition error (BSSE) and fundamental inaccuracies in long-range contributions. The cost differential between complete basis set (CBS) and small basis MP2 restricts system sizes where BSSE can be removed. Range-separation of MP2 could yield more tractable and/or accurate forms for short- and long-range correlation. Retaining only short-range contributions proves to be effective for MP2 in the small aug-cc-pVDZ (aDZ) basis. Using one range-separation parameter within either the complementary error function (erfc) or a sum of two error functions (terfc), superior behavior is obtained versus both MP2/aDZ and MP2/CBS for inter- and intra-molecular test sets. Attenuation of the long-range helps to cancel both BSSE and intrinsic MP2 errors. Direct scaling of the MP2 correlation energy (SMP2) proves useful as well. The resulting SMP2/aDZ, MP2(erfc, aDZ), and MP2(terfc, aDZ) methods perform far better than MP2/aDZ across systems with hydrogen-bonding, dispersion, and mixed interactions at a

  4. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  5. Collision-based mechanics of bipedal hopping

    National Research Council Canada - National Science Library

    Gutmann, Anne K; Lee, David V; McGowan, Craig P

    2013-01-01

    .... Previous studies have found that large bipedal hoppers can elastically store and return a large fraction of the energy required to hop, whereas small bipedal hoppers can only elastically store...

  6. Corporate psychopathy and the full-range leadership model.

    Science.gov (United States)

    Mathieu, Cynthia; Neumann, Craig; Babiak, Paul; Hare, Robert D

    2015-06-01

    The B-Scan 360 is a relatively new, purpose-built measure of corporate psychopathy that addresses many of the issues inherent in studying psychopathy in organizations. The primary goal of the present study was to measure the relationship between employees' perception of psychopathic features in their supervisor and their rating of their supervisor on the Full-Range Model of Leadership. The second goal of the study was to test the B-Scan 360's factor structure and test its interrater reliability in an organizational sample. A total of 491 civic employees and 116 employees from a branch of a large financial company completed the B-Scan 360 as well as the Multifactor Leadership Questionnaire on their direct supervisor. The B-Scan 360 and all of its four factors were positively correlated with passive leadership (Laissez-Faire leadership) and negatively correlated with positive leadership (both Transactional and Transformational leadership). Furthermore, results revealed the same four-factor structure and good interrater reliability for the B-Scan 360 in this business sample as previously reported for a general population. Overall, the results provide additional support for the B-Scan 360 as a measure of psychopathic traits in corporate settings. © The Author(s) 2014.

  7. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  8. Solid-phase microextraction of hop volatiles. Potential use for determination and verification of hop varieties.

    Science.gov (United States)

    Kovacevic, M; Kac, M

    2001-05-18

    The composition of hop essential oil is an important tool for evaluation of hop quality. As each hop variety has a typical essential oil pattern (fingerprint), hop oil analyses can be used to distinguish between hop varieties. The headspace solid-phase microextraction (SPME) method as described in this contribution is a simple sample preparation technique and represents an alternative procedure for essential oil fingerprint determination. Different SPME parameters (extraction temperature, extraction time and sample mass) were studied and the results were compared with those obtained by the routine distillation method. It is shown that SPME results can be used for determination and verification of varieties grown in Slovenia by means of principal components analysis.

  9. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    Science.gov (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  10. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  11. Phase model analysis of the long-range excitation in the hippocampal CA1 model

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sang-Gui [Nonlinear and Complex Systems Lab., Pohang University of Science and Technology, Pohang (Korea, Republic of); Hwang, Dong-Uk; Han, Seung-Kee [Chungbuk National University, Cheongju (Korea, Republic of); Kook, Hyung-Tae [Kyungwon University, Sungnam (Korea, Republic of)

    2004-03-15

    The synchronization of rhythms in various frequency ranges over participating cortical areas is one of the important issues in neuroscience. Experimental and modeling studies suggest that rhythms of the beta frequency range have a dynamical structure distinct from that of the gamma rhythms. To elucidate the mechanism of synchronization, the role of the long-range excitatory connection which is incorporated with finite conduction delay time needs to be analyzed. This work attempts such analysis, utilizing the reduced phase oscillator model. It is shown that the long-range gamma rhythm remains unstable, regardless of the presence of the excitatory connection. However, the beta rhythm is stable over a broad range of conduction time delay, which cannot apparently be tolerated by the long-range gamma rhythm. These synchronization features are consistent with experimental observations which imply that gamma rhythms are used for local computations, whereas beta rhythms are used for higher level interactions involving more distant structures.

  12. Protein structure prediction using basin-hopping

    Science.gov (United States)

    Prentiss, Michael C.; Wales, David J.; Wolynes, Peter G.

    2008-06-01

    Associative memory Hamiltonian structure prediction potentials are not overly rugged, thereby suggesting their landscapes are like those of actual proteins. In the present contribution we show how basin-hopping global optimization can identify low-lying minima for the corresponding mildly frustrated energy landscapes. For small systems the basin-hopping algorithm succeeds in locating both lower minima and conformations closer to the experimental structure than does molecular dynamics with simulated annealing. For large systems the efficiency of basin-hopping decreases for our initial implementation, where the steps consist of random perturbations to the Cartesian coordinates. We implemented umbrella sampling using basin-hopping to further confirm when the global minima are reached. We have also improved the energy surface by employing bioinformatic techniques for reducing the roughness or variance of the energy surface. Finally, the basin-hopping calculations have guided improvements in the excluded volume of the Hamiltonian, producing better structures. These results suggest a novel and transferable optimization scheme for future energy function development.

  13. Procesos hopping a través del modelo difusional en materiales nanocristalinos usados para aplicaciones fotovoltaicas

    OpenAIRE

    Mesa, Fredy

    2014-01-01

    Se presentan los modelos de hopping de rango variable (variable range hopping; VRH), vecinos cercanos (nearest neighbor hopping; NNH) y barreras de potencial presentes en las fronteras de grano; como mecanismos de transporte eléctrico predominantes en los materiales semiconductores para aplicaciones fotovoltaicas. Las medidas de conductividad a oscuras en función de temperatura fueron realizadas para región de bajas temperaturas entre 120 y 400 K con Si y compuestos Cu3BiS2 y Cu2ZnSnSe4. Sigu...

  14. Agrochemical lead optimization by scaffold hopping.

    Science.gov (United States)

    Lamberth, Clemens

    2018-02-01

    Scaffold hopping, the exchange of a specific portion of a potential active ingredient with another substructure with the aim of finding isofunctional molecular structures with significantly different molecular backbones, often offers the chance in lead discovery or optimization to mitigate problems related to toxicity, intellectual property, and insufficient potency or stability. Scaffold hopping tools such as isosteric ring replacement including 1,3 nitrogen shift and cyclic imine-amide isosterism, but also ring opening and ring closure approaches, functional group isosterism, reversion of functional groups, chain shortening, chain lengthening, and scaffolds delivered by natural products, have become a permanent fixture of the innovation and optimization process in crop protection research. Their appropriate use will be explained through examples of success stories in the field of agrochemistry. Analogies to, but also differences from, the main categories of scaffold hopping in medicinal drug discovery are discussed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. Value-at-risk modeling and forecasting with range-based volatility models: empirical evidence

    Directory of Open Access Journals (Sweden)

    Leandro dos Santos Maciel

    Full Text Available ABSTRACT This article considers range-based volatility modeling for identifying and forecasting conditional volatility models based on returns. It suggests the inclusion of range measuring, defined as the difference between the maximum and minimum price of an asset within a time interval, as an exogenous variable in generalized autoregressive conditional heteroscedasticity (GARCH models. The motivation is evaluating whether range provides additional information to the volatility process (intraday variability and improves forecasting, when compared to GARCH-type approaches and the conditional autoregressive range (CARR model. The empirical analysis uses data from the main stock market indexes for the U.S. and Brazilian economies, i.e. S&P 500 and IBOVESPA, respectively, within the period from January 2004 to December 2014. Performance is compared in terms of accuracy, by means of value-at-risk (VaR modeling and forecasting. The out-of-sample results indicate that range-based volatility models provide more accurate VaR forecasts than GARCH models.

  16. Conscious Hip-Hop, Change, and the Obama Era

    Directory of Open Access Journals (Sweden)

    Murray Forman

    2010-05-01

    Full Text Available This article identifies a particular aspect of hip-hop’s range of cultural production—conscious rap—in order to isolate one of the more politicized discursive options available to youth in America and a site where critical perspectives on post-Civil Rights America have emerged most forcefully. It further suggests that Obama’s political rise corresponds with a new phase in hip-hop and has impacted the ways in which its creative artists frame and articulate issues of race, class, and identity.

  17. A quantum inspired model of radar range and range-rate measurements with applications to weak value measurements

    Science.gov (United States)

    Escalante, George

    2017-05-01

    Weak Value Measurements (WVMs) with pre- and post-selected quantum mechanical ensembles were proposed by Aharonov, Albert, and Vaidman in 1988 and have found numerous applications in both theoretical and applied physics. In the field of precision metrology, WVM techniques have been demonstrated and proven valuable as a means to shift, amplify, and detect signals and to make precise measurements of small effects in both quantum and classical systems, including: particle spin, the Spin-Hall effect of light, optical beam deflections, frequency shifts, field gradients, and many others. In principal, WVM amplification techniques are also possible in radar and could be a valuable tool for precision measurements. However, relatively limited research has been done in this area. This article presents a quantum-inspired model of radar range and range-rate measurements of arbitrary strength, including standard and pre- and post-selected measurements. The model is used to extend WVM amplification theory to radar, with the receive filter performing the post-selection role. It is shown that the description of range and range-rate measurements based on the quantum-mechanical measurement model and formalism produces the same results as the conventional approach used in radar based on signal processing and filtering of the reflected signal at the radar receiver. Numerical simulation results using simple point scatterrer configurations are presented, applying the quantum-inspired model of radar range and range-rate measurements that occur in the weak measurement regime. Potential applications and benefits of the quantum inspired approach to radar measurements are presented, including improved range and Doppler measurement resolution.

  18. Between-session reliability of four hop tests and the agility T-test.

    Science.gov (United States)

    Munro, Allan G; Herrington, Lee C

    2011-05-01

    The purposes of this study were firstly to investigate whether learning affects were present in the administration of 4 hop tests and the Agility T-test and secondly to assess the between-session reliability of these tests. Twenty-two recreational athletes (11 women: age 22.3 ± 3.7 years, height 167.7 ± 6.2 cm, weight 59.2 ± 6.9 kg and 11 men: age 22.8 ± 3.1 years, height 179.8 ± 4 cm, weight 79.6 ± 10 kg) took part in the study. The subjects performed 6 repetitions of each hop test and 4 repetitions of the Agility T-test once a week over a period of 3 weeks. Distances were normalized to leg length and presented as a percentage value for the single, triple and crossover hop. Results showed that there were significant differences in scores between genders and that learning affects were present in all tests. Intraclass correlation coefficients ranged from 0.76 to 0.92 for the hop tests and 0.82 to 0.96 for the Agility T-test. The results indicated that the hop and Agility T-tests are reliable tests for use with subjects in a clinical or team sport environment. The error measurement statistics presented could be of help to practitioners to determine whether changes in individuals' scores in the hop and Agility T-tests are because of a true change in performance or measurement error. Of most importance was the fact that all subjects achieved at least 90% limb symmetry index on all 4 hop tests. Therefore, we recommend that a minimum limb symmetry value of 90%, rather than previously recommended 85%, should be adopted during rehabilitation and conditioning.

  19. Hopping conduction mechanism of Pr1-xNdxMnO3 (x=0.3,0.5,0.7)

    Science.gov (United States)

    Biswas, Sanjay; Pal, Sudipta

    2017-05-01

    The temperature dependences of DC electrical resistivity (ρ) of Pr1-xNdxMnO3 (x=0.3, 0.5, 0.7) have been studied in the temperature range from 115K up to 390 K. The samples were prepared by solid state reaction method. In the measured temperature range the resistivity decreases with increasing temperature for all the samples, indicating semiconductor-like behaviour. In the high temperature region, the electrical conduction follows small polaron hopping (SPH) mechanism showing exponential variation of resistivity with temperature. The activation energy decreases with Nd concentration. The low temperature resistivity data follows Mott's ln(ρT -1/2) ˜ T -1/4 law of VRH conduction mechanism. The estimated values of hopping distances (R) and hopping energies (W) of the samples start to decrease with increasing Nd concentrations. The effect of rare earth site doping on the hopping mechanism have been discussed.

  20. Determinants of Job Hopping Experience among Private and Public ...

    African Journals Online (AJOL)

    The results revealed that perceive organizational justice; job stress and job hopping significantly jointly predict employees' turnover intention. Additionally, job stress, job hopping and distributive justice which is one of the dimensions of organizational independently significantly predict employees' turnover intention.

  1. Modeling short-range stiffness of feline lower hindlimb muscles

    NARCIS (Netherlands)

    Cui, L.; Perreault, E.J.; Maas, H.; Sandercock, T.G.

    2008-01-01

    The short-range stiffness (SRS) of skeletal muscles is a critical property for understanding muscle contributions to limb stability, since it represents a muscle's capacity to resist external perturbations before reflexes or voluntary actions can intervene. A number of studies have demonstrated that

  2. Clathrin-dependent mechanisms modulate the subcellular distribution of class C Vps/HOPS tether subunits in polarized and nonpolarized cells.

    Science.gov (United States)

    Zlatic, Stephanie A; Tornieri, Karine; L'Hernault, Steven W; Faundez, Victor

    2011-05-15

    Coats define the composition of carriers budding from organelles. In addition, coats interact with membrane tethers required for vesicular fusion. The yeast AP-3 (Adaptor Protein Complex 3) coat and the class C Vps/HOPS (HOmotypic fusion and Protein Sorting) tether follow this model as their interaction occurs at the carrier fusion step. Here we show that mammalian Vps class C/HOPS subunits and clathrin interact and that acute perturbation of clathrin function disrupts the endosomal distribution of Vps class C/HOPS tethers in HEK293T and polarized neuronal cells. Vps class C/HOPS subunits and clathrin exist in complex with either AP-3 or hepatocyte growth factor receptor substrate (Hrs). Moreover, Vps class C/HOPS proteins cofractionate with clathrin-coated vesicles, which are devoid of Hrs. Expression of FK506 binding protein (FKBP)-clathrin light chain chimeras, to inhibit clathrin membrane association dynamics, increased Vps class C/HOPS subunit content in rab5 endosomal compartments. Additionally, Vps class C/HOPS subunits were concentrated at tips of neuronal processes, and their delivery was impaired by expression of FKBP-clathrin chimeras and AP20187 incubation. These data support a model in which Vps class C/HOPS subunits incorporate into clathrin-coated endosomal domains and carriers in mammalian cells. We propose that vesicular (AP-3) and nonvesicular (Hrs) clathrin mechanisms segregate class C Vps/HOPS tethers to organelles and domains of mammalian cells bearing complex architectures.

  3. The BDS Triple Frequency Pseudo-range Correlated Stochastic Model of Single Station Modeling Method

    Directory of Open Access Journals (Sweden)

    HUANG Lingyong

    2017-05-01

    Full Text Available In order to provide a reliable pseudo-range stochastic model, a method is studied to estimate the BDS triple-frequency pseudo-range related stochastic model based on three BDS triple-frequency pseudo-range minus carrier (GIF combinations using the data of a single station. In this algorithm, the low order polynomial fitting method is used to fit the GIF combination in order to eliminate the error and other constants except non pseudo noise at first. And then, multiple linear regression analysis method is used to model the stochastic function of three linearly independent GIF combinations. Finally the related stochastic model of the original BDS triple-frequency pseudo-range observations is obtained by linear transformation. The BDS triple-frequency data verification results show that this algorithm can get a single station related stochastic model of BDS triple-frequency pseudo-range observation, and it is advantageous to provide accurate stochastic model for navigation and positioning and integrity monitoring.

  4. Topological signatures of medium range order in amorphous semiconductor models

    Energy Technology Data Exchange (ETDEWEB)

    Treacy, M. M. J.; Voyles, P. M.; Gibson, J. M.

    2000-05-23

    The topological local cluster (or Schlaefli cluster) concept of Marians and Hobbs is used to detect topologically crystalline regions in models of disordered tetrahedral semiconductors. The authors present simple algorithms for detecting both Wells-type shortest circuits and O'Keeffe-type rings, which can be used to delineate alternative forms of the Schlaefli cluster in models.

  5. Modeling multipole dielectric spherical nanoantenna for optical and THz range

    Science.gov (United States)

    Storozhenko, Dmitry; Dzyuba, Vladimir; Kulchin, Yuri

    2017-09-01

    The paper gives the result of a numerical calculation of the Maxwell equation by the finite element method for a dielectric particle of spherical shape in the optical and THz ranges with a size 0.375÷0.75 of wavelength. The nature of the electric field distribution inside the sphere is shown in the case of high-order resonance for the optical range. The idea was put forward to use the resonance feature of the dielectric sphere to amplify the current in the conductor whip antenna. It is shown, that the use of such an antenna makes it possible to achieve amplification in the conductor up to 30 dB.

  6. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  7. Bounds on the hop domination number of a tree

    Indian Academy of Sciences (India)

    A hop dominating set of a graph is a set of vertices of if for every vertex of () \\ D, there exists u ∈ D such that (, ) = 2. The hop domination number of a graph , denoted by ℎ(), is the minimum cardinality of a hop dominating set of . We prove that for every tree of order with leaves and support ...

  8. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  9. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  10. 21 CFR 172.560 - Modified hop extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Modified hop extract. 172.560 Section 172.560 Food... Flavoring Agents and Related Substances § 172.560 Modified hop extract. The food additive modified hop extract may be safely used in beer in accordance with the following prescribed conditions: (a) The food...

  11. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    Science.gov (United States)

    Neiens, Silva D; Steinhaus, Martin

    2018-02-05

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  12. MGP : a tool for wide range temperature modelling

    Energy Technology Data Exchange (ETDEWEB)

    Morales, A.F. [Inst. Tecnologico Autonomo de Mexico, Mexico City (Mexico); Seisdedos, L.V. [Univ. de Oriente, Santiago de Cuba (Cuba). Dept. de Control Automatico

    2006-07-01

    This paper proposed a practical temperature modelling tool that used genetic multivariate polynomials to determine polynomial expressions of enthalpy and empirical heat transfer equations in superheaters. The model was designed to transform static parameter estimations from distributed into lumped parameter systems. Two dynamic regimes were explored: (1) a power dynamics regime containing major inputs and outputs needed for overall plant control; and (2) a steam temperature dynamics scheme that considered consecutive superheater sections considered in terms of cooling water mass flow and steam mass flow. The single lumped parameters model was developed to provide temperature control for a fossil fuel-fired power plant. The design procedure used enthalpy to determine the plant's energy balance. The enthalpy curve was seen as a function of either temperature and steam pressure. A graphic simulation tool was used to optimize the model by comparing real and simulated plant data. The study showed that the amount of energy taken by the steam mass flow per time unit can be calculated by measuring temperatures and pressures at both ends of the superheater. An algorithm was then developed to determine the polynomial's coefficients according to best curve fitting over the training set and best maximum errors. It was concluded that a unified approach is now being developed to simulate and emulate the dynamics of steam temperature for each section's attemporator-superheater. 14 refs., 3 tabs., 5 figs.

  13. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  14. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  15. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  16. Bridge Hopping on Conducting Polymers in Solution

    OpenAIRE

    Hone, Daniel W.; Orland, Henri

    2000-01-01

    Configurational fluctuations of conducting polymers in solution can bring into proximity monomers which are distant from each other along the backbone. Electrons can hop between these monomers across the "bridges" so formed. We show how this can lead to (i) a collapse transition for metallic polymers, and (ii) to the observed dramatic efficiency of acceptor molecules for quenching fluorescence in semiconducting polymers.

  17. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  18. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  19. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    Science.gov (United States)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  20. Capacitive MEMS accelerometer wide range modeling using artificial neural network

    OpenAIRE

    A. Baharodimehr; A. Abolfazl Suratgar; H. Sadeghi

    2009-01-01

    This paper presents a nonlinear model for a capacitive microelectromechanical accelerometer (MEMA). System parameters ofthe accelerometer are developed using the effect of cubic term of the folded‐flexure spring. To solve this equation, we use theFEA method. The neural network (NN) uses the Levenberg‐Marquardt (LM) method for training the system to have a moreaccurate response. The designed NN can identify and predict the displacement of the movable mass of accelerometer. Thesimulation result...

  1. Capacitive MEMS accelerometer wide range modeling using artificial neural network

    Directory of Open Access Journals (Sweden)

    A. Baharodimehr

    2009-08-01

    Full Text Available This paper presents a nonlinear model for a capacitive microelectromechanical accelerometer (MEMA. System parameters ofthe accelerometer are developed using the effect of cubic term of the folded‐flexure spring. To solve this equation, we use theFEA method. The neural network (NN uses the Levenberg‐Marquardt (LM method for training the system to have a moreaccurate response. The designed NN can identify and predict the displacement of the movable mass of accelerometer. Thesimulation results are very promising.

  2. Stretch reflex improves rolling stability during hopping of a decerebrate biped system.

    Science.gov (United States)

    Rosendo, Andre; Liu, Xiangxiao; Shimizu, Masahiro; Hosoda, Koh

    2015-01-19

    When humans hop, attitude recovery can be observed in both the sagittal and frontal planes. While it is agreed that the brain plays an important role in leg placement, the role of low-level feedback (the stretch reflex) on frontal plane stabilization remains unclear. Seeking to better understand the contribution of the soleus stretch reflex to rolling stability, we performed experiments on a biomimetic humanoid hopping robot. Various reflex responses to touching the floor, ranging from no response to long muscle activations, were examined, and the effect of a delay upon touching the floor was also examined. We found that the stretch reflex brought the system closer to stable, straight hopping. The presence of a delay did not affect the results; both the cases with and without a delay outperformed the case without a reflex response. The results of this study highlight the importance of low-level control in locomotion for which body stabilization does not require higher-level signals.

  3. Hip-Hop Fight Club: Radical Theory, Education, and Practice in and beyond the Classroom

    Directory of Open Access Journals (Sweden)

    Jared A. Ball

    2013-10-01

    Full Text Available Hip-hop remains a viable method for the teaching of radical theory, emancipatory journalism and Africana Media Theory.  Fight Club is an emergent model that builds from existing hip-hop traditions of freetyle battling where critical thought and intellectual challenges of hueristic norms are upended.  This article argues in favor of bringing the Fight Club model into the classroom which allows for heightened student engagement and the inclusion of radical theoretical approaches to the study of mass media, communication and journalism.

  4. Interaction-induced hopping phase in driven-dissipative coupled photonic microcavities

    CERN Document Server

    Rodriguez, S R K; Sagnes, I; Gratiet, L Le; Galopin, E; Lemaitre, A; Bloch, J

    2016-01-01

    Bosons hopping across sites and interacting on-site are the essence of the Bose-Hubbard model (BHM). Inspired by the success of BHM simulators with atoms in optical lattices, proposals for implementing the BHM with photons in coupled nonlinear cavities have emerged. Two coupled semiconductor microcavities constitute a model system where the hopping, interaction, and decay of exciton polaritons --- mixed light-matter quasiparticles --- can be engineered in combination with site-selective coherent driving to implement the driven-dissipative two-site optical BHM. Here we explore the interplay of interference and nonlinearity in this system, in a regime where three distinct density profiles can be observed under identical driving conditions. We demonstrate how the phase acquired by polaritons hopping between cavities can be controlled through effective polariton-polariton interactions. Our results open new perspectives for synthesizing density-dependent gauge fields for polaritons in two-dimensional multicavity s...

  5. Tietoista liikettä : Hip hop -kulttuurin merkitys katutanssin opettamisessa

    OpenAIRE

    Pikkarainen, Sara

    2015-01-01

    Tutkimuksen lähtökohtana oli saada lisää tietoa siitä, kuinka keskeiseksi hip hop -kulttuurin ym-märtäminen koetaan osana tanssinopettajan ammattitaitoa. Tutkimuskysymykseni ovat: Miksi hip hop -kulttuurin ymmärtäminen on merkityksellistä tanssinopetuksen näkökulmasta? Miten hip hop -kulttuuri ilmenee katutanssinopetuksessa tanssikouluympäristössä? Jotta tutkimuskysymyksiin voidaan vastata, täytyy ymmärtää miten hip hop -kulttuuri on vaikuttanut hip hop -tanssin kehittymiseen ja miten hip...

  6. An amino acid substitution in the Drosophila hopTum-l Jak kinase causes leukemia-like hematopoietic defects.

    Science.gov (United States)

    Luo, H; Hanratty, W P; Dearolf, C R

    1995-01-01

    Proteins of the Jak family of non-receptor kinases play important roles in mammalian hematopoietic signal transduction. They mediate the cellular response to a wide range of cytokines and growth factors. A dominant mutation in a Drosophila Jak kinase, hopscotchTumorous-lethal (hopTum-l), causes hematopoietic defects. Here we conduct a molecular analysis of hopTum-l. We demonstrate that the hopTum-l hematopoietic phenotype is caused by a single amino acid substitution of glycine to glutamic acid at residue 341. We generate a true revertant of the hopTum-l mutation, in which both the molecular lesion and the mutant hematopoietic phenotype revert back to wild type. We also examine the effects of the G341E substitution in transgenic flies. The results indicate that a mutant Jak kinase can cause leukemia-like abnormalities. Images PMID:7729418

  7. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  8. Dust Plume Modeling from Ranges and Maneuver Areas on Fort Bliss and the White Sands Missile Range: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Chapman, Elaine G.; Barnard, James C.; Rutz, Frederick C.; Pekour, Mikhail S.; Rishel, Jeremy P.; Shaw, William J.

    2009-05-04

    The potential for air quality impacts from heavy mechanized vehicles operating on and between the unpaved main supply routes at Fort Bliss and White Sands Missile Range was investigated. This report details efforts by the staff of Pacific Northwest National Laboratory for the Fort Bliss Directorate of Environment in this investigation. Dust emission and dispersion from typical move-out activities occurring on the installations were simulated using the atmospheric modeling system DUSTRAN. Major assumptions associated with designing the modeling scenarios are summarized and results of simulations conducted under these assumptions are presented for four representative meteorological periods.

  9. Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

    Science.gov (United States)

    Alim, H. Samy

    2011-01-01

    This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

  10. The effect of inter-strand hopping term on charge transport properties of an aperiodic DNA molecule

    Science.gov (United States)

    Rahman, R.; Yudiarsah, E.

    2017-07-01

    The effect of inter-strand hopping on charge transport process in an aperiodic DNA molecule has been studied using a tight-binding Hamiltonian model. In this study, a double stranded aperiodic DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA in one strand and its complement strand is used. The molecule is connected to an electrode on both ends. In the model, inter-base electron hopping is taken into account and represented by the inter-strand hopping parameter. The charge transport properties are studied from calculating transmission probability and I-V characteristics. Transfer matrix and scattering matrix methods are simultaneously used in computing transmission probability. The transmission probability is used in calculating the I-V characteristics using Launder-Büttiker formula. The result shows that change in inter-strand hopping term changes transmission probability, which changes I-V characteristics. The effect is clearer at high voltage and high temperature.

  11. Salmonella exploits the host endolysosomal tethering factor HOPS complex to promote its intravacuolar replication

    Science.gov (United States)

    Sindhwani, Aastha; Kaur, Harmeet; Tuli, Amit

    2017-01-01

    Salmonella enterica serovar typhimurium extensively remodels the host late endocytic compartments to establish its vacuolar niche within the host cells conducive for its replication, also known as the Salmonella-containing vacuole (SCV). By maintaining a prolonged interaction with late endosomes and lysosomes of the host cells in the form of interconnected network of tubules (Salmonella-induced filaments or SIFs), Salmonella gains access to both membrane and fluid-phase cargo from these compartments. This is essential for maintaining SCV membrane integrity and for bacterial intravacuolar nutrition. Here, we have identified the multisubunit lysosomal tethering factor—HOPS (HOmotypic fusion and Protein Sorting) complex as a crucial host factor facilitating delivery of late endosomal and lysosomal content to SCVs, providing membrane for SIF formation, and nutrients for intravacuolar bacterial replication. Accordingly, depletion of HOPS subunits significantly reduced the bacterial load in non-phagocytic and phagocytic cells as well as in a mouse model of Salmonella infection. We found that Salmonella effector SifA in complex with its binding partner; SKIP, interacts with HOPS subunit Vps39 and mediates recruitment of this tethering factor to SCV compartments. The lysosomal small GTPase Arl8b that binds to, and promotes membrane localization of Vps41 (and other HOPS subunits) was also required for HOPS recruitment to SCVs and SIFs. Our findings suggest that Salmonella recruits the host late endosomal and lysosomal membrane fusion machinery to its vacuolar niche for access to host membrane and nutrients, ensuring its intracellular survival and replication. PMID:29084291

  12. Resonant hopping of a robot controlled by an artificial neural oscillator.

    Science.gov (United States)

    Pelc, Evan H; Daley, Monica A; Ferris, Daniel P

    2008-06-01

    The bouncing gaits of terrestrial animals (hopping, running, trotting) can be modeled as a hybrid dynamic system, with spring-mass dynamics during stance and ballistic motion during the aerial phase. We used a simple hopping robot controlled by an artificial neural oscillator to test the ability of the neural oscillator to adaptively drive this hybrid dynamic system. The robot had a single joint, actuated by an artificial pneumatic muscle in series with a tendon spring. We examined how the oscillator-robot system responded to variation in two neural control parameters: descending neural drive and neuromuscular gain. We also tested the ability of the oscillator-robot system to adapt to variations in mechanical properties by changing the series and parallel spring stiffnesses. Across a 100-fold variation in both supraspinal gain and muscle gain, hopping frequency changed by less than 10%. The neural oscillator consistently drove the system at the resonant half-period for the stance phase, and adapted to a new resonant half-period when the muscle series and parallel stiffnesses were altered. Passive cycling of elastic energy in the tendon accounted for 70-79% of the mechanical work done during each hop cycle. Our results demonstrate that hopping dynamics were largely determined by the intrinsic properties of the mechanical system, not the specific choice of neural oscillator parameters. The findings provide the first evidence that an artificial neural oscillator will drive a hybrid dynamic system at partial resonance.

  13. Integration of intrinsic muscle properties, feed-forward and feedback signals for generating and stabilizing hopping.

    Science.gov (United States)

    Haeufle, D F B; Grimmer, S; Kalveram, K-T; Seyfarth, A

    2012-07-07

    It was hypothesized that a tight integration of feed-forward and feedback-driven muscle activation with the characteristic intrinsic muscle properties is a key feature of locomotion in challenging environments. In this simulation study it was investigated whether a combination of feed-forward and feedback signals improves hopping stability compared with those simulations with one individual type of activation. In a reduced one-dimensional hopping model with a Hill-type muscle (one contractile element, neither serial nor parallel elastic elements), the level of detail of the muscle's force-length-velocity relation and the type of activation generation (feed-forward, feedback and combination of both) were varied to test their influence on periodic hopping. The stability of the hopping patterns was evaluated by return map analysis. It was found that the combination of feed-forward and proprioceptive feedback improved hopping stability. Furthermore, the nonlinear Hill-type representation of intrinsic muscle properties led to a faster reduction of perturbations than a linear approximation, independent of the type of activation. The results emphasize the ability of organisms to exploit the stabilizing properties of intrinsic muscle characteristics.

  14. Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

    Science.gov (United States)

    Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

    2011-01-01

    For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

  15. Optimal hop position-based minimum energy routing protocol for underwater acoustic sensor networks

    Directory of Open Access Journals (Sweden)

    K.S. Geethu

    2015-05-01

    Full Text Available Development of energy-efficient routing protocols is a major concern in the design of underwater acoustic sensor networks (UASNs since UASN nodes are typically powered by batteries, which are difficult to replace or recharge in aquatic environments. This study proposes an optimal hop position-based energy-efficient routing protocol for UASNs. Initially, the authors present an analytical model to compute the total energy consumption in a multi-hop UASN for deep water scenario, taking into account dependence of usable bandwidth on transmission distance and propagation characteristics of underwater acoustic channel. They derive analytical solution for the optimal hop distance that minimises total energy consumption in the network. They then propose an energy-efficient routing protocol that relies on the computation of optimal hop distance. In their routing scheme, selection of forwarding nodes are based on their depth, residual energy and closeness to the computed optimal hop position corresponding to source node. Simulation results show that total energy consumption of the network gets reduced drastically, leading to improvement in network lifetime. Moreover, the proposed routing scheme makes use of courier nodes to handle coverage-hole problem. The efficient movement of courier nodes improves packet delivery ratio and network throughput.

  16. Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

    Science.gov (United States)

    Hartmann, Richard; Strunz, Walter T

    2017-11-09

    We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

  17. Defined subunit arrangement and rab interactions are required for functionality of the HOPS tethering complex.

    Science.gov (United States)

    Ostrowicz, Clemens W; Bröcker, Cornelia; Ahnert, Franziska; Nordmann, Mirjana; Lachmann, Jens; Peplowska, Karolina; Perz, Angela; Auffarth, Kathrin; Engelbrecht-Vandré, Siegfried; Ungermann, Christian

    2010-10-01

    Within the endomembrane system of eukaryotic cells, multisubunit tethering complexes together with their corresponding Rab-GTPases coordinate vesicle tethering and fusion. Here, we present evidence that two homologous hexameric tethering complexes, the endosomal CORVET (Class C core vacuole/endosome transport) and the vacuolar HOPS (homotypic vacuole fusion and protein sorting) complex, have similar subunit topologies. Both complexes contain two Rab-binding proteins at one end, and the Sec1/Munc18-like Vps33 at the opposite side, suggesting a model on membrane bridging via Rab-GTP and SNARE binding. In agreement, HOPS activity can be reconstituted using purified subcomplexes containing the Rab and Vps33 module, but requires all six subunits for activity. At the center of HOPS and CORVET, the class C proteins Vps11 and Vps18 connect the two parts, and Vps11 binds both HOPS Vps39 and CORVET Vps3 via the same binding site. As HOPS Vps39 is also found at endosomes, our data thus suggest that these tethering complexes follow defined but distinct assembly pathways, and may undergo transition by simple subunit interchange. © 2010 John Wiley & Sons A/S.

