WorldWideScience

Sample records for range hopping model

  1. Vortex variable range hopping in a conventional superconducting film

    Science.gov (United States)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  2. Variable range hopping in ZnO films

    Science.gov (United States)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  3. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2007-01-01

    semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

  4. Entanglement contour perspective for "strong area-law violation" in a disordered long-range hopping model

    Science.gov (United States)

    Roy, Nilanjan; Sharma, Auditya

    2018-03-01

    We numerically investigate the link between the delocalization-localization transition and entanglement in a disordered long-range hopping model of spinless fermions by studying various static and dynamical quantities. This includes the inverse participation ratio, level statistics, entanglement entropy, and number fluctuations in the subsystem along with quench and wave-packet dynamics. Finite systems show delocalized, quasilocalized, and localized phases. The delocalized phase shows strong area-law violation, whereas the (quasi)localized phase adheres to (for large subsystems) the strict area law. The idea of "entanglement contour" nicely explains the violation of area law and its relationship with "fluctuation contour" reveals a signature at the transition point. The relationship between entanglement entropy and number fluctuations in the subsystem also carries signatures for the transition in the model. Results from the Aubry-Andre-Harper model are compared in this context. The propagation of charge and entanglement are contrasted by studying quench and wave-packet dynamics at the single-particle and many-particle levels.

  5. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  6. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  7. Understanding Mott's law from scaling of variable-range-hopping currents and intrinsic current fluctuations

    NARCIS (Netherlands)

    Pasveer, W.F.; Michels, M.A.J.

    2006-01-01

    We have used the master equation to simulate variable-range hopping (VRH) of charges in a strongly disordered d-dimensional energy landscape (d=1,2,3). The current distribution over hopping distances and hopping energies gives a clear insight into the difference between hops that occur most

  8. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  9. Hops

    Science.gov (United States)

    ... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...

  10. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.

    1990-01-01

    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  11. Particle hopping vs. fluid-dynamical models for traffic flow

    Energy Technology Data Exchange (ETDEWEB)

    Nagel, K.

    1995-12-31

    Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

  12. Memory effects, two color percolation, and the temperature dependence of Mott variable-range hopping

    Science.gov (United States)

    Agam, Oded; Aleiner, Igor L.

    2014-06-01

    There are three basic processes that determine hopping transport: (a) hopping between normally empty sites (i.e., having exponentially small occupation numbers at equilibrium), (b) hopping between normally occupied sites, and (c) transitions between normally occupied and unoccupied sites. In conventional theories all these processes are considered Markovian and the correlations of occupation numbers of different sites are believed to be small (i.e., not exponential in temperature). We show that, contrary to this belief, memory effects suppress the processes of type (c) and manifest themselves in a subleading exponential temperature dependence of the variable-range hopping conductivity. This temperature dependence originates from the property that sites of type (a) and (b) form two independent resistor networks that are weakly coupled to each other by processes of type (c). This leads to a two-color percolation problem which we solve in the critical region.

  13. Correlated Hopping in the 1D Falicov--Kimball Model

    Science.gov (United States)

    Gajek, Z.; Lemanski, R.

    2001-10-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

  14. Correlated Hopping in the 1d Falicov-Kimball Model

    International Nuclear Information System (INIS)

    Gajek, Z.; Lemanski, R.

    2001-01-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

  15. The mesoscopic conductance of disordered rings, its random matrix theory and the generalized variable range hopping picture

    International Nuclear Information System (INIS)

    Stotland, Alexander; Peer, Tal; Cohen, Doron; Budoyo, Rangga; Kottos, Tsampikos

    2008-01-01

    The calculation of the conductance of disordered rings requires a theory that goes beyond the Kubo-Drude formulation. Assuming 'mesoscopic' circumstances the analysis of the electro-driven transitions shows similarities with a percolation problem in energy space. We argue that the texture and the sparsity of the perturbation matrix dictate the value of the conductance, and study its dependence on the disorder strength, ranging from the ballistic to the Anderson localization regime. An improved sparse random matrix model is introduced to capture the essential ingredients of the problem, and leads to a generalized variable range hopping picture. (fast track communication)

  16. Quantum interference magnetoconductance of polycrystalline germanium films in the variable-range hopping regime

    Science.gov (United States)

    Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong

    2018-06-01

    Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.

  17. Effect of anionic surfactant concentration on the variable range hopping conduction in polypyrrole nanoparticles

    International Nuclear Information System (INIS)

    Rawal, Ishpal; Kaur, Amarjeet

    2014-01-01

    The mechanism of charge transport in polypyrrole (PPy) nanoparticles prepared with different concentrations (5 to 30 mM) of anionic surfactant (sodium dodecyl sulfate) is reported. Transmission electron microscopy technique confirms the formation of PPy nanoparticles of sizes ∼52 to 28 nm under surfactant directed approach. The room temperature electrical conductivity of the prepared nanoparticles found to increase from 3 to 22 S/cm with surfactant concentration. The temperature dependent activation energy rules out the possibility of band conduction mechanism in the prepared PPy nanoparticles and thus the synthesized nanoparticles are analyzed under variable range hopping (VRH) model for conduction mechanism. The PPy nanoparticles, reduced with liquid ammonia, hold 3D VRH conduction mechanism for the charge transport. However, in the doped samples, some deviation from 3D VRH conduction behavior at higher temperatures (>150 K) has been observed. This may be attributed to the presence of anionic surfactant in these samples. The doping of anionic surfactant causes rise in conducting islands, which may lead to the change in the shape/distribution of density of states governed by Gaussian or exponential type near Fermi level

  18. Effect of anionic surfactant concentration on the variable range hopping conduction in polypyrrole nanoparticles

    Science.gov (United States)

    Rawal, Ishpal; Kaur, Amarjeet

    2014-01-01

    The mechanism of charge transport in polypyrrole (PPy) nanoparticles prepared with different concentrations (5 to 30 mM) of anionic surfactant (sodium dodecyl sulfate) is reported. Transmission electron microscopy technique confirms the formation of PPy nanoparticles of sizes ˜52 to 28 nm under surfactant directed approach. The room temperature electrical conductivity of the prepared nanoparticles found to increase from 3 to 22 S/cm with surfactant concentration. The temperature dependent activation energy rules out the possibility of band conduction mechanism in the prepared PPy nanoparticles and thus the synthesized nanoparticles are analyzed under variable range hopping (VRH) model for conduction mechanism. The PPy nanoparticles, reduced with liquid ammonia, hold 3D VRH conduction mechanism for the charge transport. However, in the doped samples, some deviation from 3D VRH conduction behavior at higher temperatures (>150 K) has been observed. This may be attributed to the presence of anionic surfactant in these samples. The doping of anionic surfactant causes rise in conducting islands, which may lead to the change in the shape/distribution of density of states governed by Gaussian or exponential type near Fermi level.

  19. Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

    National Research Council Canada - National Science Library

    Roberts, Christopher

    2003-01-01

    .... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

  20. Variable range hopping in TiO2 insulating layers for oxide electronic devices

    Directory of Open Access Journals (Sweden)

    Y. L. Zhao

    2012-03-01

    Full Text Available TiO2 thin films are of importance in oxide electronics, e.g., Pt/TiO2/Pt for memristors and Co-TiO2/TiO2/Co-TiO2 for spin tunneling devices. When such structures are deposited at a variety of oxygen pressures, how does TiO2 behave as an insulator? We report the discovery of an anomalous resistivity minimum in a TiO2 film at low pressure (not strongly dependent on deposition temperature. Hall measurements rule out band transport and in most of the pressure range the transport is variable range hopping (VRH though below 20 K it was difficult to differentiate between Mott and Efros-Shklovskii's (ES mechanism. Magnetoresistance (MR of the sample with lowest resistivity was positive at low temperature (for VRH but negative above 10 K indicating quantum interference effects.

  1. Efros-Shklovskii variable range hopping and nonlinear transport in 1 T /1 T'-MoS2

    Science.gov (United States)

    Papadopoulos, N.; Steele, G. A.; van der Zant, H. S. J.

    2017-12-01

    We have studied temperature- and electric-field-dependent carrier transport in single flakes of MoS2 treated with n -butyllithium. The temperature dependence of the four-terminal resistance follows the Efros-Shklovskii variable range hopping conduction mechanism. From measurements in the Ohmic and non-Ohmic regime, we estimate the localization length and the average hopping length of the carriers, as well as the effective dielectric constant. Furthermore, a comparison between two- and four-probe measurements yields a contact resistance that increases significantly with decreasing temperature.

  2. Transport Properties of the Organic Conductor (TMTSF)2BrO4: Evidence of Variable Range Hopping

    DEFF Research Database (Denmark)

    Mortensen, Kell; Jacobsen, Claus Schelde; Bechgaard, Klaus

    1984-01-01

    A study of d.c. and microwave conductivity and thermoelectric power of the organic conductor (TMTSF)2BrO4 is presented. The transport properties are in qualitative agreement with charge transport via variable-range hopping among localized states. The localization is attributed to the anions, which...

  3. Variable-range hopping in 2D quasi-1D electronic systems

    International Nuclear Information System (INIS)

    Teber, S.

    2005-12-01

    A semi-phenomenological theory of variable-range hopping (VRH) is developed for two-dimensional (2D) quasi-one-dimensional (quasi-1D) systems such as arrays of quantum wires in the Wigner crystal regime. The theory follows the phenomenology of Efros, Mott and Shklovskii allied with microscopic arguments. We first derive the Coulomb gap in the single-particle density of states, g(ε), where ε is the energy of the charge excitation. We then derive the main exponential dependence of the electron conductivity in the linear (L), i.e. σ(T) ∼ exp [-(T L /T) γL ], and current in the non-linear (NL), i.e. j(E) ∼ [-(E NL /E) γNL ], response regimes (E is the applied electric field). Due to the strong anisotropy of the system and its peculiar dielectric properties we show that unusual, with respect to known results, Coulomb gaps open followed by unusual VRH laws, i.e. with respect to the disorder-dependence of T L and E NL and the values of γ L and γ NL . (author)

  4. Hopping system control with an approximated dynamics model and upper-body motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

    2015-11-15

    A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

  5. Polaron variable range hopping in TiO2-δ(-0.04=<δ=<0.2) thin films

    International Nuclear Information System (INIS)

    Heluani, S.P.; Comedi, D.; Villafuerte, M.; Juarez, G.

    2007-01-01

    The mechanisms of electrical conduction in TiO 2-δ (-0.04= 2 +Ar gas atmospheres where changes in δ and film structure had been achieved by varying the O 2 flow rate and the substrate temperature. The electrical transport properties of these samples were investigated by measuring the conductivity as a function of temperature between 17K and room temperature. At the temperature range between 200 and 290K the best fit to the experimental data was obtained assuming a dependence characteristic of adiabatic variable range hopping. At lower temperature the activation energy for the conductivity tends to zero. The results suggest that the conduction mechanism is adiabatic small polaron hopping, which switches to conduction in a polaron band at low temperatures

  6. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid; Elsawy, Hesham; Alouini, Mohamed-Slim

    2015-01-01

    dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per

  7. Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity

    Science.gov (United States)

    Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir

    2018-05-01

    We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

  8. Exact Results on Quantum Interference and Magnetoconductance in Variable-Range Hopping

    Science.gov (United States)

    Lin, Yeong-Lieh; Nori, Franco

    1997-03-01

    We study quantum interference effects on the transition strength for strongly localized electrons hopping on 2D square and 3D cubic lattices in a magnetic field B. In 2D, we obtain closed-form expressions for the tunneling probability between two arbitrary sites by exactly summing the corresponding phase factors of all directed paths connecting them. An analytic expression for the magnetoconductance, as an explicit function of the magnetic flux, is derived. A positive MC is clearly observed when turning on the magnetic field. When the strength of B reaches a certain value, which is inversely proportional to twice the hopping length, the MC is increased by a factor of two compared to that at zero field. The periodicity in the flux of the MC is found to be equal to hc/2e. In the experimentally important 3D case, we show how the interference patterns and the small-B behavior of the magnetoconductance vary according to the orientation of B. Furthermore, for a 3D sample, the effect on the low-flux MC due to the randomness of the angles between the hopping direction and the orientation of B is examined analytically.(Y.-L. Lin and F. Nori, Phys. Rev. Lett. 76), 4580 (1996); Phys. Rev. B 53, 15543 (1996).

  9. Integrating model checking with HiP-HOPS in model-based safety analysis

    International Nuclear Information System (INIS)

    Sharvia, Septavera; Papadopoulos, Yiannis

    2015-01-01

    The ability to perform an effective and robust safety analysis on the design of modern safety–critical systems is crucial. Model-based safety analysis (MBSA) has been introduced in recent years to support the assessment of complex system design by focusing on the system model as the central artefact, and by automating the synthesis and analysis of failure-extended models. Model checking and failure logic synthesis and analysis (FLSA) are two prominent MBSA paradigms. Extensive research has placed emphasis on the development of these techniques, but discussion on their integration remains limited. In this paper, we propose a technique in which model checking and Hierarchically Performed Hazard Origin and Propagation Studies (HiP-HOPS) – an advanced FLSA technique – can be applied synergistically with benefit for the MBSA process. The application of the technique is illustrated through an example of a brake-by-wire system. - Highlights: • We propose technique to integrate HiP-HOPS and model checking. • State machines can be systematically constructed from HiP-HOPS. • The strengths of different MBSA techniques are combined. • Demonstrated through modeling and analysis of brake-by-wire system. • Root cause analysis is automated and system dynamic behaviors analyzed and verified

  10. An analytical model for the performance of geographical multi-hop broadcast

    NARCIS (Netherlands)

    Klein Wolterink, W.; Heijenk, G.; Berg, J.L. van den

    2012-01-01

    In this paper we present an analytical model accurately describing the behaviour of a multi-hop broadcast protocol. Our model covers the scenario in which a message is forwarded over a straight road and inter-node distances are distributed exponentially. Intermediate forwarders draw a small random

  11. Longitudinal hopping in intervehicle communication: Theory and simulations on modeled and empirical trajectory data

    Science.gov (United States)

    Thiemann, Christian; Treiber, Martin; Kesting, Arne

    2008-09-01

    Intervehicle communication enables vehicles to exchange messages within a limited broadcast range and thus self-organize into dynamical and geographically embedded wireless ad hoc networks. We study the longitudinal hopping mode in which messages are transported using equipped vehicles driving in the same direction as a relay. Given a finite communication range, we investigate the conditions where messages can percolate through the network, i.e., a linked chain of relay vehicles exists between the sender and receiver. We simulate message propagation in different traffic scenarios and for different fractions of equipped vehicles. Simulations are done with both, modeled and empirical traffic data. These results are used to test the limits of applicability of an analytical model assuming a Poissonian distance distribution between the relays. We found a good agreement for homogeneous traffic scenarios and sufficiently low percentages of equipped vehicles. For higher percentages, the observed connectivity was higher than that of the model while in stop-and-go traffic situations it was lower. We explain these results in terms of correlations of the distances between the relay vehicles. Finally, we introduce variable transmission ranges and found that this additional stochastic component generally increased connectivity compared to a deterministic transmission with the same mean.

  12. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    Energy Technology Data Exchange (ETDEWEB)

    Dou, Wenjie; Subotnik, Joseph E. [Department of Chemistry, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States); Nitzan, Abraham [School of Chemistry, The Sackler Faculty of Science, Tel Aviv University, Tel Aviv 69978 (Israel)

    2015-02-28

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case of out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.

  13. Conductance of partially disordered graphene: crossover from temperature-dependent to field-dependent variable-range hopping

    International Nuclear Information System (INIS)

    Cheah, C Y; Jaurigue, L C; Kaiser, A B; Gómez-Navarro, C

    2013-01-01

    We report an analysis of low-temperature measurements of the conductance of partially disordered reduced graphene oxide, finding that the data follow a simple crossover scenario. At room temperature, the conductance is dominated by two-dimensional (2D) electric field-assisted, thermally driven (Pollak–Riess) variable-range hopping (VRH) through highly disordered regions. However, at lower temperatures T, we find a smooth crossover to follow the exp(−E 0 /E) 1/3 field-driven (Shklovskii) 2D VRH conductance behaviour when the electric field E exceeds a specific crossover value E C (T) 2D =(E a E 0 1/3 /3) 3/4 determined by the scale factors E 0 and E a for the high-field and intermediate-field regimes respectively. Our crossover scenario also accounts well for experimental data reported by other authors for three-dimensional disordered carbon networks, suggesting wide applicability. (paper)

  14. Analysis of the trajectory surface hopping method from the Markov state model perspective

    International Nuclear Information System (INIS)

    Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara

    2015-01-01

    We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

  15. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  16. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid

    2015-11-19

    Carrier sense multiple access (CSMA) protocol is standardized for vehicular communication to ensure a distributed and efficient communication between vehicles. However, several vehicular applications require efficient multi-hop information dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per-hop packet forward progress, per-hop transmission success probability, and spatial frequency reuse (SFR) efficiency imposed by different packet forwarding schemes, namely, most forward with fixed radius (MFR), the nearest with forward progress (NFP), and the random with forward progress (RFP). We also define a new performance metric, denoted as the aggregate packet progress (APP), which is a dimensionless quantity that captures the aforementioned tradeoffs. To this end, the developed model reveals the interplay between the spectrum sensing threshold (th) of the CSMA protocol and the packet forwarding scheme. Our results show that, in contrary to ALOHA networks which always favor NFP, MFR may achieve the highest APP in CSMA networks if th is properly chosen.

  17. Investigation of hopped frequency waveforms for range and velocity measurements of radar targets

    CSIR Research Space (South Africa)

    Kathree, U

    2015-10-01

    Full Text Available In the field of radar, High Range Resolution (HRR) profiles are often used to improve target tracking accuracy in range and to allow the radar system to produce an image of an object using techniques such as inverse synthetic aperture radar (ISAR...

  18. Characterization of SiO2/SiC interface states and channel mobility from MOSFET characteristics including variable-range hopping at cryogenic temperature

    Directory of Open Access Journals (Sweden)

    Hironori Yoshioka

    2018-04-01

    Full Text Available The characteristics of SiC MOSFETs (drain current vs. gate voltage were measured at 0.14−350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm−2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V−1s−1 and was almost independent of temperature.

  19. Characterization of SiO2/SiC interface states and channel mobility from MOSFET characteristics including variable-range hopping at cryogenic temperature

    Science.gov (United States)

    Yoshioka, Hironori; Hirata, Kazuto

    2018-04-01

    The characteristics of SiC MOSFETs (drain current vs. gate voltage) were measured at 0.14-350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm-2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V-1s-1 and was almost independent of temperature.

  20. Role of band states and trap states in the electrical properties of organic semiconductors: Hopping versus mobility edge model

    KAUST Repository

    Mehraeen, Shafigh; Coropceanu, Veaceslav; Bré das, Jean-Luc

    2013-01-01

    We compare the merits of a hopping model and a mobility edge model in the description of the effect of charge-carrier concentration on the electrical conductivity, carrier mobility, and Fermi energy of organic semiconductors. We consider the case

  1. Two-dimensional variable range hopping in the spin-liquid candidate κ-(BEDT-TTF)2Cu2(CN)3

    International Nuclear Information System (INIS)

    Čulo, M.; Tafra, E.; Basletić, M.; Tomić, S.; Hamzić, A.; Korin-Hamzić, B.; Dressel, M.; Schlueter, J.A.

    2015-01-01

    We present the measurements of the magnetotransport properties of the spin liquid candidate κ-(BEDT-TTF) 2 Cu 2 (CN) 3 . The temperature dependencies of dc resistivity and Hall coefficient R H as well as magnetoresistance at fixed temperatures in magnetic fields up to 5 T suggest that the charge transport takes place via 2D variable range hopping among localized states

  2. Thermally assisted variable range hopping in Tl4S3Se crystal

    Indian Academy of Sciences (India)

    This proposed model is also used to explain the conduction mechanism and investigate the electrical conduction ... The simulation was handled with the help of MATlab soft- ware. ..... Mott N F and Davis E A 1979 Electronic process in non.

  3. A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

    Science.gov (United States)

    Yu, Hua-Gen

    2008-05-21

    A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

  4. Exact solution of the one-dimensional fermionic model with correlated hopping

    International Nuclear Information System (INIS)

    Schadschneider, A.; Su Gang; Zittartz, J.

    1997-01-01

    We extend the Bethe Ansatz solution of a one-dimensional integrable fermionic model with correlated hopping to the parameter regime Δt > 1. It is found that the model is equivalent to one with interaction 2 - Δt, but with twisted boundary conditions. Apart from the ground state energy we investigate the low-lying excitations and the asymptotic behaviour of the correlation functions. As in the case of Δt < 1 we find dominating superconducting correlations for small doping. The behaviour in this regime therefore differs from that of the non-integrable model with symmetric bond-charge interaction (Hirsch model). (orig.)

  5. Hop-distance relationship analysis with quasi-UDG model for node localization in wireless sensor networks

    Directory of Open Access Journals (Sweden)

    Chen Ping

    2011-01-01

    Full Text Available Abstract In wireless sensor networks (WSNs, location information plays an important role in many fundamental services which includes geographic routing, target tracking, location-based coverage, topology control, and others. One promising approach in sensor network localization is the determination of location based on hop counts. A critical priori of this approach that directly influences the accuracy of location estimation is the hop-distance relationship. However, most of the related works on the hop-distance relationship assume the unit-disk graph (UDG model that is unrealistic in a practical scenario. In this paper, we formulate the hop-distance relationship for quasi-UDG model in WSNs where sensor nodes are randomly and independently deployed in a circular region based on a Poisson point process. Different from the UDG model, quasi-UDG model has the non-uniformity property for connectivity. We derive an approximated recursive expression for the probability of the hop count with a given geographic distance. The border effect and dependence problem are also taken into consideration. Furthermore, we give the expressions describing the distribution of distance with known hop counts for inner nodes and those suffered from the border effect where we discover the insignificance of the border effect. The analytical results are validated by simulations showing the accuracy of the employed approximation. Besides, we demonstrate the localization application of the formulated relationship and show the accuracy improvement in the WSN localization.

  6. Majorana zero modes in the hopping-modulated one-dimensional p-wave superconducting model.

    Science.gov (United States)

    Gao, Yi; Zhou, Tao; Huang, Huaixiang; Huang, Ran

    2015-11-20

    We investigate the one-dimensional p-wave superconducting model with periodically modulated hopping and show that under time-reversal symmetry, the number of the Majorana zero modes (MZMs) strongly depends on the modulation period. If the modulation period is odd, there can be at most one MZM. However if the period is even, the number of the MZMs can be zero, one and two. In addition, the MZMs will disappear as the chemical potential varies. We derive the condition for the existence of the MZMs and show that the topological properties in this model are dramatically different from the one with periodically modulated potential.

  7. COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT.

    Science.gov (United States)

    Kivlan, Benjamin R; Carcia, Christopher R; Christoforetti, John J; Martin, RobRoy L

    2016-08-01

    Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Quasi-experimental, cohort comparison. Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop

  8. Role of transverse hopping in a two-coupled-chains model

    International Nuclear Information System (INIS)

    Fabrizio, M.

    1993-01-01

    We study the effect of a transverse hopping t perpendicular in two chains of both spinless and spinning repulsively interacting fermions, by means of renormalization group and bosonization techniques. We show that, independent of the presence of spin, t perpendicular strongly modifies the asymptotic long-wavelength behavior of the two chains, opening gaps in the excitation spectra. The origin of the instability of the gapless Luttinger-liquid behavior is identified in the flavor (==chain index) anisotropy induced by t perpendicular . In the case of spinning fermions, it leads to dominant pair fluctuations, in spite of the repulsive interaction. The role of spin is further analyzed in a model of two coupled chains showing, in the absence of t perpendicular , spin-charge separation without anomalous exponents. We solve this model exactly by the bosonization technique, and we find that the interesting analytical properties induced by spin-charge separation persist in the presence of transverse hopping, although t perpendicular does modify the shape of the Fermi surface. The asymptotic expression of the single-particle Green function is also obtained

  9. Algebraic approach to q-deformed supersymmetric variants of the Hubbard model with pair hoppings

    International Nuclear Information System (INIS)

    Arnaudon, D.

    1997-01-01

    Two quantum spin chains Hamiltonians with quantum sl(2/1) invariance are constructed. These spin chains define variants of the Hubbard model and describe electron models with pair hoppings. A cubic algebra that admits the Birman-Wenzl-Murakami algebra as a quotient allows exact solvability of the periodic chain. The two Hamiltonians, respectively built using the distinguished and the fermionic bases of U q (sl(2/1)) differ only in the boundary terms. They are actually equivalent, but the equivalence is non local. Reflection equations are solved to get exact solvability on open chains with non trivial boundary conditions. Two families of diagonal solutions are found. The centre and the s-Casimir of the quantum enveloping algebra of sl(2/1) appear as tools for the construction of exactly solvable Hamiltonians. (author)

  10. Simple Models for the Performance Evaluation of a Class of Two-Hop Relay Protocols

    NARCIS (Netherlands)

    Al Hanbali, Ahmad; Kherani, Arzad A.; Nain, Philippe

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  11. Simple models for the performance evaluation of a class of two-hop relay protocols

    NARCIS (Netherlands)

    Al Hanbali, A.; Kherani, A.A.; Nain, P.; Akyildiz, I.F.; Sivakumar, R.; Ekici, E.; Cavalcante de Oliveira, J.; McNair, J.

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  12. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability of radio links and communication routes. This paper presents an analytical study of the link and route availability in inter-working multi-hop wireless networks....

  13. A versatile infinite-state Markov reward model to study bottlenecks in 2-hop ad hoc networks

    NARCIS (Netherlands)

    Remke, Anne Katharina Ingrid; Haverkort, Boudewijn R.H.M.; Cloth, L.

    2006-01-01

    In a 2-hop IEEE 801.11-based wireless LAN, the distributed coordination function (DCF) tends to equally share the available capacity among the contending stations. Recently alternative capacity sharing strategies have been made possible. We propose a versatile infinite-state Markov reward model to

  14. Hopping model for the non-Debye dielectric response in ionic crystals

    International Nuclear Information System (INIS)

    Wang, J.C.; Bates, J.B.

    1988-10-01

    A model based on ion hopping in potential double-wells is proposed to explain the non-Debye dielectric response in solids. Relying on some assumptions, an attempt is made to remove the ''average'' nature of previous diffusion theories. This results in a distribution of activation energies, G(E), which decays exponentially on both sides of some given value E/sub o/. It is shown that the existence of a dielectric loss peak is a result of the decay of G(E) for E > E 0 the constant-phase-angle behavior above the loss peak is associated with the decay of G(E) for E 0 , and G(E) can produce all the main features of the empirical Havriliak-Negami function. An interesting property of this G(E) is that it broadens with increasing temperature, consistent with many experimental observations. 18 refs., 3 figs

  15. Raman, dielectric and variable range hopping nature of Gd2O3-doped K0.5N0.5NbO3 piezoelectric ceramics

    Directory of Open Access Journals (Sweden)

    Mahesh Peddigari

    2015-10-01

    Full Text Available (K0.5Na0.5NbO3 (KNN + x wt% Gd2O3 (x = 0 -1.5 ceramics have been prepared by conventional solid state reaction method. The effect of Gd2O3 on the structural, microstructural and dielectric properties of KNN ceramics were studied systematically. The effect of Gd2O3 on phase transformation from orthorhombic to psuedocubic structure is explained interms of changes in the internal vibration modes of NbO6 octahedra. The Raman intensity of the stretching mode v1 enhanced and shifted toward higher wavenumber with Gd2O3 concentration, which is attributed to the increase in polarizability and change in the O-Nb-O bond angles. Microstructural analysis revealed that the grain size of the KNN ceramics decreases from 2.26 ± 1.07 μm to 0.35 ± 0.13 μm and becomes homogenous with an increase in Gd2O3 concentration. The frequency dependent dielectric spectra are analyzed by using Havriliak-Negami function. The fitted symmetry parameter and relaxation time (τ are found to be 0.914 and 8.78 × 10−10 ± 5.5 × 10−11 s, respectively for the sample doped with x = 1.0. The addition of Gd2O3 to the KNN shifted the polymorphic phase transition orthorhombic to tetragonal transition temperature (TO-T from 199oC to 85oC with enhanced dielectric permittivity (ε′ = 1139 at 1 MHz. The sample with x = 1.0, shown a high dielectric permittivity (ε′ = 879 and low dielectric loss (<5% in the broad temperature range (-140oC – 150oC with the Curie temperature 307 oC can have the potential for high temperature piezoelectric and tunable RF circuit applications. The temperature dependent AC-conductivity follows the variable range hopping conduction mechanism by obtaining the slope -0.25 from the ln[ln(ρac] versus ln(T graph in the temperature range of 133 K-308 K. The effect of Gd2O3 on the Mott’s parameters such as density of states (N(EF, hopping length (RH, and hopping energy (WH have been discussed.

  16. Infinite-range Heisenberg model and high-temperature superconductivity

    Science.gov (United States)

    Tahir-Kheli, Jamil; Goddard, William A., III

    1993-11-01

    A strongly coupled variational wave function, the doublet spin-projected Néel state (DSPN), is proposed for oxygen holes in three-band models of high-temperature superconductors. This wave function has the three-spin system of the oxygen hole plus the two neighboring copper atoms coupled in a spin-1/2 doublet. The copper spins in the neighborhood of a hole are in an eigenstate of the infinite-range Heisenberg antiferromagnet (SPN state). The doublet three-spin magnetic polaron or hopping polaron (HP) is stabilized by the hopping terms tσ and tτ, rather than by the copper-oxygen antiferromagnetic coupling Jpd. Although, the HP has a large projection onto the Emery (Dg) polaron, a non-negligible amount of doublet-u (Du) character is required for optimal hopping stabilization. This is due to Jdd, the copper-copper antiferromagnetic coupling. For the copper spins near an oxygen hole, the copper-copper antiferromagnetic coupling can be considered to be almost infinite ranged, since the copper-spin-correlation length in the superconducting phase (0.06-0.25 holes per in-plane copper) is approximately equal to the mean separation of the holes (between 2 and 4 lattice spacings). The general DSPN wave function is constructed for the motion of a single quasiparticle in an antiferromagnetic background. The SPN state allows simple calculations of various couplings of the oxygen hole with the copper spins. The energy minimum is found at symmetry (π/2,π/2) and the bandwidth scales with Jdd. These results are in agreement with exact computations on a lattice. The coupling of the quasiparticles leads to an attraction of holes and its magnitude is estimated.

  17. Extensive Investigations on Bio-Inspired Trust and Reputation Model over Hops Coefficient Factor in Distributed Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Vinod Kumar Verma

    2014-08-01

    Full Text Available Resource utilization requires a substantial consideration for a trust and reputation model to be deployed within a wireless sensor network (WSN. In the evaluation, our attention is focused on the effect of hops coefficient factor estimation on WSN with bio-inspired trust and reputation model (BTRM. We present the state-of-the-art system level evaluation of accuracy and path length of sensor node operations for their current and average scenarios. Additionally, we emphasized over the energy consumption evaluation for static, dynamic and oscillatory modes of BTRM-WSN model. The performance of the hops coefficient factor for our proposed framework is evaluated via analytic bounds and numerical simulations.

  18. Thermally activated phase slip and variable range hopping in Tm(Ba{sub 2-x}Pr{sub x})Cu{sub 3}O{sub 7+{delta}}

    Energy Technology Data Exchange (ETDEWEB)

    Mokhtari, Z.; Khosroabadi, H.; Akhavan, M. [Magnet Research Laboratory (MRL), Department of Physics, Sharif University of Technology, P.O. Box 11365-9161, Tehran (Iran)

    2004-05-01

    The magnetoresistance measurement of single phase polycrystalline TmBa{sub 2-x}Pr{sub x}Cu{sub 3}O{sub 7+{delta}} samples have been analyzed by the Ambegaokar and Halperine (AH) phase slip model. The magnetic field dependence of pinning energy power factors increase with the increase of Pr doping. The derived critical current density from the AH theory decreases with increasing magnetic field and Pr-doping for all superconducting samples. It shows that the Pr-doping plays the role of weak link. We have also investigated the normal state resistivity with the hopping model. We have found a CG-VRH cross-over with the increase of Pr content near metal insulator transition. The deacrease of the localization length of the carriers show that Pr-doping strongly localizes the carriers, and finally causes the suppression of superconductivity. (copyright 2004 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Anderson localization in one-dimensional quasiperiodic lattice models with nearest- and next-nearest-neighbor hopping

    International Nuclear Information System (INIS)

    Gong, Longyan; Feng, Yan; Ding, Yougen

    2017-01-01

    Highlights: • Quasiperiodic lattice models with next-nearest-neighbor hopping are studied. • Shannon information entropies are used to reflect state localization properties. • Phase diagrams are obtained for the inverse bronze and golden means, respectively. • Our studies present a more complete picture than existing works. - Abstract: We explore the reduced relative Shannon information entropies SR for a quasiperiodic lattice model with nearest- and next-nearest-neighbor hopping, where an irrational number is in the mathematical expression of incommensurate on-site potentials. Based on SR, we respectively unveil the phase diagrams for two irrationalities, i.e., the inverse bronze mean and the inverse golden mean. The corresponding phase diagrams include regions of purely localized phase, purely delocalized phase, pure critical phase, and regions with mobility edges. The boundaries of different regions depend on the values of irrational number. These studies present a more complete picture than existing works.

  20. Anderson localization in one-dimensional quasiperiodic lattice models with nearest- and next-nearest-neighbor hopping

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Longyan, E-mail: lygong@njupt.edu.cn [Information Physics Research Center and Department of Applied Physics, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China); Institute of Signal Processing and Transmission, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China); National Laboratory of Solid State Microstructures, Nanjing University, Nanjing 210093 (China); Feng, Yan; Ding, Yougen [Information Physics Research Center and Department of Applied Physics, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China); Institute of Signal Processing and Transmission, Nanjing University of Posts and Telecommunications, Nanjing, 210003 (China)

    2017-02-12

    Highlights: • Quasiperiodic lattice models with next-nearest-neighbor hopping are studied. • Shannon information entropies are used to reflect state localization properties. • Phase diagrams are obtained for the inverse bronze and golden means, respectively. • Our studies present a more complete picture than existing works. - Abstract: We explore the reduced relative Shannon information entropies SR for a quasiperiodic lattice model with nearest- and next-nearest-neighbor hopping, where an irrational number is in the mathematical expression of incommensurate on-site potentials. Based on SR, we respectively unveil the phase diagrams for two irrationalities, i.e., the inverse bronze mean and the inverse golden mean. The corresponding phase diagrams include regions of purely localized phase, purely delocalized phase, pure critical phase, and regions with mobility edges. The boundaries of different regions depend on the values of irrational number. These studies present a more complete picture than existing works.

  1. Two-band model with off-diagonal occupation dependent hopping rate

    International Nuclear Information System (INIS)

    Zawadowski, A.

    1989-01-01

    In this paper two-band hopping model is treated on a two-dimensional square lattice. The atoms are located at the corners and the middles of the edges of the squares. In addition to the strongly overlapping orbitals of the atoms, there are extra orbitals at the corners, which are weakly hybridized. The assumption is made that the Fermi level is inside the broad band and is every near to the narrow band formed by the extra orbitals. The hamiltonian is Hubbard type, but the off-diagonal part of the two-site interaction t is kept also where one creation or annihilation operator acts on the extra orbital and the others on one of its neighbors. The weak coupling t is enhanced by the on-site Coulomb repulsion at the corners, which enhancement is a power function of the ratio of the broad band width and the narrow bank position measured from the Fermi level. That enhancement is obtained by summation of logarithmic Kondo-type corrections of orbital origin, which reflects the formation of a ground state of new type with strong orbital and spin correlations. Interaction between the particles of the broad band is generated by processes with one heavy and one light particle in the intermediate state

  2. Basin Hopping Graph

    DEFF Research Database (Denmark)

    Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

    2014-01-01

    of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

  3. Toward quantitative prediction of charge mobility in organic semiconductors: tunneling enabled hopping model.

    Science.gov (United States)

    Geng, Hua; Peng, Qian; Wang, Linjun; Li, Haijiao; Liao, Yi; Ma, Zhiying; Shuai, Zhigang

    2012-07-10

    A tunneling-enabled hopping mechanism is proposed, providing a pratical tool to quantitatively assess charge mobility in organic semiconductors. The paradoxical phenomena in TIPS-pentacene is well explained in that the optical probe indicates localized charges while transport measurements show bands of charge. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Hall effect in hopping regime

    International Nuclear Information System (INIS)

    Avdonin, A.; Skupiński, P.; Grasza, K.

    2016-01-01

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  5. Hall effect in hopping regime

    Energy Technology Data Exchange (ETDEWEB)

    Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

    2016-02-15

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  6. Structural, nanomechanical and variable range hopping conduction behavior of nanocrystalline carbon thin films deposited by the ambient environment assisted filtered cathodic jet carbon arc technique

    Energy Technology Data Exchange (ETDEWEB)

    Panwar, O.S., E-mail: ospanwar@mail.nplindia.ernet.in [Polymorphic Carbon Thin Films Group, Physics of Energy Harvesting Division, CSIR-National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi - 110 012 (India); Rawal, Ishpal; Tripathi, R.K. [Polymorphic Carbon Thin Films Group, Physics of Energy Harvesting Division, CSIR-National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi - 110 012 (India); Srivastava, A.K. [Electron and Ion Microscopy, Sophisticated and Analytical Instruments, CSIR-National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi - 110 012 (India); Kumar, Mahesh [Ultrafast Opto-Electronics and Tetrahertz Photonics Group, CSIR-National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi - 110 012 (India)

    2015-04-15

    Highlights: • Nanocrystalline carbon thin films are grown by filtered cathodic jet carbon arc process. • Effect of gaseous environment on the properties of carbon films has been studied. • The structural and nanomechanical properties of carbon thin films have been studied. • The VRH conduction behavior in nanocrystalline carbon thin films has been studied. - Abstract: This paper reports the deposition and characterization of nanocrystalline carbon thin films by filtered cathodic jet carbon arc technique assisted with three different gaseous environments of helium, nitrogen and hydrogen. All the films are nanocrystalline in nature as observed from the high resolution transmission electron microscopic (HRTEM) measurements, which suggests that the nanocrystallites of size ∼10–50 nm are embedded though out the amorphous matrix. X-ray photoelectron spectroscopic studies suggest that the film deposited under the nitrogen gaseous environment has the highest sp{sup 3}/sp{sup 2} ratio accompanied with the highest hardness of ∼18.34 GPa observed from the nanoindentation technique. The film deposited under the helium gaseous environment has the highest ratio of the area under the Raman D peak to G peak (A{sub D}/A{sub G}) and the highest conductivity (∼2.23 S/cm) at room temperature, whereas, the film deposited under the hydrogen environment has the lowest conductivity value (2.27 × 10{sup −7} S/cm). The temperature dependent dc conduction behavior of all the nanocrystalline carbon thin films has been analyzed in the light of Mott’s variable range hopping (VRH) conduction mechanism and observed that all the films obey three dimension VRH conduction mechanism for the charge transport.

  7. Bose-glass behavior in Bi2Sr2Ca1-xYxCu2O8 crystals with columnar defects: Experimental evidence for variable-range hopping

    International Nuclear Information System (INIS)

    Ta Phuoc, V.; Sousa, R. de; Ammor, L.; Soret, J.C.; Ruyter, A.; Wahl, A.

    1998-01-01

    Disorder plays a crucial role in the static and dynamic properties of the mixed state of high-T c cuprates. A main feature of the diagram phase is the phase transition separating a high temperature vortex liquid-like state from a low temperature vortex solid-like state. In particular, the nature of the latter depends on the strength and the dimensionality of disorder. In the presence of an unidimensional disorder, Nelson and Vinokur predict a Bose-glass. In this paper, the authors concern themselves with the variable-range vortex hopping transport predicted in a Bose-glass. They report on vortex transport in Bi 2 Sr 2 Ca 1-x Y x Cu 2 O 8 crystals irradiated at different doses of heavy ions. They show evidence of a flux-creep resistivity typical of a variable-range vortex hopping mechanism as predicted by Nelson and Vinokur

  8. Supercritical carbon dioxide hop extraction

    Directory of Open Access Journals (Sweden)

    Pfaf-Šovljanski Ivana I.

    2005-01-01

    Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

  9. Role of band states and trap states in the electrical properties of organic semiconductors: Hopping versus mobility edge model

    KAUST Repository

    Mehraeen, Shafigh

    2013-05-01

    We compare the merits of a hopping model and a mobility edge model in the description of the effect of charge-carrier concentration on the electrical conductivity, carrier mobility, and Fermi energy of organic semiconductors. We consider the case of a composite electronic density of states (DOS) that consists of a superposition of a Gaussian DOS and an exponential DOS. Using kinetic Monte Carlo simulations, we apply the two models in order to interpret the recent experimental data reported for n-doped C60 films. While both models are capable of reproducing the experimental data very well and yield qualitatively similar characteristic parameters for the density of states, some discrepancies are found at the quantitative level. © 2013 American Physical Society.

  10. The infinite range Heisenberg model and high temperature superconductivity

    Science.gov (United States)

    Tahir-Kheli, Jamil

    1992-01-01

    The thesis deals with the theory of high temperature superconductivity from the standpoint of three-band Hubbard models.Chapter 1 of the thesis proposes a strongly coupled variational wavefunction that has the three-spin system of an oxygen hole and its two neighboring copper spins in a doublet and the background Cu spins in an eigenstate of the infinite range antiferromagnet. This wavefunction is expected to be a good "zeroth order" wavefunction in the superconducting regime of dopings. The three-spin polaron is stabilized by the hopping terms rather than the copper-oxygen antiferromagnetic coupling Jpd. Considering the effect of the copper-copper antiferromagnetic coupling Jdd, we show that the three-spin polaron cannot be pure Emery (Dg), but must have a non-negligible amount of doublet-u (Du) character for hopping stabilization. Finally, an estimate is made for the magnitude of the attractive coupling of oxygen holes.Chapter 2 presents an exact solution to a strongly coupled Hamiltonian for the motion of oxygen holes in a 1-D Cu-O lattice. The Hamiltonian separates into two pieces: one for the spin degrees of freedom of the copper and oxygen holes, and the other for the charge degrees of freedom of the oxygen holes. The spinon part becomes the Heisenberg antiferromagnet in 1-D that is soluble by the Bethe Ansatz. The holon piece is also soluble by a Bethe Ansatz with simple algebraic relations for the phase shifts.Finally, we show that the nearest neighbor Cu-Cu spin correlation increases linearly with doping and becomes positive at x [...] 0.70.

  11. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček

    2015-01-01

    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  12. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  13. The spectrum and the quantum Hall effect on the square lattice with next-nearest-neighbor hopping: Statistics of holons and spinons in the t-J model

    International Nuclear Information System (INIS)

    Hatsugai, Y.; Kohmoto, M.

    1992-01-01

    We investigate the energy spectrum and the Hall effect of electrons on the square lattice with next-nearest-neighbor (NNN) hopping as well as nearest-neighbor hopping. General rational values of magnetic flux per unit cell φ=p/q are considered. In the absence of NNN hopping, the two bands at the center touch for q even, thus the Hall conductance is not well defined at half filling. An energy gap opens there by introducing NNN hoping. When φ=1/2, the NNN model coincides with the mean field Hamiltonian for the chiral spin state proposed by Wen, Wilczek and Zee (WWZ). The Hall conductance is calculated from the Diophantine equation and the E-φ diagram. We find that gaps close for other fillings at certain values of NNN hopping strength. The quantized value of the Hall conductance changes once this phenomenon occurs. In a mean field treatment of the t-J model, the effective Hamiltonian is the same as our NNN model. From this point of view, the statistics of the quasi-particles is not always semion and depends on the filling and the strength of the mean field. (orig.)

  14. Application of activated barrier hopping theory to viscoplastic modeling of glassy polymers

    Science.gov (United States)

    Sweeney, J.; Spencer, P. E.; Vgenopoulos, D.; Babenko, M.; Boutenel, F.; Caton-Rose, P.; Coates, P. D.

    2017-10-01

    An established statistical mechanical theory of amorphous polymer deformation has been incorporated as a plastic mechanism into a constitutive model and applied to a range of polymer mechanical deformations. The temperature and rate dependence of the tensile yield of PVC, as reported in early studies, has been modeled to high levels of accuracy. Tensile experiments on PET reported here are analyzed similarly and good accuracy is also achieved. The frequently observed increase in the gradient of the plot of yield stress against logarithm of strain rate is an inherent feature of the constitutive model. The form of temperature dependence of the yield that is predicted by the model is found to give an accurate representation. The constitutive model is developed in two-dimensional form and implemented as a user-defined subroutine in the finite element package ABAQUS. This analysis is applied to the tensile experiments on PET, in some of which strain is localized in the form of shear bands and necks. These deformations are modeled with partial success, though adiabatic heating of the instability causes inaccuracies for this isothermal implementation of the model. The plastic mechanism has advantages over the Eyring process, is equally tractable, and presents no particular difficulties in implementation with finite elements.

  15. Hopping absorption edge in silicon inversion layers

    International Nuclear Information System (INIS)

    Kostadinov, I.Z.

    1983-09-01

    The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

  16. Hole motion in the t-J and Hubbard models: Effect of a next-nearest-neighbor hopping

    International Nuclear Information System (INIS)

    Gagliano, E.; Bacci, S.; Dagotto, E.

    1990-01-01

    Using exact diagonalization techniques, we study one dynamical hole in the two-dimensional t-J and Hubbard models on a square lattice including a next-nearest-neighbor hopping t'. We present the phase diagram in the parameter space (J/t,t'/t), discussing the ground-state properties of the hole. At J=0, a crossing of levels exists at some value of t' separating a ferromagnetic from an antiferromagnetic ground state. For nonzero J, at least four different regions appear where the system behaves like an antiferromagnet or a (not fully saturated) ferromagnet. We study the quasiparticle behavior of the hole, showing that for small values of |t'| the previously presented string picture is still valid. We also find that, for a realistic set of parameters derived from the Cu-O Hamiltonian, the hole has momentum (π/2,π/2), suggesting an enhancement of the p-wave superconducting mode due to the second-neighbor interactions in the spin-bag picture. Results for the t-t'-U model are also discussed with conclusions similar to those of the t-t'-J model. In general we found that t'=0 is not a singular point of these models

  17. A Jackson network model and threshold policy for joint optimization of energy and delay in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-11-20

    This paper studies the joint optimization problem of energy and delay in a multi-hop wireless network. The optimization variables are the transmission rates, which are adjustable according to the packet queueing length in the buffer. The optimization goal is to minimize the energy consumption of energy-critical nodes and the packet transmission delay throughout the network. In this paper, we aim at understanding the well-known decentralized algorithms which are threshold based from a different research angle. By using a simplified network model, we show that we can adopt the semi-open Jackson network model and study this optimization problem in closed form. This simplified network model further allows us to establish some significant optimality properties. We prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate. We also prove that the threshold-type policy is optimal, i.e., when the number of packets in the buffer is larger than a threshold, transmit with the maximal rate (power); otherwise, no transmission. With these optimality properties, we develop a heuristic algorithm to iteratively find the optimal threshold. Finally, we conduct some simulation experiments to demonstrate the main idea of this paper.