  18. Implementing FORMS for the Monterey Bay Forecasting System Using HOPS and ROMS

    National Research Council Canada - National Science Library

    Gangopadhyay, Avijit

    2004-01-01

    ...) to implement the feature-oriented regional modeling system (FORMS) capabilities in the West Coast ROMS and HOPS modeling efforts for synoptic nowcast, forecast and 3D-VARS and ESSE-based assimilation in the Monterey Bay region, and (iii...

  19. Modeling Brain Circuitry over a Wide Range of Scales

    Directory of Open Access Journals (Sweden)

    Pascal eFua

    2015-04-01

    Full Text Available If we are ever to unravel the mysteries of brain function at its most fundamental level, we will need a precise understanding of how its component neurons connect to each other. Electron Microscopes (EM can now provide the nanometer resolution that is needed to image synapses, and therefore connections, while Light Microscopes (LM see at the micrometer resolution required to model the 3D structure of the dendritic network. Since both the topology and the connection strength are integral parts of the brain's wiring diagram, being able to combine these two modalities is critically important.In fact, these microscopes now routinely produce high-resolution imagery in such large quantities that the bottleneck becomes automated processing and interpretation, which is needed for such data to be exploited to its full potential. In this paper, we briefly review the Computer Vision techniques we have developed at EPFL to address this need. They include delineating dendritic arbors from LM imagery, segmenting organelles from EM, and combining the two into a consistent representation.

  20. Robust hopping based on virtual pendulum posture control.

    Science.gov (United States)

    Sharbafi, Maziar A; Maufroy, Christophe; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Seyfarth, Andre

    2013-09-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved.

  1. OFDMA Cellular Networks with Opportunistic Two-Hop Relays

    Directory of Open Access Journals (Sweden)

    Calcev George

    2009-01-01

    Full Text Available We investigate the benefits of two-hop opportunistic relay in time division duplex (TDD OFDMA cellular network configurations. The paper starts with a short analytical model for the two-hop opportunistic relay. The model expresses the probability of finding a suitable relay node in the presence of lognormal fading and it allows the computation of the expected number of out-of-coverage nodes, as well as the end-to-end spectrum efficiency increase due to opportunistic relaying. The paper then presents results for Monte Carlo simulations of opportunistic relay in some realistic scenarios. Specifically, the simulations consider two scenarios. The first scenario uses the propagation model and a wide-area 19-cell configuration specified in 802.16 OFDMA cellular standard evaluation methodologies. In the second scenario, a Manhattan-like 19-cell topology is used. Our simulations show 11% to 33% in throughput increase when the opportunistic relay technology is used. Our results evaluate the benefits of the opportunistic relay in both scenarios in terms of coverage extension and throughput increase.

  2. Subunit organisation of in vitro reconstituted HOPS and CORVET multisubunit membrane tethering complexes.

    Directory of Open Access Journals (Sweden)

    Zhong Guo

    Full Text Available Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data.

  3. Optimal inhomogeneity for pairing in Hubbard systems with next-nearest-neighbor hopping

    Science.gov (United States)

    Wachtel, Gideon; Baruch, Shirit; Orgad, Dror

    2017-08-01

    Previous studies have shown that bipartite Hubbard systems with inhomogeneous hopping amplitudes can exhibit higher pair-binding energies than the uniform model. Here we examine whether this result holds for systems with a more generic band structure. To this end, we use exact diagonalization and the density matrix renormalization-group method to study the 4 ×4 Hubbard cluster and the two-leg Hubbard ladder with checkerboard-modulated nearest-neighbor hopping, t , and next-nearest-neighbor (diagonal) hopping, td. We find that the strongest pairing continues to occur at an intermediate level of inhomogeneity. While the maximal pair-binding energy is enhanced by a positive td/t , it is suppressed and appears at weaker repulsion strengths and lower hole concentrations when td/t is negative. We point out a possible connection between the pairing maximum and the magnetic properties of the system.

  4. An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2017-01-01

    Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

  5. Problem Formulation and Analysis of the 1-Hop ARQ Links

    Science.gov (United States)

    Cheung, K.-M.

    2013-08-01

    In space communications, standard link analysis assumes that messages are sent once. For a communication link that uses an error-correction coding scheme, bit-error rate (BER) or frame-error rate (FER), and link margins are common metrics that characterize the quality of a link, and they are used to determine the supportable data rate. With the advent of Automatic Repeat-reQuest (ARQ) protocols, when messages are corrupted during transmission, they can be resent multiple times automatically until they are correctly received and acknowledged. The concept of BER, FER, and link margin cannot be directly applied, and the link analysis approach for ARQ links needs to be reexamined. In this article, we provide the problem formulation and extend the standard link analysis approach to a 1-hop ARQ link (no routing), under the assumption that code-block errors occur independently as in the case of space communications. We develop analytical models that describe the statistical behavior of standard 1-hop ARQ links. By integrating these analytical ARQ protocol models into the standard link analysis, we bypass the need to simulate or emulate the ARQ protocol operations, and generate relevant statistics on effective data rate, effective throughput, latency, and FER.

  6. Long-term oral administration of hop flower extracts mitigates Alzheimer phenotypes in mice.

    Directory of Open Access Journals (Sweden)

    Norio Sasaoka

    Full Text Available Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the "amyloid hypothesis" has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein, by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the "amyloid hypothesis", we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the "amyloid hypothesis", and indicate that Hop extract is a promising candidate for an effective prophylactic for AD.

  7. Evaluation of airborne methyl salicylate for improved conservation biological control of two-spotted spider mite and hop aphid in Oregon hop yards.

    Science.gov (United States)

    Woods, J L; James, D G; Lee, J C; Gent, D H

    2011-12-01

    The use of synthetic herbivore-induced plant volatiles (HIPV) to attract natural enemies has received interest as a tool to enhance conservation biological control (CBC). Methyl salicylate (MeSA) is a HIPV that is attractive to several key predators of two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera: Aphididae). A 2-year study was conducted to evaluate the recommended commercial use of MeSA in hop yards in Oregon. Slow-release MeSA dispensers were stapled to supporting poles in 0.5 ha plots and these plots were compared to a paired non-treated plot on each of three farms in 2008 and 2009. Across both years, there was a trend for reduced (range 40-91%) mean seasonal numbers of T. urticae in five of the six MeSA-baited plots. Stethorus spp., key spider mite predators, tended to be more numerous in MeSA-baited plots compared to control plots on a given farm. Mean seasonal densities of hop aphid and other natural enemies (e.g., Orius spp. and Anystis spp.) were similar between MeSA-treated and control plots. Variability among farms in suppression of two-spotted spider mites and attraction of Stethorus spp. suggests that the use of MeSA to enhance CBC of spider mites in commercial hop yards may be influenced by site-specific factors related to the agroecology of individual farms or seasonal effects that require further investigation. The current study also suggests that CBC of hop aphid with MeSA in this environment may be unsatisfactory.

  8. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  9. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  10. Gender specific strategies in demanding hopping conditions.

    Science.gov (United States)

    Demirbüken, Ilkşan; Yurdalan, Saadet Ufuk; Savelberg, Hans; Meijer, Kenneth

    2009-01-01

    Difference in leg stiffness between females and males is considered to be a cause of higher rates of Anterior Cruciate Ligament injury in female athletes. Females are believed to have lower stiffness and as a consequence different recruitment strategies to adapt functional tasks. The aim of the current study was to evaluate how leg stiffness is tuned to demanding conditions. 22 healthy subjects (11 Male-11 Female; age: 20-43 years) participated in this study. Subjects performed two-legged hopping tasks (at their preferred rate, as fast as possible and with added mass of 10% bodyweight) on a force platform. Leg stiffness was calculated for each condition as the ratio between peak ground reaction force and vertical displacement of center of mass. In the preferred and added mass conditions males showed substantially higher leg stiffness than females (p= 0.006 and p = 0.002, respectively). When hopping as fast as possible the gender bias in leg stiffness disappeared (p = 0.880). Added mass had no significant effect on change in leg stiffness. Results have shown that females increased their leg stiffness more than males indicating they have no gender limiting capacity to reach objectives of higher demanding tasks (i.e.fastest hopping).The relationship between observed gender differences in leg stiffness and increased Anterior Cruciate Ligament injury rate in females requires further study. Key pointsLeg stiffness is an adaptable property of neuro musculoskeletal system to different functional loading conditions.Females can increase their leg stiffness more than males indicating they have no gender limiting capacity to reach objectives of higher demanding tasks as fastest hopping.

  11. Modeling of Long-Range Atmospheric Lasercom Links Between Static and Mobile Platforms

    Energy Technology Data Exchange (ETDEWEB)

    Scharlemann, E T; Breitfeller, E F; Henderson, J R; Kallman, J S; Morris, J R; Ruggiero, A J

    2003-07-29

    We describe modeling and simulation of long-range terrestrial laser communications links between static and mobile platforms. Atmospheric turbulence modeling, along with pointing, tracking and acquisition models are combined to provide an overall capability to estimate communications link performance.

  12. System Estimation of Panel Data Models under Long-Range Dependence

    DEFF Research Database (Denmark)

    Ergemen, Yunus Emre

    A general dynamic panel data model is considered that incorporates individual and interactive fixed effects allowing for contemporaneous correlation in model innovations. The model accommodates general stationary or nonstationary long-range dependence through interactive fixed effects and innovat...

  13. Radio resource management scheme and outage analysis for network-assisted multi-hop D2D communications

    Directory of Open Access Journals (Sweden)

    Leila Melki

    2016-11-01

    Full Text Available In a cellular network it's very difficult to make spectrum resource more efficiently. Device-to-Device (D2D technology enables new service opportunities, and provides high throughput and reliable communication while reducing the base station load. For better total performance, short-range D2D links and cellular links share the same radio resource and the management of interference becomes a crucial task. Here we argue that single-hop D2D technology can be used to further improve cellular networks performance if the key D2D radio resource management algorithms are suitably extended to support multi-hop D2D communications. Aiming to establish a new paradigm for the analysis and design of multi-hop D2D communications, We propose a radio resource allocation for multi-hop D2D routes based on interference avoidance approach in LTE-A networks. On top of that, we investigate the outage probability of D2D communication. We first introduce a new definition of outage probability by considering the maximum distance to be allowable for single-hop transmission. Then we study and analyze the outage performance of a multi-hop D2D route. We derive the general closed form expression of outage probability of the multi-hop D2D routes. The results demonstrate that the D2D radio, sharing the same resources as the cellular network, provide higher capacity compared to pure cellular communication where all the data is transmitted through the base station. They also demonstrate that the new method of calculation of D2D multi hop outage probability has better performance than classical method defined in the literature.

  14. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    Science.gov (United States)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  15. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2007-01-01

    Ion conduction in noncrystals (glasses, polymers, etc) has a number of properties in common. In fact, from a purely phenomenological point of view, these properties are even more widely observed: ion conduction behaves much like electronic conduction in disordered materials (e.g., amorphous semic...

  16. Elevated Knee Joint Kinetics and Reduced Ankle Kinetics Are Present During Jogging and Hopping After Achilles Tendon Ruptures.

    Science.gov (United States)

    Willy, Richard W; Brorsson, Annelie; Powell, Hayley C; Willson, John D; Tranberg, Roy; Grävare Silbernagel, Karin

    2017-04-01

    Deficits in plantarflexor function are common after an Achilles tendon rupture. These deficits may result in an altered distribution of joint loads during lower extremity tasks. We hypothesized that, regardless of treatment, the Achilles tendon-ruptured limb would exhibit deficits in ankle kinematics and joint power while exhibiting elevated knee joint power and patellofemoral joint loads during walking, jogging, and hopping. We further hypothesized that this loading pattern would be most evident during jogging and hopping. Controlled laboratory study. Thirty-four participants (17 participants treated surgically, 17 treated nonsurgically) were tested at a mean 6.1 ± 2.0 years after an Achilles tendon rupture. Lower extremity kinematics and kinetics were assessed while participants completed walking, jogging, and single-legged hopping trials. Patellofemoral joint stress was calculated via a musculoskeletal model. Data were analyzed via mixed-model repeated analyses of variance (α = .05) and the limb symmetry index (LSI). No differences ( P ≥ .05) were found between the surgical and nonsurgical groups. In both groups, large side-to-side deficits in the plantarflexion angle at toeoff (LSI: 53.5%-73.9%) were noted during walking, jogging, and hopping in the involved limb. Side-to-side deficits in the angular velocity were only present during jogging (LSI: 93.5%) and hopping (LSI: 92.5%). This pattern was accompanied by large deficits in eccentric (LSI: 80.8%-94.7%) and concentric (LSI: 82.2%-84.7%) ankle joint powers in the involved limb during all tasks. Interestingly, only jogging and hopping demonstrated greater knee joint loads when compared with the uninvolved limb. Concentric knee power was greater during jogging (LSI: 117.2%) and hopping (LSI: 115.9%) compared with the uninvolved limb. Similarly, peak patellofemoral joint stress was greater in the involved limb during jogging (LSI: 107.5%) and hopping (LSI: 107.1%), while only hopping had a greater loading

  17. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  18. Gait-Based Quadruped Robot Planar Hopping Control with Energy Planning

    Directory of Open Access Journals (Sweden)

    Hui Chai

    2016-02-01

    Full Text Available To improve the mobility of the quadruped robot, a planar hopping control approach is proposed based on trotting gait. With the proposed approach, three joints of the stance legs are active and the fourth leg is passive. A planar kinematic model of the supporting phase is built and the calculated positions and posture of the torso are used as feedback for motion control. The forces and torque acting at the CoM of the robot torso in the plane are fully controllable and decoupled with the control approach based on a virtual model. The planar motions on three axes are controlled independently. For the hopping control, the total energy in a hopping cycle on the vertical direction is planned according to the desired hopping height of the torso's CoM and the virtual vertical stiffness of the torso is generated using the elastic potential energy of the virtual model. We verify the approach and its robustness using simulation experiments and show the results at the end of this paper.

  19. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems.

    Science.gov (United States)

    Brummitt, Charles D; Barnett, George; D'Souza, Raissa M

    2015-11-06

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast-slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to 'hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. © 2015 The Authors.

  20. Identification of critical chemical features for Aurora kinase-B inhibitors using Hip-Hop, virtual screening and molecular docking

    Science.gov (United States)

    Sakkiah, Sugunadevi; Thangapandian, Sundarapandian; John, Shalini; Lee, Keun Woo

    2011-01-01

    This study was performed to find the selective chemical features for Aurora kinase-B inhibitors using the potent methods like Hip-Hop, virtual screening, homology modeling, molecular dynamics and docking. The best hypothesis, Hypo1 was validated toward a wide range of test set containing the selective inhibitors of Aurora kinase-B. Homology modeling and molecular dynamics studies were carried out to perform the molecular docking studies. The best hypothesis Hypo1 was used as a 3D query to screen the chemical databases. The screened molecules from the databases were sorted based on ADME and drug like properties. The selective hit compounds were docked and the hydrogen bond interactions with the critical amino acids present in Aurora kinase-B were compared with the chemical features present in the Hypo1. Finally, we suggest that the chemical features present in the Hypo1 are vital for a molecule to inhibit the Aurora kinase-B activity.

  1. Simulating Muscle-Reflex Dynamics in a Simple Hopping Robot

    Science.gov (United States)

    Seyfarth, Andre; Kalveram, Karl Theodor; Geyer, Hartmut

    In legged systems, springy legs facilitate gaits with subsequent contact and flight phases. Here, we test whether electrical motors can generate leg behaviors suitable for stable hopping. We built a vertically operating sledge actuated by a motor-driven leg. The motor torque simulates either a linear leg spring or a muscle-reflex system. For stable hopping significant energy supply was required after midstance. This was achieved by enhancing leg stiffness or by continuously applying positive force feedback to the simulated muscle. The muscle properties combined with positive force feedback result in spring-like behavior which enables stable hopping with adjustable hopping height.

  2. Validity and reliability of HOP-Up: a questionnaire to evaluate physical activity environments in homes with preschool-aged children.

    Science.gov (United States)

    Cheng, Carolyn; Martin-Biggers, Jennifer; Quick, Virginia; Spaccarotella, Kim; Byrd-Bredbenner, Carol

    2016-08-18

    Early identification of physical activity (PA) opportunities in the home and neighborhood environment may help obesity prevention efforts in households with young children. This cross-sectional study's purpose was to develop a brief, easy-to-use, self-report inventory called Home Opportunities for Physical activity check-Up (HOP-Up), to evaluate the availability and accessibility of PA space and equipment in and near homes with preschool children, and establish its validity and reliability. The HOP-Up was field tested by two trained researchers and parents of preschool-aged children (n = 50; 71% white). To establish criterion validity, researchers were the 'gold standard' and visited participants' homes to assess their PA environments using the HOP-Up, while participants separately completed their HOP-Up. Two weeks later, parents completed the HOP-Up online for test-retest reliability. After minor survey refinements, exploratory and confirmatory factor analysis using a split-half cross validation procedure was conducted in a larger sample of participants (n = 655, 60% white) who completed the HOP-Up online to examine its factor structure. To establish convergent validity, correlations were conducted to compare HOP-Up scales from the factor solution generated with PA behavior and cognitions, and reported screen time. Intra-class correlations (ICCs) examining HOP-Up item agreement between researcher and parents revealed slight to substantial agreement (range 0.22 to 0.81) for all items. ICCs for all HOP-Up items ranged from fair to substantial agreement between parent responses at both time points (range 0.42 to 0.95). Exploratory factor analysis revealed a five factor solution (18 items), supported eigen values, scree plots, review for contextual sense, and confirmatory factor analysis. Additionally, there were significant (p environment-inside, outside, and the neighborhood- impacts preschool children's physical activity levels.

  3. Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

    Science.gov (United States)

    Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

    2016-04-06

    Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

  4. Comparison of four extraction methods for analysis of volatile hop-derived aroma compounds in beer.

    Science.gov (United States)

    Richter, Tobias M; Eyres, Graham T; Silcock, Patrick; Bremer, Phil J

    2017-11-01

    The volatile organic compound profile in beer is derived from hops, malt, yeast, and interactions between the ingredients, making it very diverse and complex. Due to the range and diversity of the volatile organic compounds present, the choice of the extraction method is extremely important for optimal sensitivity and selectivity. This study compared four extraction methods for hop-derived compounds in beer late hopped with Nelson Sauvin. Extraction capacity and variation were compared for headspace solid-phase micro extraction, stir bar sorptive extraction, headspace sorptive extraction, and solvent-assisted flavor evaporation. Generally, stir bar sorptive extraction was better suited for acids, headspace sorptive extraction for esters and aldehydes, while headspace solid-phase microextraction was less sensitive overall, extracting 40% fewer compounds. Solvent-assisted flavor evaporation with dichloromethane was not suitable for the extraction of hop-derived volatile organic compounds in beer, as the profile was strongly skewed towards alcohols and acids. Overall, headspace sorptive extraction is found to be best suited, closely followed by stir bar sorptive extraction. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

    Science.gov (United States)

    Lawson, Carl J

    2015-12-01

    The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

  6. A Double Rate Localization Algorithm with One Anchor for Multi-Hop Underwater Acoustic Networks.

    Science.gov (United States)

    Gao, Jingjie; Shen, Xiaohong; Zhao, Ruiqin; Mei, Haodi; Wang, Haiyan

    2017-04-28

    Localization is a basic issue for underwater acoustic networks (UANs). Currently, most localization algorithms only perform well in one-hop networks or need more anchors which are not suitable for the underwater environment. In this paper, we proposed a double rate localization algorithm with one anchor for multi-hop underwater acoustic networks (DRL). The algorithm firstly presents a double rate scheme which separates the localization procedure into two modes to increase the ranging accuracy in multi-hop UANs while maintaining the transmission rate. Then an optimal selection scheme of reference nodes was proposed to reduce the influence of references' topology on localization performance. The proposed DRL algorithm can be used in the multi-hop UANs to increase the localization accuracy and reduce the usage of anchor nodes. The simulation and experimental results demonstrated that the proposed DRL algorithm has a better localization performance than the previous algorithms in many aspects such as accuracy and communication cost, and is more suitable to the underwater environment.

  7. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  8. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  9. Pipefest hip hop -festivaalin markkinointiviestintä

    OpenAIRE

    Kallio, Timo

    2010-01-01

    Opinnäytetyöni aiheena oli Pipefest hip hop -festivaalien markkinointiviestinnän toteuttaminen. Olin ollut kävijänä tapahtumassa vuodesta 2003 lähtien, ja aloitettuani opinnot digitaalisen äänen ja kaupallisen musiikin suuntautumisvaihtoehdon linjalla, kiinnostuin tapahtuma- ja festivaalijärjestämisestä. Tutustuin tapahtumaa järjestävään tahoon ja aloin työstää Pipefestin markkinointiviestintää. Opintoihini kuuluneella tapahtumatuotannon kurssilla sain paljon oppia tapahtumatuotannosta t...

  10. Calibrating and testing a gap model for simulating forest management in the Oregon Coast Range

    Science.gov (United States)

    Robert J. Pabst; Matthew N. Goslin; Steven L. Garman; Thomas A. Spies

    2008-01-01

    The complex mix of economic and ecological objectives facing today's forest managers necessitates the development of growth models with a capacity for simulating a wide range of forest conditions while producing outputs useful for economic analyses. We calibrated the gap model ZELIG to simulate stand level forest development in the Oregon Coast Range as part of a...

  11. Design, Development and Control of a Hopping Machine – an Exercise in Biomechatronics

    Directory of Open Access Journals (Sweden)

    Kuldip Naik

    2010-01-01

    Full Text Available Hopping is a complicated dynamic behaviour in the animal kingdom. Development of a hopping machine that can mimic the biomechanics of jumping in Homo sapiens is envisioned. In this context, the design, development and control of a cost-effective, pneumatically actuated, one-legged hopping machine were initiated at the University ofRegina in 2005. The pneumatic actuator has a simple design that employs an off-the-shelf on/off control valve which regulates the air pressure supplied to the hopper's body using a pulse width modulated (PWM signal. The objective is to maintain a constant jumping height in the hopper after going through a finite number of hopping cycles. The mechanistic model of the system was investigated in full detail. This model facilitates: (1 the design of the actuating system, and (2 the synthesis and verification of different control strategies in a simulation environment prior to implementation in the real world. The movement of the hopper is supported by a vertical slide; therefore, the hopper can only jump in place. However, the proposed control strategy and the propulsion unit can be further utilised for stable hopping in a 3-D environment. A model-free Neuro-PD controller was then designed, trained and implemented on a real system. Simulation and experimentation showed promising results. This system can be used as an educational tool for teaching real-time control of hybrid and non-linear systems. It can be also used as a biomechatronics test bed to simulate the effect of different timings in firing action potentials in jump-causing leg muscles on achieving a desired jumping height in the animal kingdom.

  12. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  13. Maser Source-Finding Methods in HOPS

    Science.gov (United States)

    Walsh, A. J.; Purcell, C.; Longmore, S.; Jordan, C. H.; Lowe, V.

    2012-12-01

    The H2O Southern Galactic Plane Survey (HOPS) has observed 100 deg2 of the Galactic plane, using the Mopra radio telescope to search for emission from multiple spectral lines in the 12-mm band (19.5-27.5GHz). Perhaps the most important of these spectral lines is the 22.2-GHz water-maser transition. We describe the methods used to identify water-maser candidates and subsequent confirmation of the sources. Our methods involve a simple determination of likely candidates by searching peak emission maps, utilising the intrinsic nature of water-maser emission, spatially unresolved and spectrally narrow-lined. We estimate completeness limits and compare our method with results from the DUCHAMP source finder. We find that the two methods perform similarly. We conclude that the similarity in performance is due to the intrinsic limitation of the noise characteristics of the data. The advantages of our method are that it is slightly more efficient in eliminating spurious detections and is simple to implement. The disadvantage is that it is a manual method of finding sources and so is not practical on datasets much larger than HOPS, or for datasets with extended emission that needs to be characterised. We outline a two-stage method for the most efficient means of finding masers, using DUCHAMP.

  14. Potential African Substitutes for Hops in Tropical Beer Brewing ...

    African Journals Online (AJOL)

    Proximate analysis showed that these vegetables had protein and crude fibre values comparable to those of commercial hops. Fat content values were however much higher than those for hops with Grongonema latifolium having the highest values of 19.10%. Garcinia cola with a total resin value of 8.24% and an essential ...

  15. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  16. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  17. Factors of Intensification in the Hops Cluster of Chuvashia

    Science.gov (United States)

    Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.

    2016-01-01

    The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…

  18. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  19. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  20. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  1. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  2. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  3. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  4. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  5. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  6. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  7. Detailed balance, internal consistency, and energy conservation in fragment orbital-based surface hopping

    Science.gov (United States)

    Carof, Antoine; Giannini, Samuele; Blumberger, Jochen

    2017-12-01

    We have recently introduced an efficient semi-empirical non-adiabatic molecular dynamics method for the simulation of charge transfer/transport in molecules and molecular materials, denoted fragment orbital-based surface hopping (FOB-SH) [J. Spencer et al., J. Chem. Phys. 145, 064102 (2016)]. In this method, the charge carrier wavefunction is expanded in a set of charge localized, diabatic electronic states and propagated in the time-dependent potential due to classical nuclear motion. Here we derive and implement an exact expression for the non-adiabatic coupling vectors between the adiabatic electronic states in terms of nuclear gradients of the diabatic electronic states. With the non-adiabatic coupling vectors (NACVs) available, we investigate how different flavours of fewest switches surface hopping affect detailed balance, internal consistency, and total energy conservation for electron hole transfer in a molecular dimer with two electronic states. We find that FOB-SH satisfies detailed balance across a wide range of diabatic electronic coupling strengths provided that the velocities are adjusted along the direction of the NACV to satisfy total energy conservation upon a surface hop. This criterion produces the right fraction of energy-forbidden (frustrated) hops, which is essential for correct population of excited states, especially when diabatic couplings are on the order of the thermal energy or larger, as in organic semiconductors and DNA. Furthermore, we find that FOB-SH is internally consistent, that is, the electronic surface population matches the average quantum amplitudes, but only in the limit of small diabatic couplings. For large diabatic couplings, inconsistencies are observed as the decrease in excited state population due to frustrated hops is not matched by a corresponding decrease in quantum amplitudes. The derivation provided here for the NACV should be generally applicable to any electronic structure approach where the electronic

  8. Cu1-x Fe x O: hopping transport and ferromagnetism.

    Science.gov (United States)

    Nasir, Mohd; Islam, Rakibul; Ahmed, Md A; Ayaz, Saniya; Kumar, Gautham; Kumar, Sunil; Prajapat, C L; Roussel, Frederick; Biring, Sajal; Sen, Somaditya

    2017-09-01

    Single phase, sol-gel prepared Cu1-x Fe x O (0 ≤ x ≤ 0.125) powders are characterized in terms of structural, electronic and magnetic properties. Using dielectric and magnetic studies we investigate the coupling of electron and spin. The electrical conductivities and activation energies are studied with increasing Fe content. Modelling of experimental conductivity data emphasizes a single hopping mechanism for all samples except x = 0.125, which have two activation energies. Hole doping is confirmed by confirming a majority Fe3+ substitution of Cu2+ in CuO from X-ray photoelectron spectroscopy studies (XPS). Such a substitution results in stabilized ferromagnetism. Fe substitution introduces variation in coercivity as an intrinsic magnetic property in Fe-doped CuO, and not as a secondary impurity phase.

  9. [Passive ranging of infrared target using oxygen A-band and Elsasser model].

    Science.gov (United States)

    Li, Jin-Hua; Wang, Zhao-Ba; Wang Zhi

    2014-09-01

    Passive ranging method of short range and single band was developed based on target radiation and attenuation characteristic of oxygen spectrum absorption. The relation between transmittance of oxygen A band and range of measured target was analyzed. Radiation strength distribution of measured target can be obtained according to the distribution law of absorption coefficient with environmental parameters. Passive ranging mathematical model of short ranges was established using Elsasser model with Lorentz line shape based on the computational methods of band average transmittance and high-temperature gas radiation narrowband model. The range of measured object was obtained using transmittance fitting with test data calculation and theoretical model. Besides, ranging precision was corrected considering the influence of oxygen absorption with enviromental parameter. The ranging experiment platform was established. The source was a 10 watt black body, and a grating spectrometer with 17 cm(-1) resolution was used. In order to improve the light receiving efficiency, light input was collected with 23 mm calibre telescope. The test data was processed for different range in 200 m. The results show that the transmittance accuracy was better than 2.18% in short range compared to the test data with predicted value in the same conditions.

  10. Transport of hop aroma compounds across Caco-2 monolayers.

    Science.gov (United States)

    Heinlein, A; Metzger, M; Walles, H; Buettner, A

    2014-11-01

    Although being reported and used as a sedative remedy for several years, the bioactive principle of hop preparations is still not decisively clarified. Understanding absorption and transformation processes of potential physiologically active constituents is essential to evaluate the likeliness of biological effects on humans. Therefore, single hop aroma compounds as well as digestive transformation products thereof have been investigated in view of their human intestinal absorption, applying Caco-2 transport experiments as well as investigations on potential biotransformation processes. Selective and sensitive identification and quantification were thereby achieved by application of two-dimensional high resolution gas chromatography-mass spectrometry in conjunction with stable isotope dilution analysis, leading to the determination of apparent permeability values by different mathematical approaches considering sink and non-sink conditions. Overall, calculated permeability values ranged from 2.6 × 10(-6) to 1.8 × 10(-4) cm s(-1) with all mathematical approaches, indicating high absorption potential and almost complete bioavailability for all tested compounds with hydroxyl-functionalities. Considering this high permeability together with the high lipophilicity of these substances, a passive transcellular uptake route can be speculated. Investigated sesquiterpenes and β-myrcene showed flat absorption profiles while the investigated esters showed decreasing profiles. In view of the lipophilic and volatile nature of the investigated substances, special attention was paid to recovery and mass balance determination. Furthermore, in the course of the transport experiments of 1-octen-3-ol and 3-methyl-2-buten-1-ol, additional biotransformation products were observed, namely 3-octanone and 3-methyl-2-butenal, respectively. The absence of these additional substances in control experiments strongly indicates an intestinal first-pass metabolism of the

  11. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  12. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  13. Ising-model description of long-range correlations in DNA sequences.

    Science.gov (United States)

    Colliva, A; Pellegrini, R; Testori, A; Caselle, M

    2015-05-01

    We model long-range correlations of nucleotides in the human DNA sequence using the long-range one-dimensional (1D) Ising model. We show that, for distances between 10(3) and 10(6) bp, the correlations show a universal behavior and may be described by the non-mean-field limit of the long-range 1D Ising model. This allows us to make some testable hypothesis on the nature of the interaction between distant portions of the DNA chain which led to the DNA structure that we observe today in higher eukaryotes.

  14. Gaining local accuracy while not losing generality – extending the range of gap model applications

    NARCIS (Netherlands)

    Didion, M.P.; Kupferschmid, A.D.; Zingg, A.; Fahse, L.; Bugmann, H.

    2009-01-01

    For the study of long-term processes in forests, gap models generally sacrifice accuracy (i.e., simulating system behavior in a quantitatively accurate manner) for generality (i.e., representing a broad range of systems' behaviors with the same model). We selected the gap model ForClim to evaluate

  15. Polarization switching and polarization mode hopping in quantum dot vertical-cavity surface-emitting lasers.

    Science.gov (United States)

    Olejniczak, Lukasz; Panajotov, Krassimir; Thienpont, Hugo; Sciamanna, Marc; Mutig, Alex; Hopfer, Friedhelm; Bimberg, Dieter

    2011-01-31

    We show experimentally that polarization mode hopping in quantum dot vertical cavity surface emitting lasers (VCSELs) takes place between nonorthogonal elliptically polarized modes. In contrast to quantum well VCSELs the average dwell time decreases with injection current. This decrease is by 8 orders of magnitude: from seconds to nanoseconds and is achieved without any modifications of the VCSEL internal anisotropies. The observed scaling happens in a range of currents as wide as 8 times the threshold value.

  16. The HOPS/class C Vps complex tethers membranes by binding to one Rab GTPase in each apposed membrane.

    Science.gov (United States)

    Ho, Ruoya; Stroupe, Christopher

    2015-07-15

    Many Rab GTPase effectors are membrane-tethering factors, that is, they physically link two apposed membranes before intracellular membrane fusion. In this study, we investigate the distinct binding factors needed on apposed membranes for Rab effector-dependent tethering. We show that the homotypic fusion and protein-sorting/class C vacuole protein-sorting (HOPS/class C Vps) complex can tether low-curvature membranes, that is, liposomes with a diameter of ∼100 nm, only when the yeast vacuolar Rab GTPase Ypt7p is present in both tethered membranes. When HOPS is phosphorylated by the vacuolar casein kinase I, Yck3p, tethering only takes place when GTP-bound Ypt7p is present in both tethered membranes. When HOPS is not phosphorylated, however, its tethering activity shows little specificity for the nucleotide-binding state of Ypt7p. These results suggest a model for HOPS-mediated tethering in which HOPS tethers membranes by binding to Ypt7p in each of the two tethered membranes. Moreover, because vacuole-associated HOPS is presumably phosphorylated by Yck3p, our results suggest that nucleotide exchange of Ypt7p on multivesicular bodies (MVBs)/late endosomes must take place before HOPS can mediate tethering at vacuoles. © 2015 Ho and Stroupe. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Unified description for hopping transport in organic semiconductors including both energetic disorder and polaronic contributions

    OpenAIRE

    Fishchuk, I. I; Kadashchuk, Andriy; Hoffmann, S. T.; Athanasopoulos, S.; Genoe, Jan; Bässler, H.; Köhler, A.

    2013-01-01

    We developed an analytical model to describe hopping transport in organic semiconductors including both energetic disorder and polaronic contributions due to geometric relaxation. The model is based on a Marcus jump rate in terms of the small-polaron concept with a Gaussian energetic disorder, and it is premised upon a generalized effective medium approach yet avoids shortcomings involved in the effective transport energy or percolation concepts. It is superior to our previous treatment [ Phy...

  18. Incorporating spatial autocorrelation into species distribution models alters forecasts of climate-mediated range shifts.