  18. A Jackson network model and threshold policy for joint optimization of energy and delay in multi-hop wireless networks

    KAUST Repository

    Xia, Li; Shihada, Basem

    2014-01-01

    This paper studies the joint optimization problem of energy and delay in a multi-hop wireless network. The optimization variables are the transmission rates, which are adjustable according to the packet queueing length in the buffer. The optimization goal is to minimize the energy consumption of energy-critical nodes and the packet transmission delay throughout the network. In this paper, we aim at understanding the well-known decentralized algorithms which are threshold based from a different research angle. By using a simplified network model, we show that we can adopt the semi-open Jackson network model and study this optimization problem in closed form. This simplified network model further allows us to establish some significant optimality properties. We prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate. We also prove that the threshold-type policy is optimal, i.e., when the number of packets in the buffer is larger than a threshold, transmit with the maximal rate (power); otherwise, no transmission. With these optimality properties, we develop a heuristic algorithm to iteratively find the optimal threshold. Finally, we conduct some simulation experiments to demonstrate the main idea of this paper.

  19. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  20. KDT501, a derivative from hops, normalizes glucose metabolism and body weight in rodent models of diabetes.

    Directory of Open Access Journals (Sweden)

    Veera R Konda

    Full Text Available AIMS/HYPOTHESIS: We developed KDT501, a novel substituted 1,3-cyclopentadione chemically derived from hop extracts, and evaluated it in various in vitro and in vivo models of diabetes and insulin sensitivity. METHODS: KDT501 was evaluated for anti-inflammatory effects in monocyte/macrophage cells; agonistic activity for peroxisome proliferator-activated receptors (PPAR; lipogenesis and gene expression profile in human subcutaneous adipocytes. Body composition, glucose, insulin sensitivity, and lipids were assessed in diet-induced obesity (DIO mice and Zucker Diabetic Fatty (ZDF rats after oral administration. RESULTS: KDT501 mediated lipogenesis in 3T3L1 and human subcutaneous adipocytes; however, the gene expression profile of KDT501 differed from that of the full PPARγ agonist rosiglitazone, suggesting that KDT501 has pleiotropic biological activities. In addition, KDT501 showed only modest, partial PPARγ agonist activity and exhibited anti-inflammatory effects in monocytes/macrophages that were not observed with rosiglitazone. In a DIO mouse model, oral administration of KDT501 significantly reduced fed blood glucose, glucose/insulin AUC following an oral glucose bolus, and body fat. In ZDF rats, oral administration of KDT501 significantly reduced fed glucose, fasting plasma glucose, and glucose AUC after an oral glucose bolus. Significant, dose-dependent reductions of plasma hemoglobin A1c, weight gain, total cholesterol, and triglycerides were also observed in animals receiving KDT501. CONCLUSION: These results indicate that KDT501 produces a unique anti-diabetic profile that is distinct in its spectrum of pharmacological effects and biological mechanism from both metformin and pioglitazone. KDT501 may thus constitute a novel therapeutic agent for the treatment of Type 2 diabetes and associated conditions.

  1. A Boltzmann-weighted hopping model of charge transport in organic semicrystalline films

    KAUST Repository

    Kwiatkowski, Joe J.; Jimison, Leslie H.; Salleo, Alberto; Spakowitz, Andrew J.

    2011-01-01

    We present a model of charge transport in polycrystalline electronic films, which considers details of the microscopic scale while simultaneously allowing realistically sized films to be simulated. We discuss the approximations and assumptions made by the model, and rationalize its application to thin films of directionally crystallized poly(3-hexylthiophene). In conjunction with experimental data, we use the model to characterize the effects of defects in these films. Our findings support the hypothesis that it is the directional crystallization of these films, rather than their defects, which causes anisotropic mobilities. © 2011 American Institute of Physics.

  2. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  3. Model-driven harmonic parameterization of the cortical surface: HIP-HOP.

    Science.gov (United States)

    Auzias, G; Lefèvre, J; Le Troter, A; Fischer, C; Perrot, M; Régis, J; Coulon, O

    2013-05-01

    In the context of inter subject brain surface matching, we present a parameterization of the cortical surface constrained by a model of cortical organization. The parameterization is defined via an harmonic mapping of each hemisphere surface to a rectangular planar domain that integrates a representation of the model. As opposed to previous landmark-based registration methods we do not match folds between individuals but instead optimize the fit between cortical sulci and specific iso-coordinate axis in the model. This strategy overcomes some limitation to sulcus-based registration techniques such as topological variability in sulcal landmarks across subjects. Experiments on 62 subjects with manually traced sulci are presented and compared with the result of the Freesurfer software. The evaluation involves a measure of dispersion of sulci with both angular and area distortions. We show that the model-based strategy can lead to a natural, efficient and very fast (less than 5 min per hemisphere) method for defining inter subjects correspondences. We discuss how this approach also reduces the problems inherent to anatomically defined landmarks and open the way to the investigation of cortical organization through the notion of orientation and alignment of structures across the cortex.

  4. Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

    Science.gov (United States)

    Beyer, Eric W.

    is shown to validate the dynamic model. Using the validated dynamic model, simulations were performed to better understand the dynamics of the device. In addition, key parameters such as system weight, rotor speed, internal mass weight and location, as well as battery capacity are varied to explore and optimize flight performance characteristics such as single hop height and range, number of hops, and total achievable range. The sensitivity of the Hopping Rotochute to atmospheric winds is also investigated as is the ability of the device to perform trajectory shaping.

  5. On the connection between the macroscopical and microscopical evolution in an exactly soluble hopping model. II. Charged particles

    International Nuclear Information System (INIS)

    Banyai, L.; Gartner, P.

    1979-07-01

    The hopping rate equation for charged particles with self-consistent Coulomb interaction on an arbitrary periodic lattice can be solved exactly. It is shown that if one scales the time t and the distances x (including the characteristic length l as t → lambda 2 t, x → lambda x), then in the lambda → infinity limit the charge density and the potential tend to their macroscopical electrodynamic counterparts faster than lambda sup(-3) and lambda sup(-1) respectively. (author)

  6. Orbital Kondo effect due to assisted hopping: Superconductivity, mass enhancement in Cooper oxides with apical oxygen

    International Nuclear Information System (INIS)

    Zawadowski, A.; Penc, K.; Zimanyi, G.

    1991-07-01

    Orbital Kondo effect is treated in a model, where additional to the conduction band there are localized orbitals with energy not very far from the Fermi energy. If the hopping between the conduction band and the localized heavy orbitals depends on the occupation of the conduction band orbital then orbital Kondo correlation occurs. The assisted hopping vertex is enhanced due to the Coulomb interaction between the heavy orbital and the conduction band. The enhanced hopping results in mass enhancement and attractive interaction in the conduction band. The superconductivity transition temperature is calculated. The models of this type can be applied to the high-T c superconductors where the non-bonding oxygen orbitals of the apical oxygens play the role of heavy orbitals. For an essential range of the parameters the T c obtained is about 100K. (author). 22 refs, 9 figs

  7. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  8. Climate, weather, and hops

    Science.gov (United States)

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  9. Electron hopping through proteins

    Czech Academy of Sciences Publication Activity Database

    Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

    2012-01-01

    Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

  10. Low temperature hopping conduction in amorphous Gesub(x)Sesub(1-x)

    International Nuclear Information System (INIS)

    Mehra, R.M.; Kumar, H.; Agarwal, S.C.; Sikka, P.; Mathur, P.C.

    1985-08-01

    Bulk amorphous samples of Gesub(x)Sesub(1-x) (0.5<=x<=0.7) were prepared by quenching. Dc conductivity measurements were carried out in the temperature range 77-300 K. In the low temperature region, the conduction occurs due to variable range hopping in the localized states near the Fermi level. The results are explained by Mott, Pollak and Butcher's models. Butcher's model which is based on the equivalent of conduction network is compatible with the results. (author)

  11. Radar meteors range distribution model. I. Theory

    Czech Academy of Sciences Publication Activity Database

    Pecinová, Drahomíra; Pecina, Petr

    2007-01-01

    Roč. 37, č. 2 (2007), s. 83-106 ISSN 1335-1842 R&D Projects: GA ČR GA205/03/1405 Institutional research plan: CEZ:AV0Z10030501 Keywords : physics of meteors * radar meteors * range distribution Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  12. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    Science.gov (United States)

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  13. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  14. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2011-01-01

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station

  15. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  16. Hops (Humulus lupulus L. Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

    Directory of Open Access Journals (Sweden)

    Michael D. Flythe

    2017-08-01

    Full Text Available Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L. produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid. Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1 the ionophore-like mechanism of action and spectrum of activity and (2 the literature available on the plant due to its use in brewing.

  17. Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang

    2017-10-01

    Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

  18. Supercritical fluid extraction of hops

    Directory of Open Access Journals (Sweden)

    ZORAN ZEKOVIC

    2007-01-01

    Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

  19. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    Science.gov (United States)

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  20. Penson-Kolb-Hubbard model: A study of the competition between single-particle and pair hopping in one dimension

    International Nuclear Information System (INIS)

    Hui, A.; Doniach, S.

    1993-01-01

    In this paper, we present a study of the ground-state phase diagram of a one-dimensional quantum chain, the Penson-Kolb-Hubbard model, H=-summation i ,η=±1,σ (tc i+ησ † c iσ +Vc i+η↑ † c i+η↓ † c i↓ ci↑)+ summation i Un i↑ ni↓ at half filling. We have examined the system using exact diagonalization for samples of up to 12 sites and employed two techniques, eigenprojection decomposition and twisted-boundary conditions, in analyzing the data. These techniques allow us to characterize the ground state in a manner insensitive to changes in sample size and provide us with a clean way to visualize the physics. When used with the ''correct'' order parameter, qualitative features emerge even for sample sizes as small as six sites. We find that the second-order charge-density-wave--spin-density-wave transition in the weak-coupling limit (t much-gt U∼2V) turns into a first-order superconducting--antiferromagnetic transition in the strong-coupling regime [t much-lt U∼(4/π)V]. We also observe evidence of a charge-density-wave--superconducting transition in the parameter range (t∼V much-gt U). These three transition lines meet together at a tricritical point at (t:U:V)∼(0.04:0.54:0.42). A naive renormalization-group analysis in the intermediate-coupling regime produces results consistent with this conclusion

  1. Frequency Hopping Transceiver Multiplexer

    Science.gov (United States)

    1983-03-01

    ATC 17 ULR IHQ OCLI CPCTR ULTRA HIGH "OQS" UP TO 4X HIGHER THAN BEST INDUS- TRY STANDARD (ATC 100). MICROWAVE POWER, CURRENT. AND 0 RATINGS5...Q"W were assigned to element (FigC-2); which will be modelled into the transformer previously ment td . The center frequencies, "Q", frequency range...of the TD 1288 system. Temperature stability, change with time or storage. Flexure Frequency, or non-linear change over bandwidth. * Humidity

  2. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  3. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  4. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    Science.gov (United States)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-07-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

  5. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    International Nuclear Information System (INIS)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-01-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

  6. PROBABILISTIC MODEL OF LASER RANGE FINDER FOR THREE DIMENSIONAL GRID CELL IN CLOSE RANGE ENVIRONMENT

    Directory of Open Access Journals (Sweden)

    Hafiz b Iman

    2016-04-01

    Full Text Available The probabilistic model of a laser scanner presents an important aspect for simultaneous localization and map-building (SLAM. However, the characteristic of the beam of the laser range finder under extreme incident angles approaching 900 has not been thoroughly investigated. This research paper reports the characteristic of the density of the range value coming from a laser range finder under close range circumstances where the laser is imposed with a high incident angle. The laser was placed in a controlled environment consisting of walls at a close range and 1000 iteration of scans was collected. The assumption of normal density of the metrical data collapses when the beam traverses across sharp edges in this environment. The data collected also shows multimodal density at instances where the range has discontinuity. The standard deviation of the laser range finder is reported to average at 10.54 mm, with 0.96 of accuracy. This significance suggests that under extreme incident angles, a laser range finder reading behaves differently compared to normal distribution. The use of this information is crucial for SLAM activity in enclosed environments such as inside piping grid or other cluttered environments.KEYWORDS:   Hokuyo UTM-30LX; kernel density estimation; probabilistic model  

  7. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  8. Soil Compressibility Models for a Wide Stress Range

    KAUST Repository

    Chong, Song-Hun; Santamarina, Carlos

    2016-01-01

    Soil compressibility models with physically correct asymptotic void ratios are required to analyze situations that involve a wide stress range. Previously suggested models and other functions are adapted to satisfy asymptotic void ratios at low

  9. A Range-Based Multivariate Model for Exchange Rate Volatility

    NARCIS (Netherlands)

    B. Tims (Ben); R.J. Mahieu (Ronald)

    2003-01-01

    textabstractIn this paper we present a parsimonious multivariate model for exchange rate volatilities based on logarithmic high-low ranges of daily exchange rates. The multivariate stochastic volatility model divides the log range of each exchange rate into two independent latent factors, which are

  10. Model for using hip-hop music for small group HIV/AIDS prevention counseling with African American adolescents and young adults.

    Science.gov (United States)

    Stephens, T; Braithwaite, R L; Taylor, S E

    1998-10-01

    Currently little attention has been directed, with the exception of peer education efforts, to constructively develop new and innovative ways to promote HIV/AIDS primary prevention among African American (AA) adolescents and young adults. With this in mind, the aim of this conceptual effort is to present a HIV/AIDS preventive counseling protocol developed for use with AA young adults that makes use of hip-hop music, a form of music popularized by young AAs. The author contend that an increased understanding of the relationships that many AA young adults have with hip-hop music may be used by disease prevention personnel to educate these populations about protective factors for HIV. Making use of hip-hop music is one strategy for integrating counseling in prevention and health maintenance. The overall implications of using hip-hop music in health promotion are unlimited. First, this method makes use of cultural relevant materials to address the educational and health needs of the target community. Second, it is grounded in an approach that serves to stimulate cooperative learning based on peer developed content. Moreover, the use of this medium can be applied to other health promotion activities such as violence/harm reduction and substance abuse prevention, upon reviews of songs for appropriate content. The authors contend that such an approach holds heuristic value in dealing with HIV/AIDS prevention among AA young adults. Additional testing of the intervention is warranted in the refinement of this innovative intervention.

  11. A Range-Based Multivariate Model for Exchange Rate Volatility

    OpenAIRE

    Tims, Ben; Mahieu, Ronald

    2003-01-01

    textabstractIn this paper we present a parsimonious multivariate model for exchange rate volatilities based on logarithmic high-low ranges of daily exchange rates. The multivariate stochastic volatility model divides the log range of each exchange rate into two independent latent factors, which are interpreted as the underlying currency specific components. Due to the normality of logarithmic volatilities the model can be estimated conveniently with standard Kalman filter techniques. Our resu...

  12. Benchmarking novel approaches for modelling species range dynamics.

    Science.gov (United States)

    Zurell, Damaris; Thuiller, Wilfried; Pagel, Jörn; Cabral, Juliano S; Münkemüller, Tamara; Gravel, Dominique; Dullinger, Stefan; Normand, Signe; Schiffers, Katja H; Moore, Kara A; Zimmermann, Niklaus E

    2016-08-01

    Increasing biodiversity loss due to climate change is one of the most vital challenges of the 21st century. To anticipate and mitigate biodiversity loss, models are needed that reliably project species' range dynamics and extinction risks. Recently, several new approaches to model range dynamics have been developed to supplement correlative species distribution models (SDMs), but applications clearly lag behind model development. Indeed, no comparative analysis has been performed to evaluate their performance. Here, we build on process-based, simulated data for benchmarking five range (dynamic) models of varying complexity including classical SDMs, SDMs coupled with simple dispersal or more complex population dynamic models (SDM hybrids), and a hierarchical Bayesian process-based dynamic range model (DRM). We specifically test the effects of demographic and community processes on model predictive performance. Under current climate, DRMs performed best, although only marginally. Under climate change, predictive performance varied considerably, with no clear winners. Yet, all range dynamic models improved predictions under climate change substantially compared to purely correlative SDMs, and the population dynamic models also predicted reasonable extinction risks for most scenarios. When benchmarking data were simulated with more complex demographic and community processes, simple SDM hybrids including only dispersal often proved most reliable. Finally, we found that structural decisions during model building can have great impact on model accuracy, but prior system knowledge on important processes can reduce these uncertainties considerably. Our results reassure the clear merit in using dynamic approaches for modelling species' response to climate change but also emphasize several needs for further model and data improvement. We propose and discuss perspectives for improving range projections through combination of multiple models and for making these approaches

  13. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  14. Medium Range Forecast (MRF) and Nested Grid Model (NGM)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Nested Grid Model (NGM) and Medium Range Forecast (MRF) Archive is historical digital data set DSI-6140, archived at the NOAA National Centers for Environmental...

  15. Misleading prioritizations from modelling range shifts under climate change

    Science.gov (United States)

    Sofaer, Helen R.; Jarnevich, Catherine S.; Flather, Curtis H.

    2018-01-01

    AimConservation planning requires the prioritization of a subset of taxa and geographical locations to focus monitoring and management efforts. Integration of the threats and opportunities posed by climate change often relies on predictions from species distribution models, particularly for assessments of vulnerability or invasion risk for multiple taxa. We evaluated whether species distribution models could reliably rank changes in species range size under climate and land use change.LocationConterminous U.S.A.Time period1977–2014.Major taxa studiedPasserine birds.MethodsWe estimated ensembles of species distribution models based on historical North American Breeding Bird Survey occurrences for 190 songbirds, and generated predictions to recent years given c. 35 years of observed land use and climate change. We evaluated model predictions using standard metrics of discrimination performance and a more detailed assessment of the ability of models to rank species vulnerability to climate change based on predicted range loss, range gain, and overall change in range size.ResultsSpecies distribution models yielded unreliable and misleading assessments of relative vulnerability to climate and land use change. Models could not accurately predict range expansion or contraction, and therefore failed to anticipate patterns of range change among species. These failures occurred despite excellent overall discrimination ability and transferability to the validation time period, which reflected strong performance at the majority of locations that were either always or never occupied by each species.Main conclusionsModels failed for the questions and at the locations of greatest interest to conservation and management. This highlights potential pitfalls of multi-taxa impact assessments under global change; in our case, models provided misleading rankings of the most impacted species, and spatial information about range changes was not credible. As modelling methods and

  16. A Model for Long Range Planning for Seminole Community College.

    Science.gov (United States)

    Miner, Norris

    A model for long-range planning designed to maximize involvement of college personnel, to improve communication among various areas of the college, to provide a process for evaluation of long-range plans and the planning process, to adjust to changing conditions, to utilize data developed at a level useful for actual operations, and to have…

  17. Battery electric vehicle energy consumption modelling for range estimation

    NARCIS (Netherlands)

    Wang, J.; Besselink, I.J.M.; Nijmeijer, H.

    2017-01-01

    Range anxiety is considered as one of the major barriers to the mass adoption of battery electric vehicles (BEVs). One method to solve this problem is to provide accurate range estimation to the driver. This paper describes a vehicle energy consumption model considering the influence of weather

  18. Soil Compressibility Models for a Wide Stress Range

    KAUST Repository

    Chong, Song-Hun

    2016-03-03

    Soil compressibility models with physically correct asymptotic void ratios are required to analyze situations that involve a wide stress range. Previously suggested models and other functions are adapted to satisfy asymptotic void ratios at low and high stress levels; all updated models involve four parameters. Compiled consolidation data for remolded and natural clays are used to test the models and to develop correlations between model parameters and index properties. Models can adequately fit soil compression data for a wide range of stresses and soil types; in particular, models that involve the power of the stress σ\\'β display higher flexibility to capture the brittle response of some natural soils. The use of a single continuous function avoids numerical discontinuities or the need for ad hoc procedures to determine the yield stress. The tangent stiffness-readily computed for all models-should not be mistaken for the small-strain constant-fabric stiffness. © 2016 American Society of Civil Engineers.

  19. Finite-range-scaling analysis of metastability in an Ising model with long-range interactions

    International Nuclear Information System (INIS)

    Gorman, B.M.; Rikvold, P.A.; Novotny, M.A.

    1994-01-01

    We apply both a scalar field theory and a recently developed transfer-matrix method to study the stationary properties of metastability in a two-state model with weak, long-range interactions: the Nx∞ quasi-one-dimensional Ising model. Using the field theory, we find the analytic continuation f of the free energy across the first-order transition, assuming that the system escapes the metastable state by the nucleation of noninteracting droplets. We find that corrections to the field dependence are substantial, and, by solving the Euler-Lagrange equation for the model numerically, we have verified the form of the free-energy cost of nucleation, including the first correction. In the transfer-matrix method, we associate with the subdominant eigenvectors of the transfer matrix a complex-valued ''constrained'' free-energy density f α computed directly from the matrix. For the eigenvector with an associated magnetization most strongly opposed to the applied magnetic field, f α exhibits finite-range scaling behavior in agreement with f over a wide range of temperatures and fields, extending nearly to the classical spinodal. Some implications of these results for numerical studies of metastability are discussed

  20. Computational Analysis of Residue Interaction Networks and Coevolutionary Relationships in the Hsp70 Chaperones: A Community-Hopping Model of Allosteric Regulation and Communication.

    Directory of Open Access Journals (Sweden)

    Gabrielle Stetz

    2017-01-01

    allostery, we introduced a community-hopping model of allosteric communication. Atomistic reconstruction of signaling pathways in the DnaK structures captured a direction-specific mechanism and molecular details of signal transmission that are fully consistent with the mutagenesis experiments. The results of our study reconciled structural and functional experiments from a network-centric perspective by showing that global properties of the residue interaction networks and coevolutionary signatures may be linked with specificity and diversity of allosteric regulation mechanisms.

  1. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  2. Model-based uncertainty in species range prediction

    DEFF Research Database (Denmark)

    Pearson, R. G.; Thuiller, Wilfried; Bastos Araujo, Miguel

    2006-01-01

    Aim Many attempts to predict the potential range of species rely on environmental niche (or 'bioclimate envelope') modelling, yet the effects of using different niche-based methodologies require further investigation. Here we investigate the impact that the choice of model can have on predictions...

  3. Extension of White's layered model to the full frequency range

    NARCIS (Netherlands)

    Vogelaar, Bouko; Smeulders, D.M.J.

    2007-01-01

    The low-frequency theory of the White model to predict the dispersion and intrinsic attenuation in a single porous skeleton saturated with periodic layers of two immiscible fluids is extended to the full frequency range using the Biot theory. The extension is similar to the Dutta–Odé model for

  4. The effect of correlations on the non-ohmic behavior of the small-polaron hopping conductivity in 1D and 3D disordered systems

    International Nuclear Information System (INIS)

    Dimakogianni, M; Triberis, G P

    2010-01-01

    According to percolation theory the investigation of charge transport in disordered systems is equivalent to the study of the possibility of the passage of the carriers through a random network of impedances which interconnect the different lattice sites. When the site energies are not the same, the energy of a site affects the incoming as well as the outgoing impedances connected to the given site and this gives rise to correlations between neighboring impedances. This new condition characterizes the transport process and imposes the evaluation of the average number of sites accessible by a bond from a given site for all possible configurations of sites that satisfy the percolation condition. The generalized molecular crystal model, appropriate for the study of small-polaron hopping transport in disordered systems, and the Kubo formula permit the evaluation of these impedances. Taking correlations into account, theoretical percolation considerations applicable to one-dimensional and three-dimensional disordered systems, lead to analytical expressions for the temperature and electric field dependence of the DC conductivity at high (multi-phonon-assisted hopping) and low (few-phonon-assisted hopping) temperatures. The theoretical analysis reveals the effect of correlations on the non-ohmic behavior of the small-polaron hopping conductivity and permits the evaluation of the maximum hopping distance. Quantitative estimates of this effect are presented comparing the theoretical results, including correlations with those ignoring them, previously reported, applying them to recent experimental data for a wide temperature range and from low up to moderate electric fields.

  5. Exact solution of a quasi-one-dimensional model with long range interaction (coupled tomonaga chains)

    International Nuclear Information System (INIS)

    Nguyen Minh Khue; Solyom, J.

    1980-03-01

    The novel method proposed by one of the authors to calculate exactly the response functions of the one-dimensional Tomonaga-model is described in more detail. The method is generalized for the case of a system of coupled chains where both the interchain and interchain interactions have forward scattering components only. The model does not show real phase transition at any finite temperature indicating that the interchain backward scattering or hopping is needed to have an ordering of the chains at finite temperature. (author)

  6. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  7. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  8. Hopping control channel MAC protocol for opportunistic spectrum access networks

    Institute of Scientific and Technical Information of China (English)

    FU Jing-tuan; JI Hong; MAO Xu

    2010-01-01

    Opportunistic spectrum access (OSA) is considered as a promising approach to mitigate spectrum scarcity by allowing unlicensed users to exploit spectrum opportunities in licensed frequency bands. Derived from the existing channel-hopping multiple access (CHMA) protocol,we introduce a hopping control channel medium access control (MAC) protocol in the context of OSA networks. In our proposed protocol,all nodes in the network follow a common channel-hopping sequence; every frequency channel can be used as control channel and data channel. Considering primary users' occupancy of the channel,we use a primary user (PU) detection model to calculate the channel availability for unlicensed users' access. Then,a discrete Markov chain analytical model is applied to describe the channel states and deduce the system throughput. Through simulation,we present numerical results to demonstrate the throughput performance of our protocol and thus validate our work.

  9. Conformal Invariance in the Long-Range Ising Model

    CERN Document Server

    Paulos, Miguel F; van Rees, Balt C; Zan, Bernardo

    2016-01-01

    We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to conformal invariance. We however show that several correlation functions, computed to second order in the epsilon expansion, are nontrivially consistent with conformal invariance. We proceed to give a proof of conformal invariance to all orders in the epsilon expansion, based on the description of the long-range Ising model as a defect theory in an auxiliary higher-dimensional space. A detailed review of conformal invariance in the d-dimensional short-range Ising model is also included and may be of independent interest.

  10. Conformal invariance in the long-range Ising model

    Directory of Open Access Journals (Sweden)

    Miguel F. Paulos

    2016-01-01

    Full Text Available We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to conformal invariance. We however show that several correlation functions, computed to second order in the epsilon expansion, are nontrivially consistent with conformal invariance. We proceed to give a proof of conformal invariance to all orders in the epsilon expansion, based on the description of the long-range Ising model as a defect theory in an auxiliary higher-dimensional space. A detailed review of conformal invariance in the d-dimensional short-range Ising model is also included and may be of independent interest.

  11. Conformal invariance in the long-range Ising model

    Energy Technology Data Exchange (ETDEWEB)

    Paulos, Miguel F. [CERN, Theory Group, Geneva (Switzerland); Rychkov, Slava, E-mail: slava.rychkov@lpt.ens.fr [CERN, Theory Group, Geneva (Switzerland); Laboratoire de Physique Théorique de l' École Normale Supérieure (LPTENS), Paris (France); Faculté de Physique, Université Pierre et Marie Curie (UPMC), Paris (France); Rees, Balt C. van [CERN, Theory Group, Geneva (Switzerland); Zan, Bernardo [Institute of Physics, Universiteit van Amsterdam, Amsterdam (Netherlands)

    2016-01-15

    We consider the question of conformal invariance of the long-range Ising model at the critical point. The continuum description is given in terms of a nonlocal field theory, and the absence of a stress tensor invalidates all of the standard arguments for the enhancement of scale invariance to conformal invariance. We however show that several correlation functions, computed to second order in the epsilon expansion, are nontrivially consistent with conformal invariance. We proceed to give a proof of conformal invariance to all orders in the epsilon expansion, based on the description of the long-range Ising model as a defect theory in an auxiliary higher-dimensional space. A detailed review of conformal invariance in the d-dimensional short-range Ising model is also included and may be of independent interest.

  12. A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

    Science.gov (United States)

    Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

    2018-05-08

    With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

  13. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  14. ON range searching in the group model and combinatorial discrepancy

    DEFF Research Database (Denmark)

    Larsen, Kasper Green

    2014-01-01

    In this paper we establish an intimate connection between dynamic range searching in the group model and combinatorial discrepancy. Our result states that, for a broad class of range searching data structures (including all known upper bounds), it must hold that $t_u t_q=\\Omega(\\mbox{disc}^2......)$, where $t_u$ is the worst case update time, $t_q$ is the worst case query time, and disc is the combinatorial discrepancy of the range searching problem in question. This relation immediately implies a whole range of exceptionally high and near-tight lower bounds for all of the basic range searching...... problems. We list a few of them in the following: (1) For $d$-dimensional halfspace range searching, we get a lower bound of $t_u t_q=\\Omega(n^{1-1/d})$. This comes within an lg lg $n$ factor of the best known upper bound. (2) For orthogonal range searching, we get a lower bound of $t_u t...

  15. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    Science.gov (United States)

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  16. Constitutive modelling in the range of inelastic deformations

    International Nuclear Information System (INIS)

    Bruhns, O.T.; White, P.S.; Chaboche, J.L.; Eikhoff, J.V.D.

    1988-01-01

    The main objective of this report is to describe the state of the art in constitutive modelling in the range of inelastic deformations, with particular consideration of the practical use of these models in the field of fast reactors, rather than to formulate new models. An outline is given of the constitutive equations for high-temperature reactor materials developed at the Oak Ridge National Laboratory. Two forms of equations are considered, a semi-classical treatment in terms of separate plasticity and creep and unified equations in which the classical plasticity does not explicitly occur. The fraction model originally proposed by Besseling is described. The basic concept of this model is that the material is thought to be subdivided into a number of parallel fractions, each with simple conventional properties. The more complicated behaviour of real material is thus approximated by choosing a number of parallel fractions with suitable models and model parameters. Three time-independent formulations of plasticity are considered and compared. Attention is focused on the kinematic hardening in the multi-yield surface theory of Mroz and the non-linear kinematic rule intensively used at Enset and Onera. Some connections are pointed out with the two-surface model of Dafalias and Popov, and the range of applicability of the different models is studied in detail. Finally, the constitutive equations of the Interatom model are presented. They are mainly based on the concept of overstresses, expressing the rate-dependence of the material by the magnitude of these overstresses. This model furthermore comprises a combination of general non-linear isotropic and kinematic hardening, with a smooth transition from isotropic to kinematic hardening as a function of process time

  17. Rapid world modeling: Fitting range data to geometric primitives

    International Nuclear Information System (INIS)

    Feddema, J.; Little, C.

    1996-01-01

    For the past seven years, Sandia National Laboratories has been active in the development of robotic systems to help remediate DOE's waste sites and decommissioned facilities. Some of these facilities have high levels of radioactivity which prevent manual clean-up. Tele-operated and autonomous robotic systems have been envisioned as the only suitable means of removing the radioactive elements. World modeling is defined as the process of creating a numerical geometric model of a real world environment or workspace. This model is often used in robotics to plan robot motions which perform a task while avoiding obstacles. In many applications where the world model does not exist ahead of time, structured lighting, laser range finders, and even acoustical sensors have been used to create three dimensional maps of the environment. These maps consist of thousands of range points which are difficult to handle and interpret. This paper presents a least squares technique for fitting range data to planar and quadric surfaces, including cylinders and ellipsoids. Once fit to these primitive surfaces, the amount of data associated with a surface is greatly reduced up to three orders of magnitude, thus allowing for more rapid handling and analysis of world data

  18. The apparently contradictory energetics of hopping and running: the counter-intuitive effect of constraints resolves the paradox.

    Science.gov (United States)

    Gutmann, Anne K; Bertram, John E A

    2017-01-15

    Metabolic rate appears to increase with the rate of force application for running. Leg function during ground contact is similar in hopping and running, so one might expect that this relationship would hold for hopping as well. Surprisingly, metabolic rate appeared to decrease with increasing force rate for hopping. However, this paradox is the result of comparing different cross-sections of the metabolic cost landscapes for hopping and running. The apparent relationship between metabolic rate and force rate observed in treadmill running is likely not a fundamental characteristic of muscle physiology, but a result of runners responding to speed constraints, i.e. runners selecting step frequencies that minimize metabolic cost per distance for a series of treadmill-specified speeds. Evaluating hopping metabolic rate over a narrow range of hop frequencies similar to that selected by treadmill runners yields energy use trends similar to those of running. © 2017. Published by The Company of Biologists Ltd.

  19. Finite temperature CPN-1 model and long range Neel order

    International Nuclear Information System (INIS)

    Ichinose, Ikuo; Yamamoto, Hisashi.

    1989-09-01

    We study in d space-dimensions the finite temperature behavior of long range Neel order (LRNO) in CP N-1 model as a low energy effective field theory of the antiferromagnetic Heisenberg model. For d≤1, or d≤2 at any nonzero temperature, LRNO disappears, in agreement with Mermin-Wagner-Coleman's theorem. For d=3 in the weak coupling region, LRNO exists below the critical temperature T N (Neel temperature). T N decreases as the interlayer coupling becomes relatively weak compared with that within Cu-O layers. (author)

  20. Long range anti-ferromagnetic spin model for prebiotic evolution

    International Nuclear Information System (INIS)

    Nokura, Kazuo

    2003-01-01

    I propose and discuss a fitness function for one-dimensional binary monomer sequences of macromolecules for prebiotic evolution. The fitness function is defined by the free energy of polymers in the high temperature random coil phase. With repulsive interactions among the same kind of monomers, the free energy in the high temperature limit becomes the energy function of the one-dimensional long range anti-ferromagnetic spin model, which is shown to have a dynamical phase transition and glassy states

  1. Model Based Verification of Cyber Range Event Environments

    Science.gov (United States)

    2015-11-13

    that may include users, applications, operating systems, servers, hosts, routers, switches, control planes , and instrumentation planes , many of...which lack models for their configuration. Our main contributions in this paper are the following. First, we have developed a configuration ontology...configuration errors in environment designs for several cyber range events. The rest of the paper is organized as follows. Section 2 provides an overview of

  2. Observation of correlation effects in the hopping transport in amorphous silicon

    International Nuclear Information System (INIS)

    Voegele, V.; Kalbitzer, S.; Boehringer, K.

    1985-01-01

    Amorphous silicon films have been modified by the implantation of Au or Si ions. The d.c. conductivity, measured between 300 and 15 K, was found to exhibit hopping exponents m which increase with decreasing temperature. Depending on the varied defect densities, m ranges between the limits of 1/4 and 1. These results can be explained by variable-range-hopping theory, if a Coulomb correlation term is included. (author)

  3. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  4. Wireless Multi Hop Access Networks and Protocols

    OpenAIRE

    Nilsson Plymoth, Anders

    2007-01-01

    As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

  5. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  6. Simplified local density model for adsorption over large pressure ranges

    International Nuclear Information System (INIS)

    Rangarajan, B.; Lira, C.T.; Subramanian, R.

    1995-01-01

    Physical adsorption of high-pressure fluids onto solids is of interest in the transportation and storage of fuel and radioactive gases; the separation and purification of lower hydrocarbons; solid-phase extractions; adsorbent regenerations using supercritical fluids; supercritical fluid chromatography; and critical point drying. A mean-field model is developed that superimposes the fluid-solid potential on a fluid equation of state to predict adsorption on a flat wall from vapor, liquid, and supercritical phases. A van der Waals-type equation of state is used to represent the fluid phase, and is simplified with a local density approximation for calculating the configurational energy of the inhomogeneous fluid. The simplified local density approximation makes the model tractable for routine calculations over wide pressure ranges. The model is capable of prediction of Type 2 and 3 subcritical isotherms for adsorption on a flat wall, and shows the characteristic cusplike behavior and crossovers seen experimentally near the fluid critical point

  7. Calibration Modeling Methodology to Optimize Performance for Low Range Applications

    Science.gov (United States)

    McCollum, Raymond A.; Commo, Sean A.; Parker, Peter A.

    2010-01-01

    Calibration is a vital process in characterizing the performance of an instrument in an application environment and seeks to obtain acceptable accuracy over the entire design range. Often, project requirements specify a maximum total measurement uncertainty, expressed as a percent of full-scale. However in some applications, we seek to obtain enhanced performance at the low range, therefore expressing the accuracy as a percent of reading should be considered as a modeling strategy. For example, it is common to desire to use a force balance in multiple facilities or regimes, often well below its designed full-scale capacity. This paper presents a general statistical methodology for optimizing calibration mathematical models based on a percent of reading accuracy requirement, which has broad application in all types of transducer applications where low range performance is required. A case study illustrates the proposed methodology for the Mars Entry Atmospheric Data System that employs seven strain-gage based pressure transducers mounted on the heatshield of the Mars Science Laboratory mission.

  8. Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

    Science.gov (United States)

    Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

    2014-12-31

    Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

  9. Short-ranged memory model with preferential growth

    Science.gov (United States)

    Schaigorodsky, Ana L.; Perotti, Juan I.; Almeira, Nahuel; Billoni, Orlando V.

    2018-02-01

    In this work we introduce a variant of the Yule-Simon model for preferential growth by incorporating a finite kernel to model the effects of bounded memory. We characterize the properties of the model combining analytical arguments with extensive numerical simulations. In particular, we analyze the lifetime and popularity distributions by mapping the model dynamics to corresponding Markov chains and branching processes, respectively. These distributions follow power laws with well-defined exponents that are within the range of the empirical data reported in ecologies. Interestingly, by varying the innovation rate, this simple out-of-equilibrium model exhibits many of the characteristics of a continuous phase transition and, around the critical point, it generates time series with power-law popularity, lifetime and interevent time distributions, and nontrivial temporal correlations, such as a bursty dynamics in analogy with the activity of solar flares. Our results suggest that an appropriate balance between innovation and oblivion rates could provide an explanatory framework for many of the properties commonly observed in many complex systems.

  10. Two general models that generate long range correlation

    Science.gov (United States)

    Gan, Xiaocong; Han, Zhangang

    2012-06-01

    In this paper we study two models that generate sequences with LRC (long range correlation). For the IFT (inverse Fourier transform) model, our conclusion is the low frequency part leads to LRC, while the high frequency part tends to eliminate it. Therefore, a typical method to generate a sequence with LRC is multiplying the spectrum of a white noise sequence by a decaying function. A special case is analyzed: the linear combination of a smooth curve and a white noise sequence, in which the DFA plot consists of two line segments. For the patch model, our conclusion is long subsequences leads to LRC, while short subsequences tend to eliminate it. Therefore, we can generate a sequence with LRC by using a fat-tailed PDF (probability distribution function) of the length of the subsequences. A special case is also analyzed: if a patch model with long subsequences is mixed with a white noise sequence, the DFA plot will consist of two line segments. We have checked known models and actual data, and found they are all consistent with this study.

  11. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  12. Evaluation of long-range transport models in NOVANA

    International Nuclear Information System (INIS)

    Frohn, L.M.; Brandt, J.; Christensen, J.H.; Geels, C.; Hertel, O.; Skjoeth, C.A.; Ellemann, T.

    2007-01-01

    as good as the performance of the ACDEP model, and for the majority of the chemical parameters the performance of DEHM is better than the performance of ACDEP when model results are compared to measurements. This result is expected since the description of the long-range transport of air pollution, which contributes significantly to the concentration levels in Denmark, is better in DEHM. (BA)

  13. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  14. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  15. Hopping Conductivity Enhanced by Microwave Radiation

    International Nuclear Information System (INIS)

    Ovadyahu, Z

    2012-01-01

    Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

  16. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun

    2007-01-01

    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  17. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    Science.gov (United States)

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  18. Predicting climate-induced range shifts: model differences and model reliability.

    Science.gov (United States)

    Joshua J. Lawler; Denis White; Ronald P. Neilson; Andrew R. Blaustein

    2006-01-01

    Predicted changes in the global climate are likely to cause large shifts in the geographic ranges of many plant and animal species. To date, predictions of future range shifts have relied on a variety of modeling approaches with different levels of model accuracy. Using a common data set, we investigated the potential implications of alternative modeling approaches for...

  19. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  20. Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    1996-01-01

    A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation path...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

  1. Modelling of monovacancy diffusion in W over wide temperature range

    International Nuclear Information System (INIS)

    Bukonte, L.; Ahlgren, T.; Heinola, K.

    2014-01-01

    The diffusion of monovacancies in tungsten is studied computationally over a wide temperature range from 1300 K until the melting point of the material. Our modelling is based on Molecular Dynamics technique and Density Functional Theory. The monovacancy migration barriers are calculated using nudged elastic band method for nearest and next-nearest neighbour monovacancy jumps. The diffusion pre-exponential factor for monovacancy diffusion is found to be two to three orders of magnitude higher than commonly used in computational studies, resulting in attempt frequency of the order 10 15 Hz. Multiple nearest neighbour jumps of monovacancy are found to play an important role in the contribution to the total diffusion coefficient, especially at temperatures above 2/3 of T m , resulting in an upward curvature of the Arrhenius diagram. The probabilities for different nearest neighbour jumps for monovacancy in W are calculated at different temperatures

  2. Computational model of lightness perception in high dynamic range imaging

    Science.gov (United States)

    Krawczyk, Grzegorz; Myszkowski, Karol; Seidel, Hans-Peter

    2006-02-01

    An anchoring theory of lightness perception by Gilchrist et al. [1999] explains many characteristics of human visual system such as lightness constancy and its spectacular failures which are important in the perception of images. The principal concept of this theory is the perception of complex scenes in terms of groups of consistent areas (frameworks). Such areas, following the gestalt theorists, are defined by the regions of common illumination. The key aspect of the image perception is the estimation of lightness within each framework through the anchoring to the luminance perceived as white, followed by the computation of the global lightness. In this paper we provide a computational model for automatic decomposition of HDR images into frameworks. We derive a tone mapping operator which predicts lightness perception of the real world scenes and aims at its accurate reproduction on low dynamic range displays. Furthermore, such a decomposition into frameworks opens new grounds for local image analysis in view of human perception.

  3. Model-based cartilage thickness measurement in the submillimeter range

    International Nuclear Information System (INIS)

    Streekstra, G. J.; Strackee, S. D.; Maas, M.; Wee, R. ter; Venema, H. W.

    2007-01-01

    Current methods of image-based thickness measurement in thin sheet structures utilize second derivative zero crossings to locate the layer boundaries. It is generally acknowledged that the nonzero width of the point spread function (PSF) limits the accuracy of this measurement procedure. We propose a model-based method that strongly reduces PSF-induced bias by incorporating the PSF into the thickness estimation method. We estimated the bias in thickness measurements in simulated thin sheet images as obtained from second derivative zero crossings. To gain insight into the range of sheet thickness where our method is expected to yield improved results, sheet thickness was varied between 0.15 and 1.2 mm with an assumed PSF as present in the high-resolution modes of current computed tomography (CT) scanners [full width at half maximum (FWHM) 0.5-0.8 mm]. Our model-based method was evaluated in practice by measuring layer thickness from CT images of a phantom mimicking two parallel cartilage layers in an arthrography procedure. CT arthrography images of cadaver wrists were also evaluated, and thickness estimates were compared to those obtained from high-resolution anatomical sections that served as a reference. The thickness estimates from the simulated images reveal that the method based on second derivative zero crossings shows considerable bias for layers in the submillimeter range. This bias is negligible for sheet thickness larger than 1 mm, where the size of the sheet is more than twice the FWHM of the PSF but can be as large as 0.2 mm for a 0.5 mm sheet. The results of the phantom experiments show that the bias is effectively reduced by our method. The deviations from the true thickness, due to random fluctuations induced by quantum noise in the CT images, are of the order of 3% for a standard wrist imaging protocol. In the wrist the submillimeter thickness estimates from the CT arthrography images correspond within 10% to those estimated from the anatomical

  4. Binaural model-based dynamic-range compression.

    Science.gov (United States)

    Ernst, Stephan M A; Kortlang, Steffen; Grimm, Giso; Bisitz, Thomas; Kollmeier, Birger; Ewert, Stephan D

    2018-01-26

    Binaural cues such as interaural level differences (ILDs) are used to organise auditory perception and to segregate sound sources in complex acoustical environments. In bilaterally fitted hearing aids, dynamic-range compression operating independently at each ear potentially alters these ILDs, thus distorting binaural perception and sound source segregation. A binaurally-linked model-based fast-acting dynamic compression algorithm designed to approximate the normal-hearing basilar membrane (BM) input-output function in hearing-impaired listeners is suggested. A multi-center evaluation in comparison with an alternative binaural and two bilateral fittings was performed to assess the effect of binaural synchronisation on (a) speech intelligibility and (b) perceived quality in realistic conditions. 30 and 12 hearing impaired (HI) listeners were aided individually with the algorithms for both experimental parts, respectively. A small preference towards the proposed model-based algorithm in the direct quality comparison was found. However, no benefit of binaural-synchronisation regarding speech intelligibility was found, suggesting a dominant role of the better ear in all experimental conditions. The suggested binaural synchronisation of compression algorithms showed a limited effect on the tested outcome measures, however, linking could be situationally beneficial to preserve a natural binaural perception of the acoustical environment.

  5. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

    Directory of Open Access Journals (Sweden)

    N. Cherouvim

    2008-01-01

    Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

  7. Long-range cargo transport on crowded microtubules: The motor jamming mechanism

    Science.gov (United States)

    Rossi, Lucas W.; Radtke, Paul K.; Goldman, Carla

    2014-05-01

    The hopping model for cargo transport by molecular motors introduced in Goldman and Sena (2009), Goldman (2010) is extended here in order to incorporate the movement of cargo-motor complexes (C-MC). Hopping processes in this context express the possibility for cargo to be exchanged between neighboring motors at a microtubule where the transport takes place. Jamming of motors is essential for cargos to execute long-range movement in this way. Results from computer simulations accompanied by a mean-field analysis of the extended model confirm our previous analytical results and suggests that an interplay between cargo hopping and the movement of the C-MC’s would control the efficiency of cargo transfer and cargo delivery in these model systems.