    Science.gov (United States)

    Crase, Beth; Liedloff, Adam; Vesk, Peter A; Fukuda, Yusuke; Wintle, Brendan A

    2014-08-01

    Species distribution models (SDMs) are widely used to forecast changes in the spatial distributions of species and communities in response to climate change. However, spatial autocorrelation (SA) is rarely accounted for in these models, despite its ubiquity in broad-scale ecological data. While spatial autocorrelation in model residuals is known to result in biased parameter estimates and the inflation of type I errors, the influence of unmodeled SA on species' range forecasts is poorly understood. Here we quantify how accounting for SA in SDMs influences the magnitude of range shift forecasts produced by SDMs for multiple climate change scenarios. SDMs were fitted to simulated data with a known autocorrelation structure, and to field observations of three mangrove communities from northern Australia displaying strong spatial autocorrelation. Three modeling approaches were implemented: environment-only models (most frequently applied in species' range forecasts), and two approaches that incorporate SA; autologistic models and residuals autocovariate (RAC) models. Differences in forecasts among modeling approaches and climate scenarios were quantified. While all model predictions at the current time closely matched that of the actual current distribution of the mangrove communities, under the climate change scenarios environment-only models forecast substantially greater range shifts than models incorporating SA. Furthermore, the magnitude of these differences intensified with increasing increments of climate change across the scenarios. When models do not account for SA, forecasts of species' range shifts indicate more extreme impacts of climate change, compared to models that explicitly account for SA. Therefore, where biological or population processes induce substantial autocorrelation in the distribution of organisms, and this is not modeled, model predictions will be inaccurate. These results have global importance for conservation efforts as inaccurate

  19. Simulation of the Burridge-Knopoff Model of Earthquakes with Variable Range Stress Transfer

    Science.gov (United States)

    Xia, Junchao; Gould, Harvey; Klein, W.; Rundle, J. B.

    2005-12-01

    Simple models of earthquake faults are important for understanding the mechanisms for their observed behavior, such as Gutenberg-Richter scaling and the relation between large and small events, which is the basis for various forecasting methods. Although cellular automaton models have been studied extensively in the long-range stress transfer limit, this limit has not been studied for the Burridge-Knopoff model, which includes more realistic friction forces and inertia. We find that the latter model with long-range stress transfer exhibits qualitatively different behavior than both the long-range cellular automaton models and the usual Burridge-Knopoff model with nearest-neighbor springs, depending on the nature of the velocity-weakening friction force. These results have important implications for our understanding of earthquakes and other driven dissipative systems.

  20. Impacts of land cover data selection and trait parameterisation on dynamic modelling of species' range expansion.

    Directory of Open Access Journals (Sweden)

    Risto K Heikkinen

    Full Text Available Dynamic models for range expansion provide a promising tool for assessing species' capacity to respond to climate change by shifting their ranges to new areas. However, these models include a number of uncertainties which may affect how successfully they can be applied to climate change oriented conservation planning. We used RangeShifter, a novel dynamic and individual-based modelling platform, to study two potential sources of such uncertainties: the selection of land cover data and the parameterization of key life-history traits. As an example, we modelled the range expansion dynamics of two butterfly species, one habitat specialist (Maniola jurtina and one generalist (Issoria lathonia. Our results show that projections of total population size, number of occupied grid cells and the mean maximal latitudinal range shift were all clearly dependent on the choice made between using CORINE land cover data vs. using more detailed grassland data from three alternative national databases. Range expansion was also sensitive to the parameterization of the four considered life-history traits (magnitude and probability of long-distance dispersal events, population growth rate and carrying capacity, with carrying capacity and magnitude of long-distance dispersal showing the strongest effect. Our results highlight the sensitivity of dynamic species population models to the selection of existing land cover data and to uncertainty in the model parameters and indicate that these need to be carefully evaluated before the models are applied to conservation planning.

  1. Submillimeter-Wave Polarimetric Compact Ranges for Scale-Model Radar Measurements

    National Research Council Canada - National Science Library

    Coulombe, Michael J; Waldman, Jerry; Giles, R. H; Gatesman, Andrew J; Goyette, Thomas M; Nixon, William

    2002-01-01

    .... A dielectric material fabrication and characterization capability has also been developed to fabricate custom anechoic materials for the ranges as well as scaled dielectric parts for the models and clutter scenes...

  2. Tree-species range shifts in a changing climate: detecting, modeling, assisting

    Science.gov (United States)

    Louis R. Iverson; Donald. McKenzie

    2013-01-01

    In these times of rapidly changing climate, the science of detecting and modeling shifts in the ranges of tree species is advancing of necessity. We briefly review the current state of the science on several fronts. First, we review current and historical evidence for shifting ranges and migration. Next, we review two broad categories of methods, focused on the spatial...

  3. Wifi, WiMax and LTE multi-hop mesh networks basic communication protocols and application areas

    CERN Document Server

    Wei, Hung-Yu; Dixit, Sudhir

    2013-01-01

    Wifi, WiMAX, and Cellular Multihop Networks presents an overview of WiFi-based and WiMAX-based multihop relay networks. As the first text to cover IEEE 802.16j multihop hop relay technology, this revolutionary resource explores the latest advances in multi-hop and ad-hoc networking. Not only does this reference provide the technological aspects, but also the applications for the emerging technology and architectural issues. Ranging from introductory material to advanced topics, this guidebook, plus PowerPoint slides, is essential for engineers, researchers, and students interested in

  4. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  5. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  6. Job-hopping and New Firm Survival

    DEFF Research Database (Denmark)

    Failla, Virgilio

    for this theory, little is known about the characteristics of this so called `balanced´ skills set. Do entrepreneurial outcomes of individuals presenting a highly varied work experiences differ from entrepreneurs with a less varied career' In particular, how do the characteristics of the entrepreneurs´ job...... is the right experience that enhances the new ventures´ performances. Fallick, Fleischman and Reibtzer (1996) argue that frequent job-hopping facilitates the rapid reallocation of resources toward firms with the best innovations. This could be the result of the fact that especially high quality individuals who...... employed in the start-up they founded. This initial evidence suggests that successful jack-of-all trades are people who do not wander across industries, but those who accumulate a variety of experiences by occupying different roles in the parent organization....

  7. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  8. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  9. Self-dual quasiperiodic systems with power-law hopping

    Science.gov (United States)

    Gopalakrishnan, Sarang

    2017-08-01

    We introduce and explore a family of self-dual models of single-particle motion in quasiperiodic potentials, with hopping amplitudes that fall off as a power law with exponent p . These models are generalizations of the familiar Aubry-André model. For large enough p , their static properties are similar to those of the Aubry-André model, although the low-frequency conductivity in the localized phase is sensitive to p . For p ≲2.1 the Aubry-André localization transition splits into three transitions; two distinct intermediate regimes with both localized and delocalized states appear near the self-dual point of the Aubry-André model. In the intermediate regimes, the density of states is singular continuous in much of the spectrum, and is approximately self-similar: states form narrow energy bands, which are divided into yet narrower subbands; we find no clear sign of a mobility edge. When p law is recovered when the power law is slowly decaying. We present evidence that many of these features persist in models that are away from self-duality.

  10. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

    Science.gov (United States)

    Love, Bettina L.

    2015-01-01

    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  11. Short-Range Prediction of Monsoon Precipitation by NCMRWF Regional Unified Model with Explicit Convection

    Science.gov (United States)

    Mamgain, Ashu; Rajagopal, E. N.; Mitra, A. K.; Webster, S.

    2017-12-01

    There are increasing efforts towards the prediction of high-impact weather systems and understanding of related dynamical and physical processes. High-resolution numerical model simulations can be used directly to model the impact at fine-scale details. Improvement in forecast accuracy can help in disaster management planning and execution. National Centre for Medium Range Weather Forecasting (NCMRWF) has implemented high-resolution regional unified modeling system with explicit convection embedded within coarser resolution global model with parameterized convection. The models configurations are based on UK Met Office unified seamless modeling system. Recent land use/land cover data (2012-2013) obtained from Indian Space Research Organisation (ISRO) are also used in model simulations. Results based on short-range forecast of both the global and regional models over India for a month indicate that convection-permitting simulations by the high-resolution regional model is able to reduce the dry bias over southern parts of West Coast and monsoon trough zone with more intense rainfall mainly towards northern parts of monsoon trough zone. Regional model with explicit convection has significantly improved the phase of the diurnal cycle of rainfall as compared to the global model. Results from two monsoon depression cases during study period show substantial improvement in details of rainfall pattern. Many categories in rainfall defined for operational forecast purposes by Indian forecasters are also well represented in case of convection-permitting high-resolution simulations. For the statistics of number of days within a range of rain categories between `No-Rain' and `Heavy Rain', the regional model is outperforming the global model in all the ranges. In the very heavy and extremely heavy categories, the regional simulations show overestimation of rainfall days. Global model with parameterized convection have tendency to overestimate the light rainfall days and

  12. An Explosive Range Model Based on the Gas Composition, Temperature, and Pressure during Air Drilling

    Directory of Open Access Journals (Sweden)

    Xiangyu Fan

    2016-01-01

    Full Text Available Air drilling is low cost and effectively improves the penetration rate and causes minimal damage to liquid-sensitive pay zones. However, there is a potential downhole explosion when combustible gas mixed with drilling fluid reaches the combustible condition. In this paper, based on the underground combustion mechanism, an explosive range calculation model is established. This model couples the state equation and the empirical formula method, which considers the inert gas content, pressure, mixed gas component, and temperature. The result shows that increase of the inert gas content narrows the explosive range, while increase of the gas temperature and pressure improves the explosive range. A case in Chongqing, China, is used to validate the explosive range calculation model.

  13. A Low-Cost Time-Hopping Impulse Radio System for High Data Rate Transmission

    Directory of Open Access Journals (Sweden)

    Jinyun Zhang

    2005-03-01

    Full Text Available We present an efficient, low-cost implementation of time-hopping impulse radio that fulfills the spectral mask mandated by the FCC and is suitable for high-data-rate, short-range communications. Key features are (i all-baseband implementation that obviates the need for passband components, (ii symbol-rate (not chip rate sampling, A/D conversion, and digital signal processing, (iii fast acquisition due to novel search algorithms, and (iv spectral shaping that can be adapted to accommodate different spectrum regulations and interference environments. Computer simulations show that this system can provide 110 Mbps at 7–10 m distance, as well as higher data rates at shorter distances under FCC emissions limits. Due to the spreading concept of time-hopping impulse radio, the system can sustain multiple simultaneous users, and can suppress narrowband interference effectively.

  14. Analytic model utilizing the complex ABCD method for range dependency of a monostatic coherent lidar

    DEFF Research Database (Denmark)

    Olesen, Anders Sig; Pedersen, Anders Tegtmeier; Hanson, Steen Grüner

    2014-01-01

    In this work, we present an analytic model for analyzing the range and frequency dependency of a monostatic coherent lidar measuring velocities of a diffuse target. The model of the signal power spectrum includes both the contribution from the optical system as well as the contribution from the t...

  15. Progress in sensor performance testing, modeling and range prediction using the TOD method : An overview

    NARCIS (Netherlands)

    Bijl, P.; Hogervorst, M.A.; Toet, A.

    2017-01-01

    The Triangle Orientation Discrimination (TOD) methodology includes i) a widely applicable, accurate end-to-end EO/IR sensor test, ii) an image-based sensor system model and iii) a Target Acquisition (TA) range model. The method has been extensively validated against TA field performance for a wide

  16. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  17. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  18. On-Line RSSI-Range Model Learning for Target Localization and Tracking

    Directory of Open Access Journals (Sweden)

    José Ramiro Martínez-de Dios

    2017-08-01

    Full Text Available The interactions of Received Signal Strength Indicator (RSSI with the environment are very difficult to be modeled, inducing significant errors in RSSI-range models and highly disturbing target localization and tracking methods. Some techniques adopt a training-based approach in which they off-line learn the RSSI-range characteristics of the environment in a prior training phase. However, the training phase is a time-consuming process and must be repeated in case of changes in the environment, constraining flexibility and adaptability. This paper presents schemes in which each anchor node on-line learns its RSSI-range models adapted to the particularities of its environment and then uses its trained model for target localization and tracking. Two methods are presented. The first uses the information of the location of anchor nodes to dynamically adapt the RSSI-range model. In the second one, each anchor node uses estimates of the target location –anchor nodes are assumed equipped with cameras—to on-line adapt its RSSI-range model. The paper presents both methods, describes their operation integrated in localization and tracking schemes and experimentally evaluates their performance in the UBILOC testbed.

  19. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  20. An Efficient Computation of Effective Ground Range Using an Oblate Earth Model

    Directory of Open Access Journals (Sweden)

    Dalal A. Maturi

    2014-01-01

    Full Text Available An effcient method is presented to calculate the ground range of a ballistic missile trajectory on a nonrotating Earth. The spherical Earth model does not provide good approximation of distance between two locations on the surface of Earth. We used oblate spheroid Earth model because it provides better approximations. The effective ground range of a ballistic missile is an arc-length of a planner elliptic (or circle curve which passes through the launch and target points on the surface of Earth model. A general formulation is presented to calculate the arc-length of an elliptic (or circle curve which is the intersection of oblate Earth model and a plane. Explicit formulas are developed to calculate the coordinates of center of the ellipse as well as major and minor axes which are necessary ingredients for the calculation of effective ground range.

  1. Selecting among competing models of electro-optic, infrared camera system range performance

    Science.gov (United States)

    Nichols, Jonathan M.; Hines, James E.; Nichols, James D.

    2013-01-01

    Range performance is often the key requirement around which electro-optical and infrared camera systems are designed. This work presents an objective framework for evaluating competing range performance models. Model selection based on the Akaike’s Information Criterion (AIC) is presented for the type of data collected during a typical human observer and target identification experiment. These methods are then demonstrated on observer responses to both visible and infrared imagery in which one of three maritime targets was placed at various ranges. We compare the performance of a number of different models, including those appearing previously in the literature. We conclude that our model-based approach offers substantial improvements over the traditional approach to inference, including increased precision and the ability to make predictions for some distances other than the specific set for which experimental trials were conducted.

  2. Modeling the effects of distortion, contrast, and signal-to-noise ratio on stereophotogrammetric range mapping

    Science.gov (United States)

    Sellar, R. Glenn; Deen, Robert G.; Huffman, William C.; Willson, Reginald G.

    2016-09-01

    Stereophotogrammetry typically employs a pair of cameras, or a single moving camera, to acquire pairs of images from different camera positions, in order to create a three dimensional `range map' of the area being observed. Applications of this technique for building three-dimensional shape models include aerial surveying, remote sensing, machine vision, and robotics. Factors that would be expected to affect the quality of the range maps include the projection function (distortion) of the lenses and the contrast (modulation) and signal-to-noise ratio (SNR) of the acquired image pairs. Basic models of the precision with which the range can be measured assume a pinhole-camera model of the geometry, i.e. that the lenses provide perspective projection with zero distortion. Very-wide-angle or `fisheye' lenses, however (for e.g. those used by robotic vehicles) typically exhibit projection functions that differ significantly from this assumption. To predict the stereophotogrammetric range precision for such applications, we extend the model to the case of an equidistant lens projection function suitable for a very-wide-angle lens. To predict the effects of contrast and SNR on range precision, we perform numerical simulations using stereo image pairs acquired by a stereo camera pair on NASA's Mars rover Curiosity. Contrast is degraded and noise is added to these data in a controlled fashion and the effects on the quality of the resulting range maps are assessed.

  3. A new approach towards image based virtual 3D city modeling by using close range photogrammetry

    Science.gov (United States)

    Singh, S. P.; Jain, K.; Mandla, V. R.

    2014-05-01

    3D city model is a digital representation of the Earth's surface and it's related objects such as building, tree, vegetation, and some manmade feature belonging to urban area. The demand of 3D city modeling is increasing day to day for various engineering and non-engineering applications. Generally three main image based approaches are using for virtual 3D city models generation. In first approach, researchers used Sketch based modeling, second method is Procedural grammar based modeling and third approach is Close range photogrammetry based modeling. Literature study shows that till date, there is no complete solution available to create complete 3D city model by using images. These image based methods also have limitations This paper gives a new approach towards image based virtual 3D city modeling by using close range photogrammetry. This approach is divided into three sections. First, data acquisition process, second is 3D data processing, and third is data combination process. In data acquisition process, a multi-camera setup developed and used for video recording of an area. Image frames created from video data. Minimum required and suitable video image frame selected for 3D processing. In second section, based on close range photogrammetric principles and computer vision techniques, 3D model of area created. In third section, this 3D model exported to adding and merging of other pieces of large area. Scaling and alignment of 3D model was done. After applying the texturing and rendering on this model, a final photo-realistic textured 3D model created. This 3D model transferred into walk-through model or in movie form. Most of the processing steps are automatic. So this method is cost effective and less laborious. Accuracy of this model is good. For this research work, study area is the campus of department of civil engineering, Indian Institute of Technology, Roorkee. This campus acts as a prototype for city. Aerial photography is restricted in many country

  4. Two-Hop Secure Communication Using an Untrusted Relay

    National Research Council Canada - National Science Library

    He, Xiang; Yener, Aylin

    2009-01-01

    .... Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable...

  5. Hip Hop Dance Experience Linked to Sociocognitive Ability

    National Research Council Canada - National Science Library

    Justin W Bonny; Jenna C Lindberg; Marc C Pacampara

    2017-01-01

    .... In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability...

  6. Hopping trajectory optimization for surface exploration on small bodies

    Science.gov (United States)

    Liu, Yanjie; Zhu, Shengying; Cui, Pingyuan; Yu, Zhengshi; Zong, Hua

    2017-07-01

    Surface exploration is an important way to improve the understanding of small bodies. Considering the irregular and weak gravity field near a small body, the movement of the surface explorer is generally achieved by hopping. In this paper, a guidance algorithm method based on convex optimization approach for pinpoint hopping movement on a small body is developed in order to improve the stability and accuracy of surface exploration. We formulate a fuel-optimal control problem for the single pinpoint hopping and convert it into a second-order cone programming (SOCP) problem which can be solved effectively by primal-dual-interior points method. A multi-hopping scenario is also proposed for the long-distance transfer. To certificate the performance of the proposed guidance algorithm, a full set of simulations are conducted and the effectiveness are analyzed.

  7. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    Pospíšil, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  8. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

  9. Dispersion model for optical thin films applicable in wide spectral range

    Science.gov (United States)

    Franta, Daniel; Nečas, David; Ohlídal, Ivan; Giglia, Angelo

    2015-09-01

    In the optics industry thin film systems are used to construct various interference devices such as antireflective coatings, high-reflectance mirrors, beam splitters and filters. The optical characterization of complex optical systems can not be performed by measurements only in the short spectral range in which the interference devices will be employed because the measured data do not contain sufficient information about all relevant parameters of these systems. The characterization of film materials requires the extension of the spectral range of the measurements to the IR region containing phonon absorption and to the UV region containing the electronic excitations. However, this leads to necessity of a dispersion model suitable for the description of the dielectric response in the wide spectral range. Such model must respect the physical conditions following from theory of dispersion, particularly Kramers-Kronig relations and integrability imposed by sum rules. This work presents the construction of a universal dispersion model composed from individual contributions representing both electronic and phonon excitations. The efficiency of presented model is given by the fact that all the contributions are described by analytical expressions. It is shown that the model is suitable for precise modeling of spectral dependencies of optical constants of a broad class of materials used in the optical industry for thin film systems such as MgF2, SiO2, Al2O3, HfO2, Ta2O5 and TiO2 in the spectral range from far IR to vacuum UV.

  10. A state-space model for estimating detailed movements and home range from acoustic receiver data

    DEFF Research Database (Denmark)

    Pedersen, Martin Wæver; Weng, Kevin

    2013-01-01

    We present a state-space model for acoustic receiver data to estimate detailed movement and home range of individual fish while accounting for spatial bias. An integral part of the approach is the detection function, which models the probability of logging tag transmissions as a function...... that the location error scales log-linearly with detection range and movement speed. This result can be used as guideline for designing network layout when species movement capacity and acoustic environment are known or can be estimated prior to network deployment. Finally, as an example, the state-space model...... is used to estimate home range and movement of a reef fish in the Pacific Ocean....

  11. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  12. Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

    Science.gov (United States)

    Kea, J; Kramer, J; Forwell, L; Birmingham, T

    2001-08-01

    Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

  13. Tailoring the photon hopping by nearest and next-nearest-neighbour interaction in photonic arrays

    CERN Document Server

    Caselli, Niccolò; La China, Federico; Gerardino, Annamaria; Li, Lianhe; Linfield, Edmund H; Pagliano, Francesco; Fiore, Andrea; Intonti, Francesca; Gurioli, Massimo

    2015-01-01

    Arrays of photonic cavities are relevant structures for developing large-scale photonic integrated circuits and for investigating basic quantum electrodynamics phenomena, due to the photon hopping between interacting nanoresonators. Here, we investigate, by means of scanning near-field spectroscopy, numerical calculations and an analytical model, the role of different neighboring interactions that give rise to delocalized supermodes in different photonic crystal array configurations. The systems under investigation consist of three nominally identical two-dimensional photonic crystal nanocavities on membrane aligned along the two symmetry axes of the triangular photonic crystal lattice. We find that the nearest and next-nearest-neighbour coupling terms can be of the same relevance. In this case, a non-intuitive picture describes the resonant modes, and the photon hopping between adjacent nano-resonators is strongly affected. Our findings prove that exotic configurations and even post-fabrication engineering o...

  14. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer

    2017-02-09

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different artificial light sources and sunlight entering the room. The relay receives data packet over a VLC channel and uses the harvested energy to retransmit it to a mobile terminal over an RF channel. We develop a novel statistical model for the harvested electrical power and analyze the probability of data packet loss. We define a system design parameter (α ∈ [0, 1)) that controls the time dedicated for excess energy harvesting and data packet retransmission. It was found that the parameter has an optimal value which minimizes the packet loss probability. Further more, this optimal value is independent of the RF channel path loss. However, optimal showed inverse dependence on the packet size.

  15. Simultaneous Deep Tunneling and Classical Hopping for Hydrogen Diffusion on Metals

    Science.gov (United States)

    Fang, Wei; Richardson, Jeremy O.; Chen, Ji; Li, Xin-Zheng; Michaelides, Angelos

    2017-09-01

    Hydrogen diffusion on metals exhibits rich quantum behavior, which is not yet fully understood. Using simulations, we show that many hydrogen diffusion barriers can be categorized into those with parabolic tops and those with broad tops. With parabolic-top barriers, hydrogen diffusion evolves gradually from classical hopping, to shallow tunneling, to deep tunneling as the temperature (T ) decreases, and noticeable quantum effects persist at moderate T . In contrast, with broad-top barriers quantum effects become important only at low T and the classical-to-quantum transition is sharp, at which classical hopping and deep tunneling both occur. This coexistence indicates that more than one mechanism contributes to the quantum reaction rate. The conventional definition of the classical-to-quantum crossover T is invalid for the broad tops, and we give a new definition. Extending this, we propose a model to predict the transition T for broad-top diffusion, providing a general guide for theory and experiment.

  16. Hip Hop Syllabus: AME/MUS 303 Hip Hop: Art, Culture, and Politics

    Directory of Open Access Journals (Sweden)

    Sarah Hentges

    2013-10-01

    Full Text Available This syllabus represents a course taught online through the University of Maine at Augusta in the fall of 2011 (and every otheryear thereafter. Critical pedagogy can be a challenge in any classroom, and the challenges in an online classroom are compounded. However, the subject matter and approach of Hip Hop can be a powerful tool in teaching students critical thinking skills as well in laying a foundation for interdisciplinary and intersectional theory; here these elements are represented through curriculum—the themes, texts, contexts,approaches, structure, and assignments.

  17. Full-range stress-strain behaviour of contemporary pipeline steels: Part I. Model description

    Energy Technology Data Exchange (ETDEWEB)

    Hertele, Stijn, E-mail: stijn.hertele@ugent.be [FWO Flanders aspirant, Ghent University, Laboratory Soete, Technologiepark Zwijnaarde 903, 9052 Zwijnaarde (Belgium); De Waele, Wim; Denys, Rudi; Verstraete, Matthias [Ghent University, Laboratory Soete, Sint-Pietersnieuwstraat 41, 9000 Gent (Belgium)

    2012-04-15

    The stress-strain relationship of contemporary pipeline steels is often approximated by the relatively simple Ramberg-Osgood equation. However, these steels often show a more complex post-yield behaviour, which can result in significant errors. To address this limitation for cases where an accurate full-range description is needed, the authors developed a new 'UGent' stress-strain model which has two independent strain-hardening exponents. This paper compares the UGent model with the Ramberg-Osgood model for a wide range of experimental data, by means of least-squares curve fitting. A significant improvement is observed for contemporary pipeline steels with a yield-to-tensile ratio above 0.80. These steels typically exhibit two distinct stages of strain hardening. In contrast to the Ramberg-Osgood model, both stages are successfully described by the UGent model. A companion paper (Part II) discusses how to find appropriate model parameter values for the UGent model. - Highlights: Black-Right-Pointing-Pointer Contemporary pipeline steels often show two strain-hardening stages. Black-Right-Pointing-Pointer This phenomenon is progressively apparent as Y/T exceeds 0.80. Black-Right-Pointing-Pointer Both stages cannot be simultaneously described by the Ramberg-Osgood model. Black-Right-Pointing-Pointer A new 'UGent' model provides significantly better descriptions. Black-Right-Pointing-Pointer The improvement becomes more pronounced as Y/T increases.

  18. Gold Digger or Video Girl: the salience of an emerging hip-hop sexual script.

    Science.gov (United States)

    Ross, Jasmine N; Coleman, Nicole M

    2011-02-01

    Concerns have been expressed in the common discourse and scholarly literature about the negative influence of Hip-Hop on its young listeners' ideas about sex and sexuality. Most of the scholarly literature has focused on the impact of this urban, Black media on young African American girls' sexual self-concept and behaviours. In response to this discourse, Stephens and Phillips (2003) proposed a Hip-Hop sexual scripting model that theorises about specific sexual scripts for young African American women. Their model includes eight different sexual scripts including the Gold Digger script. The present study proposes a ninth emerging script - the Video Girl. Participants were 18 female African American college students, between the ages of 18 and 30 years old from a large urban public university in the Southwest USA. Using q-methodology the present study found support for the existence of a Video Girl script. In addition, the data indicates that this script is distinct but closely related to Stephens and Phillips' Gold Digger script. These findings support their theory by suggesting that Hip-Hop sexual scripts are salient and hold real meaning for this sample.

  19. Assimilation and Hip-Hop : Interethnic Relations and the Americanization of New Immigrants in Hip-Hop Culture

    OpenAIRE

    Aahlin, Audun Kjus

    2013-01-01

    The conflict thesis and the segmented assimilation theory account for two of the most significant trends in American immigration and ethnicity studies. Both of these major theoretical styles are utterly pessimistic towards interethnic relations in the United States and assimilation into African American urban culture. I have asked in this thesis if the experiences and the history of hip-hop culture can counterbalance these negative interpretations of interethnic relations. Hip-hop culture has...

  20. Long-Range Charge Order in the Extended Holstein-Hubbard Model

    Science.gov (United States)

    Miyao, Tadahiro

    2016-10-01

    This study investigated the extended Holstein-Hubbard model at half-filling as a model for describing the interplay of electron-electron and electron-phonon couplings. When the electron-phonon and nearest-neighbor electron-electron interactions are strong, we prove the existence of long-range charge order in three or more dimensions at a sufficiently low temperature. As a result, we rigorously justify the phase competition between the antiferromagnetism and charge orders.

  1. Diameter-growth model across shortleaf pine range using regression tree analysis

    Science.gov (United States)

    Daniel Yaussy; Louis Iverson; Anantha Prasad

    1999-01-01

    Diameter growth of a tree in most gap-phase models is limited by light, nutrients, moisture, and temperature. Growing-season temperature is represented by growing degree days (gdd), which is the sum of the average daily temperatures above a baseline temperature. Gap-phase models determine the north-south range of a species by the gdd limits at the north and south...

  2. Moho topography, ranges and folds of Tibet by analysis of global gravity models and GOCE data

    OpenAIRE

    Shin, Y. H.; C. K. Shum; Braitenberg, C.; Lee, S.M.; Na, S.-H.; Choi, K. S.; Hsu, H. (Hsiang-Hao); Park, Y. -S.; Lim, M.

    2015-01-01

    The determination of the crustal structure is essential in geophysics, as it gives insight into the geohistory, tectonic environment, geohazard mitigation, etc. Here we present the latest advance on three-dimensional modeling representing the Tibetan Mohorovi?i? discontinuity (topography and ranges) and its deformation (fold), revealed by analyzing gravity data from GOCE mission. Our study shows noticeable advances in estimated Tibetan Moho model which is superior to the results using the ear...

  3. Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states.

    Science.gov (United States)

    Humeniuk, Alexander; Mitrić, Roland

    2016-06-21

    A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully's fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronic wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.

  4. Calibrating and testing a gap model for simulating forest management in the Oregon Coast Range

    Science.gov (United States)

    Pabst, R.J.; Goslin, M.N.; Garman, S.L.; Spies, T.A.

    2008-01-01

    The complex mix of economic and ecological objectives facing today's forest managers necessitates the development of growth models with a capacity for simulating a wide range of forest conditions while producing outputs useful for economic analyses. We calibrated the gap model ZELIG to simulate stand-level forest development in the Oregon Coast Range as part of a landscape-scale assessment of different forest management strategies. Our goal was to incorporate the predictive ability of an empirical model with the flexibility of a forest succession model. We emphasized the development of commercial-aged stands of Douglas-fir, the dominant tree species in the study area and primary source of timber. In addition, we judged that the ecological approach of ZELIG would be robust to the variety of other forest conditions and practices encountered in the Coast Range, including mixed-species stands, small-scale gap formation, innovative silvicultural methods, and reserve areas where forests grow unmanaged for long periods of time. We parameterized the model to distinguish forest development among two ecoregions, three forest types and two site productivity classes using three data sources: chronosequences of forest inventory data, long-term research data, and simulations from an empirical growth-and-yield model. The calibrated model was tested with independent, long-term measurements from 11 Douglas-fir plots (6 unthinned, 5 thinned), 3 spruce-hemlock plots, and 1 red alder plot. ZELIG closely approximated developmental trajectories of basal area and large trees in the Douglas-fir plots. Differences between simulated and observed conifer basal area for these plots ranged from -2.6 to 2.4 m2/ha; differences in the number of trees/ha ???50 cm dbh ranged from -8.8 to 7.3 tph. Achieving these results required the use of a diameter-growth multiplier, suggesting some underlying constraints on tree growth such as the temperature response function. ZELIG also tended to overestimate

  5. Long-Range Epistasis Mediated by Structural Change in a Model of Ligand Binding Proteins.

    Directory of Open Access Journals (Sweden)

    Erik D Nelson

    Full Text Available Recent analyses of amino acid mutations in proteins reveal that mutations at many pairs of sites are epistatic-i.e., their effects on fitness are non-additive-the combined effect of two mutations being significantly larger or smaller than the sum of their effects considered independently. Interestingly, epistatic sites are not necessarily near each other in the folded structure of a protein, and may even be located on opposite sides of a molecule. However, the mechanistic reasons for long-range epistasis remain obscure. Here, we study long-range epistasis in proteins using a previously developed model in which off-lattice polymers are evolved under ligand binding constraints. Epistatic effects in the model are qualitatively similar to those recently reported for small proteins, and many are long-range. We find that a major reason for long-range epistasis is conformational change-a recurrent theme in both positive and negative epistasis being the transfer, or exchange of material between the ordered nucleus, which supports the binding site, and the liquid-like surface of a folded molecule. These local transitions in phase and folded structure are largely responsible for long-range epistasis in our model.

  6. Long-Range Epistasis Mediated by Structural Change in a Model of Ligand Binding Proteins.

    Science.gov (United States)

    Nelson, Erik D; Grishin, Nick V

    2016-01-01

    Recent analyses of amino acid mutations in proteins reveal that mutations at many pairs of sites are epistatic-i.e., their effects on fitness are non-additive-the combined effect of two mutations being significantly larger or smaller than the sum of their effects considered independently. Interestingly, epistatic sites are not necessarily near each other in the folded structure of a protein, and may even be located on opposite sides of a molecule. However, the mechanistic reasons for long-range epistasis remain obscure. Here, we study long-range epistasis in proteins using a previously developed model in which off-lattice polymers are evolved under ligand binding constraints. Epistatic effects in the model are qualitatively similar to those recently reported for small proteins, and many are long-range. We find that a major reason for long-range epistasis is conformational change-a recurrent theme in both positive and negative epistasis being the transfer, or exchange of material between the ordered nucleus, which supports the binding site, and the liquid-like surface of a folded molecule. These local transitions in phase and folded structure are largely responsible for long-range epistasis in our model.

  7. Hops (Humulus lupulus) Content in Beer Modulates Effects of Beer on the Liver After Acute Ingestion in Female Mice.

    Science.gov (United States)

    Landmann, Marianne; Sellmann, Cathrin; Engstler, Anna Janina; Ziegenhardt, Doreen; Jung, Finn; Brombach, Christine; Bergheim, Ina

    2017-01-01

    Using a binge-drinking mouse model, we aimed to determine whether hops (Humulus lupulus) in beer is involved in the less damaging effects of acute beer consumption on the liver in comparison with ethanol. Female C57BL/6 J mice were either fed one iso-alcoholic and iso-caloric bolus dose of ethanol, beer, beer without hops (6 g ethanol/kg body weight) or an iso-caloric bolus of maltodextrin control solution. Markers of steatosis, intestinal barrier function, activation of toll-like receptor 4 signaling cascades, lipid peroxidation and lipogenesis were determined in liver, small intestine and plasma 2 h and 12 h after acute alcohol ingestion. Alcohol-induced hepatic fat accumulation was significantly attenuated in mice fed beer whereas in those fed beer without hops, hepatic fat accumulation was similar to that found in ethanol-fed mice. While markers of intestinal barrier function e.g. portal endotoxin levels and lipogenesis only differed slightly between groups, hepatic concentrations of myeloid differentiation primary response gene 88, inducible nitric oxide synthase (iNOS) and plasminogen-activator inhibitor 1 protein as well as of 4-hydroxynonenal and 3-nitrotyrosine protein adducts were similarly elevated in livers of mice fed ethanol or beer without hops when compared with controls. Induction of these markers was markedly attenuated in mice fed hops-containing beer. Taken together, our data suggest that hops in beer markedly attenuated acute alcohol-induced liver steatosis in female mice through mechanisms involving a suppression of iNOS induction in the liver. © The Author 2016. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  8. Long-range Acoustic Interactions in Insect Swarms - An Adaptive Gravity Model

    Science.gov (United States)

    Gorbonos, Dan; Ianconescu, Reuven; Puckett, James G.; Ni, Rui; Ouellette, Nicholas T.; Gov, Nir S.