  8. Corporate psychopathy and the full-range leadership model.

    Science.gov (United States)

    Mathieu, Cynthia; Neumann, Craig; Babiak, Paul; Hare, Robert D

    2015-06-01

    The B-Scan 360 is a relatively new, purpose-built measure of corporate psychopathy that addresses many of the issues inherent in studying psychopathy in organizations. The primary goal of the present study was to measure the relationship between employees' perception of psychopathic features in their supervisor and their rating of their supervisor on the Full-Range Model of Leadership. The second goal of the study was to test the B-Scan 360's factor structure and test its interrater reliability in an organizational sample. A total of 491 civic employees and 116 employees from a branch of a large financial company completed the B-Scan 360 as well as the Multifactor Leadership Questionnaire on their direct supervisor. The B-Scan 360 and all of its four factors were positively correlated with passive leadership (Laissez-Faire leadership) and negatively correlated with positive leadership (both Transactional and Transformational leadership). Furthermore, results revealed the same four-factor structure and good interrater reliability for the B-Scan 360 in this business sample as previously reported for a general population. Overall, the results provide additional support for the B-Scan 360 as a measure of psychopathic traits in corporate settings. © The Author(s) 2014.

  9. Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail: giovanni.granucci@unipi.it; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)

    2014-01-28

    We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

  10. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  11. Beer spoilage bacteria and hop resistance.

    Science.gov (United States)

    Sakamoto, Kanta; Konings, Wil N

    2003-12-31

    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

  12. Degradation of hop bitter acids by fungi

    International Nuclear Information System (INIS)

    Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

    2008-01-01

    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

  13. Mountain range specific analog weather forecast model for ...

    Indian Academy of Sciences (India)

    used to draw weather forecast for that mountain range in operational weather forecasting mode, three days ... various road management activities and for better .... −0.8. 1.5. 0.0. Pir Panjal range (HP). 1989–90 to 2002–03. 14. Snow day. 2.2. −4.1 ..... ed days,. S. = snow day,. N. S. = no-snow day and. P. C. = per cent correct).

  14. Evidence for the 'grasshopper' effect and fractionation during long-range atmospheric transport of organic contaminants

    International Nuclear Information System (INIS)

    Gouin, T.; Mackay, D.; Jones, K.C.; Harner, T.; Meijer, S.N.

    2004-01-01

    Although there is indisputable evidence that long-range atmospheric transport (LRAT) of organic contaminants occurs on a global scale, uncertainties remain about the detailed mechanism and extent of this phenomenon as well as the physical-chemical properties which facilitate LRAT. In this study, we discuss how mass balance models and monitoring data can contribute to a fuller understanding of the mechanism and extent of LRAT. Specifically we address the issues of 'grasshopping' or 'hopping' (the extent to which molecules are subject to multiple hops as distinct from a single emission-deposition event) and 'global fractionation' (the differing behavior of chemicals as they are transported). It is shown that simple mass balance models can be used to assist the interpretation of monitoring data while also providing an instrument that can be used to assess the LRAT potential and the extent of hopping that organic substances may experience. The available evidence supports the notion that many persistent organic pollutants experience varying degrees of 'hopping' during their environmental journey and as a consequence become fractionated with distance from source. - Evidence for global scale fractionation and hopping of POPs is reviewed

  15. Purely hopping conduction in c-axis oriented LiNbO3 thin films

    Science.gov (United States)

    Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay

    2009-05-01

    Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.

  16. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  17. A quantum inspired model of radar range and range-rate measurements with applications to weak value measurements

    Science.gov (United States)

    Escalante, George

    2017-05-01

    Weak Value Measurements (WVMs) with pre- and post-selected quantum mechanical ensembles were proposed by Aharonov, Albert, and Vaidman in 1988 and have found numerous applications in both theoretical and applied physics. In the field of precision metrology, WVM techniques have been demonstrated and proven valuable as a means to shift, amplify, and detect signals and to make precise measurements of small effects in both quantum and classical systems, including: particle spin, the Spin-Hall effect of light, optical beam deflections, frequency shifts, field gradients, and many others. In principal, WVM amplification techniques are also possible in radar and could be a valuable tool for precision measurements. However, relatively limited research has been done in this area. This article presents a quantum-inspired model of radar range and range-rate measurements of arbitrary strength, including standard and pre- and post-selected measurements. The model is used to extend WVM amplification theory to radar, with the receive filter performing the post-selection role. It is shown that the description of range and range-rate measurements based on the quantum-mechanical measurement model and formalism produces the same results as the conventional approach used in radar based on signal processing and filtering of the reflected signal at the radar receiver. Numerical simulation results using simple point scatterrer configurations are presented, applying the quantum-inspired model of radar range and range-rate measurements that occur in the weak measurement regime. Potential applications and benefits of the quantum inspired approach to radar measurements are presented, including improved range and Doppler measurement resolution.

  18. Radar meteors range distribution model. IV. Ionization coefficient

    Czech Academy of Sciences Publication Activity Database

    Pecinová, Drahomíra; Pecina, Petr

    2008-01-01

    Roč. 38, č. 1 (2008), s. 12-20 ISSN 1335-1842 R&D Projects: GA ČR GA205/03/1405 Institutional research plan: CEZ:AV0Z10030501 Keywords : physics of meteors * radar meteors * range distribution Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  19. Toluene model for molecular dynamics simulations in the ranges 298

    NARCIS (Netherlands)

    Fioroni, M.; Vogt, D.

    2004-01-01

    An all-atom model for toluene is presented in the framework of classical molecular dynamics (MD). The model has been parametrized under the GROMOS96 force field to reproduce the physicochemical properties of the neat liquid. Four new atom types have been introduced, distinguishing between carbons

  20. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  1. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    Science.gov (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  2. Long-range correlations in Boltzmann-Langevin model

    International Nuclear Information System (INIS)

    Ayik, S.

    1994-01-01

    The average phase-space density described by the Boltzmann-Langevin model can largely deviate from the one provided by the Boltzmann-Uhling-Uhlenbeck model, due to the non-linear evolution of density fluctuations. This aspect is investigated for long-wavelength, small density fluctuations in the framework of a memory incorporated Boltzmann-Langevin model. It is shown that the correlations associated with density fluctuations yield a collision term describing coupling between the collective vibrations and the single-particle degrees of freedom, which may play an important role in damping of collective motion in both the stable and unstable regions. (orig.)

  3. Modelling control of epidemics spreading by long-range interactions.

    Science.gov (United States)

    Dybiec, Bartłomiej; Kleczkowski, Adam; Gilligan, Christopher A

    2009-10-06

    We have studied the spread of epidemics characterized by a mixture of local and non-local interactions. The infection spreads on a two-dimensional lattice with the fixed nearest neighbour connections. In addition, long-range dynamical links are formed by moving agents (vectors). Vectors perform random walks, with step length distributed according to a thick-tail distribution. Two distributions are considered in this paper, an alpha-stable distribution describing self-similar vector movement, yet characterized by an infinite variance and an exponential power characterized by a large but finite variance. Such long-range interactions are hard to track and make control of epidemics very difficult. We also allowed for cryptic infection, whereby an infected individual on the lattice can be infectious prior to showing any symptoms of infection or disease. To account for such cryptic spread, we considered a control strategy in which not only detected, i.e. symptomatic, individuals but also all individuals within a certain control neighbourhood are treated upon the detection of disease. We show that it is possible to eradicate the disease by using such purely local control measures, even in the presence of long-range jumps. In particular, we show that the success of local control and the choice of the optimal strategy depend in a non-trivial way on the dispersal patterns of the vectors. By characterizing these patterns using the stability index of the alpha-stable distribution to change the power-law behaviour or the exponent characterizing the decay of an exponential power distribution, we show that infection can be successfully contained using relatively small control neighbourhoods for two limiting cases for long-distance dispersal and for vectors that are much more limited in their dispersal range.

  4. ICRF [Ion Cyclotron Range of Frequencies] edge modeling studies

    International Nuclear Information System (INIS)

    Lehrman, I.S.; Colestock, P.L.

    1989-01-01

    Theoretical models have been developed, and are currently being refined, to explain the edge plasma-antenna interaction that occurs during ICRF heating. The periodic structure of a Faraday shielded antenna is found to result in strong ponderomotive force in the vicinity of the antenna. A fluid model, which incorporates the ponderomotive force, shows an increase in transport to the Faraday shield. A kinetic model shows that the strong antenna near fields act to increase the energy of deuterons which strike the shield, thereby increasing the sputtering of shield material. Estimates of edge impurity harmonic heating no significant heating for either in or out-of-phase antenna operation. Additionally, a particle model for electrons near the shield shows that heating results from the parallel electric field associated with the fast wave. A quasilinear model for edge electron heating is presented and compared to the particle calculations. The models' predictions are shown to be consistent with measurements of enhanced transport. 19 refs., 9 figs

  5. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  6. Global transportation cost modeling for long-range planning

    International Nuclear Information System (INIS)

    Pope, R.B.; Michelhaugh, R.D.; Singley, P.T.; Lester, P.B.

    1998-02-01

    The US Department of Energy (DOE) is preparing to perform significant remediation activities of the sites for which it is responsible. To accomplish this, it is preparing a corporate global plan focused on activities over the next decade. Significant in these planned activities is the transportation of the waste arising from the remediation. The costs of this transportation are expected to be large. To support the initial assessment of the plan, a cost estimating model was developed, peer-reviewed against other available packaging and transportation cost data, and applied to a significant number of shipping campaigns of radioactive waste. This cost estimating model, known as the Ten-year Plan Transportation Cost Model (TEPTRAM), can be used to model radioactive material shipments between DOE sites or from DOE sites to non-DOE destinations. The model considers the costs for (a) recovering and processing of the wastes, (b)packaging the wastes for transport, and (c) the carriage of the waste. It also provides a rough order of magnitude estimate of labor costs associated with preparing and undertaking the shipments. At the user's direction, the model can also consider the cost of DOE's interactions with its external stakeholders (e.g., state and local governments and tribal entities) and the cost associated with tracking and communicating with the shipments. By considering all of these sources of costs, it provides a mechanism for assessing and comparing the costs of various waste processing and shipping campaign alternatives to help guide decision-making. Recent analyses of specific planned shipments of transuranic (TRU) waste which consider alternative packaging options are described. These analyses show that options are available for significantly reducing total costs while still satisfying regulatory requirements

  7. Global transportation cost modeling for long range planning

    International Nuclear Information System (INIS)

    Pope, R.B.; Michelhaugh, R.D.; Singley, P.T.; Lester, P.B.

    1998-01-01

    The U.S. Department of Energy (DOE) is preparing to perform significant remediation activities of the sites for which it is responsible. To accomplish this, it is preparing a corporate global plan focused on activities over the next decade. Significant in these planned activities is the transportation of the waste arising from the remediation. The costs of this transportation are expected to be large. To support the initial assessment of the plan, a cost-estimating model was developed, peer-reviewed against other available packaging and transportation cost data, and applied to significant number of shipping campaigns of radioactive waste. This cost-estimating model, known as the TEn-year Plan TRAnsportation cost Model (TEPTRAM), can be used to model radioactive material shipments between DOE sites or from DOE sites to non-DOE destinations. The model considers the costs for recovering and processing of the wastes, packaging the wastes for transport, and the carriage of the waste. It also provides a rough order-of-magnitude estimate of labor costs associated with preparing nd undertaking the shipments. At the user's direction, the model can also consider the cost of DOE's interactions with its external stakeholders (e.g., state and local governments and tribal entities) and the cost associated with tracking and communicating with the shipments. By considering all of these sources of costs, it provides a mechanism for assessing and comparing the costs of various waste processing and shipping campaign alternatives to help guide decision-making. Recent analyses of specific planned shipments of transuranic (TRU) waste which consider alternative packaging options are described. These analyses show that options are available for significantly reducing total costs while still satisfying regulatory requirements. (authors)

  8. Collective probabilities algorithm for surface hopping calculations

    International Nuclear Information System (INIS)

    Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

    2003-01-01

    General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

  9. a Range Based Method for Complex Facade Modeling

    Science.gov (United States)

    Adami, A.; Fregonese, L.; Taffurelli, L.

    2011-09-01

    3d modelling of Architectural Heritage does not follow a very well-defined way, but it goes through different algorithms and digital form according to the shape complexity of the object, to the main goal of the representation and to the starting data. Even if the process starts from the same data, such as a pointcloud acquired by laser scanner, there are different possibilities to realize a digital model. In particular we can choose between two different attitudes: the mesh and the solid model. In the first case the complexity of architecture is represented by a dense net of triangular surfaces which approximates the real surface of the object. In the other -opposite- case the 3d digital model can be realized by the use of simple geometrical shapes, by the use of sweeping algorithm and the Boolean operations. Obviously these two models are not the same and each one is characterized by some peculiarities concerning the way of modelling (the choice of a particular triangulation algorithm or the quasi-automatic modelling by known shapes) and the final results (a more detailed and complex mesh versus an approximate and more simple solid model). Usually the expected final representation and the possibility of publishing lead to one way or the other. In this paper we want to suggest a semiautomatic process to build 3d digital models of the facades of complex architecture to be used for example in city models or in other large scale representations. This way of modelling guarantees also to obtain small files to be published on the web or to be transmitted. The modelling procedure starts from laser scanner data which can be processed in the well known way. Usually more than one scan is necessary to describe a complex architecture and to avoid some shadows on the facades. These have to be registered in a single reference system by the use of targets which are surveyed by topography and then to be filtered in order to obtain a well controlled and homogeneous point cloud of

  10. A RANGE BASED METHOD FOR COMPLEX FACADE MODELING

    Directory of Open Access Journals (Sweden)

    A. Adami

    2012-09-01

    Full Text Available 3d modelling of Architectural Heritage does not follow a very well-defined way, but it goes through different algorithms and digital form according to the shape complexity of the object, to the main goal of the representation and to the starting data. Even if the process starts from the same data, such as a pointcloud acquired by laser scanner, there are different possibilities to realize a digital model. In particular we can choose between two different attitudes: the mesh and the solid model. In the first case the complexity of architecture is represented by a dense net of triangular surfaces which approximates the real surface of the object. In the other -opposite- case the 3d digital model can be realized by the use of simple geometrical shapes, by the use of sweeping algorithm and the Boolean operations. Obviously these two models are not the same and each one is characterized by some peculiarities concerning the way of modelling (the choice of a particular triangulation algorithm or the quasi-automatic modelling by known shapes and the final results (a more detailed and complex mesh versus an approximate and more simple solid model. Usually the expected final representation and the possibility of publishing lead to one way or the other. In this paper we want to suggest a semiautomatic process to build 3d digital models of the facades of complex architecture to be used for example in city models or in other large scale representations. This way of modelling guarantees also to obtain small files to be published on the web or to be transmitted. The modelling procedure starts from laser scanner data which can be processed in the well known way. Usually more than one scan is necessary to describe a complex architecture and to avoid some shadows on the facades. These have to be registered in a single reference system by the use of targets which are surveyed by topography and then to be filtered in order to obtain a well controlled and

  11. Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

    Science.gov (United States)

    Schumacher, Christian; Seyfarth, André

    2017-01-01

    In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific

  12. Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

    Science.gov (United States)

    Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

    2018-03-30

    Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

  13. RETADDII: modeling long-range atmospheric transport of radionuclides

    International Nuclear Information System (INIS)

    Murphy, B.D.

    1982-01-01

    A versatile model is described which estimates atmospheric dispersion based on plume trajectories calculated for the mixed layer. This model allows the treatment of the dispersal from a source at an arbitrary height while taking account of plume depletion by dry and wet deposition together with the decay of material to successor species. The plume depletion, decay and growth equations are solved in an efficient manner which can accommodate up to eight pollutants (i.e. a parent and seven serial decay products). The code is particularly suitable for applications involving radioactive chain decay or for cases involving chemical species with successor decay products. Arbitrary emission rates can be specified for the members of the chain or, as is commonly the case, a sole emission rate can be specified for the first member. The code, in its current configuration, uses readily available upper-air wind data for the North American continent

  14. A long range transport model of Rn-222

    International Nuclear Information System (INIS)

    Ikebe, Y.; Kojima, S.; Shimo, M.

    1993-01-01

    In this report, we propose an analytical treatment about temporal variation of 222 Rn concentration in the atmosphere with an aim to clarify origin and transport of 222 Rn. Based on the results of numerical simulation of radon, we separate the 222 Re concentration measured at Nagoya into the following two components : (1) 222 Rn atom originated near from the measuring site, which is denoted by 'diurnal variation component'. From numerical simulation of radon, it has been shown that the measured diurnal variation can be explained by this component. (2) 222 Rn atoms originated far from the measuring site (including Chinese Continent), which is denoted by 'background component'. For this component, we propose here a one layer transport model using air mass trajectory technique. By this model we can explain the temporal variation of background component and seasonal variation of 222 Rn at Nagoya. (3 figs.)

  15. Modeling of long-range migration of boron interstitials

    International Nuclear Information System (INIS)

    Velichko, O.I.; Burunova, O.N.

    2009-01-01

    A model of the interstitial migration of ion-implanted dopant in silicon during low-temperature thermal treatment has been formulated. It is supposed that the boron interstitials are created during ion implantation or at the initial stage of annealing. During thermal treatment a migration of these impurity interstitials to the surface and in the bulk of a semiconductor occurs. On this basis, a simulation of boron redistribution during thermal annealing for 35 minutes at a temperature of 800 0 C has been carried out. The calculated boron profile agrees well with the experimental data. A number of the parameters describing the interstitial diffusion have been derived. In particular, the average migration length of nonequilibrium boron interstitials is equal to 0.092 μm at a temperature of 800 0 C. To carry out modeling of ion-implanted boron redistribution, the analytical solutions of nonstationary diffusion equation for impurity interstitials have been obtained. The case of Dirichlet boundary conditions and the case of reflecting boundary on the surface of a semiconductor have been considered. (authors)

  16. Dust Plume Modeling from Ranges and Maneuver Areas on Fort Bliss and the White Sands Missile Range: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Chapman, Elaine G.; Barnard, James C.; Rutz, Frederick C.; Pekour, Mikhail S.; Rishel, Jeremy P.; Shaw, William J.

    2009-05-04

    The potential for air quality impacts from heavy mechanized vehicles operating on and between the unpaved main supply routes at Fort Bliss and White Sands Missile Range was investigated. This report details efforts by the staff of Pacific Northwest National Laboratory for the Fort Bliss Directorate of Environment in this investigation. Dust emission and dispersion from typical move-out activities occurring on the installations were simulated using the atmospheric modeling system DUSTRAN. Major assumptions associated with designing the modeling scenarios are summarized and results of simulations conducted under these assumptions are presented for four representative meteorological periods.

  17. Spallation model for the high strain rates range

    Science.gov (United States)

    Dekel, E.; Eliezer, S.; Henis, Z.; Moshe, E.; Ludmirsky, A.; Goldberg, I. B.

    1998-11-01

    Measurements of the dynamic spall strength in aluminum and copper shocked by a high power laser to pressures of hundreds of kbars show a rapid increase in the spall strength with the strain rate at values of about 107 s-1. We suggest that this behavior is a result of a change in the spall mechanism. At low strain rates the spall is caused by the motion and coalescence of material's initial flaws. At high strain rates there is not enough time for the flaws to move and the spall is produced by the formation and coalescence of additional cavities where the interatomic forces become dominant. Material under tensile stress is in a metastable condition and cavities of a critical radius are formed in it due to thermal fluctuations. These cavities grow due to the tension. The total volume of the voids grow until the material disintegrates at the spall plane. Simplified calculations based on this model, describing the metal as a viscous liquid, give results in fairly good agreement with the experimental data and predict the increase in spall strength at high strain rates.

  18. Modeling Brain Circuitry over a Wide Range of Scales

    Directory of Open Access Journals (Sweden)

    Pascal eFua

    2015-04-01

    Full Text Available If we are ever to unravel the mysteries of brain function at its most fundamental level, we will need a precise understanding of how its component neurons connect to each other. Electron Microscopes (EM can now provide the nanometer resolution that is needed to image synapses, and therefore connections, while Light Microscopes (LM see at the micrometer resolution required to model the 3D structure of the dendritic network. Since both the topology and the connection strength are integral parts of the brain's wiring diagram, being able to combine these two modalities is critically important.In fact, these microscopes now routinely produce high-resolution imagery in such large quantities that the bottleneck becomes automated processing and interpretation, which is needed for such data to be exploited to its full potential. In this paper, we briefly review the Computer Vision techniques we have developed at EPFL to address this need. They include delineating dendritic arbors from LM imagery, segmenting organelles from EM, and combining the two into a consistent representation.

  19. Modeling brain circuitry over a wide range of scales.

    Science.gov (United States)

    Fua, Pascal; Knott, Graham W

    2015-01-01

    If we are ever to unravel the mysteries of brain function at its most fundamental level, we will need a precise understanding of how its component neurons connect to each other. Electron Microscopes (EM) can now provide the nanometer resolution that is needed to image synapses, and therefore connections, while Light Microscopes (LM) see at the micrometer resolution required to model the 3D structure of the dendritic network. Since both the topology and the connection strength are integral parts of the brain's wiring diagram, being able to combine these two modalities is critically important. In fact, these microscopes now routinely produce high-resolution imagery in such large quantities that the bottleneck becomes automated processing and interpretation, which is needed for such data to be exploited to its full potential. In this paper, we briefly review the Computer Vision techniques we have developed at EPFL to address this need. They include delineating dendritic arbors from LM imagery, segmenting organelles from EM, and combining the two into a consistent representation.

  20. Research on synchronization technology of frequency hopping communication system

    Science.gov (United States)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

    2018-05-01

    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  1. An analysis of the accuracy of an initial value representation surface hopping wave function in the interaction and asymptotic regions

    International Nuclear Information System (INIS)

    Sergeev, Alexey; Herman, Michael F.

    2006-01-01

    The behavior of an initial value representation surface hopping wave function is examined. Since this method is an initial value representation for the semiclassical solution of the time independent Schroedinger equation for nonadiabatic problems, it has computational advantages over the primitive surface hopping wave function. The primitive wave function has been shown to provide transition probabilities that accurately compare with quantum results for model problems. The analysis presented in this work shows that the multistate initial value representation surface hopping wave function should approach the primitive result in asymptotic regions and provide transition probabilities with the same level of accuracy for scattering problems as the primitive method

  2. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  3. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  4. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  5. Performance analysis of multi-hop wireless packet networks

    Directory of Open Access Journals (Sweden)

    Lim J.-T.

    1997-01-01

    Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

  6. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    Science.gov (United States)

    Neiens, Silva D; Steinhaus, Martin

    2018-02-14

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  7. Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures

    Science.gov (United States)

    Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter

    2018-05-01

    The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.

  8. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  9. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  10. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  11. Communication: Fully coherent quantum state hopping

    Energy Technology Data Exchange (ETDEWEB)

    Martens, Craig C., E-mail: cmartens@uci.edu [University of California, Irvine, California 92697-2025 (United States)

    2015-10-14

    In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

  12. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    Science.gov (United States)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  13. Quantum Hall effect and hopping conductivity in n-InGaAs/InAlAs nanoheterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Gudina, S. V., E-mail: svpopova@imp.uran.ru; Arapov, Yu. G.; Saveliev, A. P.; Neverov, V. N.; Podgornykh, S. M.; Shelushinina, N. G.; Yakunin, M. V. [Russian Academy of Sciences, Mikheev Institute of Metal Physics, Ural Branch (Russian Federation); Vasil’evskii, I. S.; Vinichenko, A. N. [National Research Nuclear University MEPhI (Russian Federation)

    2016-12-15

    The longitudinal and Hall magnetoresistances are measured in the quantum Hall effect regime in the n-InGaAs/InAlAs heterostructures at temperatures of T = (1.8–30) K in magnetic fields up to B = 9 T. Temperature-induced transport in the region of the longitudinal resistance minima, corresponding to the plateau regions at Hall resistance, is investigated within the framework of the concept of hopping conductivity in a strongly localized electron system. The analysis of variable-range hopping conductivity in the region of the second, third, and fourth plateau of the quantum Hall effect provides the possibility of determining the localization length exponent.