    The collective motion of groups of animals emerges from the net effect of the interactions between individual members of the group. In many cases, such as birds, fish, or ungulates, these interactions are mediated by sensory stimuli that predominantly arise from nearby neighbors. But not all stimuli in animal groups are short range. We consider mating swarms of midges, which are thought to interact primarily via long-range acoustic stimuli. We exploit the similarity in form between the decay of acoustic and gravitational sources to build a model for swarm behavior. By accounting for the adaptive nature of the midges' acoustic sensing, we show that our ``adaptive gravity'' model makes mean-field predictions that agree well with experimental observations of laboratory swarms. Our results highlight the role of sensory mechanisms and interaction range in collective animal behavior. Additionally, the adaptive interactions open a new class of equations of motion, which may appear in other biological contexts.

  9. Model-assisted forest yield estimation with light detection and ranging

    Science.gov (United States)

    Jacob L. Strunk; Stephen E. Reutebuch; Hans-Erik Andersen; Peter J. Gould; Robert J. McGaughey

    2012-01-01

    Previous studies have demonstrated that light detection and ranging (LiDAR)-derived variables can be used to model forest yield variables, such as biomass, volume, and number of stems. However, the next step is underrepresented in the literature: estimation of forest yield with appropriate confidence intervals. It is of great importance that the procedures required for...

  10. Intelligent traffic signals : extending the range of self-organization in the BML model.

    Science.gov (United States)

    2013-04-01

    The two-dimensional traffic model of Biham, Middleton and Levine (Phys. Rev. A, 1992) is : a simple cellular automaton that exhibits a wide range of complex behavior. It consists of both : northbound and eastbound cars traveling on a rectangular arra...

  11. Perceptions of the Full Range Leadership Model Practiced by Select High School Administrators in Tennessee

    Science.gov (United States)

    Prater, Michelle L.

    2013-01-01

    The purpose of this research was to study the three leadership styles on the Full Range Leadership Model (FRLM) practiced by high school administrators in the educational organization. The aspects of studying leadership styles was to determine the degree high school administrators practiced leadership styles; the degree of perceptional congruence…

  12. Fusing range and intensity images for generating dense models of three-dimensional environments

    DEFF Research Database (Denmark)

    Ellekilde, Lars-Peter; Miró, Jaime Valls; Dissanayake., Gamini

    This paper presents a novel strategy for the construction of dense three-dimensional environment models by combining images from a conventional camera and a range imager. Ro- bust data association is ?rst accomplished by exploiting the Scale Invariant Feature Transformation (SIFT) technique on th...

  13. How the viscous subrange determines inertial range properties in turbulence shell models

    NARCIS (Netherlands)

    Schoerghofer, N.; Kadanoff, L.; Lohse, Detlef

    1995-01-01

    We calculate static solutions of the `GOY¿ shell model of turbulence and do a linear stability analysis. The asymptotic limit of large Reynolds numbers is analyzed. A phase diagram is presented which shows the range of stability of the static solution. We see an unexpected oscillatory dependence of

  14. Model Study of Wave Overtopping of Marine Structure for a Wide Range of Geometric Parameters

    DEFF Research Database (Denmark)

    Kofoed, Jens Peter

    2000-01-01

    The objective of the study described in this paper is to enable estimation of wave overtopping rates for slopes/ramps given by a wide range of geometric parameters when subjected to varying wave conditions. To achieve this a great number of model tests are carried out in a wave tank using irregular...

  15. Link Budget Analysis and Modeling of Short-Range UWB Channels

    NARCIS (Netherlands)

    Irahhauten, Z.; Dacuna, J.; Janssen, G.J.M.; Nikookar, H.; Yarovoy, A.G.; Ligthart, L.P.

    2008-01-01

    Ultrawideband (UWB) technology is an attractive alternative for short-range applications, e.g., wireless personal area networks. In these applications, transmit and receive antennas are very close to each other and the far-field condition assumed in most of the link budget models may not be

  16. A nonlinear model of magnetorheological elastomer with wide amplitude range and variable frequencies

    Science.gov (United States)

    Wang, Qi; Dong, Xufeng; Li, Luyu; Ou, Jinping

    2017-06-01

    To develop control algorithms that taking maximum advantage of rapidly varying rheological properties of MR elastomer devices, models must be developed that can adequately characterize the smart material’s intrinsic nonlinearity. However, most existing MRE models are only effective within a narrow strain amplitude range and under certain loading frequencies. To derive a MRE model with better applicability, MR elastomer samples were fabricated and their steady-state response under harmonic loading with different strain amplitudes, frequencies and magnetic fields were tested. Following a review of several existing models of MR elastomer, a new revised Bouc-Wen model is proposed that can effectively portray the behavior of the material. Comparison with experimental results indicates that the model is accurate over a wide range of frequencies, strain amplitudes and magnetic flux densities. A simplified model was then proposed after parametric study. As the magnetic field is the only determinant of the parameters, the simplified model is adequate for base isolation devices design and simulation.

  17. Long-range correlation in synchronization and syncopation tapping: a linear phase correction model.

    Directory of Open Access Journals (Sweden)

    Didier Delignières

    Full Text Available We propose in this paper a model for accounting for the increase in long-range correlations observed in asynchrony series in syncopation tapping, as compared with synchronization tapping. Our model is an extension of the linear phase correction model for synchronization tapping. We suppose that the timekeeper represents a fractal source in the system, and that a process of estimation of the half-period of the metronome, obeying a random-walk dynamics, combines with the linear phase correction process. Comparing experimental and simulated series, we show that our model allows accounting for the experimentally observed pattern of serial dependence. This model complete previous modeling solutions proposed for self-paced and synchronization tapping, for a unifying framework of event-based timing.

  18. Power and delay optimisation in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-02-05

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the ‘bang-bang’ control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  19. Power and delay optimisation in multi-hop wireless networks

    Science.gov (United States)

    Xia, Li; Shihada, Basem

    2014-06-01

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the 'bang-bang' control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  20. The prenylflavonoid isoxanthohumol from hops (Humulus lupulus L.) is activated into the potent phytoestrogen 8-prenylnaringenin in vitro and in the human intestine.

    Science.gov (United States)

    Possemiers, Sam; Bolca, Selin; Grootaert, Charlotte; Heyerick, Arne; Decroos, Karel; Dhooge, Willem; De Keukeleire, Denis; Rabot, Sylvie; Verstraete, Willy; Van de Wiele, Tom

    2006-07-01

    Hops, an essential beer ingredient, are a source of prenylflavonoids, including 8-prenylnaringenin (8-PN), one of the most potent phytoestrogens. Because 8-PN concentrations in beers are generally low, its health effects after moderate beer consumption were considered negligible. However, human intestinal microbiota may activate up to 4 mg/L isoxanthohumol (IX) in beer into 8-PN. Depending on interindividual differences in the intestinal transformation potential, this conversion could easily increase the 8-PN exposure 10-fold upon beer consumption. Here, we present a further investigation of the process both in vitro and in vivo. In vitro experiments with the dynamic SHIME model showed that hop prenylflavonoids pass unaltered through the stomach and small intestine and that activation of IX into 8-PN (up to 80% conversion) occurs only in the distal colon. In vitro incubations of 51 fecal samples from female volunteers with IX enabled us to separate the fecal microbiota into high (8 of 51), moderate (11 of 51) and slow (32 of 51) 8-PN producers, clearly illustrating an interindividual variability. Three women, selected from the respective groups, received a daily dose of 5.59 mg IX for 4 d. Intestinal IX activation and urinary 8-PN excretion were correlated (R(2) = 0.6417, P < 0.01). These data show that intestinal conversion of IX upon moderate beer consumption can lead to 8-PN exposure values that might fall within the range of human biological activity.

  1. Lithium-ion battery dynamic model for wide range of operating conditions

    DEFF Research Database (Denmark)

    Stroe, Ana-Irina; Stroe, Daniel-Ioan; Swierczynski, Maciej Jozef

    2017-01-01

    In order to analyze the dynamic behavior of a Lithium-ion (Li-ion) battery and to determine their suitability for various applications, battery models are needed. An equivalent electrical circuit model is the most common way of representing the behavior of a Li-ion battery. There are different...... characterization tests performed for a wide range of operating conditions (temperature, load current and state-of-charge) on a commercial available 13Ah high-power lithium titanate oxide battery cell. The obtained results were used to parametrize the proposed dynamic model of the battery cell. To assess...

  2. Dynamic occupancy models for analyzing species' range dynamics across large geographic scales.

    Science.gov (United States)

    Bled, Florent; Nichols, James D; Altwegg, Res

    2013-12-01

    Large-scale biodiversity data are needed to predict species' responses to global change and to address basic questions in macroecology. While such data are increasingly becoming available, their analysis is challenging because of the typically large heterogeneity in spatial sampling intensity and the need to account for observation processes. Two further challenges are accounting for spatial effects that are not explained by covariates, and drawing inference on dynamics at these large spatial scales. We developed dynamic occupancy models to analyze large-scale atlas data. In addition to occupancy, these models estimate local colonization and persistence probabilities. We accounted for spatial autocorrelation using conditional autoregressive models and autologistic models. We fitted the models to detection/nondetection data collected on a quarter-degree grid across southern Africa during two atlas projects, using the hadeda ibis (Bostrychia hagedash) as an example. The model accurately reproduced the range expansion between the first (SABAP1: 1987-1992) and second (SABAP2: 2007-2012) Southern African Bird Atlas Project into the drier parts of interior South Africa. Grid cells occupied during SABAP1 generally remained occupied, but colonization of unoccupied grid cells was strongly dependent on the number of occupied grid cells in the neighborhood. The detection probability strongly varied across space due to variation in effort, observer identity, seasonality, and unexplained spatial effects. We present a flexible hierarchical approach for analyzing grid-based atlas data using dynamical occupancy models. Our model is similar to a species' distribution model obtained using generalized additive models but has a number of advantages. Our model accounts for the heterogeneous sampling process, spatial correlation, and perhaps most importantly, allows us to examine dynamic aspects of species ranges.

  3. Modelling seasonal habitat suitability for wide-ranging species: Invasive wild pigs in northern Australia.

    Directory of Open Access Journals (Sweden)

    Jens G Froese

    Full Text Available Invasive wildlife often causes serious damage to the economy and agriculture as well as environmental, human and animal health. Habitat models can fill knowledge gaps about species distributions and assist planning to mitigate impacts. Yet, model accuracy and utility may be compromised by small study areas and limited integration of species ecology or temporal variability. Here we modelled seasonal habitat suitability for wild pigs, a widespread and harmful invader, in northern Australia. We developed a resource-based, spatially-explicit and regional-scale approach using Bayesian networks and spatial pattern suitability analysis. We integrated important ecological factors such as variability in environmental conditions, breeding requirements and home range movements. The habitat model was parameterized during a structured, iterative expert elicitation process and applied to a wet season and a dry season scenario. Model performance and uncertainty was evaluated against independent distributional data sets. Validation results showed that an expert-averaged model accurately predicted empirical wild pig presences in northern Australia for both seasonal scenarios. Model uncertainty was largely associated with different expert assumptions about wild pigs' resource-seeking home range movements. Habitat suitability varied considerably between seasons, retracting to resource-abundant rainforest, wetland and agricultural refuge areas during the dry season and expanding widely into surrounding grassland floodplains, savanna woodlands and coastal shrubs during the wet season. Overall, our model suggested that suitable wild pig habitat is less widely available in northern Australia than previously thought. Mapped results may be used to quantify impacts, assess risks, justify management investments and target control activities. Our methods are applicable to other wide-ranging species, especially in data-poor situations.

  4. Modelling seasonal habitat suitability for wide-ranging species: Invasive wild pigs in northern Australia.

    Science.gov (United States)

    Froese, Jens G; Smith, Carl S; Durr, Peter A; McAlpine, Clive A; van Klinken, Rieks D

    2017-01-01

    Invasive wildlife often causes serious damage to the economy and agriculture as well as environmental, human and animal health. Habitat models can fill knowledge gaps about species distributions and assist planning to mitigate impacts. Yet, model accuracy and utility may be compromised by small study areas and limited integration of species ecology or temporal variability. Here we modelled seasonal habitat suitability for wild pigs, a widespread and harmful invader, in northern Australia. We developed a resource-based, spatially-explicit and regional-scale approach using Bayesian networks and spatial pattern suitability analysis. We integrated important ecological factors such as variability in environmental conditions, breeding requirements and home range movements. The habitat model was parameterized during a structured, iterative expert elicitation process and applied to a wet season and a dry season scenario. Model performance and uncertainty was evaluated against independent distributional data sets. Validation results showed that an expert-averaged model accurately predicted empirical wild pig presences in northern Australia for both seasonal scenarios. Model uncertainty was largely associated with different expert assumptions about wild pigs' resource-seeking home range movements. Habitat suitability varied considerably between seasons, retracting to resource-abundant rainforest, wetland and agricultural refuge areas during the dry season and expanding widely into surrounding grassland floodplains, savanna woodlands and coastal shrubs during the wet season. Overall, our model suggested that suitable wild pig habitat is less widely available in northern Australia than previously thought. Mapped results may be used to quantify impacts, assess risks, justify management investments and target control activities. Our methods are applicable to other wide-ranging species, especially in data-poor situations.

  5. Analysing the origin of long-range interactions in proteins using lattice models

    Directory of Open Access Journals (Sweden)

    Unger Ron

    2009-01-01

    Full Text Available Abstract Background Long-range communication is very common in proteins but the physical basis of this phenomenon remains unclear. In order to gain insight into this problem, we decided to explore whether long-range interactions exist in lattice models of proteins. Lattice models of proteins have proven to capture some of the basic properties of real proteins and, thus, can be used for elucidating general principles of protein stability and folding. Results Using a computational version of double-mutant cycle analysis, we show that long-range interactions emerge in lattice models even though they are not an input feature of them. The coupling energy of both short- and long-range pairwise interactions is found to become more positive (destabilizing in a linear fashion with increasing 'contact-frequency', an entropic term that corresponds to the fraction of states in the conformational ensemble of the sequence in which the pair of residues is in contact. A mathematical derivation of the linear dependence of the coupling energy on 'contact-frequency' is provided. Conclusion Our work shows how 'contact-frequency' should be taken into account in attempts to stabilize proteins by introducing (or stabilizing contacts in the native state and/or through 'negative design' of non-native contacts.

  6. Time-resolved Tomographic PIV Measurements of Water Flea Hopping: Body Size Comparison

    Science.gov (United States)

    Skipper, A. N.; Murphy, D. W.; Webster, D. R.; Yen, J.

    2014-11-01

    The flow field of the freshwater crustacean Daphnia magna is quantified with time-resolved tomographic PIV. In the current work, we compare body kinematics and flow disturbance between organisms of small (body length = 1.8 mm) versus medium (2.3 mm) versus large (2.65 mm) size. These plankters are equipped with a pair of antennae that are biramous such that the protopodite splits or branches into an exopodite and an endopodite. They beat the antennae pair synchronously to impulsively propel themselves, or `hop,' through the water. The stroke cycle of Daphnia magna is roughly 80 ms in duration and this period is evenly split between the power and recovery strokes. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. Unlike copepod escape motion, no body vortex is observed in front of the animal. Rather, the flow induced by each antennae consists of a viscous vortex ring that demonstrates a slow decay. The time-record of velocity (peak of 40 mm/s for the medium specimen) and hop acceleration (1.8 m/s2 for the medium specimen) are compared, as well as the strength, size, and decay of the induced viscous vortex rings. The viscous vortex ring analysis will be presented in the context of a double Stokeslet model consisting of two impulsively applied point forces separated by the animal width.

  7. Achilles tendinopathy alters stretch shortening cycle behaviour during a sub-maximal hopping task.

    Science.gov (United States)

    Debenham, James R; Travers, Mervyn J; Gibson, William; Campbell, Amity; Allison, Garry T

    2016-01-01

    To describe stretch shortening cycle behaviour of the ankle and lower limb in patients with Achilles tendinopathy (AT) and establish differences with healthy volunteers. Between-subjects case-controlled. Fifteen patients with AT (mean age 41.2±12.7 years) and 11 healthy volunteers (CON) (mean age 23.2±6.7 years) performed sub-maximal single-limb hopping on a custom built sledge-jump system. Using 3D motion analysis and surface EMG, temporal kinematic (lower limb stiffness, ankle angle at 80ms pre-contact, ankle angle at contact, peak ankle angle, ankle stretch amplitude) and EMG measures (onset, offset and peak times relative to contact) were captured. Data between AT and CON were compared statistically using a linear mixed model. Patients with AT exhibited significantly increased lower limb stiffness when compared to healthy volunteers (pbehaviour during sub-maximal hopping when compared with healthy volunteers. Patients with AT hop with greater lower limb stiffness, in a greater degree of ankle dorsiflexion and have a greater stretch amplitude. Likewise, delayed muscle activity is evident. These findings have implications in terms of informing the understanding of the pathoaetiology and management of AT. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  8. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    Science.gov (United States)

    Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

    2017-01-01

    As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs. PMID:28098818

  9. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs.

    Science.gov (United States)

    Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

    2017-01-14

    As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  10. New Diagnostic, Launch and Model Control Techniques in the NASA Ames HFFAF Ballistic Range

    Science.gov (United States)

    Bogdanoff, David W.

    2012-01-01

    This report presents new diagnostic, launch and model control techniques used in the NASA Ames HFFAF ballistic range. High speed movies were used to view the sabot separation process and the passage of the model through the model splap paper. Cavities in the rear of the sabot, to catch the muzzle blast of the gun, were used to control sabot finger separation angles and distances. Inserts were installed in the powder chamber to greatly reduce the ullage volume (empty space) in the chamber. This resulted in much more complete and repeatable combustion of the powder and hence, in much more repeatable muzzle velocities. Sheets of paper or cardstock, impacting one half of the model, were used to control the amplitudes of the model pitch oscillations.

  11. Wide speed range sensorless control of PM-RSM via "active flux model"

    DEFF Research Database (Denmark)

    Paicu, Mihaela Codruta; Tutelea, Lucian; Andreescu, Gheorghe-Daniel

    2009-01-01

    This paper presents two improved control strategies for the sensorless control of permanent magnet reluctance synchronous motor (PM-RSM) in wide speed range. The first control strategy is a novel torque referencing strategy, which includes a reference torque calculator for maximum torque...... sensorless control is obtained via model-based "active flux" concept. Comprehensive digital simulations for wide speed range operating down to 1 rpm and up to 6000 rpm, demonstrate the effectiveness of both proposed sensorless control strategies. Experimental results between 30 rpm and 3000 rpm...

  12. Moho topography, ranges and folds of Tibet by analysis of global gravity models and GOCE data.

    Science.gov (United States)

    Shin, Young Hong; Shum, C K; Braitenberg, Carla; Lee, Sang Mook; Na, Sung-Ho; Choi, Kwang Sun; Hsu, Houtse; Park, Young-Sue; Lim, Mutaek

    2015-06-26

    The determination of the crustal structure is essential in geophysics, as it gives insight into the geohistory, tectonic environment, geohazard mitigation, etc. Here we present the latest advance on three-dimensional modeling representing the Tibetan Mohorovičić discontinuity (topography and ranges) and its deformation (fold), revealed by analyzing gravity data from GOCE mission. Our study shows noticeable advances in estimated Tibetan Moho model which is superior to the results using the earlier gravity models prior to GOCE. The higher quality gravity field of GOCE is reflected in the Moho solution: we find that the Moho is deeper than 65 km, which is twice the normal continental crust beneath most of the Qinghai-Tibetan plateau, while the deepest Moho, up to 82 km, is located in western Tibet. The amplitude of the Moho fold is estimated to be ranging from -9 km to 9 km with a standard deviation of ~2 km. The improved GOCE gravity derived Moho signals reveal a clear directionality of the Moho ranges and Moho fold structure, orthogonal to deformation rates observed by GPS. This geophysical feature, clearly more evident than the ones estimated using earlier gravity models, reveals that it is the result of the large compressional tectonic process.

  13. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...

  14. Nonlinear hopping transport in ring systems and open channels.

    Science.gov (United States)

    Einax, Mario; Körner, Martin; Maass, Philipp; Nitzan, Abraham

    2010-01-21

    We study the nonlinear hopping transport in one-dimensional rings and open channels. Analytical results are derived for the stationary current response to a constant bias without assuming any specific coupling of the rates to the external fields. It is shown that anomalous large effective jump lengths, as observed in recent experiments by taking the ratio of the third-order nonlinear and the linear conductivity, can occur already in ordered systems. Rectification effects due to site energy disorder in ring systems are expected to become irrelevant for large system sizes. In open channels, in contrast, rectification effects occur already for disorder in the jump barriers and do not vanish in the thermodynamic limit. Numerical solutions for a sinusoidal bias show that the ring system provides a good description for the transport behavior in the open channel for intermediate and high frequencies. For low frequencies temporal variations in the mean particle number have to be taken into account in the open channel, which cannot be captured in the more simple ring model.

  15. The middle range verification of numerical model performance for heavy rainfall in North China

    Science.gov (United States)

    Zhang, Bo; Zhao, Bin; Niu, Ruoyun

    2017-04-01

    The heavy rainfall forecast in North China is the focus and difficulty in middle range numerical weather forecast. 70 typical heavy precipitation cases in North China in summer from 2010 to 2016 are selected, which are divided into vortex type, the west trough and shear line type according to the atmospheric circulation. Based on ECMWF model and the Chinese operational model T639, a spatial verification method MODE is used, the middle range precipitation forecast abilities for heavy rain in summer in North China are evaluated according to contrast the difference of centroidal distance, axis angel and aspect ratios. It is found that the ECMWF model and the T639 model all show weak predictive ability for the low-vortex-type heavy rainfall in Northern China from all the similarities. When the area of rainfall is larger, the precipitation patterns of the two models are mostly northeast-southwest. It is consistent with the actual situation. For a large area of precipitation area, both models predict the precipitation area aspect ratio is less than 1. It shows that precipitation drop area is long and narrow, and the forecast is also consistent with the actual situation. However, as far as T639 and ECMWF models are concerned, there are systematic deviations in the precipitation area, and the predicted precipitation area is located on the southwestern side of the field. For smaller/larger areas of precipitation, the predicted precipitation area is larger/smaller than the actual situation. In addition, a sensitive test for the regional heavy precipitation process in North China (such as Huanghuai and other regions) from July 18 to 20, 2016 is also done and the results show that each numerical model of the process prediction is not successful. Therefore, further research is needed on the future correction of systematic bias of numerical models of regional heavy precipitation in medium-term forecasters.

  16. A numerical shallow-water model for gravity currents for a wide range of density differences

    Science.gov (United States)

    Shimizu, Hiroyuki A.; Koyaguchi, Takehiro; Suzuki, Yujiro J.

    2017-12-01

    Gravity currents with various contrasting densities play a role in mass transport in a number of geophysical situations. The ratio of the density of the current, ρ c, to the density of the ambient fluid, ρ a, can vary between 100 and 103. In this paper, we present a numerical method of simulating gravity currents for a wide range of ρ c/ ρ a using a shallow-water model. In the model, the effects of varying ρ c/ ρ a are taken into account via the front condition (i.e., factors describing the balance between the driving pressure and the ambient resistance pressure at the flow front). Previously, two types of numerical models have been proposed to solve the front condition. These are referred to here as the Boundary Condition (BC) model and the Artificial Bed (AB) model. The front condition is calculated as a boundary condition at each time step in the BC model, whereas it is calculated by setting a thin artificial bed ahead of the front in the AB model. We assessed the BC and AB models by comparing their numerical results with the analytical results for a simple case of homogeneous currents. The results from the BC model agree well with the analytical results when ρ c/ ρ a≲102, but the model tends to overestimate the speed of the front position when ρ c/ρ a≳102. In contrast, the AB model generates good approximations of the analytical results for ρ c/ρ a≳ 102, given a sufficiently small artificial bed thickness, but fails to reproduce the analytical results when ρ c/ ρ a≲102. Therefore, we propose a numerical method in which the BC model is used for currents with ρ c/ ρ a≲102 and the AB model is used for currents with ρ c/ρ a≳ 102.

  17. Long-range interactions, wobbles, and phase defects in chains of model cilia

    Science.gov (United States)

    Brumley, Douglas R.; Bruot, Nicolas; Kotar, Jurij; Goldstein, Raymond E.; Cicuta, Pietro; Polin, Marco

    2016-12-01

    Eukaryotic cilia and flagella are chemo-mechanical oscillators capable of generating long-range coordinated motions known as metachronal waves. Pair synchronization is a fundamental requirement for these collective dynamics, but it is generally not sufficient for collective phase-locking, chiefly due to the effect of long-range interactions. Here we explore experimentally and numerically a minimal model for a ciliated surface: hydrodynamically coupled oscillators rotating above a no-slip plane. Increasing their distance from the wall profoundly affects the global dynamics, due to variations in hydrodynamic interaction range. The array undergoes a transition from a traveling wave to either a steady chevron pattern or one punctuated by periodic phase defects. Within the transition between these regimes the system displays behavior reminiscent of chimera states.

  18. Soil functional operating range linked to microbial biodiversity and community composition using denitrifiers as model guild.

    Science.gov (United States)

    Hallin, Sara; Welsh, Allana; Stenström, John; Hallet, Stephanie; Enwall, Karin; Bru, David; Philippot, Laurent

    2012-01-01

    Soil microorganisms are key players in biogeochemical cycles. Yet, there is no consistent view on the significance of microbial biodiversity for soil ecosystem functioning. According to the insurance hypothesis, declines in ecosystem functioning due to reduced biodiversity are more likely to occur under fluctuating, extreme or rapidly changing environmental conditions. Here, we compare the functional operating range, a new concept defined as the complete range of environmental conditions under which soil microbial communities are able to maintain their functions, between four naturally assembled soil communities from a long-term fertilization experiment. A functional trait approach was adopted with denitrifiers involved in nitrogen cycling as our model soil community. Using short-term temperature and salt gradients, we show that the functional operating range was broader and process rates were higher when the soil community was phylogenetically more diverse. However, key bacterial genotypes played an important role for maintaining denitrification as an ecosystem functioning under certain conditions.

  19. A framework for modelling range shifts and migrations: asking when, whither, whether and will it return.

    Science.gov (United States)

    Gurarie, Eliezer; Cagnacci, Francesca; Peters, Wibke; Fleming, Christen H; Calabrese, Justin M; Mueller, Thomas; Fagan, William F

    2017-07-01

    Many animals undertake movements that are longer scaled and more directed than their typical home ranging behaviour. These movements include seasonal migrations (e.g. between breeding and feeding grounds), natal dispersal, nomadic range shifts and responses to local environmental disruptions. While various heuristic tools exist for identifying range shifts and migrations, none explicitly model the movement of the animals within a statistical framework that facilitates quantitative comparisons. We present the mechanistic range shift analysis (MRSA), a method to estimate a suite of range shift parameters: times of initiation, duration of transitions, centroids and areas of respective ranges. The method can take the autocorrelation and irregular sampling that is characteristic of much movement data into account. The mechanistic parameters suggest an intuitive measure, the range shift index, for the extent of a range shift. The likelihood based estimation further allows for statistical tests of several relevant hypotheses, including a range shift test, a stopover test and a site fidelity test. The analysis tools are provided in an R package (marcher). We applied the MRSA to a population of GPS tracked roe deer (Capreolus capreolus) in the Italian Alps between 2005 and 2008. With respect to seasonal migration, this population is extremely variable and difficult to classify. Using the MRSA, we were able to quantify the behaviours across the population and among individuals across years, identifying extents, durations and locations of seasonal range shifts, including cases that would have been ambiguous to detect using existing tools. The strongest patterns were differences across years: many animals simply did not perform a seasonal migration to wintering grounds during the mild winter of 2006-2007, even though some of these same animals did move extensively in other, harsher winters. For seasonal migrants, however, site fidelity across years was extremely high, even

  20. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  1. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  2. Modeling coral reef fish home range movements in Dry Tortugas, Florida.

    Science.gov (United States)

    Farmer, Nicholas A; Ault, Jerald S

    2014-01-01

    Underestimation of reef fish space use may result in marine reserves that are too small to effectively buffer a portion of the stock from fishing mortality. Commonly used statistical home range models, such as minimum convex polygon (MCP) or 95% kernel density (95% KD) methods, require the exclusion of individuals who move beyond the bounds of the tracking study. Spatially explicit individual-based models of fish home range movements parameterized from multiple years of acoustic tracking data were developed for three exploited coral reef fishes (red grouper Epinephelus morio, black grouper Mycteroperca bonaci, and mutton snapper Lutjanus analis) in Dry Tortugas, Florida. Movements were characterized as a combination of probability of movement, distance moved, and turning angle. Simulations suggested that the limited temporal and geographic scope of most movement studies may underestimate home range size, especially for fish with home range centers near the edges of the array. Simulations provided useful upper bounds for home range size (red grouper: 2.28±0.81 km2 MCP, 3.60±0.89 km2 KD; black grouper: 2.06±0.84 km2 MCP, 3.93±1.22 km2 KD; mutton snapper: 7.72±2.23 km2 MCP, 6.16±1.11 km2 KD). Simulations also suggested that MCP home ranges are more robust to artifacts of passive array acoustic detection patterns than 95% KD methods.

  3. Modeling Coral Reef Fish Home Range Movements in Dry Tortugas, Florida

    Directory of Open Access Journals (Sweden)

    Nicholas A. Farmer

    2014-01-01

    Full Text Available Underestimation of reef fish space use may result in marine reserves that are too small to effectively buffer a portion of the stock from fishing mortality. Commonly used statistical home range models, such as minimum convex polygon (MCP or 95% kernel density (95% KD methods, require the exclusion of individuals who move beyond the bounds of the tracking study. Spatially explicit individual-based models of fish home range movements parameterized from multiple years of acoustic tracking data were developed for three exploited coral reef fishes (red grouper Epinephelus morio, black grouper Mycteroperca bonaci, and mutton snapper Lutjanus analis in Dry Tortugas, Florida. Movements were characterized as a combination of probability of movement, distance moved, and turning angle. Simulations suggested that the limited temporal and geographic scope of most movement studies may underestimate home range size, especially for fish with home range centers near the edges of the array. Simulations provided useful upper bounds for home range size (red grouper: 2.28±0.81 km2 MCP, 3.60±0.89 km2 KD; black grouper: 2.06±0.84 km2 MCP, 3.93±1.22 km2 KD; mutton snapper: 7.72±2.23 km2 MCP, 6.16±1.11 km2 KD. Simulations also suggested that MCP home ranges are more robust to artifacts of passive array acoustic detection patterns than 95% KD methods.

  4. Range Verification Methods in Particle Therapy: Underlying Physics and Monte Carlo Modeling.

    Science.gov (United States)

    Kraan, Aafke Christine

    2015-01-01

    Hadron therapy allows for highly conformal dose distributions and better sparing of organs-at-risk, thanks to the characteristic dose deposition as function of depth. However, the quality of hadron therapy treatments is closely connected with the ability to predict and achieve a given beam range in the patient. Currently, uncertainties in particle range lead to the employment of safety margins, at the expense of treatment quality. Much research in particle therapy is therefore aimed at developing methods to verify the particle range in patients. Non-invasive in vivo monitoring of the particle range can be performed by detecting secondary radiation, emitted from the patient as a result of nuclear interactions of charged hadrons with tissue, including β (+) emitters, prompt photons, and charged fragments. The correctness of the dose delivery can be verified by comparing measured and pre-calculated distributions of the secondary particles. The reliability of Monte Carlo (MC) predictions is a key issue. Correctly modeling the production of secondaries is a non-trivial task, because it involves nuclear physics interactions at energies, where no rigorous theories exist to describe them. The goal of this review is to provide a comprehensive overview of various aspects in modeling the physics processes for range verification with secondary particles produced in proton, carbon, and heavier ion irradiation. We discuss electromagnetic and nuclear interactions of charged hadrons in matter, which is followed by a summary of some widely used MC codes in hadron therapy. Then, we describe selected examples of how these codes have been validated and used in three range verification techniques: PET, prompt gamma, and charged particle detection. We include research studies and clinically applied methods. For each of the techniques, we point out advantages and disadvantages, as well as clinical challenges still to be addressed, focusing on MC simulation aspects.

  5. Range Verification Methods in Particle Therapy: Underlying Physics and Monte Carlo Modeling

    Science.gov (United States)

    Kraan, Aafke Christine

    2015-01-01

    Hadron therapy allows for highly conformal dose distributions and better sparing of organs-at-risk, thanks to the characteristic dose deposition as function of depth. However, the quality of hadron therapy treatments is closely connected with the ability to predict and achieve a given beam range in the patient. Currently, uncertainties in particle range lead to the employment of safety margins, at the expense of treatment quality. Much research in particle therapy is therefore aimed at developing methods to verify the particle range in patients. Non-invasive in vivo monitoring of the particle range can be performed by detecting secondary radiation, emitted from the patient as a result of nuclear interactions of charged hadrons with tissue, including β+ emitters, prompt photons, and charged fragments. The correctness of the dose delivery can be verified by comparing measured and pre-calculated distributions of the secondary particles. The reliability of Monte Carlo (MC) predictions is a key issue. Correctly modeling the production of secondaries is a non-trivial task, because it involves nuclear physics interactions at energies, where no rigorous theories exist to describe them. The goal of this review is to provide a comprehensive overview of various aspects in modeling the physics processes for range verification with secondary particles produced in proton, carbon, and heavier ion irradiation. We discuss electromagnetic and nuclear interactions of charged hadrons in matter, which is followed by a summary of some widely used MC codes in hadron therapy. Then, we describe selected examples of how these codes have been validated and used in three range verification techniques: PET, prompt gamma, and charged particle detection. We include research studies and clinically applied methods. For each of the techniques, we point out advantages and disadvantages, as well as clinical challenges still to be addressed, focusing on MC simulation aspects. PMID:26217586

  6. FIRST EXPERIENCES WITH KINECT V2 SENSOR FOR CLOSE RANGE 3D MODELLING

    Directory of Open Access Journals (Sweden)

    E. Lachat

    2015-02-01

    Full Text Available RGB-D cameras, also known as range imaging cameras, are a recent generation of sensors. As they are suitable for measuring distances to objects at high frame rate, such sensors are increasingly used for 3D acquisitions, and more generally for applications in robotics or computer vision. This kind of sensors became popular especially since the Kinect v1 (Microsoft arrived on the market in November 2010. In July 2014, Windows has released a new sensor, the Kinect for Windows v2 sensor, based on another technology as its first device. However, due to its initial development for video games, the quality assessment of this new device for 3D modelling represents a major investigation axis. In this paper first experiences with Kinect v2 sensor are related, and the ability of close range 3D modelling is investigated. For this purpose, error sources on output data as well as a calibration approach are presented.