  14. Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

    2015-10-07

    We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

  15. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  16. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  17. Semiclassical quantization of nonadiabatic systems with hopping periodic orbits

    International Nuclear Information System (INIS)

    Fujii, Mikiya; Yamashita, Koichi

    2015-01-01

    We present a semiclassical quantization condition, i.e., quantum–classical correspondence, for steady states of nonadiabatic systems consisting of fast and slow degrees of freedom (DOFs) by extending Gutzwiller’s trace formula to a nonadiabatic form. The quantum–classical correspondence indicates that a set of primitive hopping periodic orbits, which are invariant under time evolution in the phase space of the slow DOF, should be quantized. The semiclassical quantization is then applied to a simple nonadiabatic model and accurately reproduces exact quantum energy levels. In addition to the semiclassical quantization condition, we also discuss chaotic dynamics involved in the classical limit of nonadiabatic dynamics

  18. Hopping transport and electrical conductivity in one-dimensional systems with off-diagonal disorder

    International Nuclear Information System (INIS)

    Ma Songshan; Xu Hui; Li Yanfeng; Song Zhaoquan

    2007-01-01

    In this paper, we present a model to describe hopping transport and electrical conductivity of one-dimensional systems with off-diagonal disorder, in which electrons are transported via hopping between localized states. We find that off-diagonal disorder leads to delocalization and drastically enhances the electrical conductivity of systems. The model also quantitatively explains the temperature and electrical field dependence of the conductivity in one-dimensional systems with off-diagonal disorder. In addition, we also show the dependence of the conductivity on the strength of off-diagonal disorder

  19. Hip-Hop Fight Club: Radical Theory, Education, and Practice in and beyond the Classroom

    Directory of Open Access Journals (Sweden)

    Jared A. Ball

    2013-10-01

    Full Text Available Hip-hop remains a viable method for the teaching of radical theory, emancipatory journalism and Africana Media Theory.  Fight Club is an emergent model that builds from existing hip-hop traditions of freetyle battling where critical thought and intellectual challenges of hueristic norms are upended.  This article argues in favor of bringing the Fight Club model into the classroom which allows for heightened student engagement and the inclusion of radical theoretical approaches to the study of mass media, communication and journalism.

  20. Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

    Science.gov (United States)

    Alim, H. Samy

    2011-01-01

    This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

  1. Adaptive Demand-Driven Multicast Routing in Multi-Hop Wireless Ad Hoc Networks

    National Research Council Canada - National Science Library

    Jetcheva, Jorjeta G

    2004-01-01

    ...) nodes that wish to communicate. Each node in the ad hoc network acts as a router and forwards packets on behalf of other nodes, allowing nodes that are not within wireless range of each other to communicate over multi-hop paths...

  2. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  3. Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

    Science.gov (United States)

    Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

    2011-01-01

    For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

  4. Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

    Science.gov (United States)

    Hartmann, Richard; Strunz, Walter T

    2017-12-12

    We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

  5. The role of intrinsic muscle properties for stable hopping-stability is achieved by the force-velocity relation

    International Nuclear Information System (INIS)

    Haeufle, D F B; Grimmer, S; Seyfarth, A

    2010-01-01

    A reductionist approach was presented to investigate which level of detail of the physiological muscle is required for stable locomotion. Periodic movements of a simplified one-dimensional hopping model with a Hill-type muscle (one contractile element, neither serial nor parallel elastic elements) were analyzed. Force-length and force-velocity relations of the muscle were varied in three levels of approximation (constant, linear and Hill-shaped nonlinear) resulting in nine different hopping models of different complexity. Stability of these models was evaluated by return map analysis and the performance by the maximum hopping height. The simplest model (constant force-length and constant force-velocity relations) outperformed all others in the maximum hopping height but was unstable. Stable hopping was achieved with linear and Hill-shaped nonlinear characteristic of the force-velocity relation. The characteristics of the force-length relation marginally influenced hopping stability. The results of this approach indicate that the intrinsic properties of the contractile element are responsible for stabilization of periodic movements. This connotes that (a) complex movements like legged locomotion could benefit from stabilizing effects of muscle properties, and (b) technical systems could benefit from the emerging stability when implementing biological characteristics into artificial muscles.

  6. Robust hopping based on virtual pendulum posture control

    International Nuclear Information System (INIS)

    Sharbafi, Maziar A; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Maufroy, Christophe; Seyfarth, Andre

    2013-01-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved. (paper)

  7. Subunit Organisation of In Vitro Reconstituted HOPS and CORVET Multisubunit Membrane Tethering Complexes

    Science.gov (United States)

    Guo, Zhong; Johnston, Wayne; Kovtun, Oleksiy; Mureev, Sergey; Bröcker, Cornelia; Ungermann, Christian; Alexandrov, Kirill

    2013-01-01

    Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data. PMID:24312556

  8. An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2017-01-01

    Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

  9. Generalization of fewest-switches surface hopping for coherences

    Science.gov (United States)

    Tempelaar, Roel; Reichman, David R.

    2018-03-01

    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  10. Evaluation of airborne methyl salicylate for improved conservation biological control of two-spotted spider mite and hop aphid in Oregon hop yards.

    Science.gov (United States)

    Woods, J L; James, D G; Lee, J C; Gent, D H

    2011-12-01

    The use of synthetic herbivore-induced plant volatiles (HIPV) to attract natural enemies has received interest as a tool to enhance conservation biological control (CBC). Methyl salicylate (MeSA) is a HIPV that is attractive to several key predators of two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera: Aphididae). A 2-year study was conducted to evaluate the recommended commercial use of MeSA in hop yards in Oregon. Slow-release MeSA dispensers were stapled to supporting poles in 0.5 ha plots and these plots were compared to a paired non-treated plot on each of three farms in 2008 and 2009. Across both years, there was a trend for reduced (range 40-91%) mean seasonal numbers of T. urticae in five of the six MeSA-baited plots. Stethorus spp., key spider mite predators, tended to be more numerous in MeSA-baited plots compared to control plots on a given farm. Mean seasonal densities of hop aphid and other natural enemies (e.g., Orius spp. and Anystis spp.) were similar between MeSA-treated and control plots. Variability among farms in suppression of two-spotted spider mites and attraction of Stethorus spp. suggests that the use of MeSA to enhance CBC of spider mites in commercial hop yards may be influenced by site-specific factors related to the agroecology of individual farms or seasonal effects that require further investigation. The current study also suggests that CBC of hop aphid with MeSA in this environment may be unsatisfactory.

  11. Radio resource management scheme and outage analysis for network-assisted multi-hop D2D communications

    Directory of Open Access Journals (Sweden)

    Leila Melki

    2016-11-01

    Full Text Available In a cellular network it's very difficult to make spectrum resource more efficiently. Device-to-Device (D2D technology enables new service opportunities, and provides high throughput and reliable communication while reducing the base station load. For better total performance, short-range D2D links and cellular links share the same radio resource and the management of interference becomes a crucial task. Here we argue that single-hop D2D technology can be used to further improve cellular networks performance if the key D2D radio resource management algorithms are suitably extended to support multi-hop D2D communications. Aiming to establish a new paradigm for the analysis and design of multi-hop D2D communications, We propose a radio resource allocation for multi-hop D2D routes based on interference avoidance approach in LTE-A networks. On top of that, we investigate the outage probability of D2D communication. We first introduce a new definition of outage probability by considering the maximum distance to be allowable for single-hop transmission. Then we study and analyze the outage performance of a multi-hop D2D route. We derive the general closed form expression of outage probability of the multi-hop D2D routes. The results demonstrate that the D2D radio, sharing the same resources as the cellular network, provide higher capacity compared to pure cellular communication where all the data is transmitted through the base station. They also demonstrate that the new method of calculation of D2D multi hop outage probability has better performance than classical method defined in the literature.

  12. Epigenetic changes detected in micropropagated hop plants.

    Science.gov (United States)

    Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles

    2009-07-01

    Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

  13. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    Science.gov (United States)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  14. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  15. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  16. Small polaron hopping in magnetic semiconductors

    International Nuclear Information System (INIS)

    Emin, D.; Liu, N.L.H.

    1978-01-01

    In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

  17. Crossover from quantum tunneling to classical hopping of domain walls in ferromagnets

    Science.gov (United States)

    Zhou, Bin; Liang, Jiu-Qing; Pu, Fu-Cho

    2001-09-01

    In the model of quantum tunneling of domain walls in ferromagnets given by Chudnovsky et al., the crossover from quantum tunneling to classical hopping is investigated. Considering the periodical boundary condition of spatial coordinate, the type of transition depends critically on the length of ferromagnet along the Y-axis.

  18. Asynchronous Channel-Hopping Scheme under Jamming Attacks

    Directory of Open Access Journals (Sweden)

    Yongchul Kim

    2018-01-01

    Full Text Available Cognitive radio networks (CRNs are considered an attractive technology to mitigate inefficiency in the usage of licensed spectrum. CRNs allow the secondary users (SUs to access the unused licensed spectrum and use a blind rendezvous process to establish communication links between SUs. In particular, quorum-based channel-hopping (CH schemes have been studied recently to provide guaranteed blind rendezvous in decentralized CRNs without using global time synchronization. However, these schemes remain vulnerable to jamming attacks. In this paper, we first analyze the limitations of quorum-based rendezvous schemes called asynchronous channel hopping (ACH. Then, we introduce a novel sequence sensing jamming attack (SSJA model in which a sophisticated jammer can dramatically reduce the rendezvous success rates of ACH schemes. In addition, we propose a fast and robust asynchronous rendezvous scheme (FRARS that can significantly enhance robustness under jamming attacks. Our numerical results demonstrate that the performance of the proposed scheme vastly outperforms the ACH scheme when there are security concerns about a sequence sensing jammer.

  19. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  20. Theory of one-dimensional hopping motion of a heavy particle interacting with phonons by different couplings

    Science.gov (United States)

    Itai, K.

    1987-02-01

    Two models which describe one-dimensional hopping motion of a heavy particle interacting with phonons are discussed. Model A corresponds to hopping in 1D metals or to the polaron problem. In model B the momentum dependence of the particle-phonon coupling is proportional to k-1/2. The scaling equations show that only in model B does localization occur for a coupling larger than a critical value. In the localization region this model shows close analogy to the Caldeira-Leggett model for macroscopic quantum tunneling.

  1. Identification of critical chemical features for Aurora kinase-B inhibitors using Hip-Hop, virtual screening and molecular docking

    Science.gov (United States)

    Sakkiah, Sugunadevi; Thangapandian, Sundarapandian; John, Shalini; Lee, Keun Woo

    2011-01-01

    This study was performed to find the selective chemical features for Aurora kinase-B inhibitors using the potent methods like Hip-Hop, virtual screening, homology modeling, molecular dynamics and docking. The best hypothesis, Hypo1 was validated toward a wide range of test set containing the selective inhibitors of Aurora kinase-B. Homology modeling and molecular dynamics studies were carried out to perform the molecular docking studies. The best hypothesis Hypo1 was used as a 3D query to screen the chemical databases. The screened molecules from the databases were sorted based on ADME and drug like properties. The selective hit compounds were docked and the hydrogen bond interactions with the critical amino acids present in Aurora kinase-B were compared with the chemical features present in the Hypo1. Finally, we suggest that the chemical features present in the Hypo1 are vital for a molecule to inhibit the Aurora kinase-B activity.

  2. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems

    Science.gov (United States)

    Barnett, George; D'Souza, Raissa M.

    2015-01-01

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast–slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to ‘hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. PMID:26559684

  3. Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

    Science.gov (United States)

    Lawson, Carl J

    2015-12-01

    The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

  4. Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

    Science.gov (United States)

    Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

    2016-04-06

    Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

  5. Hopping on the methadone bus.

    Science.gov (United States)

    Lippert, Steffen; Schumacher, Christoph

    2009-05-01

    This paper investigates the impact of a 'free drug program' on the market equilibrium of drugs. We introduce a screening model of the hard drug market in which dealers use payment and punishment options to screen between high and low risk users. We show that, if a free drug program selects sufficiently many high-risk drug users, the pure-strategy separating market equilibrium ceases to exist and a symmetric mixed-strategy equilibrium results, in which drug users derive a higher expected utility. This encourages new drug users to enter the market. The novelty of the paper is the transmission mechanism for this effect, which is via the influence on market price.

  6. A feedback-retransmission based asynchronous frequency hopping MAC protocol for military aeronautical ad hoc networks

    Directory of Open Access Journals (Sweden)

    Jinhui TANG

    2018-05-01

    Full Text Available Attacking time-sensitive targets has rigid demands for the timeliness and reliability of information transmission, while typical Media Access Control (MAC designed for this application works well only in very light-load scenarios; as a consequence, the performances of system throughput and channel utilization are degraded. For this problem, a feedback-retransmission based asynchronous FRequency hopping Media Access (FRMA control protocol is proposed. Burst communication, asynchronous Frequency Hopping (FH, channel coding, and feedback retransmission are utilized in FRMA. With the mechanism of asynchronous FH, immediate packet transmission and multi-packet reception can be realized, and thus the timeliness is improved. Furthermore, reliability can be achieved via channel coding and feedback retransmission. With theories of queuing theory, Markov model, packets collision model, and discrete Laplace transformation, the formulas of packet success probability, system throughput, average packet end-to-end delay, and delay distribution are obtained. The approximation accuracy of theoretical derivation is verified by experimental results. Within a light-load network, the proposed FRMA has the ability of millisecond delay and 99% reliability as well as outperforms the non-feedback-retransmission based asynchronous frequency hopping media access control protocol. Keywords: Ad hoc networks, Aeronautical communications, Frequency hopping, Media Access Control (MAC, Time-sensitive

  7. Climate change impacts on tree ranges: model intercomparison facilitates understanding and quantification of uncertainty.

    Science.gov (United States)

    Cheaib, Alissar; Badeau, Vincent; Boe, Julien; Chuine, Isabelle; Delire, Christine; Dufrêne, Eric; François, Christophe; Gritti, Emmanuel S; Legay, Myriam; Pagé, Christian; Thuiller, Wilfried; Viovy, Nicolas; Leadley, Paul

    2012-06-01

    Model-based projections of shifts in tree species range due to climate change are becoming an important decision support tool for forest management. However, poorly evaluated sources of uncertainty require more scrutiny before relying heavily on models for decision-making. We evaluated uncertainty arising from differences in model formulations of tree response to climate change based on a rigorous intercomparison of projections of tree distributions in France. We compared eight models ranging from niche-based to process-based models. On average, models project large range contractions of temperate tree species in lowlands due to climate change. There was substantial disagreement between models for temperate broadleaf deciduous tree species, but differences in the capacity of models to account for rising CO(2) impacts explained much of the disagreement. There was good quantitative agreement among models concerning the range contractions for Scots pine. For the dominant Mediterranean tree species, Holm oak, all models foresee substantial range expansion. © 2012 Blackwell Publishing Ltd/CNRS.

  8. A sub-circuit MOSFET model with a wide temperature range including cryogenic temperature

    Energy Technology Data Exchange (ETDEWEB)

    Jia Kan; Sun Weifeng; Shi Longxing, E-mail: jiakan.01@gmail.com [National ASIC System Engineering Research Center, Southeast University, Nanjing 210096 (China)

    2011-06-15

    A sub-circuit SPICE model of a MOSFET for low temperature operation is presented. Two resistors are introduced for the freeze-out effect, and the explicit behavioral models are developed for them. The model can be used in a wide temperature range covering both cryogenic temperature and regular temperatures. (semiconductor devices)

  9. Creating historical range of variation (HRV) time series using landscape modeling: Overview and issues [Chapter 8

    Science.gov (United States)

    Robert E. Keane

    2012-01-01

    Simulation modeling can be a powerful tool for generating information about historical range of variation (HRV) in landscape conditions. In this chapter, I will discuss several aspects of the use of simulation modeling to generate landscape HRV data, including (1) the advantages and disadvantages of using simulation, (2) a brief review of possible landscape models. and...

  10. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  11. Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

    Czech Academy of Sciences Publication Activity Database

    Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal

    2009-01-01

    Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

  12. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  13. Incorporating spatial autocorrelation into species distribution models alters forecasts of climate-mediated range shifts.

    Science.gov (United States)

    Crase, Beth; Liedloff, Adam; Vesk, Peter A; Fukuda, Yusuke; Wintle, Brendan A

    2014-08-01

    Species distribution models (SDMs) are widely used to forecast changes in the spatial distributions of species and communities in response to climate change. However, spatial autocorrelation (SA) is rarely accounted for in these models, despite its ubiquity in broad-scale ecological data. While spatial autocorrelation in model residuals is known to result in biased parameter estimates and the inflation of type I errors, the influence of unmodeled SA on species' range forecasts is poorly understood. Here we quantify how accounting for SA in SDMs influences the magnitude of range shift forecasts produced by SDMs for multiple climate change scenarios. SDMs were fitted to simulated data with a known autocorrelation structure, and to field observations of three mangrove communities from northern Australia displaying strong spatial autocorrelation. Three modeling approaches were implemented: environment-only models (most frequently applied in species' range forecasts), and two approaches that incorporate SA; autologistic models and residuals autocovariate (RAC) models. Differences in forecasts among modeling approaches and climate scenarios were quantified. While all model predictions at the current time closely matched that of the actual current distribution of the mangrove communities, under the climate change scenarios environment-only models forecast substantially greater range shifts than models incorporating SA. Furthermore, the magnitude of these differences intensified with increasing increments of climate change across the scenarios. When models do not account for SA, forecasts of species' range shifts indicate more extreme impacts of climate change, compared to models that explicitly account for SA. Therefore, where biological or population processes induce substantial autocorrelation in the distribution of organisms, and this is not modeled, model predictions will be inaccurate. These results have global importance for conservation efforts as inaccurate

  14. Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping

    Directory of Open Access Journals (Sweden)

    Christian Schumacher

    2017-11-01

    Full Text Available In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB, velocity (VFB and force feedback (FFB pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort. Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map. The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency. Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length or environmental parameters (ground compliance. Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a

  15. Impacts of land cover data selection and trait parameterisation on dynamic modelling of species' range expansion.

    Directory of Open Access Journals (Sweden)

    Risto K Heikkinen

    Full Text Available Dynamic models for range expansion provide a promising tool for assessing species' capacity to respond to climate change by shifting their ranges to new areas. However, these models include a number of uncertainties which may affect how successfully they can be applied to climate change oriented conservation planning. We used RangeShifter, a novel dynamic and individual-based modelling platform, to study two potential sources of such uncertainties: the selection of land cover data and the parameterization of key life-history traits. As an example, we modelled the range expansion dynamics of two butterfly species, one habitat specialist (Maniola jurtina and one generalist (Issoria lathonia. Our results show that projections of total population size, number of occupied grid cells and the mean maximal latitudinal range shift were all clearly dependent on the choice made between using CORINE land cover data vs. using more detailed grassland data from three alternative national databases. Range expansion was also sensitive to the parameterization of the four considered life-history traits (magnitude and probability of long-distance dispersal events, population growth rate and carrying capacity, with carrying capacity and magnitude of long-distance dispersal showing the strongest effect. Our results highlight the sensitivity of dynamic species population models to the selection of existing land cover data and to uncertainty in the model parameters and indicate that these need to be carefully evaluated before the models are applied to conservation planning.

  16. Range walk error correction and modeling on Pseudo-random photon counting system

    Science.gov (United States)

    Shen, Shanshan; Chen, Qian; He, Weiji

    2017-08-01

    Signal to noise ratio and depth accuracy are modeled for the pseudo-random ranging system with two random processes. The theoretical results, developed herein, capture the effects of code length and signal energy fluctuation are shown to agree with Monte Carlo simulation measurements. First, the SNR is developed as a function of the code length. Using Geiger-mode avalanche photodiodes (GMAPDs), longer code length is proven to reduce the noise effect and improve SNR. Second, the Cramer-Rao lower bound on range accuracy is derived to justify that longer code length can bring better range accuracy. Combined with the SNR model and CRLB model, it is manifested that the range accuracy can be improved by increasing the code length to reduce the noise-induced error. Third, the Cramer-Rao lower bound on range accuracy is shown to converge to the previously published theories and introduce the Gauss range walk model to range accuracy. Experimental tests also converge to the presented boundary model in this paper. It has been proven that depth error caused by the fluctuation of the number of detected photon counts in the laser echo pulse leads to the depth drift of Time Point Spread Function (TPSF). Finally, numerical fitting function is used to determine the relationship between the depth error and the photon counting ratio. Depth error due to different echo energy is calibrated so that the corrected depth accuracy is improved to 1cm.

  17. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  18. Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

    Science.gov (United States)

    Moktan, Hem; Pezza, Roberto; Zhou, Donghua

    2015-03-01

    The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

  19. Long-range transport and global fractionation of POPs: insights from multimedia modeling studies

    International Nuclear Information System (INIS)

    Scheringer, M.; Salzmann, M.; Stroebe, M.; Wegmann, F.; Fenner, K.; Hungerbuehler, K.

    2004-01-01

    The long-range transport of persistent organic pollutants (POPs) is investigated with two multimedia box models of the global system. ChemRange is a purely evaluative, one-dimensional steady-state (level III) model; CliMoChem is a two-dimensional model with different temperatures, land/water ratios and vegetation types in different latitudinal zones. Model results are presented for three case studies: (i) the effect of atmospheric aerosol particles on the long-range transport of POPs, (ii) the effect of oceanic deposition on the long-range transport of different PCB congeners, (iii) the global fractionation of different PCB congeners. The model results for these case studies show: (i) the low atmospheric half-lives estimated for several organochlorine pesticides are likely to be inconsistent with the observed long-range transport of these compounds; (ii) export to the deep sea reduces the potential for long-range transport of highly hydrophobic compounds (but does not remove these chemicals from the biosphere); (iii) there are different meanings of the term global fractionation that refer to different aspects of the fractionation process and need to be distinguished. The case-study results further indicate that the influences of varying environmental conditions on the physicochemical properties and the degradation rate constants of POPs need to be determined. - Multimedia box models are applied to case studies of the behavior of POPs

  20. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  1. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  2. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  3. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  4. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  5. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  6. Hop powdery mildew control through alteration of spring pruning practices

    Science.gov (United States)

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  7. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  8. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  9. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  10. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  11. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  12. Study of an Ising model with competing long- and short-range interactions

    International Nuclear Information System (INIS)

    Loew, U.; Emery, V.J.; Fabricius, K.; Kivelson, S.A.

    1994-01-01

    A classical spin-one lattice gas model is used to study the competition between short-range ferromagnetic coupling and long-range antiferromagnetic Coulomb interactions. The model is a coarse-grained representation of frustrated phase separation in high-temperature superconductors. The ground states are determined for the complete range of parameters by using a combination of numerical and analytical techniques. The crossover between ferromagnetic and antiferromagnetic states proceeds via a rich structure of highly symmetric striped and checkerboard phases. There is no devil's staircase behavior because mixtures of stripes with different period phase separate

  13. Electronic and vibrational hopping transport in boron carbides

    International Nuclear Information System (INIS)

    Emin, D.

    1991-01-01

    General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

  14. Short-Range Prediction of Monsoon Precipitation by NCMRWF Regional Unified Model with Explicit Convection

    Science.gov (United States)

    Mamgain, Ashu; Rajagopal, E. N.; Mitra, A. K.; Webster, S.