  7. Predicting commuter flows in spatial networks using a radiation model based on temporal ranges

    Science.gov (United States)

    Ren, Yihui; Ercsey-Ravasz, Mária; Wang, Pu; González, Marta C.; Toroczkai, Zoltán

    2014-11-01

    Understanding network flows such as commuter traffic in large transportation networks is an ongoing challenge due to the complex nature of the transportation infrastructure and human mobility. Here we show a first-principles based method for traffic prediction using a cost-based generalization of the radiation model for human mobility, coupled with a cost-minimizing algorithm for efficient distribution of the mobility fluxes through the network. Using US census and highway traffic data, we show that traffic can efficiently and accurately be computed from a range-limited, network betweenness type calculation. The model based on travel time costs captures the log-normal distribution of the traffic and attains a high Pearson correlation coefficient (0.75) when compared with real traffic. Because of its principled nature, this method can inform many applications related to human mobility driven flows in spatial networks, ranging from transportation, through urban planning to mitigation of the effects of catastrophic events.

  8. Model-independent sum rule analysis based on limited-range spectral data

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmenko, A B; Marel, D van der; Carbone, F; Marsiglio, F [Departement de Physique de la Matiere Condensee, University of Geneva, 1211 Geneva 4 (Switzerland)

    2007-07-15

    Partial sum rules are widely used in physics to separate low- and high-energy degrees of freedom of complex dynamical systems. Their application, though, is challenged in practice by the always finite spectrometer bandwidth and is often performed using risky model-dependent extrapolations. We show that, given spectra of the real and imaginary parts of any causal frequency-dependent response function (for example, optical conductivity, magnetic susceptibility, acoustical impedance etc) in a limited range, the sum-rule integral from zero to a certain cutoff frequency inside this range can be safely derived using only the Kramers-Kronig dispersion relations without any extra model assumptions. This implies that experimental techniques providing both active and reactive response components independently, such as spectroscopic ellipsometry in optics, allow an extrapolation-independent determination of spectral weight 'hidden' below the lowest accessible frequency.

  9. Enhanced UWB Radio Channel Model for Short-Range Communication Scenarios Including User Dynamics

    DEFF Research Database (Denmark)

    Kovacs, Istvan Zsolt; Nguyen, Tuan Hung; Eggers, Patrick Claus F.

    2005-01-01

    In this paper we propose a SISO UWB radio channel model for short-range radio link scenarios between a fixed device and a dynamic user hand-held device. The channel model is derived based on novel experimental UWB radio propagation investigations carried out in typical indoor PAN scenarios...... including realistic device and user terminal antenna configurations. The radio channel measurements have been performed in the lower UWB frequency band of 3GHz to 5GHz with a 2x4 MIMO antenna configuration. Several environments, user scenarios and two types of user terminals have been used. The developed...... channel model represents an enhancement of the existing IEEE 802.15.3a/4a PAN channel model, where antenna and user-proximity effects are not included. Our investigations showed that significant variations of the received wideband power and time-delay signal clustering are possible due the human body...

  10. Dependence of simulations of long range transport on meteorology, model and dust size

    Science.gov (United States)

    Mahowald, N. M.; Albani, S.; Smith, M.; Losno, R.; Marticorena, B.; Ridley, D. A.; Heald, C. L.; Qu, Z.

    2015-12-01

    Mineral aerosols interact with radiation directly, as well as modifying climate, and provide important micronutrients to ocean and land ecosystems. Mineral aerosols are transported long distances from the source regions to remote regions, but the rates at which this occurs can be difficult to deduce from either observations or models. Here we consider interactions between the details of the simulation of dust size and long-range transport. In addition, we compare simulations of dust using multiple reanalysis datasets, as well as different model basis to understand how robust the mean, seasonality and interannual variability are in models. Models can provide insight into how long observations are required in order to characterize the atmospheric concentration and deposition to remote regions.

  11. Inhomogeneous Long-Range Percolation for Real-Life Network Modeling

    Directory of Open Access Journals (Sweden)

    Philippe Deprez

    2015-01-01

    Full Text Available The study of random graphs has become very popular for real-life network modeling, such as social networks or financial networks. Inhomogeneous long-range percolation (or scale-free percolation on the lattice Zd, d ≥ 1, is a particular attractive example of a random graph model because it fulfills several stylized facts of real-life networks. For this model, various geometric properties, such as the percolation behavior, the degree distribution and graph distances, have been analyzed. In the present paper, we complement the picture of graph distances and we prove continuity of the percolation probability in the phase transition point. We also provide an illustration of the model connected to financial networks.

  12. Generalized Efficient Inference on Factor Models with Long-Range Dependence

    DEFF Research Database (Denmark)

    Ergemen, Yunus Emre

    . Short-memory dynamics are allowed in the common factor structure and possibly heteroskedastic error term. In the estimation, a generalized version of the principal components (PC) approach is proposed to achieve efficiency. Asymptotics for efficient common factor and factor loading as well as long......A dynamic factor model is considered that contains stochastic time trends allowing for stationary and nonstationary long-range dependence. The model nests standard I(0) and I(1) behaviour smoothly in common factors and residuals, removing the necessity of a priori unit-root and stationarity testing...

  13. Use of agent-based modelling in emergency management under a range of flood hazards

    Directory of Open Access Journals (Sweden)

    Tagg Andrew

    2016-01-01

    Full Text Available The Life Safety Model (LSM was developed some 15 years ago, originally for dam break assessments and for informing reservoir evacuation and emergency plans. Alongside other technological developments, the model has evolved into a very useful agent-based tool, with many applications for a range of hazards and receptor behaviour. HR Wallingford became involved in its use in 2006, and is now responsible for its technical development and commercialisation. Over the past 10 years the model has been applied to a range of flood hazards, including coastal surge, river flood, dam failure and tsunami, and has been verified against historical events. Commercial software licences are being used in Canada, Italy, Malaysia and Australia. A core group of LSM users and analysts has been specifying and delivering a programme of model enhancements. These include improvements to traffic behaviour at intersections, new algorithms for sheltering in high-rise buildings, and the addition of monitoring points to allow detailed analysis of vehicle and pedestrian movement. Following user feedback, the ability of LSM to handle large model ‘worlds’ and hydrodynamic meshes has been improved. Recent developments include new documentation, performance enhancements, better logging of run-time events and bug fixes. This paper describes some of the recent developments and summarises some of the case study applications, including dam failure analysis in Japan and mass evacuation simulation in England.

  14. Progress in sensor performance testing, modeling and range prediction using the TOD method: an overview

    Science.gov (United States)

    Bijl, Piet; Hogervorst, Maarten A.; Toet, Alexander

    2017-05-01

    The Triangle Orientation Discrimination (TOD) methodology includes i) a widely applicable, accurate end-to-end EO/IR sensor test, ii) an image-based sensor system model and iii) a Target Acquisition (TA) range model. The method has been extensively validated against TA field performance for a wide variety of well- and under-sampled imagers, systems with advanced image processing techniques such as dynamic super resolution and local adaptive contrast enhancement, and sensors showing smear or noise drift, for both static and dynamic test stimuli and as a function of target contrast. Recently, significant progress has been made in various directions. Dedicated visual and NIR test charts for lab and field testing are available and thermal test benches are on the market. Automated sensor testing using an objective synthetic human observer is within reach. Both an analytical and an image-based TOD model have recently been developed and are being implemented in the European Target Acquisition model ECOMOS and in the EOSTAR TDA. Further, the methodology is being applied for design optimization of high-end security camera systems. Finally, results from a recent perception study suggest that DRI ranges for real targets can be predicted by replacing the relevant distinctive target features by TOD test patterns of the same characteristic size and contrast, enabling a new TA modeling approach. This paper provides an overview.

  15. Sabots, Obturator and Gas-In-Launch Tube Techniques for Heat Flux Models in Ballistic Ranges

    Science.gov (United States)

    Bogdanoff, David W.; Wilder, Michael C.

    2013-01-01

    For thermal protection system (heat shield) design for space vehicle entry into earth and other planetary atmospheres, it is essential to know the augmentation of the heat flux due to vehicle surface roughness. At the NASA Ames Hypervelocity Free Flight Aerodynamic Facility (HFFAF) ballistic range, a campaign of heat flux studies on rough models, using infrared camera techniques, has been initiated. Several phenomena can interfere with obtaining good heat flux data when using this measuring technique. These include leakage of the hot drive gas in the gun barrel through joints in the sabot (model carrier) to create spurious thermal imprints on the model forebody, deposition of sabot material on the model forebody, thereby changing the thermal properties of the model surface and unknown in-barrel heating of the model. This report presents developments in launch techniques to greatly reduce or eliminate these problems. The techniques include the use of obturator cups behind the launch package, enclosed versus open front sabot designs and the use of hydrogen gas in the launch tube. Attention also had to be paid to the problem of the obturator drafting behind the model and impacting the model. Of the techniques presented, the obturator cups and hydrogen in the launch tube were successful when properly implemented

  16. Aerodynamic Coefficients from Aeroballistic Range Testing of Deployed- and Stowed-SIAD SFDT Models

    Science.gov (United States)

    Wilder, Michael C.; Brown, Jeffrey D.; Bogdanoff, David W.; Yates, Leslie A.; Dyakonov, Artem A.; Clark, Ian G.; Grinstead, Jay H.

    2017-01-01

    This report documents a ballistic-range test campaign conducted in 2012 in order to estimate the aerodynamic stability characteristics of two configurations of the Supersonic Flight Dynamics Test (SFDT) vehicle prior to its initial flight in 2014. The SFDT vehicle was a test bed for demonstrating several new aerodynamic decelerator technologies then being developed under the Low-Density Supersonic Decelerator (LDSD) Project. Of particular interest here is the Supersonic Inflatable Aerodynamic Decelerator (SIAD), an inflatable attached torus used to increase the drag surface area of an entry vehicle during the supersonic portion of the entry trajectory. Two model configurations were tested in the ballistic range: one representing the SFDT vehicle prior to deployment of the SIAD, and the other representing the nominal shape with the SIAD inflated. Both models were fabricated from solid metal, and therefore, the effects of the flexibility of the inflatable decelerator were not considered. The test conditions were chosen to match, as close as possible, the Mach number, Reynolds number, and motion dynamics expected for the SFDT vehicle in flight, both with the SIAD stowed and deployed. For SFDT models with the SIAD stowed, 12 shots were performed covering a Mach number range of 3.2 to 3.7. For models representing the deployed SIAD, 37 shots were performed over a Mach number range of 2.0 to 3.8. Pitch oscillation amplitudes covered a range from 0.7 to 20.6 degrees RMS. Portions of this report (data analysis approach, aerodynamic modeling, and resulting aerodynamic coefficients) were originally published as an internal LDSD Project report [1] in 2012. In addition, this report provides a description of the test design approach, the test facility, and experimental procedures. Estimated non-linear aerodynamic coefficients, including pitch damping, for both model configurations are reported, and the shot-by-shot trajectory measurements, plotted in comparison with calculated

  17. A statistical approach to modelling permafrost distribution in the European Alps or similar mountain ranges

    Directory of Open Access Journals (Sweden)

    L. Boeckli

    2012-01-01

    explanatory variables are MAAT and PISR. The linear regression achieves a root mean square error (RMSE of 1.6 °C. The final model combines the two sub-models and accounts for the different scales used for model calibration.

    The modelling approach provides a theoretical basis for estimating mountain permafrost distribution over larger mountain ranges and can be expanded to more surface types and sub-models than considered, here. The analyses performed with the Alpine data set further provide quantitative insight into larger-area patterns as well as the model coefficients for a later spatial application. The transfer into a map-based product, however, requires further steps such as the definition of offset terms that usually contain a degree of subjectivity.

  18. DISTRIBUTION AND RANGE OF RADIONUCLIDE SORPTION COEFFICIENTS IN A SAVANNAH RIVER SITE SUBSURFACE: STOCHASTIC MODELING CONSIDERATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, D.; et. al

    2010-01-11

    The uncertainty associated with the sorption coefficient, or K{sub d} value, is one of the key uncertainties in estimating risk associated with burying low-level nuclear waste in the subsurface. The objective of this study was to measure >648 K{sub d} values and provide a measure of the range and distribution (normal or log-normal) of radionuclide K{sub d} values appropriate for the E-Area disposal site, within the Savannah River Site, near Aiken South Carolina. The 95% confidence level for the mean K{sub d} was twice the mean in the Aquifer Zone (18-30.5 m depth), equal to the mean for the Upper Vadose Zone (3.3-10 m depth), and half the mean for the Lower Vadose Zone (3.10-18 m depth). The distribution of K{sub d} values was log normal in the Upper Vadose Zone and Aquifer Zone, and normal in the Lower Vadose Zone. To our knowledge, this is the first report of natural radionuclide Kd variability in the literature. Using ranges and distribution coefficients that are specific to the hydrostratigraphic unit improved model accuracy and reduced model uncertainty. Unfortunately, extension of these conclusions to other sites is likely not appropriate given that each site has its own sources of hydrogeological variability. However, this study provides one of the first examples of the development stochastic ranges and distributions of K{sub d} values for a hydrological unit for stochastic modeling.

  19. A state-and-transition simulation modeling approach for estimating the historical range of variability

    Directory of Open Access Journals (Sweden)

    Kori Blankenship

    2015-04-01

    Full Text Available Reference ecological conditions offer important context for land managers as they assess the condition of their landscapes and provide benchmarks for desired future conditions. State-and-transition simulation models (STSMs are commonly used to estimate reference conditions that can be used to evaluate current ecosystem conditions and to guide land management decisions and activities. The LANDFIRE program created more than 1,000 STSMs and used them to assess departure from a mean reference value for ecosystems in the United States. While the mean provides a useful benchmark, land managers and researchers are often interested in the range of variability around the mean. This range, frequently referred to as the historical range of variability (HRV, offers model users improved understanding of ecosystem function, more information with which to evaluate ecosystem change and potentially greater flexibility in management options. We developed a method for using LANDFIRE STSMs to estimate the HRV around the mean reference condition for each model state in ecosystems by varying the fire probabilities. The approach is flexible and can be adapted for use in a variety of ecosystems. HRV analysis can be combined with other information to help guide complex land management decisions.

  20. Integrating physiological threshold experiments with climate modeling to project mangrove species' range expansion.

    Science.gov (United States)

    Cavanaugh, Kyle C; Parker, John D; Cook-Patton, Susan C; Feller, Ilka C; Williams, A Park; Kellner, James R

    2015-05-01

    Predictions of climate-related shifts in species ranges have largely been based on correlative models. Due to limitations of these models, there is a need for more integration of experimental approaches when studying impacts of climate change on species distributions. Here, we used controlled experiments to identify physiological thresholds that control poleward range limits of three species of mangroves found in North America. We found that all three species exhibited a threshold response to extreme cold, but freeze tolerance thresholds varied among species. From these experiments, we developed a climate metric, freeze degree days (FDD), which incorporates both the intensity and the frequency of freezes. When included in distribution models, FDD accurately predicted mangrove presence/absence. Using 28 years of satellite imagery, we linked FDD to observed changes in mangrove abundance in Florida, further exemplifying the importance of extreme cold. We then used downscaled climate projections of FDD to project that these range limits will move northward by 2.2-3.2 km yr(-1) over the next 50 years. © 2014 John Wiley & Sons Ltd.

  1. Astronomical Constraints on Some Long-Range Models of Modified Gravity

    Directory of Open Access Journals (Sweden)

    Lorenzo Iorio

    2007-01-01

    Full Text Available We use the corrections to the Newton-Einstein secular precessions of the longitudes of the perihelia of the inner planets, phenomenologically estimated E.V. Pitjeva by fitting almost one century of data with the EPM2004 ephemerides, to constrain some long-range models of modified gravity recently put forth to address the dark energy and dark matter problems. They are the four-dimensional ones obtained with the addition of inverse powers and logarithm of some curvature invariants, and the DGP multidimensional braneworld model. After working out the analytical expressions of the secular perihelion precessions induced by the corrections to the Newtonian potential of such models, we compare them to the estimated extra-rates of perihelia by taking their ratio for different pairs of planets instead of using one perihelion at a time for each planet separately, as done so far in literature. The curvature invariants-based models are ruled out, even by rescaling by a factor 10 the errors in the estimated planetary orbital parameters. Less neat is the situation for the DGP model. Only the general relativistic Lense-Thirring effect, not included, as the other exotic models considered here, by Pitjeva in the EPM force models, passes such a test.

  2. Feasibility of Close-Range Photogrammetric Models for Geographic Information System

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Luke; /Rice U.

    2011-06-22

    The objective of this project was to determine the feasibility of using close-range architectural photogrammetry as an alternative three dimensional modeling technique in order to place the digital models in a geographic information system (GIS) at SLAC. With the available equipment and Australis photogrammetry software, the creation of full and accurate models of an example building, Building 281 on SLAC campus, was attempted. After conducting several equipment tests to determine the precision achievable, a complete photogrammetric survey was attempted. The dimensions of the resulting models were then compared against the true dimensions of the building. A complete building model was not evidenced to be obtainable using the current equipment and software. This failure was likely attributable to the limits of the software rather than the precision of the physical equipment. However, partial models of the building were shown to be accurate and determined to still be usable in a GIS. With further development of the photogrammetric software and survey procedure, the desired generation of a complete three dimensional model is likely still feasible.

  3. Modelling atmospheric chemistry and long-range transport of emerging Asian pollutants

    CERN Document Server

    Wang, Kuo-Ying

    2008-01-01

    Modeling is a very important tool for scientific processes, requiring long-term dedication, desire, and continuous reflection. In this work, we discuss several aspects of modeling, and the reasons for doing it. We discuss two major modeling systems that have been built by us over the last 10 years. It is a long and arduous process but the reward of understanding can be enormous, as demonstrated in the examples shown in this work. We found that long-range transport of emerging Asian pollutants can be interpreted using a Lagrangian framework for wind analysis. More detailed processes still need to be modeled but an accurate representation of the wind structure is the most important thing above all others. Our long-term chemistry integrations reveal the capability of the IMS model in simulating tropospheric chemistry on a climate scale. These long-term integrations also show ways for further model development. Modeling is a quantitative process, and the understanding can be sustained only when theories are vigor...

  4. Discrimination of different hop varieties using headspace gas chromatographic data

    Directory of Open Access Journals (Sweden)

    Jorge Katia

    2003-01-01

    Full Text Available Methods for characterization of hop varieties include analyses of bitter acids and essential oils, followed by comparison of the chemical composition, particularly chromatographic profiles. In the present work discrimination of different hop varieties was carried out based on their essential oil volatile composition, assessed by headspace gas chromatography, with subsequent statistical treatment of the data. Differences and similarities were determined in samples from USA, New Zealand and Europe, using correlation and cluster analysis. Aroma hops presented low levels of myrcene while bitter samples showed high levels of beta-caryophyllene, aloaromadendrene and also the sum of the marker ratios, independently of being in the form of pellets or extracts. Highly correlated samples with no significant differences have good possibility to substitute each other in the beer manufacture.

  5. Utility of ionosphere and troposphere models for extending the range of high-accuracy GPS

    Science.gov (United States)

    Dodd, David William

    This dissertation studied the use of NOAA real-time ionosphere and troposphere products in extending the range of long-baseline, high-accuracy DGPS for real-time positioning. The question being addressed by this work is; can existing real-time ionosphere and troposphere models reduce the observation uncertainties to the level where they can be used to reliably resolve integer ambiguities, in real-time, over long baselines (>30km). In-house GPS processing software (USM_OTF) was developed to ingest the models and compute epoch-to-epoch, float and fixed ambiguity position solutions. Single baseline processing, ranging from 20 to 740 kin, over several days in four separate sessions (July 2004, January 2005, August 2005 and July 2006) incorporating four regions of the U.S.A. (Michigan, California, Central and the South East), were evaluated. The first session looked at the NOAA real-time troposphere model and the second session looked at the NOAA real-time ionosphere model. The third and fourth sessions looked at the use of both the NOAA real-time ionosphere and troposphere models. Results showed that the NOAA troposphere model reduced the height bias uncertainty by up to 30 cm, under high activity conditions. They also showed that the troposphere model increased the uncertainty standard deviation under these high activity conditions. The results from the first tests of the real-time NOAA ionosphere model showed that, due to satellite coverage issues, it produced worse results than other real-time models. The NOAA model suffered from lack of satellite coverage corrections, especially in areas near the limits of the model, and at the beginning and end of a satellite's flight path. A reduction in satellite numbers lead to weaker geometry and less reliable position solutions. These tests showed that it was better to provide less accurate ionosphere estimates than to leave the satellites out of the solution. These problems were addressed by NOAA prior to the final tests

  6. Comment on "Many-body localization in Ising models with random long-range interactions"

    Science.gov (United States)

    Maksymov, Andrii O.; Rahman, Noah; Kapit, Eliot; Burin, Alexander L.

    2017-11-01

    This Comment is dedicated to the investigation of many-body localization in a quantum Ising model with long-range power-law interactions r-α, relevant for a variety of systems ranging from electrons in Anderson insulators to spin excitations in chains of cold atoms. It has earlier been argued [arXiv:cond-mat/0611387 (2005); Phys. Rev. B 91, 094202 (2015), 10.1103/PhysRevB.91.094202] that this model obeys the dimensional constraint suggesting the delocalization of all finite-temperature states in the thermodynamic limit for α ≤2 d in a d -dimensional system. This expectation conflicts with the recent numerical studies of the specific interacting spin model of Li et al. [Phys. Rev. A 94, 063625 (2016), 10.1103/PhysRevA.94.063625]. To resolve this controversy we reexamine the model of Li et al. [Phys. Rev. A 94, 063625 (2016), 10.1103/PhysRevA.94.063625] and demonstrate that the infinite-temperature states there obey the dimensional constraint. The earlier developed scaling theory for the critical system size required for delocalization is extended to small exponents 0 ≤α ≤d . The disagreements between the two works are explained by the nonstandard selection of investigated states in the ordered phase in the work of Li et al. [Phys. Rev. A 94, 063625 (2016)10.1103/PhysRevA.94.063625].

  7. Modelling Vulnerability and Range Shifts in Ant Communities Responding to Future Global Warming in Temperate Forests.

    Science.gov (United States)

    Kwon, Tae-Sung; Li, Fengqing; Kim, Sung-Soo; Chun, Jung Hwa; Park, Young-Seuk

    2016-01-01

    Global warming is likely leading to species' distributional shifts, resulting in changes in local community compositions and diversity patterns. In this study, we applied species distribution models to evaluate the potential impacts of temperature increase on ant communities in Korean temperate forests, by testing hypotheses that 1) the risk of extinction of forest ant species would increase over time, and 2) the changes in species distribution ranges could drive upward movements of ant communities and further alter patterns of species richness. We sampled ant communities at 335 evenly distributed sites across South Korea and modelled the future distribution range for each species using generalized additive models. To account for spatial autocorrelation, autocovariate regressions were conducted prior to generalized additive models. Among 29 common ant species, 12 species were estimated to shrink their suitable geographic areas, whereas five species would benefit from future global warming. Species richness was highest at low altitudes in the current period, and it was projected to be highest at the mid-altitudes in the 2080s, resulting in an upward movement of 4.9 m yr-1. This altered the altitudinal pattern of species richness from a monotonic-decrease curve (common in temperate regions) to a bell-shaped curve (common in tropical regions). Overall, ant communities in temperate forests are vulnerable to the on-going global warming and their altitudinal movements are similar to other faunal communities.

  8. An interactive system for creating object models from range data based on simulated annealing

    Energy Technology Data Exchange (ETDEWEB)

    Hoff, W.A.; Hood, F.W.; King, R.H. [Colorado School of Mines, Golden, CO (United States). Center for Robotics and Intelligent Systems

    1997-05-01

    In hazardous applications such as remediation of buried waste and dismantlement of radioactive facilities, robots are an attractive solution. Sensing to recognize and locate objects is a critical need for robotic operations in unstructured environments. An accurate 3-D model of objects in the scene is necessary for efficient high level control of robots. Drawing upon concepts from supervisory control, the authors have developed an interactive system for creating object models from range data, based on simulated annealing. Site modeling is a task that is typically performed using purely manual or autonomous techniques, each of which has inherent strengths and weaknesses. However, an interactive modeling system combines the advantages of both manual and autonomous methods, to create a system that has high operator productivity as well as high flexibility and robustness. The system is unique in that it can work with very sparse range data, tolerate occlusions, and tolerate cluttered scenes. The authors have performed an informal evaluation with four operators on 16 different scenes, and have shown that the interactive system is superior to either manual or automatic methods in terms of task time and accuracy.

  9. Prenatal and postnatal animal models of immune activation: relevance to a range of neurodevelopmental disorders.

    Science.gov (United States)

    Harvey, Louise; Boksa, Patricia

    2012-10-01

    Epidemiological evidence has established links between immune activation during the prenatal or early postnatal period and increased risk of developing a range of neurodevelopment disorders in later life. Animal models have been used to great effect to explore the ramifications of immune activation during gestation and neonatal life. A range of behavioral, neurochemical, molecular, and structural outcome measures associated with schizophrenia, autism, cerebral palsy, and epilepsy have been assessed in models of prenatal and postnatal immune activation. However, the epidemiology-driven disease-first approach taken by some studies can be limiting and, despite the wealth of data, there is a lack of consensus in the literature as to the specific dose, timing, and nature of the immunogen that results in replicable and reproducible changes related to a single disease phenotype. In this review, we highlight a number of similarities and differences in models of prenatal and postnatal immune activation currently being used to investigate the origins of schizophrenia, autism, cerebral palsy, epilepsy, and Parkinson's disease. However, we describe a lack of synthesis not only between but also within disease-specific models. Our inability to compare the equivalency dose of immunogen used is identified as a significant yet easily remedied problem. We ask whether early life exposure to infection should be described as a disease-specific or general vulnerability factor for neurodevelopmental disorders and discuss the implications that either classification has on the design, strengths and limitations of future experiments. Copyright © 2012 Wiley Periodicals, Inc.

  10. Irregular GIS Curve Fitting based High Speed Railway Earthquake Influence Range Calculation Model

    Directory of Open Access Journals (Sweden)

    Hu Zhaobing

    2017-01-01

    Full Text Available In this paper, to guarantee that the train can take measures to reduce the damage caused by the earthquake, it propose an irregular GI S curve fitting based high-speed railway earthquake influence range calculation model. Firstly, this model eliminates the abnormal points, calculates feature points and finds demarcation points of the high- speed railway GI S curve to get the processed point collection in Mercator coordinate. Secondly, though usin g the processed point collection, this model applies least square polynomial segmentation fitting method to implement complex high-speed GI S curve fitting. Thirdly, calculate the earthquake influence rang on high-seed railway line, according to the scope of the earthquake equation and the high-speed railway GI S curve fitt ed equation. Finally, the paper selects the Beijing So uth to Dezhou East high-speed railway section which is part of Beijing-Shanghai line as a case study, which proves that the model can calculate the earthquake influence scope on the railway line offering decision support for train operation to ensure safety.

  11. Coherent reverberation model based on adiabatic normal mode theory in a range dependent shallow water environment

    Science.gov (United States)

    Li, Zhenglin; Zhang, Renhe; Li, Fenghua

    2010-09-01

    Ocean reverberation in shallow water is often the predominant background interference in active sonar applications. It is still an open problem in underwater acoustics. In recent years, an oscillation phenomenon of the reverberation intensity, due to the interference of the normal modes, has been observed in many experiments. A coherent reverberation theory has been developed and used to explain this oscillation phenomenon [F. Li et al., Journal of Sound and Vibration, 252(3), 457-468, 2002]. However, the published coherent reverberation theory is for the range independent environment. Following the derivations by F. Li and Ellis [D. D. Ellis, J. Acoust. Soc. Am., 97(5), 2804-2814, 1995], a general reverberation model based on the adiabatic normal mode theory in a range dependent shallow water environment is presented. From this theory the coherent or incoherent reverberation field caused by sediment inhomogeneity and surface roughness can be predicted. Observations of reverberation from the 2001 Asian Sea International Acoustic Experiment (ASIAEX) in the East China Sea are used to test the model. Model/data comparison shows that the coherent reverberation model can predict the experimental oscillation phenomenon of reverberation intensity and the vertical correlation of reverberation very well.

  12. Modelling the effect of temperature on the range expansion of species by reaction-diffusion equations.

    Science.gov (United States)

    Richter, Otto; Moenickes, Sylvia; Suhling, Frank

    2012-02-01

    The spatial dynamics of range expansion is studied in dependence of temperature. The main elements population dynamics, competition and dispersal are combined in a coherent approach based on a system of coupled partial differential equations of the reaction-diffusion type. The nonlinear reaction terms comprise population dynamic models with temperature dependent reproduction rates subject to an Allee effect and mutual competition. The effect of temperature on travelling wave solutions is investigated for a one dimensional model version. One main result is the importance of the Allee effect for the crossing of regions with unsuitable habitats. The nonlinearities of the interaction terms give rise to a richness of spatio-temporal dynamic patterns. In two dimensions, the resulting non-linear initial boundary value problems are solved over geometries of heterogeneous landscapes. Geo referenced model parameters such as mean temperature and elevation are imported into the finite element tool COMSOL Multiphysics from a geographical information system. The model is applied to the range expansion of species at the scale of middle Europe. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Atom-by-Atom and Concerted Hopping of Adatom Pairs on an Open Metal Surface

    Energy Technology Data Exchange (ETDEWEB)

    Bogicevic, A.; Ovesson, S.; Lundqvist, B.I.; Jennison, D.R.

    1999-08-25

    Atom-by-atom and concerted hopping of ad-dimers on the open (100) surface of fcc metals are studied by means of density-functional calculations. The adatom interaction is relatively short-ranged, and beyond next-nearest neighbors ad-dimers are effectively dissociated. Diffusion takes place by a simple shearing process, favored because it maximizes adatom coordination at the transition state This holds for Al, Au, and Rh, and is likely a general result because geometrical arguments dominate over details of the electronic structure.

  14. Assessing Extreme Models of the Stober Synthesis Using Transients under a Range of Initial Composition

    Science.gov (United States)

    Lee; Look; Harris; McCormick

    1997-10-01

    29Si-NMR, conductimetry, and photon correlation spectroscopy are used to monitor the temporal profile of intermediate concentrations in Stober synthesis (i.e., ammonia-catalyzed hydrolysis of tetraethoxysilane in a batch reactor). Extreme models of the process are assessed by examining the effect of initial composition on these transients (over a wider range of composition than attempted previously). The trends with initial composition suggest that the nucleation is rate-limited by the hydrolysis of the singly hydrolyzed monomer, the product of which probably phase separates. Moreover, the trends are consistent with the aggregation model discussed by G. H. Bogush and C. F. Zukoski (J. Colloid Interface Sci. 142, 1, 19 (1991) and by M. T. Harris (Ph.D. dissertation, Univ. of Tennessee, 1992). The trends are not consistent with a growth model without aggregation. Copyright 1997 Academic Press. Copyright 1997Academic Press

  15. Modeling the potential area of occupancy at fine resolution may reduce uncertainty in species range estimates

    DEFF Research Database (Denmark)

    Jiménez-Alfaro, Borja; Draper, David; Nogues, David Bravo

    2012-01-01

    and maximum entropy modeling to assess whether different sampling (expert versus systematic surveys) may affect AOO estimates based on habitat suitability maps, and the differences between such measurements and traditional coarse-grid methods. Fine-scale models performed robustly and were not influenced...... Area (MPA). As defined here, the potential AOO provides spatially-explicit measures of species ranges which are permanent in the time and scarcely affected by sampling bias. The overestimation of these measures may be reduced using higher thresholds of habitat suitability, but standard rules as the MPA...... by survey protocols, providing similar habitat suitability outputs with high spatial agreement. Model-based estimates of potential AOO were significantly smaller than AOO measures obtained from coarse-scale grids, even if the first were obtained from conservative thresholds based on the Minimal Predicted...

  16. Dielectric relaxation and localized electron hopping in colossal dielectric (Nb,In)-doped TiO2 rutile nanoceramics.

    Science.gov (United States)

    Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A

    2017-03-28

    Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.

  17. Hopping conduction in GaAs layers grown by molecular-beam epitaxy at low temperatures

    OpenAIRE

    Shimogishi, F.; Mukai, K; Fukushima, S; Otsuka, N.

    2002-01-01

    The electrical conductivity of GaAs layers grown by molecular-beam epitaxy at low temperatures was studied by using the van der Pauw method. The electrical conductivity of thick GaAs layers grown at temperatures above 200 °C changes with the concentration of antisite As atoms following the nearest-neighbor hopping model. From the dependence of the conductivity on the average spacing of antisite As atoms, the Bohr radius of the donor wave function in the hydrogen like model was estimated to be...

  18. Polaron Hopping in Nano-scale Poly(dA–Poly(dT DNA

    Directory of Open Access Journals (Sweden)

    Singh Mahi

    2010-01-01

    Full Text Available Abstract We investigate the current–voltage relationship and the temperature-dependent conductance of nano-scale samples of poly(dA–poly(dT DNA molecules. A polaron hopping model has been used to calculate the I–V characteristic of nano-scale samples of DNA. This model agrees with the data for current versus voltage at temperatures greater than 100 K. The quantities G 0 , i 0 , and T 1d are determined empirically, and the conductivity is estimated for samples of poly(dA–poly(dT.

  19. Model Predictive Control considering Reachable Range of Wheels for Leg / Wheel Mobile Robots

    Science.gov (United States)

    Suzuki, Naito; Nonaka, Kenichiro; Sekiguchi, Kazuma

    2016-09-01

    Obstacle avoidance is one of the important tasks for mobile robots. In this paper, we study obstacle avoidance control for mobile robots equipped with four legs comprised of three DoF SCARA leg/wheel mechanism, which enables the robot to change its shape adapting to environments. Our previous method achieves obstacle avoidance by model predictive control (MPC) considering obstacle size and lateral wheel positions. However, this method does not ensure existence of joint angles which achieves reference wheel positions calculated by MPC. In this study, we propose a model predictive control considering reachable mobile ranges of wheels positions by combining multiple linear constraints, where each reachable mobile range is approximated as a convex trapezoid. Thus, we achieve to formulate a MPC as a quadratic problem with linear constraints for nonlinear problem of longitudinal and lateral wheel position control. By optimization of MPC, the reference wheel positions are calculated, while each joint angle is determined by inverse kinematics. Considering reachable mobile ranges explicitly, the optimal joint angles are calculated, which enables wheels to reach the reference wheel positions. We verify its advantages by comparing the proposed method with the previous method through numerical simulations.

  20. Lattice Gauge Quantum Simulation via State-Dependent Hopping

    DEFF Research Database (Denmark)

    Salami Dehkharghani, Amin

    2017-01-01

    We develop a quantum simulator architecture that is suitable for the simulation of U(1) Abelian gauge theories such as quantum electrodynamics. Our approach relies on the ability to control the hopping of a particle through a barrier by means of the internal quantum states of a neutral or charged...... impurity-particle sitting at the barrier. This scheme is highly experimentally feasible, as the correlated hopping does not require fine-tuning of the intra- and inter-species interactions. We investigate the applicability of the scheme in a double well potential, which is the basic building block...

  1. Information structure in Wichí: focus marker hop

    OpenAIRE

    Ekaterina Levina

    2013-01-01

    Abstract: The present paper provides an overview of the functions of the morphological focus marker hop in the grammar of Wichí, a Mataco-Mataguayan language spoken in the North of Argentina and the South of Bolivia. Basing the analysis on the corpus which I have compiled from the existing research which has been published on the language so far, we can conclude that the focus marker hop can but does not have to be used for the focusing of the subject, object, predicate, adverbial as well as ...

  2. Research on three-phase traffic flow modeling based on interaction range

    Science.gov (United States)

    Zeng, Jun-Wei; Yang, Xu-Gang; Qian, Yong-Sheng; Wei, Xu-Ting

    2017-12-01

    On the basis of the multiple velocity difference effect (MVDE) model and under short-range interaction, a new three-phase traffic flow model (S-MVDE) is proposed through careful consideration of the influence of the relationship between the speeds of the two adjacent cars on the running state of the rear car. The random slowing rule in the MVDE model is modified in order to emphasize the influence of vehicle interaction between two vehicles on the probability of vehicles’ deceleration. A single-lane model which without bottleneck structure under periodic boundary conditions is simulated, and it is proved that the traffic flow simulated by S-MVDE model will generate the synchronous flow of three-phase traffic theory. Under the open boundary, the model is expanded by adding an on-ramp, the congestion pattern caused by the bottleneck is simulated at different main road flow rates and on-ramp flow rates, which is compared with the traffic congestion pattern observed by Kerner et al. and it is found that the results are consistent with the congestion characteristics in the three-phase traffic flow theory.

  3. Analog VLSI Models of Range-Tuned Neurons in the Bat Echolocation System

    Directory of Open Access Journals (Sweden)

    Horiuchi Timothy

    2003-01-01

    Full Text Available Bat echolocation is a fascinating topic of research for both neuroscientists and engineers, due to the complex and extremely time-constrained nature of the problem and its potential for application to engineered systems. In the bat's brainstem and midbrain exist neural circuits that are sensitive to the specific difference in time between the outgoing sonar vocalization and the returning echo. While some of the details of the neural mechanisms are known to be species-specific, a basic model of reafference-triggered, postinhibitory rebound timing is reasonably well supported by available data. We have designed low-power, analog VLSI circuits to mimic this mechanism and have demonstrated range-dependent outputs for use in a real-time sonar system. These circuits are being used to implement range-dependent vocalization amplitude, vocalization rate, and closest target isolation.

  4. Range-Specific High-Resolution Mesoscale Model Setup: Data Assimilation

    Science.gov (United States)

    Watson, Leela R.

    2014-01-01

    Mesoscale weather conditions can have an adverse effect on space launch, landing, and ground processing at the Eastern Range (ER) in Florida and Wallops Flight Facility (WFF) in Virginia. During summer, land-sea interactions across Kennedy Space Center (KSC) and Cape Canaveral Air Force Station (CCAFS) lead to sea breeze front formation, which can spawn deep convection that can hinder operations and endanger personnel and resources. Many other weak locally driven low-level boundaries and their interactions with the sea breeze front and each other can also initiate deep convection in the KSC/CCAFS area. Some of these other boundaries include the Indian River breeze front, Banana River breeze front, outflows from previous convection, horizontal convective rolls, convergence lines from other inland bodies of water such as Lake Okeechobee, the trailing convergence line from convergence of sea breeze fronts due to the shape of Cape Canaveral, frictional convergence lines from the islands in the Bahamas, convergence lines from soil moisture differences, convergence lines from cloud shading, and others. All these subtle weak boundary interactions often make forecasting of operationally important weather very difficult at KSC/CCAFS during the convective season (May-Oct). These convective processes often build quickly, last a short time (60 minutes or less), and occur over small distances, all of which also poses a significant challenge to the local forecasters who are responsible for issuing weather advisories, watches, and warnings. Surface winds during the transition seasons of spring and fall pose the most difficulties for the forecasters at WFF. They also encounter problems forecasting convective activity and temperature during those seasons. Therefore, accurate mesoscale model forecasts are needed to aid in their decision making. Both the ER and WFF would benefit greatly from high-resolution mesoscale model output to better forecast a variety of unique weather

  5. Using Models to Provide Predicted Ranges for Building-Human Interfaces: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Long, N.; Scheib, J.; Pless, S.; Schott, M.

    2013-09-01

    Most building energy consumption dashboards provide only a snapshot of building performance; whereas some provide more detailed historic data with which to compare current usage. This paper will discuss the Building Agent(tm) platform, which has been developed and deployed in a campus setting at the National Renewable Energy Laboratory as part of an effort to maintain the aggressive energyperformance achieved in newly constructed office buildings and laboratories. The Building Agent(tm) provides aggregated and coherent access to building data, including electric energy, thermal energy, temperatures, humidity, and lighting levels, and occupant feedback, which are displayed in various manners for visitors, building occupants, facility managers, and researchers. This paper focuseson the development of visualizations for facility managers, or an energy performance assurance role, where metered data are used to generate models that provide live predicted ranges of building performance by end use. These predicted ranges provide simple, visual context for displayed performance data without requiring users to also assess historical information or trends. Several energymodelling techniques were explored including static lookup-based performance targets, reduced-order models derived from historical data using main effect variables such as solar radiance for lighting performance, and integrated energy models using a whole-building energy simulation program.

  6. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  7. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  8. Image simulation and a model of noise power spectra across a range of mammographic beam qualities.

    Science.gov (United States)

    Mackenzie, Alistair; Dance, David R; Diaz, Oliver; Young, Kenneth C

    2014-12-01

    The aim of this work is to create a model to predict the noise power spectra (NPS) for a range of mammographic radiographic factors. The noise model was necessary to degrade images acquired on one system to match the image quality of different systems for a range of beam qualities. Five detectors and x-ray systems [Hologic Selenia (ASEh), Carestream computed radiography CR900 (CRc), GE Essential (CSI), Carestream NIP (NIPc), and Siemens Inspiration (ASEs)] were characterized for this study. The signal transfer property was measured as the pixel value against absorbed energy per unit area (E) at a reference beam quality of 28 kV, Mo/Mo or 29 kV, W/Rh with 45 mm polymethyl methacrylate (PMMA) at the tube head. The contributions of the three noise sources (electronic, quantum, and structure) to the NPS were calculated by fitting a quadratic at each spatial frequency of the NPS against E. A quantum noise correction factor which was dependent on beam quality was quantified using a set of images acquired over a range of radiographic factors with different thicknesses of PMMA. The noise model was tested for images acquired at 26 kV, Mo/Mo with 20 mm PMMA and 34 kV, Mo/Rh with 70 mm PMMA for three detectors (ASEh, CRc, and CSI) over a range of exposures. The NPS were modeled with and without the noise correction factor and compared with the measured NPS. A previous method for adapting an image to appear as if acquired on a different system was modified to allow the reference beam quality to be different from the beam quality of the image. The method was validated by adapting the ASEh flat field images with two thicknesses of PMMA (20 and 70 mm) to appear with the imaging characteristics of the CSI and CRc systems. The quantum noise correction factor rises with higher beam qualities, except for CR systems at high spatial frequencies, where a flat response was found against mean photon energy. This is due to the dominance of secondary quantum noise in CR. The use of the

  9. Image simulation and a model of noise power spectra across a range of mammographic beam qualities

    Energy Technology Data Exchange (ETDEWEB)

    Mackenzie, Alistair, E-mail: alistairmackenzie@nhs.net; Dance, David R.; Young, Kenneth C. [National Coordinating Centre for the Physics of Mammography, Royal Surrey County Hospital, Guildford GU2 7XX, United Kingdom and Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Diaz, Oliver [Centre for Vision, Speech and Signal Processing, Faculty of Engineering and Physical Sciences, University of Surrey, Guildford GU2 7XH, United Kingdom and Computer Vision and Robotics Research Institute, University of Girona, Girona 17071 (Spain)

    2014-12-15

    Purpose: The aim of this work is to create a model to predict the noise power spectra (NPS) for a range of mammographic radiographic factors. The noise model was necessary to degrade images acquired on one system to match the image quality of different systems for a range of beam qualities. Methods: Five detectors and x-ray systems [Hologic Selenia (ASEh), Carestream computed radiography CR900 (CRc), GE Essential (CSI), Carestream NIP (NIPc), and Siemens Inspiration (ASEs)] were characterized for this study. The signal transfer property was measured as the pixel value against absorbed energy per unit area (E) at a reference beam quality of 28 kV, Mo/Mo or 29 kV, W/Rh with 45 mm polymethyl methacrylate (PMMA) at the tube head. The contributions of the three noise sources (electronic, quantum, and structure) to the NPS were calculated by fitting a quadratic at each spatial frequency of the NPS against E. A quantum noise correction factor which was dependent on beam quality was quantified using a set of images acquired over a range of radiographic factors with different thicknesses of PMMA. The noise model was tested for images acquired at 26 kV, Mo/Mo with 20 mm PMMA and 34 kV, Mo/Rh with 70 mm PMMA for three detectors (ASEh, CRc, and CSI) over a range of exposures. The NPS were modeled with and without the noise correction factor and compared with the measured NPS. A previous method for adapting an image to appear as if acquired on a different system was modified to allow the reference beam quality to be different from the beam quality of the image. The method was validated by adapting the ASEh flat field images with two thicknesses of PMMA (20 and 70 mm) to appear with the imaging characteristics of the CSI and CRc systems. Results: The quantum noise correction factor rises with higher beam qualities, except for CR systems at high spatial frequencies, where a flat response was found against mean photon energy. This is due to the dominance of secondary quantum noise

  10. High-Resolution Mesoscale Model Setup for the Eastern Range and Wallops Flight Facility

    Science.gov (United States)

    Watson, Leela R.; Zavodsky, Bradley T.

    2015-01-01

    Mesoscale weather conditions can have an adverse effect on space launch, landing, ground processing, and weather advisories, watches, and warnings at the Eastern Range (ER) in Florida and Wallops Flight Facility (WFF) in Virginia. During summer, land-sea interactions across Kennedy Space Center (KSC) and Cape Canaveral Air Force Station (CCAFS) lead to sea breeze front formation, which can spawn deep convection that can hinder operations and endanger personnel and resources. Many other weak locally-driven low-level boundaries and their interactions with the sea breeze front and each other can also initiate deep convection in the KSC/CCAFS area. These convective processes often last 60 minutes or less and pose a significant challenge to the local forecasters. Surface winds during the transition seasons (spring and fall) pose the most difficulties for the forecasters at WFF. They also encounter problems forecasting convective activity and temperature during those seasons. Therefore, accurate mesoscale model forecasts are needed to better forecast a variety of unique weather phenomena. Global and national scale models cannot properly resolve important local-scale weather features at each location due to their horizontal resolutions being much too coarse. Therefore, a properly tuned local data assimilation (DA) and forecast model at a high resolution is needed to provide improved capability. To accomplish this, a number of sensitivity tests were performed using the Weather Research and Forecasting (WRF) model in order to determine the best DA/model configuration for operational use at each of the space launch ranges to best predict winds, precipitation, and temperature. A set of Perl scripts to run the Gridpoint Statistical Interpolation (GSI)/WRF in real-time were provided by NASA's Short-term Prediction Research and Transition Center (SPoRT). The GSI can analyze many types of observational data including satellite, radar, and conventional data. The GSI/WRF scripts

  11. Fermion condensation and non Fermi liquid behavior in a model with long range forces

    Energy Technology Data Exchange (ETDEWEB)

    Dukelsky, J. [Consejo Superior de Investigaciones Cientificas (CSIC), Madrid (Spain). Inst. de Estructura de la Materia; Khodel, V.A. [Gosudarstvennyj Komitet po Ispol`zovaniyu Atomnoj Ehnergii SSSR, Moscow (Russian Federation). Inst. Atomnoj Ehnergii; Schuck, P. [Grenoble-1 Univ., 38 (France). Inst. des Sciences Nucleaires; Shaginyan, V.R. [St. Petersburg Inst. of Nuclear Physics, Gatchina (Russian Federation)

    1997-02-01

    The phenomenon of the so called Fermion condensation, a phase transition analogous to Bose condensation but for Fermions, postulated in the past to occur in systems with strong momentum dependent forces, is reanalyzed in a model with infinite range interactions. The strongly non Fermi liquid behavior of this system is demonstrated analytically at T=0 and at T{ne}0 in the superconducting and normal phases. The validity of the quasiparticle picture is investigated and seen to hold true for temperatures less than the characteristic temperature T{sub f} of the Fermion condensation. (orig.) With 6 figs., 17 refs.

  12. Modeling Climate-Change Effects on Snake Range Extents for Military Land Management

    Science.gov (United States)

    2013-09-01

    34Factors Influencing Home-Range Sizes of Eastern Indigo Snakes in Central Florida." Journal of Herpetology 45.4 (2011): 484-490. Breininger, David... Herpetology 17.3, 256-264. Dyck, S. 1983, Overview on the present status of the concepts of water balance models, in: Van der Beken, A. and Herrmann, A...versus Unharvested Forest Stands." Journal or Herpetology 39.4, 619-626. Speake, D. W., and J. Diemer. 1983. “The Distribution of the Eastern Indigo

  13. Localization of networks with presence and distance constraints based on 1-hop and 2-hop mass–spring optimization

    Directory of Open Access Journals (Sweden)

    Gabriele Oliva

    2016-03-01

    Full Text Available In this paper we consider the localization of a sensor network where the nodes are heterogeneous, in that some of them are able to measure the distance from their neighbors, while some others are just able to detect their presence, and we provide a post-processing algorithm that can be used to improve an initial estimate for the location of the nodes, based on a mass–spring optimization approach, taking into account presence and distance information, as well as one-hop and two-hop information.

  14. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  15. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  16. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  17. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  18. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  19. Interaction Models for Common Long-Range Dependence in Asset Prices Volatility

    Science.gov (United States)

    Teyssière, G.

    We consider a class of microeconomic models with interacting agents which replicate the main properties of asset prices time series: non-linearities in levels and common degree of long-memory in the volatilities and co-volatilities of multivariate time series. For these models, long-range dependence in asset price volatility is the consequence of swings in opinions and herding behavior of market participants, which generate switches in the heteroskedastic structure of asset prices. Thus, the observed long-memory in asset prices volatility might be the outcome of a change-point in the conditional variance process, a conclusion supported by a wavelet anaysis of the volatility series. This explains why volatility processes share only the properties of the second moments of long-memory processes, but not the properties of the first moments.

  20. Nanoporous Anodic Alumina 3D FDTD Modelling for a Broad Range of Inter-pore Distances.

    Science.gov (United States)

    Bertó-Roselló, Francesc; Xifré-Pérez, Elisabet; Ferré-Borrull, Josep; Pallarès, Josep; Marsal, Lluis F

    2016-12-01

    The capability of the finite difference time domain (FDTD) method for the numerical modelling of the optical properties of nanoporous anodic alumina (NAA) in a broad range of inter-pore distances is evaluated. FDTD permits taking into account in the same numerical framework all the structural features of NAA, such as the texturization of the interfaces or the incorporation of electrolyte anions in the aluminium oxide host. The evaluation is carried out by comparing reflectance measurements from two samples with two very different inter-pore distances with the simulation results. Results show that considering the texturization is crucial to obtain good agreement with the measurements. On the other hand, including the anionic layer in the model leads to a second-order contribution to the reflectance spectrum.

  1. Dislocation model for aseismic fault slip in the transverse ranges of Southern California

    Science.gov (United States)

    Cheng, A.; Jackson, D. D.; Matsuura, M.

    1985-01-01

    Geodetic data at a plate boundary can reveal the pattern of subsurface displacements that accompany plate motion. These displacements are modelled as the sum of rigid block motion and the elastic effects of frictional interaction between blocks. The frictional interactions are represented by uniform dislocation on each of several rectangular fault patches. The block velocities and fault parameters are then estimated from geodetic data. Bayesian inversion procedure employs prior estimates based on geological and seismological data. The method is applied to the Transverse Ranges, using prior geological and seismological data and geodetic data from the USGS trilateration networks. Geodetic data imply a displacement rate of about 20 mm/yr across the San Andreas Fault, while the geologic estimates exceed 30 mm/yr. The prior model and the final estimates both imply about 10 mm/yr crustal shortening normal to the trend of the San Andreas Fault. Aseismic fault motion is a major contributor to plate motion. The geodetic data can help to identify faults that are suffering rapid stress accumulation; in the Transverse Ranges those faults are the San Andreas and the Santa Susana.

  2. Modelling the evolution of solar-mass stars with a range of metallicities using MESA

    Directory of Open Access Journals (Sweden)

    Jones E.F.

    2015-01-01

    Full Text Available The nuclides 1,2H, 3,4He, 7Li, 7Be, 8B, 12,13C, 13-15N, 14-18O, 17-19F, 18-22Ne, 22Mg, and 24Mg were used in the code package MESA (Modules for Experiments in Stellar Astrophysics[Paxton] to model a one-solar-mass star with a range of metallicities, z, from 0 to 0.1. On HR diagrams of each star model’s luminosity and effective temperature from before zero-age main sequence (pre-ZAMS to white dwarf, oscillations were noted in the horizontal branch at intervals from z = 0 to 0.0070. At z, = 0, the calculated stellar lifetime is 6.09x109 years. The calculated lifetime of the model stars increases to a maximum of 1.25x1010 years at z = 0.022 and then decreases to 2.59x109 years at z = 0.1. A piecewise fit of the model lifetimes vs. metallicity was obtained.

  3. A lithium-ion capacitor model working on a wide temperature range

    Science.gov (United States)

    Barcellona, S.; Piegari, L.

    2017-02-01

    Energy storage systems are spreading both in stationary and transport applications. Among innovative storage devices, lithium ion capacitors (LiCs) are very interesting. They combine the advantages of both traditional electric double layer capacitors (EDLCs) and lithium ion batteries (LiBs). The behavior of this device is much more similar to ELDCs than to batteries. For this reason, several models developed for traditional ELDCs were extended to LiCs. Anyway, at low temperatures LiCs behavior is quite different from ELDCs and it is more similar to a LiB. Consequently, EDLC models works fine at room temperature but give worse results at low temperatures. This paper proposes a new electric model that, overcoming this issue, is a valid solution in a wide temperature range. Based on only five parameters, depending on polarization voltage and temperature, the proposed model is very simple to be implemented. Its accuracy is verified through experimental tests. From the reported results, it is also shown that, at very low temperatures, the dependence of the resistance from the current has to be taken into account.

  4. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  5. Interference-based routing in multi-hop wireless infrastructures

    NARCIS (Netherlands)

    Heijenk, Geert; Liu, F.; Braun, Torsten; Carle, Georg; Koucheryavy, Yevgeni; Tsaoussidis, Vassilis

    In this paper, multi-hop wireless infrastructures are identified as a way to increase user data rates and/or capacity of wireless systems by means of a high base station density without high base station interconnection costs. For such a system, a new routing algorithm, named Balanced Interference

  6. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  7. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed c...

  8. Potential African Substitutes for Hops in Tropical Beer Brewing

    African Journals Online (AJOL)

    1' Department of Food Science and Nutrition, E.N.S.A.I.. P. O. Box. 455, University ofNgaoundere, Cameroon. 2' Department of Food Technology, Faculty of Technology, University of Ibadan, Nigeria. "Corresponding author. Abstract. The potential ... Industry (Hough er dl., 1982, Grant,. 1977). Hops contribute to foam stability.

  9. Molecular mechanisms of Tetranychus urticae chemical adaptation in hop fields.

    Science.gov (United States)

    Piraneo, Tara G; Bull, Jon; Morales, Mariany A; Lavine, Laura C; Walsh, Douglas B; Zhu, Fang

    2015-12-01

    The two-spotted spider mite, Tetranychus urticae Koch is a major pest that feeds on >1,100 plant species. Many perennial crops including hop (Humulus lupulus) are routinely plagued by T. urticae infestations. Hop is a specialty crop in Pacific Northwest states, where 99% of all U.S. hops are produced. To suppress T. urticae, growers often apply various acaricides. Unfortunately T. urticae has been documented to quickly develop resistance to these acaricides which directly cause control failures. Here, we investigated resistance ratios and distribution of multiple resistance-associated mutations in field collected T. urticae samples compared with a susceptible population. Our research revealed that a mutation in the cytochrome b gene (G126S) in 35% tested T. urticae populations and a mutation in the voltage-gated sodium channel gene (F1538I) in 66.7% populations may contribute resistance to bifenazate and bifenthrin, respectively. No mutations were detected in Glutamate-gated chloride channel subunits tested, suggesting target site insensitivity may not be important in our hop T. urticae resistance to abamectin. However, P450-mediated detoxification was observed and is a putative mechanism for abamectin resistance. Molecular mechanisms of T. urticae chemical adaptation in hopyards is imperative new information that will help growers develop effective and sustainable management strategies.

  10. Interference-based routing in multi-hop wireless infrastructures

    NARCIS (Netherlands)

    Heijenk, Geert; Liu, F.; Braun, T.; Carle, G.; Koucheryavy, Y.; Tsaoussidis, V.

    In this paper, multi-hop wireless infrastructures are identified as a way to increase user data rates and/or capacity of wireless systems by means of a high base station density without high base station interconnection costs. For such a system, a new routing algorithm, named balanced interference

  11. Hopping in a supercooled binary Lennard-Jones liquid

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, Jeppe

    1998-01-01

    A binary Lennard–Jones liquid has been investigated by molecular dynamics at equilibrium supercooled conditions. At the lowest temperature investigated, hopping is present in the system as indicated by a secondary peak in 4r2Gs(r,t), where Gs(r,t) is the van Hove self correlation function...

  12. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  13. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  14. Multiple-hopping trajectories near a rotating asteroid

    Science.gov (United States)

    Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian

    2017-03-01

    We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.

  15. Analysis of mode-hopping effect in Fabry–Pérot multiple-quantum well laser diodes via low frequency noise investigation

    DEFF Research Database (Denmark)

    Pralgauskaitė, Sandra; Palenskis, Vilius; Matukas, Jonas

    2013-01-01

    Comprehensive investigation of noise characteristics and radiation spectrum with special attention to the mode-hopping effect of Fabry–Pérot (FP) multiple quantum well laser diodes (LDs) have been carried out: laser radiation spectra, optical and electrical fluctuations and cross-correlation factor...... fluctuations are observed. Characteristic time of physical processes that take part in LD structure during mode-hopping is ranged from microseconds to milliseconds. These processes are caused by the carrier generation and recombination in the centers formed by the defects in barrier layer (in the active region)....

  16. Evaluation of long-range transport models in NOVANA; Evaluering af langtransportmodeller i NOVANA

    Energy Technology Data Exchange (ETDEWEB)

    Frohn, L.M.; Brandt, J.; Christensen, J.H.; Geels, C.; Hertel, O.; Skjoeth, C.A.; Ellemann, T.

    2007-06-15

    obtained with ACDEP for 11 out of 16 chemical parameters. In general the performance of the DEHM model is at least as good as the performance of the ACDEP model, and for the majority of the chemical parameters the performance of DEHM is better than the performance of ACDEP when model results are compared to measurements. This result is expected since the description of the long-range transport of air pollution, which contributes significantly to the concentration levels in Denmark, is better in DEHM. (BA)

  17. Higher measured than modeled ozone production at increased NOx levels in the Colorado Front Range

    Science.gov (United States)

    Baier, Bianca C.; Brune, William H.; Miller, David O.; Blake, Donald; Long, Russell; Wisthaler, Armin; Cantrell, Christopher; Fried, Alan; Heikes, Brian; Brown, Steven; McDuffie, Erin; Flocke, Frank; Apel, Eric; Kaser, Lisa; Weinheimer, Andrew

    2017-09-01

    Chemical models must correctly calculate the ozone formation rate, P(O3), to accurately predict ozone levels and to test mitigation strategies. However, air quality models can have large uncertainties in P(O3) calculations, which can create uncertainties in ozone forecasts, especially during the summertime when P(O3) is high. One way to test mechanisms is to compare modeled P(O3) to direct measurements. During summer 2014, the Measurement of Ozone Production Sensor (MOPS) directly measured net P(O3) in Golden, CO, approximately 25 km west of Denver along the Colorado Front Range. Net P(O3) was compared to rates calculated by a photochemical box model that was constrained by measurements of other chemical species and that used a lumped chemical mechanism and a more explicit one. Median observed P(O3) was up to a factor of 2 higher than that modeled during early morning hours when nitric oxide (NO) levels were high and was similar to modeled P(O3) for the rest of the day. While all interferences and offsets in this new method are not fully understood, simulations of these possible uncertainties cannot explain the observed P(O3) behavior. Modeled and measured P(O3) and peroxy radical (HO2 and RO2) discrepancies observed here are similar to those presented in prior studies. While a missing atmospheric organic peroxy radical source from volatile organic compounds co-emitted with NO could be one plausible solution to the P(O3) discrepancy, such a source has not been identified and does not fully explain the peroxy radical model-data mismatch. If the MOPS accurately depicts atmospheric P(O3), then these results would imply that P(O3) in Golden, CO, would be NOx-sensitive for more of the day than what is calculated by models, extending the NOx-sensitive P(O3) regime from the afternoon further into the morning. These results could affect ozone reduction strategies for the region surrounding Golden and possibly other areas that do not comply with national ozone regulations

  18. Thermally driven hopping and electron transport in amorphous materials from density functional calculations

    Energy Technology Data Exchange (ETDEWEB)

    Abtew, Tesfaye A; Drabold, D A [Department of Physics and Astronomy, Ohio University, Athens, OH 45701-2979 (United States)

    2004-11-10

    In this paper we study electron dynamics and transport in models of amorphous silicon and amorphous silicon hydride. By integrating the time-dependent Kohn-Sham equation, we compute the time evolution of electron states near the gap, and study the spatial and spectral diffusion of these states due to lattice motion. We perform these calculations with a view to developing ab initio hopping transport methods. The techniques are implemented with the ab initio local basis code SIESTA, and may be applicable to molecular, biomolecular and other condensed matter systems.

  19. Exact dynamical state of the exclusive queueing process with deterministic hopping.

    Science.gov (United States)

    Arita, Chikashi; Schadschneider, Andreas

    2011-11-01

    The exclusive queueing process (EQP) has recently been introduced as a model for the dynamics of queues that takes into account the spatial structure of the queue. It can be interpreted as a totally asymmetric exclusion process of varying length. Here we investigate the case of deterministic bulk hopping p=1 that turns out to be one of the rare cases where exact nontrivial results for the dynamical properties can be obtained. Using a time-dependent matrix product form we calculate several dynamical properties, e.g., the density profile of the system.

  20. Rat tibial osteotomy model providing a range of normal to impaired healing.

    Science.gov (United States)

    Miles, Joan D; Weinhold, Paul; Brimmo, Olubusola; Dahners, Laurence

    2011-01-01

    The purpose of this study was to develop an inexpensive and easily implemented rat tibial osteotomy model capable of producing a range of healing outcomes. A saw blade was used to create a transverse osteotomy of the tibia in 89 Sprague-Dawley rats. A 0.89 mm diameter stainless steel wire was then inserted as an intramedullary nail to stabilize the fracture. To impair healing, 1, 2, or 3 mm cylindrical polyetheretherketone (PEEK) spacer beads were threaded onto the wires, between the bone ends. Fracture healing was evaluated radiographically, biomechanically, and histologically at 5 weeks. Means were compared for statistical differences by one-way ANOVA and Holm-Sidak multiple comparison testing. The mean number of "cortices bridged" for the no spacer group was 3.4 (SD ± 0.8), which was significantly greater than in the 1 mm (2.3 ± 1.4), 2 mm (0.8 ± 0.7), and 3 mm (0.3 ± 0.4) groups (p < 0.003). Biomechanical results correlated with radiographic findings, with an ultimate torque of 172 ± 53, 137 ± 41, 90 ± 38, and 24 ± 23 N/mm with a 0, 1, 2, or 3 mm defect, respectively. In conclusion, we have demonstrated that this inexpensive, technically straightforward model can be used to create a range of outcomes from normal healing to impaired healing, to nonunions. This model may be useful for testing new therapeutic strategies to promote fracture healing, materials thought to be able to heal critical-sized defects, or evaluating agents suspected of impairing healing. Copyright © 2010 Orthopaedic Research Society.

  1. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  2. The effect of different values of inter-strand hopping on the current and transmission probability of an aperiodic DNA molecule

    Science.gov (United States)

    Apriyanti, L.; Yudiarsah, E.

    2017-07-01

    The effect of different values of inter-strand hopping on the current and transmission probability of an aperiodic DNA molecule has been studied. This research used double strands model of 32 base pairs long ATGC DNA (Adenine, Thymine, Guanine, Cytosine) that was arranged randomly. By changing the beta values on inter-strand hopping. By changing the beta values of inter-strand hopping, current and transmission probability was calculated by using the transfer matrix method. The beta value is involved in the tight-binding Hamiltonian model of the molecule. The result of calculation showed that at temperature 4.2 K at frequency 2 meV and 4 meV, current decreases as the beta values increases. Likewise, at the same temperature and frequency, the transmission probability decreases with the increment of beta values.

  3. Higher measured than modeled ozone production at increased NOx levels in the Colorado Front Range

    Directory of Open Access Journals (Sweden)

    B. C. Baier

    2017-09-01

    Full Text Available Chemical models must correctly calculate the ozone formation rate, P(O3, to accurately predict ozone levels and to test mitigation strategies. However, air quality models can have large uncertainties in P(O3 calculations, which can create uncertainties in ozone forecasts, especially during the summertime when P(O3 is high. One way to test mechanisms is to compare modeled P(O3 to direct measurements. During summer 2014, the Measurement of Ozone Production Sensor (MOPS directly measured net P(O3 in Golden, CO, approximately 25 km west of Denver along the Colorado Front Range. Net P(O3 was compared to rates calculated by a photochemical box model that was constrained by measurements of other chemical species and that used a lumped chemical mechanism and a more explicit one. Median observed P(O3 was up to a factor of 2 higher than that modeled during early morning hours when nitric oxide (NO levels were high and was similar to modeled P(O3 for the rest of the day. While all interferences and offsets in this new method are not fully understood, simulations of these possible uncertainties cannot explain the observed P(O3 behavior. Modeled and measured P(O3 and peroxy radical (HO2 and RO2 discrepancies observed here are similar to those presented in prior studies. While a missing atmospheric organic peroxy radical source from volatile organic compounds co-emitted with NO could be one plausible solution to the P(O3 discrepancy, such a source has not been identified and does not fully explain the peroxy radical model–data mismatch. If the MOPS accurately depicts atmospheric P(O3, then these results would imply that P(O3 in Golden, CO, would be NOx-sensitive for more of the day than what is calculated by models, extending the NOx-sensitive P(O3 regime from the afternoon further into the morning. These results could affect ozone reduction strategies for the region surrounding Golden and possibly other areas that do not comply with national ozone

  4. ANOMALOUS CO{sub 2} ICE TOWARD HOPS-68: A TRACER OF PROTOSTELLAR FEEDBACK

    Energy Technology Data Exchange (ETDEWEB)

    Poteet, Charles A.; Megeath, S. Thomas; Bjorkman, Jon E. [Department of Physics and Astronomy, The University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606 (United States); Pontoppidan, Klaus M. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Watson, Dan M.; Sheehan, Patrick D. [Department of Physics and Astronomy, University of Rochester, Rochester, NY 14627 (United States); Isokoski, Karoliina; Linnartz, Harold, E-mail: charles.poteet@gmail.com [Sackler Laboratory for Astrophysics, Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands)

    2013-04-01

    We report the detection of a unique CO{sub 2} ice band toward the deeply embedded, low-mass protostar HOPS-68. Our spectrum, obtained with the Infrared Spectrograph on board the Spitzer Space Telescope, reveals a 15.2 {mu}m CO{sub 2} ice bending mode profile that cannot be modeled with the same ice structure typically found toward other protostars. We develop a modified CO{sub 2} ice profile decomposition, including the addition of new high-quality laboratory spectra of pure, crystalline CO{sub 2} ice. Using this model, we find that 87%-92% of the CO{sub 2} is sequestered as spherical, CO{sub 2}-rich mantles, while typical interstellar ices show evidence of irregularly shaped, hydrogen-rich mantles. We propose that (1) the nearly complete absence of unprocessed ices along the line of sight is due to the flattened envelope structure of HOPS-68, which lacks cold absorbing material in its outer envelope, and possesses an extreme concentration of material within its inner (10 AU) envelope region and (2) an energetic event led to the evaporation of inner envelope ices, followed by cooling and re-condensation, explaining the sequestration of spherical, CO{sub 2} ice mantles in a hydrogen-poor mixture. The mechanism responsible for the sublimation could be either a transient accretion event or shocks in the interaction region between the protostellar outflow and envelope. The proposed scenario is consistent with the rarity of the observed CO{sub 2} ice profile, the formation of nearly pure CO{sub 2} ice, and the production of spherical ice mantles. HOPS-68 may therefore provide a unique window into the protostellar feedback process, as outflows and heating shape the physical and chemical structure of protostellar envelopes and molecular clouds.