    2018-03-01

    There are increasing efforts towards the prediction of high-impact weather systems and understanding of related dynamical and physical processes. High-resolution numerical model simulations can be used directly to model the impact at fine-scale details. Improvement in forecast accuracy can help in disaster management planning and execution. National Centre for Medium Range Weather Forecasting (NCMRWF) has implemented high-resolution regional unified modeling system with explicit convection embedded within coarser resolution global model with parameterized convection. The models configurations are based on UK Met Office unified seamless modeling system. Recent land use/land cover data (2012-2013) obtained from Indian Space Research Organisation (ISRO) are also used in model simulations. Results based on short-range forecast of both the global and regional models over India for a month indicate that convection-permitting simulations by the high-resolution regional model is able to reduce the dry bias over southern parts of West Coast and monsoon trough zone with more intense rainfall mainly towards northern parts of monsoon trough zone. Regional model with explicit convection has significantly improved the phase of the diurnal cycle of rainfall as compared to the global model. Results from two monsoon depression cases during study period show substantial improvement in details of rainfall pattern. Many categories in rainfall defined for operational forecast purposes by Indian forecasters are also well represented in case of convection-permitting high-resolution simulations. For the statistics of number of days within a range of rain categories between `No-Rain' and `Heavy Rain', the regional model is outperforming the global model in all the ranges. In the very heavy and extremely heavy categories, the regional simulations show overestimation of rainfall days. Global model with parameterized convection have tendency to overestimate the light rainfall days and

  15. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  16. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  17. Scaling behavior and variable hopping conductivity in the quantum Hall plateau transition

    International Nuclear Information System (INIS)

    Tu, Tao; Zhao, Yong-Jie; Guo, Guo-Ping; Hao, Xiao-Jie; Guo, Guang-Can

    2007-01-01

    We have measured the temperature dependence of the longitudinal resistivity ρ xx of a two-dimensional electron system in the regime of the quantum Hall plateau transition. We extracted the quantitative form of scaling function for ρ xx and compared it with the results of ordinary scaling theory and variable range hopping based theory. We find that the two alternative theoretically proposed scaling functions are valid in different regions

  18. Finite-range Coulomb gas models of banded random matrices and quantum kicked rotors.

    Science.gov (United States)

    Pandey, Akhilesh; Kumar, Avanish; Puri, Sanjay

    2017-11-01

    Dyson demonstrated an equivalence between infinite-range Coulomb gas models and classical random matrix ensembles for the study of eigenvalue statistics. We introduce finite-range Coulomb gas (FRCG) models via a Brownian matrix process, and study them analytically and by Monte Carlo simulations. These models yield new universality classes, and provide a theoretical framework for the study of banded random matrices (BRMs) and quantum kicked rotors (QKRs). We demonstrate that, for a BRM of bandwidth b and a QKR of chaos parameter α, the appropriate FRCG model has the effective range d=b^{2}/N=α^{2}/N, for large N matrix dimensionality. As d increases, there is a transition from Poisson to classical random matrix statistics.

  19. A Vertically Flow-Following, Icosahedral Grid Model for Medium-Range and Seasonal Prediction. Part 1: Model Description

    Science.gov (United States)

    Bleck, Rainer; Bao, Jian-Wen; Benjamin, Stanley G.; Brown, John M.; Fiorino, Michael; Henderson, Thomas B.; Lee, Jin-Luen; MacDonald, Alexander E.; Madden, Paul; Middlecoff, Jacques; hide

    2015-01-01

    A hydrostatic global weather prediction model based on an icosahedral horizontal grid and a hybrid terrain following/ isentropic vertical coordinate is described. The model is an extension to three spatial dimensions of a previously developed, icosahedral, shallow-water model featuring user-selectable horizontal resolution and employing indirect addressing techniques. The vertical grid is adaptive to maximize the portion of the atmosphere mapped into the isentropic coordinate subdomain. The model, best described as a stacked shallow-water model, is being tested extensively on real-time medium-range forecasts to ready it for possible inclusion in operational multimodel ensembles for medium-range to seasonal prediction.

  20. System Estimation of Panel Data Models under Long-Range Dependence

    DEFF Research Database (Denmark)

    Ergemen, Yunus Emre

    A general dynamic panel data model is considered that incorporates individual and interactive fixed effects allowing for contemporaneous correlation in model innovations. The model accommodates general stationary or nonstationary long-range dependence through interactive fixed effects...... and innovations, removing the necessity to perform a priori unit-root or stationarity testing. Moreover, persistence in innovations and interactive fixed effects allows for cointegration; innovations can also have vector-autoregressive dynamics; deterministic trends can be featured. Estimations are performed...

  1. Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

    Science.gov (United States)

    Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

    2015-12-17

    The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

  2. Worldwide status of long range atmospheric transportation models for use in emergency situations

    International Nuclear Information System (INIS)

    Tveten, U.

    1992-02-01

    This report contains the results of the work of a working group put together in order to summarize the status of long range atmospheric transportation models for use in an emergency situation in real-time mode. The most important characteristics of the various models are summarized. The models in use in the Nordic countries as well as a couple of non-Nordic models are presented in more detail. A discussion of the desired characteristics of real-time models (also referred to as Emergency Response Assisting Systems) is included

  3. Predicting long-range transport: a systematic evaluation of two multimedia transport models.

    Science.gov (United States)

    Bennett, D H; Scheringer, M; McKone, T E; Hungerbühler, K

    2001-03-15

    The United Nations Environment Program has recently developed criteria to identify and restrict chemicals with a potential for persistence and long-range transport (persistent organic pollutants or POPs). There are many stakeholders involved, and the issues are not only scientific but also include social, economic, and political factors. This work focuses on one aspect of the POPs debate, the criteria for determining the potential for long-range transport (LRT). Our goal is to determine if current models are reliable enough to support decisions that classify a chemical based on the LRT potential. We examine the robustness of two multimedia fate models for determining the relative ranking and absolute spatial range of various chemicals in the environment. We also consider the effect of parameter uncertainties and the model uncertainty associated with the selection of an algorithm for gas-particle partitioning on the model results. Given the same chemical properties, both models give virtually the same ranking. However, when chemical parameter uncertainties and model uncertainties such as particle partitioning are considered, the spatial range distributions obtained for the individual chemicals overlap, preventing a distinct rank order. The absolute values obtained for the predicted spatial range or travel distance differ significantly between the two models for the uncertainties evaluated. We find that to evaluate a chemical when large and unresolved uncertainties exist, it is more informative to use two or more models and include multiple types of uncertainty. Model differences and uncertainties must be explicitly confronted to determine how the limitations of scientific knowledge impact predictions in the decision-making process.

  4. Wifi, WiMax and LTE multi-hop mesh networks basic communication protocols and application areas

    CERN Document Server

    Wei, Hung-Yu; Dixit, Sudhir

    2013-01-01

    Wifi, WiMAX, and Cellular Multihop Networks presents an overview of WiFi-based and WiMAX-based multihop relay networks. As the first text to cover IEEE 802.16j multihop hop relay technology, this revolutionary resource explores the latest advances in multi-hop and ad-hoc networking. Not only does this reference provide the technological aspects, but also the applications for the emerging technology and architectural issues. Ranging from introductory material to advanced topics, this guidebook, plus PowerPoint slides, is essential for engineers, researchers, and students interested in

  5. Photometric evidence of electron precipitation induced by first hop whistlers

    International Nuclear Information System (INIS)

    Doolittle, J.H.; Carpenter, D.L.

    1983-01-01

    Electron precipitation events induced by discrete VLF whistler mode waves have previously been detected by photometers at Siple Station, Antarctica. This paper presents the first observations of ionospheric optical emissions correlated with VLF waves at the conjugate location, near Roberval, Quebec. Since most whistlers recorded at Siple or Roberval originate in the north, Roberval affords a clear perspective on the direct precipitation induced during the first pass of the wave as it propagates southward. For such a wave the direct precipitation and that induced in the ''mirrored mode'' by the returning two-hop wave should differ in arrival time by roughly twice the wave propagation time between hemispheres, while at Siple the effects of the direct and mirrored modes may overlap in time. A well defined series of observations of structured lambda4278 optical emissions was observed on August 30, 1979 in the aftermath of an intense magnetic storm. The optical emissions were found to lead the arrival time of the two-hop waves by about 0.7 s instead of lagging the local waves by about 1--2 s as had been previously observed for whistler driven events at Siple. The observed arrival time relationships are consistent with the predictions of a cyclotron resonance interaction model, and thus support previous observations of x-rays at Roberval. The importance of the first pass of the wave is further emphasized by an approximate proportionality between the amplitude of the VLF waves recorded at Siple and the intensity of the optical emission bursts at Roberval. Although structured optical emissions correlated with wave bursts can clearly be detected at Roberval, relatively large magnetospheric particle fluxes may be required to produce such events

  6. Thermal equilibrium properties of surface hopping with an implicit Langevin bath

    International Nuclear Information System (INIS)

    Sherman, M. C.; Corcelli, S. A.

    2015-01-01

    The ability of fewest switches surface hopping (FSSH) approach, where the classical degrees of freedom are coupled to an implicit Langevin bath, to establish and maintain an appropriate thermal equilibrium was evaluated in the context of a three site model for electron transfer. The electron transfer model consisted of three coupled diabatic states that each depends harmonically on the collective bath coordinate. This results in three states with increasing energy in the adiabatic representation. The adiabatic populations and distributions of the collective solvent coordinate were monitored during the course of 250 ns FSSH-Langevin (FSSH-L) simulations performed at a broad range of temperatures and for three different nonadiabatic coupling strengths. The agreement between the FSSH-L simulations and numerically exact results for the adiabatic population ratios and solvent coordinate distributions was generally favorable. The FSSH-L method produces a correct Boltzmann distribution of the solvent coordinate on each of the adiabats, but the integrated populations are slightly incorrect because FSSH does not rigorously obey detailed balance. The overall agreement is better at high temperatures and for high nonadiabatic coupling, which agrees with a previously reported analytical and simulation analysis [J. R. Schmidt, P. V. Parandekar, and J. C. Tully, J. Chem. Phys. 129, 044104 (2008)] on a two-level system coupled to a classical bath

  7. A new approach towards image based virtual 3D city modeling by using close range photogrammetry

    Science.gov (United States)

    Singh, S. P.; Jain, K.; Mandla, V. R.

    2014-05-01

    3D city model is a digital representation of the Earth's surface and it's related objects such as building, tree, vegetation, and some manmade feature belonging to urban area. The demand of 3D city modeling is increasing day to day for various engineering and non-engineering applications. Generally three main image based approaches are using for virtual 3D city models generation. In first approach, researchers used Sketch based modeling, second method is Procedural grammar based modeling and third approach is Close range photogrammetry based modeling. Literature study shows that till date, there is no complete solution available to create complete 3D city model by using images. These image based methods also have limitations This paper gives a new approach towards image based virtual 3D city modeling by using close range photogrammetry. This approach is divided into three sections. First, data acquisition process, second is 3D data processing, and third is data combination process. In data acquisition process, a multi-camera setup developed and used for video recording of an area. Image frames created from video data. Minimum required and suitable video image frame selected for 3D processing. In second section, based on close range photogrammetric principles and computer vision techniques, 3D model of area created. In third section, this 3D model exported to adding and merging of other pieces of large area. Scaling and alignment of 3D model was done. After applying the texturing and rendering on this model, a final photo-realistic textured 3D model created. This 3D model transferred into walk-through model or in movie form. Most of the processing steps are automatic. So this method is cost effective and less laborious. Accuracy of this model is good. For this research work, study area is the campus of department of civil engineering, Indian Institute of Technology, Roorkee. This campus acts as a prototype for city. Aerial photography is restricted in many country

  8. A whole range hygric material model: Modelling liquid and vapour transport properties in porous media

    DEFF Research Database (Denmark)

    Scheffler, Gregor Albrecht; Plagge, Rudolf

    2010-01-01

    This paper addresses the modelling of hygric material coefficients bridging the gap between measured material properties and the non-linear storage and transport coefficients in the transfer equation. The conductivity approach and a bundle of tubes model are the basis. By extending this model wit...

  9. Formal Process Modeling to Improve Human Decision-Making in Test and Evaluation Acoustic Range Control

    Science.gov (United States)

    2017-09-01

    MODELING TO IMPROVE HUMAN DECISION-MAKING DURING TEST AND EVALUATION RANGE CONTROL by William Carlson September 2017 Thesis Advisor...the Office of Management and Budget, Paperwork Reduction Project (0704-0188) Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT...MAKING DURING TEST AND EVALUATION RANGE CONTROL 5. FUNDING NUMBERS 6. AUTHOR(S) William Carlson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES

  10. Range bagging: a new method for ecological niche modelling from presence-only data.

    Science.gov (United States)

    Drake, John M

    2015-06-06

    The ecological niche is the set of environments in which a population of a species can persist without introduction of individuals from other locations. A good mathematical or computational representation of the niche is a prerequisite to addressing many questions in ecology, biogeography, evolutionary biology and conservation. A particularly challenging question for ecological niche modelling is the problem of presence-only modelling. That is, can an ecological niche be identified from records drawn only from the set of niche environments without records from non-niche environments for comparison? Here, I introduce a new method for ecological niche modelling from presence-only data called range bagging. Range bagging draws on the concept of a species' environmental range, but was inspired by the empirical performance of ensemble learning algorithms in other areas of ecological research. This paper extends the concept of environmental range to multiple dimensions and shows that range bagging is computationally feasible even when the number of environmental dimensions is large. The target of the range bagging base learner is an environmental tolerance of the species in a projection of its niche and is therefore an ecologically interpretable property of a species' biological requirements. The computational complexity of range bagging is linear in the number of examples, which compares favourably with the main alternative, Qhull. In conclusion, range bagging appears to be a reasonable choice for niche modelling in applications in which a presence-only method is desired and may provide a solution to problems in other disciplines where one-class classification is required, such as outlier detection and concept learning.

  11. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  12. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  13. Objectives for next generation of practical short-range atmospheric dispersion models

    International Nuclear Information System (INIS)

    Olesen, H.R.; Mikkelsen, T.

    1992-01-01

    The proceedings contains papers from the workshop ''Objectives for Next Generation of Practical Short-Range Atmospheric Dispersion Models''. They deal with two types of models, namely models for regulatory purposes and models for real-time applications. The workshop was the result of an action started in 1991 for increased cooperation and harmonization within atmospheric dispersion modelling. The focus of the workshop was on the management of model development and the definition of model objectives, rather than on detailed model contents. It was the intention to identify actions that can be taken in order to improve the development and use of atmospheric dispersion models. The papers in the proceedings deal with various topics within the broad spectrum of matters related to up-to-date practical models, such as their scientific basis, requirements for model input and output, meteorological preprocessing, standardisation within modelling, electronic information exchange as a potentially useful tool, model evaluation and data bases for model evaluation. In addition to the papers, the proceedings contain summaries of the discussions at the workshop. These summaries point to a number of recommended actions which can be taken in order to improve ''modelling culture''. (AB)

  14. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  15. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  16. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

    Science.gov (United States)

    Love, Bettina L.

    2015-01-01

    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  17. Slopes, nearly constant loss, universality, and hopping rates for dispersive ionic conduction

    International Nuclear Information System (INIS)

    Macdonald, J Ross; Ahmad, Mohamad M

    2007-01-01

    The title topics are investigated, discussed, and new insights provided by considering isothermal frequency response data for seven different materials having quite different conductivity spans and involving different electrode polarization effects and temperatures. These data sets were fitted using several different models, including the Kohlrausch-related K0 and K1 ones derived from stretched-exponential response in the temporal domain. The quasi-universal UN model, the K1 with its shape parameter, β 1 , fixed at 1/3, fitted most of the data very well, and its fits of such data were used to compare its predictions for hopping rate with those derived from fitting with the conventional 'universal dynamic response' Almond-West real-part-of-conductivity model. The K1-model theoretical hopping rate, involving the mean waiting time for a hop and derived from microscopic stochastic analysis, was roughly twice as large as the empirical Almond-West rate for most of the materials considered and should be used in place of it. Its use in a generalized Nernst-Einstein equation led to comparison of estimates of the concentration of fully dissociated mobile charge carriers in superionic PbSnF 4 with earlier estimates of Ahmad using an Almond-West hopping rate value. Agreement with an independent structure-derived value was relatively poor. Fitting results obtained using the K0 model, for Na 2 SO 4 data sets for two different polycrystalline material phases, and involving severely limited conductivity variation, were far superior to those obtained using the K1 model. The estimated values of the K0 shape parameter, β 0 , were close to 1/3 for both phases, strongly suggesting that the charge motion was one dimensional for each phase, even though they involved different crystalline structures

  18. Modelling plastic deformation of metals over a wide range of strain rates using irreversible thermodynamics

    International Nuclear Information System (INIS)

    Huang Mingxin; Rivera-Diaz-del-Castillo, Pedro E J; Zwaag, Sybrand van der; Bouaziz, Olivier

    2009-01-01

    Based on the theory of irreversible thermodynamics, the present work proposes a dislocation-based model to describe the plastic deformation of FCC metals over wide ranges of strain rates. The stress-strain behaviour and the evolution of the average dislocation density are derived. It is found that there is a transitional strain rate (∼ 10 4 s -1 ) over which the phonon drag effects appear, resulting in a significant increase in the flow stress and the average dislocation density. The model is applied to pure Cu deformed at room temperature and at strain rates ranging from 10 -5 to 10 6 s -1 showing good agreement with experimental results.

  19. Comprehensive Regional Modeling for Long-Range Planning: Linking Integrated Urban Models and Geographic Information Systems

    OpenAIRE

    Johnston, Robert; de la Barra, Thomas

    2000-01-01

    This study demonstrates the sequential linking of two types of models to permit the comprehensive evaluation of regional transportation and land use policies. First, we operate an integrated urban model (TRANUS), which represents both land and travel markets with zones and networks. The travel and land use projections from TRANUS are outlined, to demonstrate the general reasonableness of the results, as this is the first application of a market-based urban model in the US. Second, the land us...

  20. Comparison of physically based constitutive models characterizing armor steel over wide temperature and strain rate ranges

    International Nuclear Information System (INIS)

    Xu, Zejian; Huang, Fenglei

    2012-01-01

    Both descriptive and predictive capabilities of five physically based constitutive models (PB, NNL, ZA, VA, and RK) are investigated and compared systematically, in characterizing plastic behavior of the 603 steel at temperatures ranging from 288 to 873 K, and strain rates ranging from 0.001 to 4500 s −1 . Determination of the constitutive parameters is introduced in detail for each model. Validities of the established models are checked by strain rate jump tests performed under different loading conditions. The results show that the RK and NNL models have better performance in the description of material behavior, especially the work-hardening effect, while the PB and VA models predict better. The inconsistency that is observed between the capabilities of description and prediction of the models indicates the existence of the minimum number of required fitting data, reflecting the degree of a model's requirement for basic data in parameter calibration. It is also found that the description capability of a model is dependent to a large extent on both its form and the number of its constitutive parameters, while the precision of prediction relies largely on the performance of description. In the selection of constitutive models, the experimental data and the constitutive models should be considered synthetically to obtain a better efficiency in material behavior characterization

  1. Scaffold hopping in drug discovery using inductive logic programming.

    Science.gov (United States)

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

    2008-05-01

    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  2. Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

    Science.gov (United States)

    Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

    2018-04-01

    Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

  3. A state-space model for estimating detailed movements and home range from acoustic receiver data

    DEFF Research Database (Denmark)

    Pedersen, Martin Wæver; Weng, Kevin

    2013-01-01

    We present a state-space model for acoustic receiver data to estimate detailed movement and home range of individual fish while accounting for spatial bias. An integral part of the approach is the detection function, which models the probability of logging tag transmissions as a function of dista......We present a state-space model for acoustic receiver data to estimate detailed movement and home range of individual fish while accounting for spatial bias. An integral part of the approach is the detection function, which models the probability of logging tag transmissions as a function...... that the location error scales log-linearly with detection range and movement speed. This result can be used as guideline for designing network layout when species movement capacity and acoustic environment are known or can be estimated prior to network deployment. Finally, as an example, the state-space model...... is used to estimate home range and movement of a reef fish in the Pacific Ocean....

  4. A Low-Cost Time-Hopping Impulse Radio System for High Data Rate Transmission

    Directory of Open Access Journals (Sweden)

    Jinyun Zhang

    2005-03-01

    Full Text Available We present an efficient, low-cost implementation of time-hopping impulse radio that fulfills the spectral mask mandated by the FCC and is suitable for high-data-rate, short-range communications. Key features are (i all-baseband implementation that obviates the need for passband components, (ii symbol-rate (not chip rate sampling, A/D conversion, and digital signal processing, (iii fast acquisition due to novel search algorithms, and (iv spectral shaping that can be adapted to accommodate different spectrum regulations and interference environments. Computer simulations show that this system can provide 110 Mbps at 7–10 m distance, as well as higher data rates at shorter distances under FCC emissions limits. Due to the spreading concept of time-hopping impulse radio, the system can sustain multiple simultaneous users, and can suppress narrowband interference effectively.

  5. Diffuse radiation models and monthly-average, daily, diffuse data for a wide latitude range

    International Nuclear Information System (INIS)

    Gopinathan, K.K.; Soler, A.

    1995-01-01

    Several years of measured data on global and diffuse radiation and sunshine duration for 40 widely spread locations in the latitude range 36° S to 60° N are used to develop and test models for estimating monthly-mean, daily, diffuse radiation on horizontal surfaces. Applicability of the clearness-index (K) and sunshine fraction (SSO) models for diffuse estimation and the effect of combining several variables into a single multilinear equation are tested. Correlations connecting the diffuse to global fraction (HdH) with K and SSO predict Hd values more accurately than their separate use. Among clearness-index and sunshine-fraction models, SSO models are found to have better accuracy if correlations are developed for wide latitude ranges. By including a term for declinations in the correlation, the accuracy of the estimated data can be marginally improved. The addition of latitude to the equation does not help to improve the accuracy further. (author)

  6. Hopping conductivity via deep impurity states in InP

    International Nuclear Information System (INIS)

    Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.

    1984-01-01

    Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

  7. Crossover in tunneling hops in systems of strongly localized electrons

    International Nuclear Information System (INIS)

    Lien Nguyen, V.; Gamietea, A.D.

    1995-11-01

    Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

  8. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  9. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  10. Free boundary models for mosquito range movement driven by climate warming.

    Science.gov (United States)

    Bao, Wendi; Du, Yihong; Lin, Zhigui; Zhu, Huaiping

    2018-03-01

    As vectors, mosquitoes transmit numerous mosquito-borne diseases. Among the many factors affecting the distribution and density of mosquitoes, climate change and warming have been increasingly recognized as major ones. In this paper, we make use of three diffusive logistic models with free boundary in one space dimension to explore the impact of climate warming on the movement of mosquito range. First, a general model incorporating temperature change with location and time is introduced. In order to gain insights of the model, a simplified version of the model with the change of temperature depending only on location is analyzed theoretically, for which the dynamical behavior is completely determined and presented. The general model can be modified into a more realistic one of seasonal succession type, to take into account of the seasonal changes of mosquito movements during each year, where the general model applies only for the time period of the warm seasons of the year, and during the cold season, the mosquito range is fixed and the population is assumed to be in a hibernating status. For both the general model and the seasonal succession model, our numerical simulations indicate that the long-time dynamical behavior is qualitatively similar to the simplified model, and the effect of climate warming on the movement of mosquitoes can be easily captured. Moreover, our analysis reveals that hibernating enhances the chances of survival and successful spreading of the mosquitoes, but it slows down the spreading speed.