  5. Assessing extreme models of the Stoeber synthesis using transients under a range of initial composition

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K.; McCormick, A.V. [Univ. of Minnesota, Minneapolis, MN (United States); Look, J.L. [Oak Ridge National Lab., TN (United States); Harris, M.T. [Univ. of Maryland, College Park, MD (United States). Dept. of Chemical Engineering

    1997-10-01

    Monodispersely sized micrometer-scale spherical colloids of metal oxides are important for the controlled fabrication of high quality ceramic materials. Their synthesis by the hydrolysis of metal alkoxides is of particular interest. {sup 29}Si-NMR, conductimetry, and photon correlation spectroscopy are used to monitor the temporal profile of intermediate concentrations in Stoeber synthesis (i.e., ammonia-catalyzed hydrolysis of tetraethoxysilane in a batch reactor). Extreme models of the process are assessed by examining the effect of initial composition on these transients (over a wider range of composition than attempted previously). The trends with initial composition suggest that the nucleation is rate-limited by the hydrolysis of the singly hydrolyzed monomer, the product of which probably phase separates. Moreover, the trends are consistent with the aggregation model discussed by G.H. Bogush and C.F. Zukoski (J. Colloid Interface Sci. 142, 1, 19, 1991) and by M.T. Harris (Ph.D. dissertation, Univ. of Tennessee, 1992). The trends are not consistent with a growth model without aggregation.

  6. [Comparison between the Range of Movement Canine Real Cervical Spine and Numerical Simulation - Computer Model Validation].

    Science.gov (United States)

    Srnec, R; Horák, Z; Sedláček, R; Sedlinská, M; Krbec, M; Nečas, A

    2017-01-01

    PURPOSE OF THE STUDY In developing new or modifying the existing surgical treatment methods of spine conditions an integral part of ex vivo experiments is the assessment of mechanical, kinematic and dynamic properties of created constructions. The aim of the study is to create an appropriately validated numerical model of canine cervical spine in order to obtain a tool for basic research to be applied in cervical spine surgeries. For this purpose, canine is a suitable model due to the occurrence of similar cervical spine conditions in some breeds of dogs and in humans. The obtained model can also be used in research and in clinical veterinary practice. MATERIAL AND METHODS In order to create a 3D spine model, the LightSpeed 16 (GE, Milwaukee, USA) multidetector computed tomography was used to scan the cervical spine of Doberman Pinscher. The data were transmitted to Mimics 12 software (Materialise HQ, Belgium), in which the individual vertebrae were segmented on CT scans by thresholding. The vertebral geometry was exported to Rhinoceros software (McNeel North America, USA) for modelling, and subsequently the specialised software Abaqus (Dassault Systemes, France) was used to analyse the response of the physiological spine model to external load by the finite element method (FEM). All the FEM based numerical simulations were considered as nonlinear contact statistic tasks. In FEM analyses, angles between individual spinal segments were monitored in dependence on ventroflexion/ /dorziflexion. The data were validated using the latero-lateral radiographs of cervical spine of large breed dogs with no evident clinical signs of cervical spine conditions. The radiographs within the cervical spine range of motion were taken at three different positions: in neutral position, in maximal ventroflexion and in maximal dorziflexion. On X-rays, vertebral inclination angles in monitored spine positions were measured and compared with the results obtain0ed from FEM analyses of the

  7. Close-range geophotogrammetric mapping of trench walls using multi-model stereo restitution software

    Energy Technology Data Exchange (ETDEWEB)

    Coe, J.A.; Taylor, E.M.; Schilling, S.P.

    1991-06-01

    Methods for mapping geologic features exposed on trench walls have advanced from conventional gridding and sketch mapping to precise close-range photogrammetric mapping. In our study, two strips of small-format (60 {times} 60) stereo pairs, each containing 42 photos and covering approximately 60 m of nearly vertical trench wall (2-4 m high), were contact printed onto eight 205 {times} 255-mm transparent film sheets. Each strip was oriented in a Kern DSR15 analytical plotter using the bundle adjustment module of Multi-Model Stereo Restitution Software (MMSRS). We experimented with several systematic-control-point configurations to evaluate orientation accuracies as a function of the number and position of control points. We recommend establishing control-point columns (each containing 2-3 points) in every 5th photo to achieve the 7-mm Root Mean Square Error (RMSE) accuracy required by our trench-mapping project. 7 refs., 8 figs., 1 tab.

  8. A Simple Experimental Model to Investigate Force Range for Membrane Nanotube Formation

    CERN Document Server

    Lor, Chai; Mattson-Hoss, Michelle K; Xu, Jing; Hirst, Linda S

    2016-01-01

    The presence of membrane tubules in living cells is essential to many biological processes. In cells, one mechanism to form nanosized lipid tubules is via molecular motor induced bilayer extraction. In this paper, we describe a simple experimental model to investigate the forces required for lipid tube formation using kinesin motors anchored to DOPC vesicles. Previous related studies have used molecular motors actively pulling on the membrane to extract a nanotube. Here, we invert the system geometry; molecular motors are used as static anchors linking DOPC vesicles to a two-dimensional microtubule network and an external flow is introduced to generate nanotubes facilitated by the drag force. We found that a drag force of ~7 pN was sufficient for tubule extraction for vesicles ranging from 1 to 2 um in radius. By our method, we found that the force generated by a single molecular motor was sufficient for membrane tubule extraction from a spherical lipid vesicle.

  9. Prospects for bioenergy use in Ghana using Long-range Energy Alternatives Planning model

    DEFF Research Database (Denmark)

    Kemausuor, Francis; Nygaard, Ivan; Mackenzie, Gordon A.

    2015-01-01

    that introducing bioenergy to the energy mix could reduce GHG (greenhouse gas) emissions by about 6 million tonnes CO2e by 2030, equivalent to a 14% reduction in a business-as-usual scenario. This paper advocates the use of second generation ethanol for transport, to the extent that it is economically exploitable......As Ghana's economy grows, the choice of future energy paths and policies in the coming years will have a significant influence on its energy security. A Renewable Energy Act approved in 2011 seeks to encourage the influx of renewable energy sources in Ghana's energy mix. The new legal framework...... biomass sources, through the production of biogas, liquid biofuels and electricity. Analysis was based on moderate and high use of bioenergy for transportation, electricity generation and residential fuel using the LEAP (Long-range Energy Alternatives Planning) model. Results obtained indicate...

  10. Immunomodulation by the Pseudomonas syringae HopZ type III effector family in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jennifer D Lewis

    Full Text Available Pseudomonas syringae employs a type III secretion system to inject 20-30 different type III effector (T3SE proteins into plant host cells. A major role of T3SEs is to suppress plant immune responses and promote bacterial infection. The YopJ/HopZ acetyltransferases are a superfamily of T3SEs found in both plant and animal pathogenic bacteria. In P. syringae, this superfamily includes the evolutionarily diverse HopZ1, HopZ2 and HopZ3 alleles. To investigate the roles of the HopZ family in immunomodulation, we generated dexamethasone-inducible T3SE transgenic lines of Arabidopsis for HopZ family members and characterized them for immune suppression phenotypes. We show that all of the HopZ family members can actively suppress various facets of Arabidopsis immunity in a catalytic residue-dependent manner. HopZ family members can differentially suppress the activation of mitogen-activated protein (MAP kinase cascades or the production of reactive oxygen species, whereas all members can promote the growth of non-virulent P. syringae. Localization studies show that four of the HopZ family members containing predicted myristoylation sites are localized to the vicinity of the plasma membrane while HopZ3 which lacks the myristoylation site is at least partially nuclear localized, suggesting diversification of immunosuppressive mechanisms. Overall, we demonstrate that despite significant evolutionary diversification, all HopZ family members can suppress immunity in Arabidopsis.

  11. Griffiths phase and long-range correlations in a biologically motivated visual cortex model

    Science.gov (United States)

    Girardi-Schappo, M.; Bortolotto, G. S.; Gonsalves, J. J.; Pinto, L. T.; Tragtenberg, M. H. R.

    2016-07-01

    Activity in the brain propagates as waves of firing neurons, namely avalanches. These waves’ size and duration distributions have been experimentally shown to display a stable power-law profile, long-range correlations and 1/f b power spectrum in vivo and in vitro. We study an avalanching biologically motivated model of mammals visual cortex and find an extended critical-like region - a Griffiths phase - characterized by divergent susceptibility and zero order parameter. This phase lies close to the expected experimental value of the excitatory postsynaptic potential in the cortex suggesting that critical be-havior may be found in the visual system. Avalanches are not perfectly power-law distributed, but it is possible to collapse the distributions and define a cutoff avalanche size that diverges as the network size is increased inside the critical region. The avalanches present long-range correlations and 1/f b power spectrum, matching experiments. The phase transition is analytically determined by a mean-field approximation.

  12. HopX1 in Erwinia amylovora functions as an avirulence protein in apple and is regulated by HrpL.

    Science.gov (United States)

    Bocsanczy, A M; Schneider, D J; DeClerck, G A; Cartinhour, S; Beer, S V

    2012-02-01

    Fire blight is a devastating disease of rosaceous plants caused by the Gram-negative bacterium Erwinia amylovora. This pathogen delivers virulence proteins into host cells utilizing the type III secretion system (T3SS). Expression of the T3SS and of translocated and secreted substrates is activated by the alternative sigma factor HrpL, which recognizes hrp box promoters upstream of regulated genes. A collection of hidden Markov model (HMM) profiles was used to identify putative hrp boxes in the genome sequence of Ea273, a highly virulent strain of E. amylovora. Among potential virulence factors preceded by putative hrp boxes, two genes previously known as Eop3 and Eop2 were characterized. The presence of functionally active hrp boxes upstream of these two genes was confirmed by β-glucuronidase (GUS) assays. Deletion mutants of the latter candidate genes, renamed hopX1(Ea) and hopAK1(Ea), respectively, did not differ in virulence from the wild-type strain when assayed in pear fruit and apple shoots. The hopX1(Ea) deletion mutant of Ea273, complemented with a plasmid overexpressing hopX1(E)(a), suppressed the development of the hypersensitivity response (HR) when inoculated into Nicotiana benthamiana; however, it contributed to HR in Nicotiana tabacum and significantly reduced the progress of disease in apple shoots, suggesting that HopX1(Ea) may act as an avirulence protein in apple shoots.

  13. Learning from local knowledge: modeling the pastoral-nomadic range management of the Himba, Namibia.

    Science.gov (United States)

    Müller, Birgit; Linstädter, Anja; Frank, Karin; Bollig, Michael; Wissel, Christian

    2007-10-01

    It is widely accepted that successful grazing management strategies in semiarid ecosystems need to be adapted to the highly temporal and spatially heterogeneous forage production. Nevertheless, a full understanding of the key factors and processes for sustainable adaptive management has yet to be reached. The investigation of existing, successful range management systems by simulation models may help to derive general understanding and basic principles. The semi-nomadic Himba in northern Namibia applied a sophisticated management system until the mid-1990s which combined season-dependent pasture use (resulting in rainy-season pastures and dry-season pastures), preservation of reserves for drought and sanctions for rule breaking. A stochastic ecological simulation model has been developed here which represents the main aspects of this management system. With this model we analyze (1) which components of the traditional Himba strategy are essential for sustainability and (2) what happens to the state of the rangeland system under socioeconomic changes. This study shows that temporally and spatially heterogeneous pasture use yields higher productivity and quality of a pasture area than the pressure of homogeneous permanent grazing. Two aspects are of importance: (1) intra-annual heterogeneous use (resting of the dry-season pastures during the rainy season) and (2) interannual heterogeneous use (spatial extension of grazing in years of drought). This management system leads to an effective build-up and use of a buffer in the system: the reserve biomass (the non-photosynthetic reserve organs of the plants), an indicator for grazing and management history. Analyzing purchase as one form of socioeconomic change, we demonstrate that easier market access to purchase livestock may lead to a decline in vegetation quality. However, cattle production increases as long as rest periods on parts of the pasture during the rainy season are granted. Methodologically, we emphasize

  14. TRM4: Range performance model for electro-optical imaging systems

    Science.gov (United States)

    Keßler, Stefan; Gal, Raanan; Wittenstein, Wolfgang

    2017-05-01

    TRM4 is a commonly used model for assessing device and range performance of electro-optical imagers. The latest version, TRM4.v2, has been released by Fraunhofer IOSB of Germany in June 2016. While its predecessor, TRM3, was developed for thermal imagers, assuming blackbody targets and backgrounds, TRM4 extends the TRM approach to assess three imager categories: imagers that exploit emitted radiation (TRM4 category Thermal), reflected radiation (TRM4 category Visible/NIR/SWIR), and both emitted and reflected radiation (TRM4 category General). Performance assessment in TRM3 and TRM4 is based on the perception of standard four-bar test patterns, whether distorted by under-sampling or not. Spatial and sampling characteristics are taken into account by the Average Modulation at Optimum Phase (AMOP), which replaces the system MTF used in previous models. The Minimum Temperature Difference Perceived (MTDP) figure of merit was introduced in TRM3 for assessing the range performance of thermal imagers. In TRM4, this concept is generalized to the MDSP (Minimum Difference Signal Perceived), which can be applied to all imager categories. In this paper, we outline and discuss the TRM approach and pinpoint differences between TRM4 and TRM3. In addition, an overview of the TRM4 software and its functionality is given. Features newly introduced in TRM4, such as atmospheric turbulence, irradiation sources, and libraries are addressed. We conclude with an outlook on future work and the new module for intensified CCD cameras that is currently under development

  15. Consequences of environmental and biological variances for range margins: a spatially explicit theoretical model

    Science.gov (United States)

    Malanson, G. P.; DeRose, R. J.; Bekker, M. F.

    2016-12-01

    The consequences of increasing climatic variance while including variability among individuals and populations are explored for range margins of species with a spatially explicit simulation. The model has a single environmental gradient and a single species then extended to two species. Species response to the environment is a Gaussian function with a peak of 1.0 at their peak fitness on the gradient. The variance in the environment is taken from the total variance in the tree ring series of 399 individuals of Pinus edulis in FIA plots in the western USA. The variability is increased by a multiplier of the standard deviation for various doubling times. The variance of individuals in the simulation is drawn from these same series. Inheritance of individual variability is based on the geographic locations of the individuals. The variance for P. edulis is recomputed as time-dependent conditional standard deviations using the GARCH procedure. Establishment and mortality are simulated in a Monte Carlo process with individual variance. Variance for P. edulis does not show a consistent pattern of heteroscedasticity. An obvious result is that increasing variance has deleterious effects on species persistence because extreme events that result in extinctions cannot be balanced by positive anomalies, but even less extreme negative events cannot be balanced by positive anomalies because of biological and spatial constraints. In the two species model the superior competitor is more affected by increasing climatic variance because its response function is steeper at the point of intersection with the other species and so the uncompensated effects of negative anomalies are greater for it. These theoretical results can guide the anticipated need to mitigate the effects of increasing climatic variability on P. edulis range margins. The trailing edge, here subject to increasing drought stress with increasing temperatures, will be more affected by negative anomalies.

  16. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  17. A wide-range model for simulation of pump-probe experiments with metals

    Energy Technology Data Exchange (ETDEWEB)

    Povarnitsyn, Mikhail E., E-mail: povar@ihed.ras.ru [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Andreev, Nikolay E. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Moscow Institute of Physics and Technology (State University), Institutsky lane 9, Dolgoprudny, Moscow region, 141700 (Russian Federation); Apfelbaum, Eugeny M. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Itina, Tatiana E. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Laboratoire Hubert Curien, UMR CNRS 5516, 18 rue Benoit Lauras, Bat. F, 42000, St-Etienne (France); Khishchenko, Konstatntin V. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Moscow Institute of Physics and Technology (State University), Institutsky lane 9, Dolgoprudny, Moscow region, 141700 (Russian Federation); Kostenko, Oleg F. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Levashov, Pavel R. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Moscow Institute of Physics and Technology (State University), Institutsky lane 9, Dolgoprudny, Moscow region, 141700 (Russian Federation); Veysman, Mikhail E. [Joint Institute for High Temperatures RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation)

    2012-09-15

    Highlights: Black-Right-Pointing-Pointer Pump-probe experiments provide an integral test of the models in the theoretically difficult regime of warm dense matter. Black-Right-Pointing-Pointer The target material motion is evident for heating by femtosecond pulses of intensity more than 10{sup 14} W/cm{sup 2}. Black-Right-Pointing-Pointer Phase shift of S and P-polarized pulses is different because of separated zones of absorption. Black-Right-Pointing-Pointer Uncertainty in the pulse energy determination of {approx}10% gives substantial deflection of the theoretical curves. Black-Right-Pointing-Pointer The surface target oxide films may result in bigger phase shift in experiment. - Abstract: High precision pump-probe experiments can provide a valuable information about material states out of equilibrium. A wide-range numerical model is used for the description of material response on ultrashort laser action. The model is developed on the basis of two-temperature hydrodynamics with heat transport, ionization, plasma expansion, electron-ion collisions and two-temperature equation of state for an irradiated substance. Comparison of experimental findings with the results of simulation is used both for the numerical model verification and for calculation of plasma thermodynamic parameters that cannot be measured directly in experiment. An aluminum target is heated by an intense 400 nm (2{omega}) pump laser pulse that is incident normal to the planar target. Weak S- and P-polarized probe pulses with wavelength 800 nm (1{omega}) are used for diagnostics of the plasma. Both probe pulses illuminate the target at a 45 Degree-Sign angle. Calculation of the reflectivity and phase shift of probe pulses with both polarizations are in good agreement with experiment.

  18. Information structure in Wichí: focus marker hop

    Directory of Open Access Journals (Sweden)

    Ekaterina Levina

    2013-12-01

    Full Text Available Abstract: The present paper provides an overview of the functions of the morphological focus marker hop in the grammar of Wichí, a Mataco-Mataguayan language spoken in the North of Argentina and the South of Bolivia. Basing the analysis on the corpus which I have compiled from the existing research which has been published on the language so far, we can conclude that the focus marker hop can but does not have to be used for the focusing of the subject, object, predicate, adverbial as well as on entire dependent clauses in the language. The focus marker hop can express both the informational focus as well as the contrastive focus. In the case of predicate focusing the verum-focus can also be marked and the focus marker can scope over the complex predicate. Key words: Wichí; Languages of America; Information structure; Focus marker.  Resumo: O presente artigo fornece uma visão geral das funções do marcador morfológico hop na gramática de Wichí, uma linguagem Mataco-Mataguayan falada no norte da Argentina e no sul da Bolívia. Com base na análise do corpus que compilamos a partir das pesquisas existentes e publicadas sobre a língua até agora, podemos concluir que o marcador de foco hop pode, mas não tem que, necessariamente, ser usado para o foco no sujeito, objeto, predicado, advérbio, bem como nas cláusulas inteiramente dependentes na língua. O marcador de foco hop pode expressar tanto o foco informacional quanto o foco contrastante. No caso do predicado com foco no verum-foco, também pode ser marcado e o marcador de foco sobre o predicado complexo pode se estender. Palavras-chave: Wichí; idiomas da América; estrutura de informação; marcador de foco.  Resumen: El articulo presentado ofrece una descripción general de las funciones del marcador morfológico de foco hop en la gramática de la lengua Wichí, hablada en el Norte de Argentina y el Sur de Bolivia. El presente análisis hecho a base del corpus formado de

  19. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  20. Solar Flash Sub-Millimeter Wave Range Spectrum Part Radiation Modeling

    Directory of Open Access Journals (Sweden)

    V. Yu. Shustikov

    2015-01-01

    Full Text Available Currently, solar flares are under observation on the RT-7.5 radio telescope of BMSTU. This telescope operates in a little-studied range of the spectrum, at wavelengths of 3.2 and 2.2 mm (93 and 140 GHz, thereby providing unique information about parameters of the chromosphere plasma and zone of the temperature minimum. Observations on various instruments provided relatively small amount of data on the radio emission flare at frequencies close to 93 GHz, and at frequency of 140 GHz such observations were not carried out. For these reasons, data collected from the RT-7.5 radio telescope are of high value (Shustikov et al., 2012.This work describes modeling and gives interpretation of the reason for raising flux density spectrum of sub-millimeter radio frequency emission using as an example the GOES flare of class M 5.3 occurred on 04.07.2012 in the active region 11515. This flare was observed on the RT-7.5 radio telescope of BMSTU and was described by Shustikov et al. (2012 and by Smirnova et al. (2013, where it has been suggested that the reason for raising radio frequency emission is a bremsstrahlung of the thermal electrons in the hot plasma of the solar chromosphere. Rough estimates of the plasma temperature at the flare source were obtained.This paper proposes model calculations of the flux density spectrum of the sub-millimeter radio emission based on the gyrosynchrotron Fleischman-Kuznetsov code (Fleishman & Kuznetsov, 2010. Section 1 briefly describes observational data, tools and processing methods used in the work. Section 2 shows results of modeling the flare radio emission. Section 3 discusses results and conclusions.Numerical modeling the sub-millimeter part of the spectrum of the radio flux density for the GOES flare of class M5.3 has been carried out. This flare occurred in the active region 11515 on 04.07.2012. Modeling was based on the observations on the BMSTU’s RT-7.5 radio telescope.The paper draws conclusion based on the

  1. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. Tracing Protostellar Envelope Evolution with HOPS, the Herschel Orion Protostar Survey

    Science.gov (United States)

    Fischer, Will; Megeath, Tom; Furlan, Elise; Ali, Babar; Stutz, Amy; Booker, Joseph; Tobin, John; Stanke, Thomas; Osorio, Mayra

    2013-07-01

    HOPS, the Herschel Orion Protostar Survey, is an unprecedented program of large surveys with the Herschel, Spitzer, Hubble, and APEX observatories, as well as near-IR observations from the IRTF and other telescopes. Together these are providing a comprehensive observational assessment of protostellar evolution, from the earliest phases (see poster by A. Stutz) through the dissipation of the protostellar envelope. The BLT (bolometric luminosity and temperature) diagram for the ˜300 HOPS protostars resembles those constructed for other nearby star-forming regions. We fit the 1-870 um SEDs of the protostars with our grid of radiative transfer models to determine their luminosities, envelope densities, cavity angles, and inclinations (see poster by E. Furlan). High-resolution HST images of the scattered light nebulae provide additional constraints on envelope density, disk geometry, cavity geometry, and inclination angle (see poster by J. Booker). Finally, near-IR atomic hydrogen lines provide independent estimates of reddening and accretion luminosity in the less embedded sources. This multi-pronged modeling approach provides a more reliable assessment of envelope evolution than raw observational diagnostics like the bolometric temperature. We will compare the distributions of envelope densities and protostellar luminosities to the predictions of star-formation models.

  3. Tank Investigation of a Powered Dynamic Model of a Large Long-Range Flying Boat

    Science.gov (United States)

    Parkinson, John B; Olson, Roland E; Harr, Marvin I

    1947-01-01

    Principles for designing the optimum hull for a large long-range flying boat to meet the requirements of seaworthiness, minimum drag, and ability to take off and land at all operational gross loads were incorporated in a 1/12-size powered dynamic model of a four-engine transport flying boat having a design gross load of 165,000 pounds. These design principles included the selection of a moderate beam loading, ample forebody length, sufficient depth of step, and close adherence to the form of a streamline body. The aerodynamic and hydrodynamic characteristics of the model were investigated in Langley tank no. 1. Tests were made to determine the minimum allowable depth of step for adequate landing stability, the suitability of the fore-and-aft location of the step, the take-off performance, the spray characteristics, and the effects of simple spray-control devices. The application of the design criterions used and test results should be useful in the preliminary design of similar large flying boats.

  4. PROCESSING OF UAV BASED RANGE IMAGING DATA TO GENERATE DETAILED ELEVATION MODELS OF COMPLEX NATURAL STRUCTURES

    Directory of Open Access Journals (Sweden)

    T. K. Kohoutek

    2012-07-01

    Full Text Available Unmanned Aerial Vehicles (UAVs are more and more used in civil areas like geomatics. Autonomous navigated platforms have a great flexibility in flying and manoeuvring in complex environments to collect remote sensing data. In contrast to standard technologies such as aerial manned platforms (airplanes and helicopters UAVs are able to fly closer to the object and in small-scale areas of high-risk situations such as landslides, volcano and earthquake areas and floodplains. Thus, UAVs are sometimes the only practical alternative in areas where access is difficult and where no manned aircraft is available or even no flight permission is given. Furthermore, compared to terrestrial platforms, UAVs are not limited to specific view directions and could overcome occlusions from trees, houses and terrain structures. Equipped with image sensors and/or laser scanners they are able to provide elevation models, rectified images, textured 3D-models and maps. In this paper we will describe a UAV platform, which can carry a range imaging (RIM camera including power supply and data storage for the detailed mapping and monitoring of complex structures, such as alpine riverbed areas. The UAV platform NEO from Swiss UAV was equipped with the RIM camera CamCube 2.0 by PMD Technologies GmbH to capture the surface structures. Its navigation system includes an autopilot. To validate the UAV-trajectory a 360° prism was installed and tracked by a total station. Within the paper a workflow for the processing of UAV-RIM data is proposed, which is based on the processing of differential GNSS data in combination with the acquired range images. Subsequently, the obtained results for the trajectory are compared and verified with a track of a UAV (Falcon 8, Ascending Technologies carried out with a total station simultaneously to the GNSS data acquisition. The results showed that the UAV's position using differential GNSS could be determined in the centimetre to the decimetre

  5. Normal social seeking behavior, hypoactivity and reduced exploratory range in a mouse model of Angelman syndrome

    Directory of Open Access Journals (Sweden)

    Reiter Lawrence T

    2011-01-01

    Full Text Available Abstract Background Angelman syndrome (AS is a neurogenetic disorder characterized by severe developmental delay with mental retardation, a generally happy disposition, ataxia and characteristic behaviors such as inappropriate laughter, social-seeking behavior and hyperactivity. The majority of AS cases are due to loss of the maternal copy of the UBE3A gene. Maternal Ube3a deficiency (Ube3am-/p+, as well as complete loss of Ube3a expression (Ube3am-/p-, have been reproduced in the mouse model used here. Results Here we asked if two characteristic AS phenotypes - social-seeking behavior and hyperactivity - are reproduced in the Ube3a deficient mouse model of AS. We quantified social-seeking behavior as time spent in close proximity to a stranger mouse and activity as total time spent moving during exploration, movement speed and total length of the exploratory path. Mice of all three genotypes (Ube3am+/p+, Ube3am-/p+, Ube3am-/p- were tested and found to spend the same amount of time in close proximity to the stranger, indicating that Ube3a deficiency in mice does not result in increased social seeking behavior or social dis-inhibition. Also, Ube3a deficient mice were hypoactive compared to their wild-type littermates as shown by significantly lower levels of activity, slower movement velocities, shorter exploratory paths and a reduced exploratory range. Conclusions Although hyperactivity and social-seeking behavior are characteristic phenotypes of Angelman Syndrome in humans, the Ube3a deficient mouse model does not reproduce these phenotypes in comparison to their wild-type littermates. These phenotypic differences may be explained by differences in the size of the genetic defect as ~70% of AS patients have a deletion that includes several other genes surrounding the UBE3A locus.

  6. SiC JFET Transistor Circuit Model for Extreme Temperature Range

    Science.gov (United States)

    Neudeck, Philip G.

    2008-01-01

    A technique for simulating extreme-temperature operation of integrated circuits that incorporate silicon carbide (SiC) junction field-effect transistors (JFETs) has been developed. The technique involves modification of NGSPICE, which is an open-source version of the popular Simulation Program with Integrated Circuit Emphasis (SPICE) general-purpose analog-integrated-circuit-simulating software. NGSPICE in its unmodified form is used for simulating and designing circuits made from silicon-based transistors that operate at or near room temperature. Two rapid modifications of NGSPICE source code enable SiC JFETs to be simulated to 500 C using the well-known Level 1 model for silicon metal oxide semiconductor field-effect transistors (MOSFETs). First, the default value of the MOSFET surface potential must be changed. In the unmodified source code, this parameter has a value of 0.6, which corresponds to slightly more than half the bandgap of silicon. In NGSPICE modified to simulate SiC JFETs, this parameter is changed to a value of 1.6, corresponding to slightly more than half the bandgap of SiC. The second modification consists of changing the temperature dependence of MOSFET transconductance and saturation parameters. The unmodified NGSPICE source code implements a T(sup -1.5) temperature dependence for these parameters. In order to mimic the temperature behavior of experimental SiC JFETs, a T(sup -1.3) temperature dependence must be implemented in the NGSPICE source code. Following these two simple modifications, the Level 1 MOSFET model of the NGSPICE circuit simulation program reasonably approximates the measured high-temperature behavior of experimental SiC JFETs properly operated with zero or reverse bias applied to the gate terminal. Modification of additional silicon parameters in the NGSPICE source code was not necessary to model experimental SiC JFET current-voltage performance across the entire temperature range from 25 to 500 C.

  7. Elastically cooperative activated barrier hopping theory of relaxation in viscous fluids. I. General formulation and application to hard sphere fluids.

    Science.gov (United States)

    Mirigian, Stephen; Schweizer, Kenneth S

    2014-05-21

    We generalize the force-level nonlinear Langevin equation theory of single particle hopping to include collective effects associated with long range elastic distortion of the liquid. The activated alpha relaxation event is of a mixed spatial character, involving two distinct, but inter-related, local and collective barriers. There are no divergences at volume fractions below jamming or temperatures above zero Kelvin. The ideas are first developed and implemented analytically and numerically in the context of hard sphere fluids. In an intermediate volume fraction crossover regime, the local cage process is dominant in a manner consistent with an apparent Arrhenius behavior. The super-Arrhenius collective barrier is more strongly dependent on volume fraction, dominates the highly viscous regime, and is well described by a nonsingular law below jamming. The increase of the collective barrier is determined by the amplitude of thermal density fluctuations, dynamic shear modulus or transient localization length, and a growing microscopic jump length. Alpha relaxation time calculations are in good agreement with recent experiments and simulations on dense fluids and suspensions of hard spheres. Comparisons of the theory with elastic models and entropy crisis ideas are explored. The present work provides a foundation for constructing a quasi-universal, fit-parameter-free theory for relaxation in thermal molecular liquids over 14 orders of magnitude in time.

  8. Splitting of critical energies in the n=0 Landau level of graphene driven by a random hopping disorder

    Science.gov (United States)

    Pereira, Ana L. C.

    2010-03-01

    The lifting of the degeneracies of the states from the graphene n=0 Landau level (LL) was recently observed experimentally and is discussed in many theoretical works, with various different proposed explanations for the origins of the observed splittings. In this work, valley/sublattice symmetry breaking is investigated through a non-interacting tight-binding model with a random hopping disorder. A disorder-driven splitting of two bands and of two critical energies is observed by means of density of states and participation ratio calculations, elucidating the interplay of lattice and disorder effects on the splitting process. The analysis of the probability densities of the states within the n=0 LL shows that there is a region, for the states closer to E=0, where there is an important asymmetry in the distribution of the wave function amplitudes between the two sublattices (where there is no matching of the spatial positions of the amplitudes over both sublattices). Furthermore, it is shown that as the splitting is increased, the two split levels also get increasingly broadened, in such a way that the proportion of the overlapped states keeps approximately constant for a wide range of disorder or magnetic field variation.

  9. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

    Science.gov (United States)

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-09-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

  10. Competing phases in the single-band Hubbard model on the 1/5-depleted square lattice

    Science.gov (United States)

    Mulanix, Michael; Khatami, Ehsan

    Using exact diagonalization of small clusters, we study the Hubbard model on the 1/5-depleted square lattice. This geometry, which arises in ordered-vacancy iron selenide superconductors, consists of 2 by 2 plaquettes connected through inter-plaquette bonds. Previous determinantal quantum Monte Carlo simulations have shown that the model at half filling displays multiple quantum phase transitions by tuning the ratio of hoppings for the two types of bonds, or by varying the interaction strength. We extend those results to the region away from half filling and study the magnetic, charge and pairing correlation functions for a wide range of interaction strengths and the hopping ratios. We find an interesting variation of the magnetic ordering wavevector as the density changes, particularly if the hopping ratio is tuned in favor of the intra-plaquatte bond. We also find that, for small interaction strengths and at low densities, unexpected charge or pair density waves dominate.

  11. Dielectric properties of the lithium-titanium ferrite ceramics in a wide frequency range

    Science.gov (United States)

    Surzhikov, A. P.; Gyngazov, S. A.; Lysenko, E. N.; Frangul'yan, T. S.; Malyshev, A. V.

    2015-06-01

    Electrophysical properties of the Li-Ti ferrite ceramics with the spinel structure (Li0.649Fe1.598Ti0.5Zn0.2Mn0.051O4) are studied in the frequency interval 0.5-2.5 GHz at temperatures ranging from room temperature to 530 K. The thermal emf of the ferrite ceramic samples is studied. It is demonstrated that the sample under study exhibits electron conduction. The calculated results are used to interpret the conduction mechanism using the hopping model.

  12. Product/Process (P/P) Models For The Defense Waste Processing Facility (DWPF): Model Ranges And Validation Ranges For Future Processing

    Energy Technology Data Exchange (ETDEWEB)

    Jantzen, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Edwards, T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-09-25

    Radioactive high level waste (HLW) at the Savannah River Site (SRS) has successfully been vitrified into borosilicate glass in the Defense Waste Processing Facility (DWPF) since 1996. Vitrification requires stringent product/process (P/P) constraints since the glass cannot be reworked once it is poured into ten foot tall by two foot diameter canisters. A unique “feed forward” statistical process control (SPC) was developed for this control rather than statistical quality control (SQC). In SPC, the feed composition to the DWPF melter is controlled prior to vitrification. In SQC, the glass product would be sampled after it is vitrified. Individual glass property-composition models form the basis for the “feed forward” SPC. The models transform constraints on the melt and glass properties into constraints on the feed composition going to the melter in order to guarantee, at the 95% confidence level, that the feed will be processable and that the durability of the resulting waste form will be acceptable to a geologic repository.

  13. Predicting muscle forces during the propulsion phase of single leg triple hop test.

    Science.gov (United States)

    Alvim, Felipe Costa; Lucareli, Paulo Roberto Garcia; Menegaldo, Luciano Luporini

    2018-01-01

    Functional biomechanical tests allow the assessment of musculoskeletal system impairments in a simple way. Muscle force synergies associated with movement can provide additional information for diagnosis. However, such forces cannot be directly measured noninvasively. This study aims to estimate muscle activations and forces exerted during the preparation phase of the single leg triple hop test. Two different approaches were tested: static optimization (SO) and computed muscle control (CMC). As an indirect validation, model-estimated muscle activations were compared with surface electromyography (EMG) of selected hip and thigh muscles. Ten physically healthy active women performed a series of jumps, and ground reaction forces, kinematics and EMG data were recorded. An existing OpenSim model with 92 musculotendon actuators was used to estimate muscle forces. Reflective markers data were processed using the OpenSim Inverse Kinematics tool. Residual Reduction Algorithm (RRA) was applied recursively before running the SO and CMC. For both, the same adjusted kinematics were used as inputs. Both approaches presented similar residuals amplitudes. SO showed a closer agreement between the estimated activations and the EMGs of some muscles. Due to inherent EMG methodological limitations, the superiority of SO in relation to CMC can be only hypothesized. It should be confirmed by conducting further studies comparing joint contact forces. The workflow presented in this study can be used to estimate muscle forces during the preparation phase of the single leg triple hop test and allows investigating muscle activation and coordination. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. On Multi-Hop Decode-and-Forward Cooperative Relaying for Industrial Wireless Sensor Networks.

    Science.gov (United States)

    Ai, Yun; Cheffena, Michael

    2017-03-28

    Wireless sensor networks (WSNs) will play a fundamental role in the realization of Internet of Things and Industry 4.0. Arising from the presence of spatially distributed sensor nodes in a sensor network, cooperative diversity can be achieved by using the sensor nodes between a given source-destination pair as intermediate relay stations. In this paper, we investigate the end-to-end average bit error rate (BER) and the channel capacity of a multi-hop relay network in the presence of impulsive noise modeled by the well-known Middleton's class-A model. Specifically, we consider a multi-hop decode-and-forward (DF) relay network over Nakagami-m fading channel due to its generality, but also due to the absence of reported works in this area. Closed-form analytical expressions for the end-to-end average BER and the statistical properties of the end-to-end channel capacity are obtained. The impacts of the channel parameters on these performance quantities are evaluated and discussed.

  15. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  16. Mixed quantum-classical equilibrium in global flux surface hopping.

    Science.gov (United States)

    Sifain, Andrew E; Wang, Linjun; Prezhdo, Oleg V

    2015-06-14

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors.

  17. Mixed quantum-classical equilibrium in global flux surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun; Prezhdo, Oleg V. [Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2015-06-14

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors.

  18. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  19. Using a data-constrained model of home range establishment to predict abundance in spatially heterogeneous habitats.

    Directory of Open Access Journals (Sweden)

    Mark C Vanderwel

    Full Text Available Mechanistic modelling approaches that explicitly translate from individual-scale resource selection to the distribution and abundance of a larger population may be better suited to predicting responses to spatially heterogeneous habitat alteration than commonly-used regression models. We developed an individual-based model of home range establishment that, given a mapped distribution of local habitat values, estimates species abundance by simulating the number and position of viable home ranges that can be maintained across a spatially heterogeneous area. We estimated parameters for this model from data on red-backed vole (Myodes gapperi abundances in 31 boreal forest sites in Ontario, Canada. The home range model had considerably more support from these data than both non-spatial regression models based on the same original habitat variables and a mean-abundance null model. It had nearly equivalent support to a non-spatial regression model that, like the home range model, scaled an aggregate measure of habitat value from local associations with habitat resources. The home range and habitat-value regression models gave similar predictions for vole abundance under simulations of light- and moderate-intensity partial forest harvesting, but the home range model predicted lower abundances than the regression model under high-intensity disturbance. Empirical regression-based approaches for predicting species abundance may overlook processes that affect habitat use by individuals, and often extrapolate poorly to novel habitat conditions. Mechanistic home range models that can be parameterized against abundance data from different habitats permit appropriate scaling from individual- to population-level habitat relationships, and can potentially provide better insights into responses to disturbance.

  20. Effects of Powdery Mildew Fungicide Programs on Twospotted Spider Mite (Acari: Tetranychidae), Hop Aphid (Homoptera: Aphididae), and Their Natural Enemies in Hop Yards

    Science.gov (United States)

    Twospotted spider mite, Tetranychus urticae Koch (Acari:Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera:Aphidiae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological c...

  1. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  2. HipHop Scholastics: Effective Teacher Professional Learning

    OpenAIRE

    Garcia, Itoco

    2016-01-01

    AbstractHipHop Scholastics: Effective Teacher Professional LearningbyItoco GarcíaDoctor of EducationUniversity of California, BerkeleyProfessor P. David Pearson, ChairMeeting the needs of culturally and linguistically diverse students in order to improve their academic engagement and achievement is a central challenge to American education. A Critical Race analysis and synthesis of academic research on teacher professional learning, Culturally Relevant Pedagogy (CRP), and the mismatch between...

  3. Reconstruction of Frequency Hopping Signals From Multi-Coset Samples

    OpenAIRE

    Lim, Chia Wei; Wakin, Michael B.

    2016-01-01

    Multi-Coset (MC) sampling is a well established, practically feasible scheme for sampling multiband analog signals below the Nyquist rate. MC sampling has gained renewed interest in the Compressive Sensing (CS) community, due partly to the fact that in the frequency domain, MC sampling bears a strong resemblance to other sub-Nyquist CS acquisition protocols. In this paper, we consider MC sampling of analog frequency hopping signals, which can be viewed as multiband signals with changing band ...

  4. Opportunistic Access in Frequency Hopping Cognitive Radio Networks

    Science.gov (United States)

    2014-03-27

    frequency hopping radio to mitigate the interference caused by other transmitters in a contentious environment such as the unlicensed 2.4 GHz region...Avionics Circle WPAFB, OH 45433 vasu.chakravarthy@us.af.mil 937- 528 -8269 AFRL/RYWE 12. DISTRIBUTION / AVAILABILITY STATEMENT DISTRIBUTION STATEMENT A...unlicensed 2.4 GHz region. Additionally, this work demonstrates how dynamic spectrum access techniques can be used not only to prevent interfering with

  5. Nanoscale live cell imaging using hopping probe ion conductance microscopy

    Science.gov (United States)

    Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.

    2009-01-01

    We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505

  6. Hip-Hop Development™ Bridging the Generational Divide for Youth Development

    Directory of Open Access Journals (Sweden)

    P. Thandi Hicks Harper

    2007-09-01

    Full Text Available Hip-Hop culture in the lives of youth can not be ignored. This research is based on the premise that youth workers who expect ongoing successes must increase their Hip-Hop culture competence. The study examined the knowledge of and attitude towards Hip-Hop by educators who participated in a Hip-Hop 101 workshop. Their perceptions relevant to the importance of Hip-Hop awareness and application for positively influencing youth behaviors were also explored. Results revealed that workshop participants significantly increased their Hip-Hop knowledge. They also demonstrated significantly more favorable attitudes toward Hip-Hop and its use for youth development. Findings suggest that the workshop promoted an environment conducive to bridging the generation gap between youth who embrace Hip-Hop, and educators who have a less favorable view. This research provides insight into Hip-Hop Developmenttm as a core component for establishing the kinds of youth-adult partnerships necessary for today’s Hip-Hop generation’s self-growth, skill enhancement, and leadership development.

  7. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  8. Lack of association between gastric cancer and hopQ alleles in Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Kazemi Elham

    2016-01-01

    Full Text Available Helicobacter pylori use a number of mechanisms to survive in the stomach lumen. The presence of these bacteria in the stomach can lead to gastritis and reduction in stomach acid production. Acute inflammation can directly damage to the peripheral cells that are responsible for the secretion of acid. The risk of developing gastric carcinoma is associated to heterogeneity of Helicobacter pylori virulence factors (such as cagA. The HopQ is one of the outer membrane proteins involved in bacterial adherence to gastric mucosa and has been suggested to also play a role in the virulence of H. pylori. This gene has been shown in two types. The purpose of the current study was to investigate the association between different H. pylori virulence hopQ alleles (types I and II and patients with gastroduodenal disorders. For this purpose 58 stomach biopsies the of patients with gastric cancer and 100 saliva samples from healthy individuals were collected. Then genomic DNA was purified and PCR for was done for desired genes via specific primers. The H. pylori infections were diagnosed by PCR for GlmM gene. Then frequencies of hopQI+, hopQII+ and hopQI+ hopQII+ genotypes were determined in H. pylori infected cases. Statistical analysis showed that there were not significant differences between healthy and diseased ones for genotypes hopQI+, hopQII+ and hopQI+ hopQII+.

  9. 3D indoor modeling using a hand-held embedded system with multiple laser range scanners

    Science.gov (United States)

    Hu, Shaoxing; Wang, Duhu; Xu, Shike

    2016-10-01

    Accurate three-dimensional perception is a key technology for many engineering applications, including mobile mapping, obstacle detection and virtual reality. In this article, we present a hand-held embedded system designed for constructing 3D representation of structured indoor environments. Different from traditional vehicle-borne mobile mapping methods, the system presented here is capable of efficiently acquiring 3D data while an operator carrying the device traverses through the site. It consists of a simultaneous localization and mapping(SLAM) module, a 3D attitude estimate module and a point cloud processing module. The SLAM is based on a scan matching approach using a modern LIDAR system, and the 3D attitude estimate is generated by a navigation filter using inertial sensors. The hardware comprises three 2D time-flight laser range finders and an inertial measurement unit(IMU). All the sensors are rigidly mounted on a body frame. The algorithms are developed on the frame of robot operating system(ROS). The 3D model is constructed using the point cloud library(PCL). Multiple datasets have shown robust performance of the presented system in indoor scenarios.

  10. Long-range rapidity correlations between mean transverse momenta in the model with string fusion

    Directory of Open Access Journals (Sweden)

    Vechernin Vladimir

    2016-01-01

    Full Text Available The long-range correlation between mean-event transverse momenta, being robust against the volume fluctuations and the details of the centrality determination, enables to obtain the signatures of string fusion at the initial stage of hadronic interaction in relativistic heavy ion collisions. The dependence of the correlation strength between mean-event transverse momenta on the collision centrality and initial energy is analyzed in a simple model with quark-gluon string fusion on the transverse lattice. It is shown that above RHIC energy the dependence reveals the decline of the correlation coefficient for most central collisions, reflecting the attenuation of color field fluctuations due to the string fusion at large string density. It is also found that contrary to the correlation between transverse momenta of single particles the strength of the correlation between mean-event transverse momenta of particles in two separated rapidity intervals is not decreasing with the total number of produced strings, remaining significant even in the case of Pb-Pb collisions, in which the total number of strings can reach several thousand.

  11. Swellable Model POPC/POPG/DHPC Membrane with a Lamellar Long-Range Order

    Science.gov (United States)

    Li, Ming; Nieh, Mu-Ping

    2012-02-01

    A physiological relevant biomimetic model membrane is of great necessity for the structural characterization of membrane protein. This presentation will report a small-angle neutron scattering (SANS) result on two lipid bicellar series composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine(POPC)/1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC) and POPC/DHPC/1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (POPG). Instead of the multi-lamellae vesicle (MLV) structure observed in zwitterionic POPC/DHPC mixture, the perforated lamellae (PL) structure is found in POPC/POPG/DHPC upon addition of small amount of charged lipid, POPG R=[POPG]/([POPC]+[POPG])=0.01. The PL phase exists from 10 to 60 degree C and the interlamellar spacing (d-spacing) varies from 12.9 to 49.0 nm as the lipid concentration changes from 25 to 7.5% wt where the lamellae still indicate long-range order. The effect of temperature and charge density (R) on structural variation will be discussed in this presentation.

  12. Higgs mass range from standard model false vacuum inflation in scalar-tensor gravity

    DEFF Research Database (Denmark)

    Masina, I.; Notari, A.

    2012-01-01

    If the standard model is valid up to very high energies it is known that the Higgs potential can develop a local minimum at field values around 10(15)-10(17) GeV, for a narrow band of values of the top quark and Higgs masses. We show that in a scalar-tensor theory of gravity such Higgs false vacuum...... can give rise to viable inflation if the potential barrier is very shallow, allowing for tunneling and relaxation into the electroweak scale true vacuum. The amplitude of cosmological density perturbations from inflation is directly linked to the value of the Higgs potential at the false minimum....... Requiring the top quark mass, the amplitude and spectral index of density perturbations to be compatible with observations, selects a narrow range of values for the Higgs mass, m(H) = 126.0 +/- 3.5 GeV, where the error is mostly due to the theoretical uncertainty of the 2-loop renormalization group equation...

  13. A Novel Short-Range Prediction Model for Railway Track Irregularity

    Directory of Open Access Journals (Sweden)

    Peng Xu

    2012-01-01

    Full Text Available In recent years, with axle loads, train loads, transport volume, and travel speed constantly increasing and railway network steadily lengthening, shortcomings of current maintenance strategies are getting to be noticed from an economical and safety perspective. To overcome the shortcomings, permanent-of-way departments throughout the world have given a considerable attention to an ideal maintenance strategy which is to carry out appropriate maintenances just in time on track locations really requiring maintenance. This strategy is simplified as the condition-based maintenance (CBM which has attracted attentions of engineers of many industries in the recent 70 years. To implement CBM for track irregularity, there are many issues which need to be addressed. One of them focuses on predicting track irregularity of each day in a future short period. In this paper, based on track irregularity evolution characteristics, a Short-Range Prediction Model was developed to this aim and is abbreviated to TI-SRPM. Performance analysis results for TI-SRPM illustrate that track irregularity amplitude predictions on sampling points by TI-SRPM are very close to their measurements by Track Geometry Car.

  14. Comparison of the most odor-active compounds in fresh and dried hop cones (Humulus lupulus L. variety spalter select) based on GC-olfactometry and odor dilution techniques.

    Science.gov (United States)

    Steinhaus, M; Schieberle, P

    2000-05-01

    Application of aroma extract dilution analysis on the volatiles obtained from dried cones of Spalter Select hops grown in the German hop-growing area of Hallertau revealed 23 odorants in the flavor dilution (FD) factor range of 16-4096, 20 of which could be identified. On the basis of high FD factors, trans-4, 5-epoxy-(E)-2-decenal, linalool, and myrcene were identified as the most potent odorants, followed by ethyl 2-methylpropanoate, methyl 2-methylbutanoate, (Z)-1,5-octadien-3-one, nonanal, (E,Z)-1,3, 5-undecatriene, 1,3(E),5(Z),9-undecatetraene, propyl 2-methylbutanoate, 4-ethenyl-2-methoxyphenol, and 1-octen-3-one. Ten of the high-impact hop aroma compounds had previously not been identified as hop constituents and, in particular, 1,3(E),5(Z), 9-undecatetraene has not yet been reported as a food odorant. In an extract obtained from fresh hops, in addition to the odorants found in dry hops, (Z)-3-hexenal was characterized as a further key odorant rendering an additional green aroma note to the fresh material.

  15. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  16. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  17. Bak–Tang–Wiesenfeld model in the finite range random link lattice

    Energy Technology Data Exchange (ETDEWEB)

    Najafi, M.N., E-mail: morteza.nattagh@gmail.com

    2014-06-13

    We consider the BTW model in random link lattices with finite range interaction (RLFRI). The degree distribution of nodes is considered to be uniform in the interval (0,n{sub 0}). We tune the topology of the lattices by two parameters (n{sub 0},R) in which R is the range of interactions. We numerically calculate the exponents of the statistical distribution functions in terms of these parameters. Dijkstra radius is utilized to calculate the fractal dimension of the avalanches. Our analysis shows that for a fixed n{sub 0} value there are two intervals of R, namely (1,R{sub 0}) and (R{sub 0},L) each of which has a distinct behavior. In the first interval the fractal dimension monotonically grows from D{sub f}(R=1)≃D{sub f}{sup BTW}=1.25, up to D{sub f}≃5.0±0.4. We found however that in the second interval there is a length scale r{sub 0}(n{sub 0},R) in which the behaviors are changed. For the scales smaller than r{sub 0}(n{sub 0},R), which is typically one decade, the fractal dimension is nearly independent of n{sub 0} and R and is nearly equal to 2.0±0.2. We retrieve the BTW-type behaviors in the limit R→1 and find some new behaviors in the random scaleless lattice limit, i.e. R→L. We also numerically calculate the explicit form of the number of unstable nodes (NUN) as a time-dependent process and show that for regular lattice, it is (up to a normalization) proportional to a one-dimensional Weiner process and for RLFRI it acquires a drift term. Our analytical analysis shows that the relaxation time (exit time) for NUN process for RLFRI is related to a fitting parameter of NUN and is shorter than the regular one.

  18. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  19. Hip-Hop to Health Jr. Randomized Effectiveness Trial

    Science.gov (United States)

    Kong, Angela; Buscemi, Joanna; Stolley, Melinda R.; Schiffer, Linda A.; Kim, Yoonsang; Braunschweig, Carol L.; Gomez-Perez, Sandra L.; Blumstein, Lara B.; Van Horn, Linda; Dyer, Alan R.; Fitzgibbon, Marian L.

    2015-01-01

    Introduction The preschool years provide a unique window of opportunity to intervene on obesity-related lifestyle risk factors during the formative years of a child’s life. The purpose of this study was to assess the impact of a preschool-based obesity prevention effectiveness trial at 1-year follow-up. Design RCT. Settings/participants Primarily African American children (aged 3–5 years, N=618) attending Head Start preschool programs administered by Chicago Public Schools. Methods Eighteen preschools were randomly assigned in 2007–2008 to receive either: (1) a 14-week teacher-delivered intervention focused on healthy lifestyle behaviors; or (2) a 14-week teacher-delivered general health curriculum (control group). Main outcome measures The primary outcome, BMI, was measured at baseline, post-intervention, and 1-year follow-up. Diet and screen time behaviors were also assessed at these time points. Multilevel mixed effects models were used to test for between-group differences. Data were analyzed in 2014. Results Significant between-group differences were observed in diet, but not in BMI z-score or screen time at 1-year follow-up. Diet differences favored the intervention arm over controls in overall diet quality (p=0.02) and in subcomponents of diet quality, as measured by the Healthy Eating Index-2005, and in fruit intake (servings/day, excludes juice) (p=0.02). Diet quality worsened more among controls than the intervention group at 1-year follow-up. Conclusions The adaptation of Hip-Hop to Health Jr. produced modest benefits in diet quality, but did not significantly impact weight gain trajectory. Not unlike other effectiveness trials, this real-world version delivered by Head Start teachers produced fewer benefits than the more rigorous efficacy trial. It is important to understand and build upon the lessons learned from these types of trials so that we can design, implement, and disseminate successful evidence-based programs more widely and effectively

  20. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana

    2013-04-01

    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  1. Low-coverage surface diffusion in complex periodic energy landscapes: Analytical solution for systems with symmetric hops and application to intercalation in topological insulators

    Science.gov (United States)

    Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.

    2016-02-01

    This is the first of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low-coverage, single-tracer limit). The present report focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials. For diffusion in two dimensions, a number of formulas are presented for complex combinations of the different hops in systems with triangular, rectangular, and square symmetry. The formulas provide values in excellent agreement with kinetic Monte Carlo simulations, concluding that the diffusion coefficient can be directly determined from the proposed expressions without performing the simulations. Based on the diffusion barriers obtained from first-principles calculations and a physically meaningful estimate of the attempt frequencies, the proposed formulas are used to analyze the diffusion of Cu, Ag, and Rb adatoms on the surface and within the van der Waals (vdW) gap of a model topological insulator, Bi2Se3 . Considering the possibility of adsorbate intercalation from the terraces to the vdW gaps at morphological steps, we infer that, at low coverage and room temperature, (i) a majority of the Rb atoms bounce back at the steps and remain on the terraces, (ii) Cu atoms mostly intercalate into the vdW gap, the remaining fraction staying at the steps, and (iii) Ag atoms essentially accumulate at the steps and gradually intercalate into the vdW gap. These conclusions are in good qualitative agreement with previous experiments. The companion report (M. A. Gosálvez et al., Phys. Rev. B, submitted] extends the present study to the description of systems that contain asymmetric hops.

  2. Occurrence of Theaspirane and its Odorant Degradation Products in Hop and Beer.

    Science.gov (United States)

    Scholtes, Caroline; Nizet, Sabrina; Massart, Hadrien; Gerbaux, Pascal; Collin, Sonia

    2015-09-23

    In model oxidized media, six theaspirane-derived compounds were identified by gas chromatography-high resolution mass spectrometry: 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, dihydrodehydro-β-ionone, two monoepoxides, and a derived alcohol. Only 4-hydroxy-7,8-dihydro-β-ionone and dihydrodehydro-β-ionone have been described previously in the literature. Investigation of hop revealed five of these compounds in free form together with theaspirane (especially in the Mosaic variety), while the Citra and Amarillo hop varieties emerged as very interesting for the release of theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone from glucoside precursors. For the first time, theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, and both monoepoxides were found in a fresh commercial top fermentation beer (only theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone have recently been mentioned as Gueuze constituents).

  3. Multi-Hop-Enabled Energy-Efficient MAC Protocol for Underwater Acoustic Sensor Networks

    Directory of Open Access Journals (Sweden)

    Khaja Shazzad

    2015-09-01

    Full Text Available In multi-hop underwater acoustic sensor networks (UWASNs, packet collisions due to hidden and local nodes adversely affect throughput, energy efficiency and end-to-end delay. Existing medium access control (MAC protocols try to solve the problem by utilizing a single-phase contention resolution mechanism, which causes a large number of control packet exchanges and energy overhead. In this paper, we introduce a MAC protocol that splits this single-phase contention resolution mechanism into two phases to provide efficient multi-hop networking. In the first phase, local nodes are eliminated from the contention, and in the later phase, the adverse effects of hidden nodes are mitigated. This two-phased contention resolution provides higher energy efficiency, better throughput and shorter end-to-end delay, and it also enables adaptability for different network architectures. A probabilistic model of the proposed protocol is also developed to analyse the performance. The proposed protocol has been evaluated through quantitative analysis and simulation. Results obtained through quantitative analysis and simulation reveal that the proposed protocol achieves significantly better energy efficiency, higher and more stable throughput and lower end-to-end delay compared to existing protocols, namely T-Lohi and slotted floor acquisition multiple access (S-FAMA.

  4. Chemical Characterization of Beer Aging Products Derived from Hard Resin Components in Hops (Humulus lupulus L.).

    Science.gov (United States)

    Taniguchi, Yoshimasa; Yamada, Makiko; Taniguchi, Harumi; Matsukura, Yasuko; Shindo, Kazutoshi

    2015-11-25

    The bitter taste of beer originates from resins in hops (Humulus lupulus L.), which are classified into two subtypes (soft and hard). Whereas the nature and reactivity of soft-resin-derived compounds, such as α-, β-, and iso-α-acids, are well studied, there is only a little information on the compounds in hard resin. For this work, hard resin was prepared from stored hops and investigated for its compositional changes in an experimental model of beer aging. The hard resin contained a series of α-acid oxides. Among them, 4'-hydroxyallohumulinones were unstable under beer storage conditions, and their transformation induced primary compositional changes of the hard resin during beer aging. The chemical structures of the products, including novel polycyclic compounds scorpiohumulinols A and B and dicyclohumulinols A and B, were determined by HRMS and NMR analyses. These compounds were proposed to be produced via proton-catalyzed cyclization reactions of 4'-hydroxyallohumulinones. Furthermore, they were more stable than their precursor 4'-hydroxyallohumulinones during prolonged storage periods.

  5. A probabilistic dispersion model applied to the long-range transport of radionuclides from the Chernobyl accident

    DEFF Research Database (Denmark)

    Lauritzen, B.; Mikkelsen, T.

    1999-01-01

    Long-range atmospheric transport of radionuclides from the Chernobyl accident is modelled as an Eulerian diffusion process. From observations of the gross deposition pattern of particulate radiocaesium an effective long-range Eddy diffusivity K of the order of 10(6) m(2) s(-1) is inferred...

  6. Two-phase 1D+1D model of a DMFC: development and validation on extensive operating conditions range

    Energy Technology Data Exchange (ETDEWEB)

    Casalegno, A.; Marchesi, R.; Parenti, D. [Dipartimento di Energetica, Politecnico di Milano (Italy)

    2008-02-15

    A two-phase 1D+1D model of a direct methanol fuel cell (DMFC) is developed, considering overall mass balance, methanol transport in gas phase through anode diffusion layer, methanol and water crossover. The model is quantitatively validated on an extensive range of operating conditions, 24 polarisation curves. The model accurately reproduces DMFC performance in the validation range and, outside this, it is able to predict values under feasible operating conditions. Finally, the estimations of methanol crossover flux are qualitatively and quantitatively similar to experimental measures and the main local quantities' trends are coherent with results obtained with more complex models. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  7. Range performance calculations using the NVEOL-Georgia Tech Research Institute 0.1- to 100-GHz radar performance model

    Science.gov (United States)

    Rodak, S. P.; Thomas, N. I.

    1983-05-01

    A computer model that can be used to calculate radar range performance at any frequency in the 0.1-to 100-GHz electromagnetic spectrum is described. These different numerical examples are used to demonstrate how to use the radar range performance model. Input/output documentation are included for each case that was run on the MERADCOM CDC 6600 computer at Fort Belvoir, Virginia.

  8. Lattice Model of Fractional Gradient and Integral Elasticity: Long-Range Interaction of Grunwald-Letnikov-Riesz Type

    OpenAIRE

    Tarasov, Vasily E.

    2015-01-01

    Lattice model with long-range interaction of power-law type that is connected with difference of non-integer order is suggested. The continuous limit maps the equations of motion of lattice particles into continuum equations with fractional Grunwald-Letnikov-Riesz derivatives. The suggested continuum equations describe fractional generalizations of the gradient and integral elasticity. The proposed type of long-range interaction allows us to have united approach to describe of lattice models ...

  9. Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State

    Science.gov (United States)

    Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen

    2017-10-01

    Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.

  10. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  11. A Hybrid Finite Element/Helmholtz-Kirchhoff-Integral Model for Shooting Range Sound Prediction

    NARCIS (Netherlands)

    Nijhof, M.J.J.; Eerden, F.J.M. van der

    2013-01-01

    National legislation enforces a limit on the Sound Levels of outdoor military shooting ranges observed in nearby residential areas. These restrictions directly influence the number of shots that may be fired at a specific shooting range, which may conflict with the required/ scheduled training

  12. Structural influence on atomic hopping and electronic states of Pd-based bulk metallic glasses

    OpenAIRE

    Tang, X.-P.; Löffler, Jörg F.; Schwarz, R. B.; Johnson, William L.; Wu, Yue

    2005-01-01

    Atomic motion and electronic structures of Pd–Ni–Cu–P bulk metallic glasses were investigated using 31P nuclear magnetic resonance. The hopping rate of P atoms was determined by the stimulated echo technique. Significant hopping was observed in all alloys well below the glass transition temperature. Increasing the Cu content to above 25 at. % increases P hopping significantly, consistent with the previous finding that the openness of the structure increases with Cu content. In contrast, P h...

  13. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  14. One Hop: In The Right Direction

    Science.gov (United States)

    Glotfelty, K. J.

    2013-10-01

    Accelerated by the ease of access to data triggered by growing archive registries and common search protocols, many more application than before are now directly interfacing with archives. Gone and going are the days when data sat behind proprietary archive interfaces. What were once exclusively considered analysis tools designed to consume files on disk are now becoming first-class front ends to archives to discover and retrieve remote data-sets. More than that, whether by saving files to disk or sending and servicing SAMP messages, these applications are themselves now local data service providers for other local applications. The problem is that often data that are retrieve remotely are directly cast into the applications internal data model - likely altering the data in the process. Content may be added (e.g. new columns), nonessential information (to the current application) may be purged, provenance altered, or content directly modified (e.g. WCS conventions). This possibly insufficient or incompatible view of the data is then what is presented to postliminary tools in the work-flow. The remote data have in essence become trapped in the application that retrieved it from the remote service. In this paper we will discuss this “one hop” effect and the strain it imposes on application developers. We will showcase a current example of this problem and discuss why a “return to source” model of sending all applications back to the original remote source is, in general, insufficient.

  15. Quasi-additive estimates on the Hamiltonian for the one-dimensional long range Ising model

    Science.gov (United States)

    Littin, Jorge; Picco, Pierre

    2017-07-01

    In this work, we study the problem of getting quasi-additive bounds for the Hamiltonian of the long range Ising model, when the two-body interaction term decays proportionally to 1/d2 -α , α ∈(0,1 ) . We revisit the paper by Cassandro et al. [J. Math. Phys. 46, 053305 (2005)] where they extend to the case α ∈[0 ,ln3/ln2 -1 ) the result of the existence of a phase transition by using a Peierls argument given by Fröhlich and Spencer [Commun. Math. Phys. 84, 87-101 (1982)] for α =0 . The main arguments of Cassandro et al. [J. Math. Phys. 46, 053305 (2005)] are based in a quasi-additive decomposition of the Hamiltonian in terms of hierarchical structures called triangles and contours, which are related to the original definition of contours introduced by Fröhlich and Spencer [Commun. Math. Phys. 84, 87-101 (1982)]. In this work, we study the existence of a quasi-additive decomposition of the Hamiltonian in terms of the contours defined in the work of Cassandro et al. [J. Math. Phys. 46, 053305 (2005)]. The most relevant result obtained is Theorem 4.3 where we show that there is a quasi-additive decomposition for the Hamiltonian in terms of contours when α ∈[0,1 ) but not in terms of triangles. The fact that it cannot be a quasi-additive bound in terms of triangles lead to a very interesting maximization problem whose maximizer is related to a discrete Cantor set. As a consequence of the quasi-additive bounds, we prove that we can generalise the [Cassandro et al., J. Math. Phys. 46, 053305 (2005)] result, that is, a Peierls argument, to the whole interval α ∈[0,1 ) . We also state here the result of Cassandro et al. [Commun. Math. Phys. 327, 951-991 (2014)] about cluster expansions which implies that Theorem 2.4 that concerns interfaces and Theorem 2.5 that concerns n point truncated correlation functions in Cassandro et al. [Commun. Math. Phys. 327, 951-991 (2014)] are valid for all α ∈[0,1 ) instead of only α ∈[0 ,ln3/ln2 -1 ) .

  16. Animal galloping and human hopping: an energetics and biomechanics laboratory exercise.

    Science.gov (United States)

    Lindstedt, Stan L; Mineo, Patrick M; Schaeffer, Paul J

    2013-12-01

    This laboratory exercise demonstrates fundamental principles of mammalian locomotion. It provides opportunities to interrogate aspects of locomotion from biomechanics to energetics to body size scaling. It has the added benefit of having results with robust signal to noise so that students will have success even if not "meticulous" in attention to detail. First, using respirometry, students measure the energetic cost of hopping at a "preferred" hop frequency. This is followed by hopping at an imposed frequency half of the preferred. By measuring the O2 uptake and work done with each hop, students calculate mechanical efficiency. Lessons learned from this laboratory include 1) that the metabolic cost per hop at half of the preferred frequency is nearly double the cost at the preferred frequency; 2) that when a person is forced to hop at half of their preferred frequency, the mechanical efficiency is nearly that predicted for muscle but is much higher at the preferred frequency; 3) that the preferred hop frequency is strongly body size dependent; and 4) that the hop frequency of a human is nearly identical to the galloping frequency predicted for a quadruped of our size. Together, these exercises demonstrate that humans store and recover elastic recoil potential energy when hopping but that energetic savings are highly frequency dependent. This stride frequency is dependent on body size such that frequency is likely chosen to maximize this function. Finally, by requiring students to make quantitative solutions using appropriate units and dimensions of the physical variables, these exercises sharpen analytic and quantitative skills.

  17. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  18. Helicobacter pylori adhesin HopQ engages in a virulence-enhancing interaction with human CEACAMs.

    Science.gov (United States)

    Javaheri, Anahita; Kruse, Tobias; Moonens, Kristof; Mejías-Luque, Raquel; Debraekeleer, Ayla; Asche, Carmen I; Tegtmeyer, Nicole; Kalali, Behnam; Bach, Nina C; Sieber, Stephan A; Hill, Darryl J; Königer, Verena; Hauck, Christof R; Moskalenko, Roman; Haas, Rainer; Busch, Dirk H; Klaile, Esther; Slevogt, Hortense; Schmidt, Alexej; Backert, Steffen; Remaut, Han; Singer, Bernhard B; Gerhard, Markus

    2016-10-17

    Helicobacter pylori specifically colonizes the human gastric epithelium and is the major causative agent for ulcer disease and gastric cancer development. Here, we identify members of the carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family as receptors of H. pylori and show that HopQ is the surface-exposed adhesin that specifically binds human CEACAM1, CEACAM3, CEACAM5 and CEACAM6. HopQ-CEACAM binding is glycan-independent and targeted to the N-domain. H. pylori binding induces CEACAM1-mediated signalling, and the HopQ-CEACAM1 interaction enables translocation of the virulence factor CagA into host cells and enhances the release of pro-inflammatory mediators such as interleukin-8. Based on the crystal structure of HopQ, we found that a β-hairpin insertion (HopQ-ID) in HopQ's extracellular 3+4 helix bundle domain is important for CEACAM binding. A peptide derived from this domain competitively inhibits HopQ-mediated activation of the Cag virulence pathway, as genetic or antibody-mediated abrogation of the HopQ function shows. Together, our data suggest the HopQ-CEACAM1 interaction to be a potentially promising novel therapeutic target to combat H. pylori-associated diseases.

  19. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  20. A No-Arbitrage Fractional Cointegration Model for Futures and Spot Daily Ranges

    DEFF Research Database (Denmark)

    Rossi, Eduardo; Santucci de Magistris, Paolo

    2013-01-01

    The no-arbitrage relation between futures and spot prices implies an analogous relation between futures and spot daily ranges. The long-memory features of the range-based volatility estimators are analyzed, and fractional cointegration is tested in a semi-parametric framework. In particular, the ...... highlight the importance of incorporating the long-run equilibrium in volatilities to obtain better forecasts, given the information content in the volatility of futures prices.......The no-arbitrage relation between futures and spot prices implies an analogous relation between futures and spot daily ranges. The long-memory features of the range-based volatility estimators are analyzed, and fractional cointegration is tested in a semi-parametric framework. In particular, the no...