  11. Full-range stress–strain behaviour of contemporary pipeline steels: Part I. Model description

    International Nuclear Information System (INIS)

    Hertelé, Stijn; De Waele, Wim; Denys, Rudi; Verstraete, Matthias

    2012-01-01

    The stress–strain relationship of contemporary pipeline steels is often approximated by the relatively simple Ramberg–Osgood equation. However, these steels often show a more complex post-yield behaviour, which can result in significant errors. To address this limitation for cases where an accurate full-range description is needed, the authors developed a new ‘UGent’ stress–strain model which has two independent strain-hardening exponents. This paper compares the UGent model with the Ramberg–Osgood model for a wide range of experimental data, by means of least-squares curve fitting. A significant improvement is observed for contemporary pipeline steels with a yield-to-tensile ratio above 0.80. These steels typically exhibit two distinct stages of strain hardening. In contrast to the Ramberg–Osgood model, both stages are successfully described by the UGent model. A companion paper (Part II) discusses how to find appropriate model parameter values for the UGent model. - Highlights: ► Contemporary pipeline steels often show two strain-hardening stages. ► This phenomenon is progressively apparent as Y/T exceeds 0.80. ► Both stages cannot be simultaneously described by the Ramberg–Osgood model. ► A new “UGent” model provides significantly better descriptions. ► The improvement becomes more pronounced as Y/T increases.

  12. Range and Image Based Modelling: a way for Frescoed Vault Texturing Optimization

    Science.gov (United States)

    Caroti, G.; Martínez-Espejo Zaragoza, I.; Piemonte, A.

    2015-02-01

    In the restoration of the frescoed vaults it is not only important to know the geometric shape of the painted surface, but it is essential to document its chromatic characterization and conservation status. The new techniques of range-based and image-based modelling, each with its limitations and advantages, offer a wide range of methods to obtain the geometric shape. In fact, several studies widely document that laser scanning enable obtaining three-dimensional models with high morphological precision. However, the quality level of the colour obtained with built-in laser scanner cameras is not comparable to that obtained for the shape. It is possible to improve the texture quality by means of a dedicated photographic campaign. This procedure, however, requires to calculate the external orientation of each image identifying the control points on it and on the model through a costly step of post processing. With image-based modelling techniques it is possible to obtain models that maintain the colour quality of the original images, but with variable geometric precision, locally lower than the laser scanning model. This paper presents a methodology that uses the camera external orientation parameters calculated by image based modelling techniques to project the same image on the model obtained from the laser scan. This methodology is tested on an Italian mirror (a schifo) frescoed vault. In the paper the different models, the analysis of precision and the efficiency evaluation of proposed methodology are presented.

  13. TRADOS - an air trajectory dose model for long range transport of radioactive release to the atmosphere

    International Nuclear Information System (INIS)

    Rossi, J.; Valkama, I.

    1985-01-01

    A model for estimating radiation doses resulting from long range atmospheric transport of released radionuclides in accidents is precented. The model (TRADOS) is able to treat changing diffusion conditions. For example the plume can be exposed to temporary rain, changes in turbulence and mixing depth. This can result in considerable changes in individual doses. The method is applied to an example trajectory and the doses caused by a serious reactor accident are calculated

  14. Calibrating and testing a gap model for simulating forest management in the Oregon Coast Range

    Science.gov (United States)

    Pabst, R.J.; Goslin, M.N.; Garman, S.L.; Spies, T.A.

    2008-01-01

    The complex mix of economic and ecological objectives facing today's forest managers necessitates the development of growth models with a capacity for simulating a wide range of forest conditions while producing outputs useful for economic analyses. We calibrated the gap model ZELIG to simulate stand-level forest development in the Oregon Coast Range as part of a landscape-scale assessment of different forest management strategies. Our goal was to incorporate the predictive ability of an empirical model with the flexibility of a forest succession model. We emphasized the development of commercial-aged stands of Douglas-fir, the dominant tree species in the study area and primary source of timber. In addition, we judged that the ecological approach of ZELIG would be robust to the variety of other forest conditions and practices encountered in the Coast Range, including mixed-species stands, small-scale gap formation, innovative silvicultural methods, and reserve areas where forests grow unmanaged for long periods of time. We parameterized the model to distinguish forest development among two ecoregions, three forest types and two site productivity classes using three data sources: chronosequences of forest inventory data, long-term research data, and simulations from an empirical growth-and-yield model. The calibrated model was tested with independent, long-term measurements from 11 Douglas-fir plots (6 unthinned, 5 thinned), 3 spruce-hemlock plots, and 1 red alder plot. ZELIG closely approximated developmental trajectories of basal area and large trees in the Douglas-fir plots. Differences between simulated and observed conifer basal area for these plots ranged from -2.6 to 2.4 m2/ha; differences in the number of trees/ha ???50 cm dbh ranged from -8.8 to 7.3 tph. Achieving these results required the use of a diameter-growth multiplier, suggesting some underlying constraints on tree growth such as the temperature response function. ZELIG also tended to overestimate

  15. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    Directory of Open Access Journals (Sweden)

    Haejoon Jung

    2018-01-01

    Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  16. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  17. Estimating indices of range shifts in birds using dynamic models when detection is imperfect

    Science.gov (United States)

    Clement, Matthew J.; Hines, James E.; Nichols, James D.; Pardieck, Keith L.; Ziolkowski, David J.

    2016-01-01

    There is intense interest in basic and applied ecology about the effect of global change on current and future species distributions. Projections based on widely used static modeling methods implicitly assume that species are in equilibrium with the environment and that detection during surveys is perfect. We used multiseason correlated detection occupancy models, which avoid these assumptions, to relate climate data to distributional shifts of Louisiana Waterthrush in the North American Breeding Bird Survey (BBS) data. We summarized these shifts with indices of range size and position and compared them to the same indices obtained using more basic modeling approaches. Detection rates during point counts in BBS surveys were low, and models that ignored imperfect detection severely underestimated the proportion of area occupied and slightly overestimated mean latitude. Static models indicated Louisiana Waterthrush distribution was most closely associated with moderate temperatures, while dynamic occupancy models indicated that initial occupancy was associated with diurnal temperature ranges and colonization of sites was associated with moderate precipitation. Overall, the proportion of area occupied and mean latitude changed little during the 1997–2013 study period. Near-term forecasts of species distribution generated by dynamic models were more similar to subsequently observed distributions than forecasts from static models. Occupancy models incorporating a finite mixture model on detection – a new extension to correlated detection occupancy models – were better supported and may reduce bias associated with detection heterogeneity. We argue that replacing phenomenological static models with more mechanistic dynamic models can improve projections of future species distributions. In turn, better projections can improve biodiversity forecasts, management decisions, and understanding of global change biology.

  18. Hydrothermal germination models: Improving experimental efficiency by limiting data collection to the relevant hydrothermal range

    Science.gov (United States)

    Hydrothermal models used to predict germination response in the field are usually parameterized with data from laboratory experiments that examine the full range of germination response to temperature and water potential. Inclusion of low water potential and high and low-temperature treatments, how...

  19. A skull might lie: modelling ancestral ranges and diet from genes and shape of tree squirrels

    Czech Academy of Sciences Publication Activity Database

    Pečnerová, Patrícia; Moravec, Jiří C.; Martínková, Natália

    2015-01-01

    Roč. 64, č. 6 (2015), s. 1074-1088 ISSN 1063-5157 EU Projects: European Commission(XE) CZ.1.07/2.4.00/17.0138 Institutional support: RVO:68081766 Keywords : Sciurini * multilocus phylogeny * geometric morphometry * speciation * ancestral range reconstruction * diet modelling Subject RIV: EG - Zoology Impact factor: 8.225, year: 2015

  20. Fusing range and intensity images for generating dense models of three-dimensional environments

    DEFF Research Database (Denmark)

    Ellekilde, Lars-Peter; Miró, Jaime Valls; Dissanayake., Gamini

    This paper presents a novel strategy for the construction of dense three-dimensional environment models by combining images from a conventional camera and a range imager. Ro- bust data association is ?rst accomplished by exploiting the Scale Invariant Feature Transformation (SIFT) technique...

  1. Prospects for bioenergy use in Ghana using Long-range Energy Alternatives Planning model

    DEFF Research Database (Denmark)

    Kemausuor, Francis; Nygaard, Ivan; Mackenzie, Gordon A.

    2015-01-01

    biomass sources, through the production of biogas, liquid biofuels and electricity. Analysis was based on moderate and high use of bioenergy for transportation, electricity generation and residential fuel using the LEAP (Long-range Energy Alternatives Planning) model. Results obtained indicate...

  2. Long-range Transport Modeling System and its Application over the Northeast Asia

    Directory of Open Access Journals (Sweden)

    Il-Soo Park

    2006-06-01

    Full Text Available A Comprehensive Acid Deposition Modeling (CADM was developed at the National Institute of Environmental Research (NIER and Yonsei University in South Korea in order to simulate the long-range transboundary air pollutants and regional acid deposition processes over the Northeast Asia. The modeling system CADM is composed of a real-time numerical weather forecasting model (RAMS and an Eulerian air pollution transport/dispersion/deposition model including gas- and aqueous-phase atmospheric chemical processes for the real-time acquisition of model results and prediction of acidic pollutants. The main objective of CADM is to facilitate an efficient assessment tools by providing the explicit information on the acidic deposition processes. This paper introduces the components of CADM, and describes the comprehensive atmospheric modeling system including atmospheric chemistry for the simulation of acidic processes over the Eastern Asia. The presently developed modeling system CADM has been used to simulate long-range transport over the Northeast Asian region during the spring season from March 5 to 15 2002. For the model validation, the simulated results are compared with both aircraft measurements and surface monitoring observations, and discussed for its operational consideration in Korea

  3. Specification for a surface-search radar-detection-range model

    Science.gov (United States)

    Hattan, Claude P.

    1990-09-01

    A model that predicts surface-search radar detection range versus a variety of combatants has been developed at the Naval Ocean Systems Center. This model uses a simplified ship radar cross section (RCS) model and the U.S. Navy Oceanographic and Atmospheric Mission Library Standard Electromagnetic Propagation Model. It provides the user with a method of assessing the effects of the environment of the performance of a surface-search radar system. The software implementation of the model is written in ANSI FORTRAN 77, with MIL-STD-1753 extensions. The program provides the user with a table of expected detection ranges when the model is supplied with the proper environmental radar system inputs. The target model includes the variation in RCS as a function of aspect angle and the distribution of reflected radar energy as a function of height above the waterline. The modeled propagation effects include refraction caused by a multisegmented refractivity profile, sea-surface roughness caused by local winds, evaporation ducting, and surface-based ducts caused by atmospheric layering.

  4. Long-range correlation in synchronization and syncopation tapping: a linear phase correction model.

    Directory of Open Access Journals (Sweden)

    Didier Delignières

    Full Text Available We propose in this paper a model for accounting for the increase in long-range correlations observed in asynchrony series in syncopation tapping, as compared with synchronization tapping. Our model is an extension of the linear phase correction model for synchronization tapping. We suppose that the timekeeper represents a fractal source in the system, and that a process of estimation of the half-period of the metronome, obeying a random-walk dynamics, combines with the linear phase correction process. Comparing experimental and simulated series, we show that our model allows accounting for the experimentally observed pattern of serial dependence. This model complete previous modeling solutions proposed for self-paced and synchronization tapping, for a unifying framework of event-based timing.

  5. GHz band frequency hopping PLL-based frequency synthesizers

    Institute of Scientific and Technical Information of China (English)

    XU Yong; WANG Zhi-gong; GUAN Yu; XU Zhi-jun; QIAO Lu-feng

    2005-01-01

    In this paper we describe a full-integrated circuit containing all building blocks of a completed PLL-based synthesizer except for low pass filter(LPF).The frequency synthesizer is designed for a frequency hopping (FH) transceiver operating up to 1.5 GHz as a local oscillator. The architecture of Voltage Controlled Oscillator (VCO) is optimized to get better performance, and a phase noise of -111.85-dBc/Hz @ 1 MHz and a tuning range of 250 MHz are gained at a centre frequency of 1.35 GHz.A novel Dual-Modulus Prescaler(DMP) is designed to achieve a very low jitter and a lower power.The settling time of PLL is 80 μs while the reference frequency is 400 KHz.This monolithic frequency synthesizer is to integrate all main building blocks of PLL except for the low pass filter,with a maximum VCO output frequency of 1.5 GHz,and is fabricated with a 0.18 μm mixed signal CMOS process. Low power dissipation, low phase noise, large tuning range and fast settling time are gained in this design.

  6. Modelling of the dual frequency capacitive sheath in the intermediate pressure range

    International Nuclear Information System (INIS)

    Boyle, P C; Robiche, J; Turner, M M

    2004-01-01

    The nonlinearity of the plasma sheath in dual frequency capacitively coupled reactors is investigated for frequencies well above the ion plasma frequency. This work focuses on the behaviour of the voltage and the sheath width with respect to the driving current source and the collisionality regime. For typical plasma processing applications, the gas pressure ranges from a few milliTorrs to hundreds of milliTorrs, and the ion dynamics span different collisional regimes. To describe these different ion dynamics, we have used a collisionless model and a variable mobility model. The sheath widths and the voltages obtained from these two models have then been compared

  7. Lithium-ion battery dynamic model for wide range of operating conditions

    DEFF Research Database (Denmark)

    Stroe, Ana-Irina; Stroe, Daniel-Ioan; Swierczynski, Maciej Jozef

    2017-01-01

    In order to analyze the dynamic behavior of a Lithium-ion (Li-ion) battery and to determine their suitability for various applications, battery models are needed. An equivalent electrical circuit model is the most common way of representing the behavior of a Li-ion battery. There are different...... characterization tests performed for a wide range of operating conditions (temperature, load current and state-of-charge) on a commercial available 13Ah high-power lithium titanate oxide battery cell. The obtained results were used to parametrize the proposed dynamic model of the battery cell. To assess...

  8. Trapping-to-percolation transition in the hopping diffusion of substitutionally disordered solids with a binary energy distribution

    International Nuclear Information System (INIS)

    Parris, P.E.; Bookout, B.D.

    1993-01-01

    We consider charge carriers that undergo nearest-neighbor hopping among the sites of a binary random lattice, each site of which is associated with one of two possible energies E 1 or E 2 . A general and recently observed feature of this problem not predicted by previous treatments of disordered hopping models is a crossover between trap-limited conduction and percolation. We introduce new energy-projected equations of motion whose solutions reveal the deep conductivity minimum associated with this phenomenon, and compare the results predicted to numerical simulations

  9. Surrogate runner model for draft tube losses computation within a wide range of operating points

    International Nuclear Information System (INIS)

    Susan-Resiga, R; Ciocan, T; Muntean, S; De Colombel, T; Leroy, P

    2014-01-01

    We introduce a quasi two-dimensional (Q2D) methodology for assessing the swirling flow exiting the runner of hydraulic turbines at arbitrary operating points, within a wide operating range. The Q2D model does not need actual runner computations, and as a result it represents a surrogate runner model for a-priori assessment of the swirling flow ingested by the draft tube. The axial, radial and circumferential velocity components are computed on a conical section located immediately downstream the runner blades trailing edge, then used as inlet conditions for regular draft tube computations. The main advantage of our model is that it allows the determination of the draft tube losses within the intended turbine operating range in the early design stages of a new or refurbished runner, thus providing a robust and systematic methodology to meet the optimal requirements for the flow at the runner outlet

  10. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    POSPÍŠIL, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  11. A Quasiphysics Intelligent Model for a Long Range Fast Tool Servo

    Science.gov (United States)

    Liu, Qiang; Zhou, Xiaoqin; Lin, Jieqiong; Xu, Pengzi; Zhu, Zhiwei

    2013-01-01

    Accurately modeling the dynamic behaviors of fast tool servo (FTS) is one of the key issues in the ultraprecision positioning of the cutting tool. Herein, a quasiphysics intelligent model (QPIM) integrating a linear physics model (LPM) and a radial basis function (RBF) based neural model (NM) is developed to accurately describe the dynamic behaviors of a voice coil motor (VCM) actuated long range fast tool servo (LFTS). To identify the parameters of the LPM, a novel Opposition-based Self-adaptive Replacement Differential Evolution (OSaRDE) algorithm is proposed which has been proved to have a faster convergence mechanism without compromising with the quality of solution and outperform than similar evolution algorithms taken for consideration. The modeling errors of the LPM and the QPIM are investigated by experiments. The modeling error of the LPM presents an obvious trend component which is about ±1.15% of the full span range verifying the efficiency of the proposed OSaRDE algorithm for system identification. As for the QPIM, the trend component in the residual error of LPM can be well suppressed, and the error of the QPIM maintains noise level. All the results verify the efficiency and superiority of the proposed modeling and identification approaches. PMID:24163627

  12. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

  13. Modelling seasonal habitat suitability for wide-ranging species: Invasive wild pigs in northern Australia.

    Directory of Open Access Journals (Sweden)

    Jens G Froese

    Full Text Available Invasive wildlife often causes serious damage to the economy and agriculture as well as environmental, human and animal health. Habitat models can fill knowledge gaps about species distributions and assist planning to mitigate impacts. Yet, model accuracy and utility may be compromised by small study areas and limited integration of species ecology or temporal variability. Here we modelled seasonal habitat suitability for wild pigs, a widespread and harmful invader, in northern Australia. We developed a resource-based, spatially-explicit and regional-scale approach using Bayesian networks and spatial pattern suitability analysis. We integrated important ecological factors such as variability in environmental conditions, breeding requirements and home range movements. The habitat model was parameterized during a structured, iterative expert elicitation process and applied to a wet season and a dry season scenario. Model performance and uncertainty was evaluated against independent distributional data sets. Validation results showed that an expert-averaged model accurately predicted empirical wild pig presences in northern Australia for both seasonal scenarios. Model uncertainty was largely associated with different expert assumptions about wild pigs' resource-seeking home range movements. Habitat suitability varied considerably between seasons, retracting to resource-abundant rainforest, wetland and agricultural refuge areas during the dry season and expanding widely into surrounding grassland floodplains, savanna woodlands and coastal shrubs during the wet season. Overall, our model suggested that suitable wild pig habitat is less widely available in northern Australia than previously thought. Mapped results may be used to quantify impacts, assess risks, justify management investments and target control activities. Our methods are applicable to other wide-ranging species, especially in data-poor situations.

  14. Analysing the origin of long-range interactions in proteins using lattice models

    Directory of Open Access Journals (Sweden)

    Unger Ron

    2009-01-01

    Full Text Available Abstract Background Long-range communication is very common in proteins but the physical basis of this phenomenon remains unclear. In order to gain insight into this problem, we decided to explore whether long-range interactions exist in lattice models of proteins. Lattice models of proteins have proven to capture some of the basic properties of real proteins and, thus, can be used for elucidating general principles of protein stability and folding. Results Using a computational version of double-mutant cycle analysis, we show that long-range interactions emerge in lattice models even though they are not an input feature of them. The coupling energy of both short- and long-range pairwise interactions is found to become more positive (destabilizing in a linear fashion with increasing 'contact-frequency', an entropic term that corresponds to the fraction of states in the conformational ensemble of the sequence in which the pair of residues is in contact. A mathematical derivation of the linear dependence of the coupling energy on 'contact-frequency' is provided. Conclusion Our work shows how 'contact-frequency' should be taken into account in attempts to stabilize proteins by introducing (or stabilizing contacts in the native state and/or through 'negative design' of non-native contacts.

  15. New Diagnostic, Launch and Model Control Techniques in the NASA Ames HFFAF Ballistic Range

    Science.gov (United States)

    Bogdanoff, David W.

    2012-01-01

    This report presents new diagnostic, launch and model control techniques used in the NASA Ames HFFAF ballistic range. High speed movies were used to view the sabot separation process and the passage of the model through the model splap paper. Cavities in the rear of the sabot, to catch the muzzle blast of the gun, were used to control sabot finger separation angles and distances. Inserts were installed in the powder chamber to greatly reduce the ullage volume (empty space) in the chamber. This resulted in much more complete and repeatable combustion of the powder and hence, in much more repeatable muzzle velocities. Sheets of paper or cardstock, impacting one half of the model, were used to control the amplitudes of the model pitch oscillations.

  16. Majorana edge States in atomic wires coupled by pair hopping.

    Science.gov (United States)

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  17. Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

    Science.gov (United States)

    Kea, J; Kramer, J; Forwell, L; Birmingham, T

    2001-08-01

    Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

  18. Recording and Modelling of MONUMENTS' Interior Space Using Range and Optical Sensors

    Science.gov (United States)

    Georgiadis, Charalampos; Patias, Petros; Tsioukas, Vasilios

    2016-06-01

    Three dimensional modelling of artefacts and building interiors is a highly active research field in our days. Several techniques are being utilized to perform such a task, spanning from traditional surveying techniques and photogrammetry to structured light scanners, laser scanners and so on. New technological advancements in both hardware and software create new recording techniques, tools and approaches. In this paper we present a new recording and modelling approach based on the SwissRanger SR4000 range camera coupled with a Canon 400D dSLR camera. The hardware component of our approach consists of a fixed base, which encloses the range and SLR cameras. The two sensors are fully calibrated and registered to each other thus we were able to produce colorized point clouds acquired from the range camera. In this paper we present the initial design and calibration of the system along with experimental data regarding the accuracy of the proposed approach. We are also providing results regarding the modelling of interior spaces and artefacts accompanied with accuracy tests from other modelling approaches based on photogrammetry and laser scanning.

  19. High-resolution surface analysis for extended-range downscaling with limited-area atmospheric models

    Science.gov (United States)

    Separovic, Leo; Husain, Syed Zahid; Yu, Wei; Fernig, David

    2014-12-01

    High-resolution limited-area model (LAM) simulations are frequently employed to downscale coarse-resolution objective analyses over a specified area of the globe using high-resolution computational grids. When LAMs are integrated over extended time frames, from months to years, they are prone to deviations in land surface variables that can be harmful to the quality of the simulated near-surface fields. Nudging of the prognostic surface fields toward a reference-gridded data set is therefore devised in order to prevent the atmospheric model from diverging from the expected values. This paper presents a method to generate high-resolution analyses of land-surface variables, such as surface canopy temperature, soil moisture, and snow conditions, to be used for the relaxation of lower boundary conditions in extended-range LAM simulations. The proposed method is based on performing offline simulations with an external surface model, forced with the near-surface meteorological fields derived from short-range forecast, operational analyses, and observed temperatures and humidity. Results show that the outputs of the surface model obtained in the present study have potential to improve the near-surface atmospheric fields in extended-range LAM integrations.

  20. Signaling induced by hop/STI-1 depends on endocytosis

    International Nuclear Information System (INIS)

    Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

    2007-01-01

    The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

  1. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  2. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer

    2017-02-09

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different artificial light sources and sunlight entering the room. The relay receives data packet over a VLC channel and uses the harvested energy to retransmit it to a mobile terminal over an RF channel. We develop a novel statistical model for the harvested electrical power and analyze the probability of data packet loss. We define a system design parameter (α ∈ [0, 1)) that controls the time dedicated for excess energy harvesting and data packet retransmission. It was found that the parameter has an optimal value which minimizes the packet loss probability. Further more, this optimal value is independent of the RF channel path loss. However, optimal showed inverse dependence on the packet size.

  3. Strong-coupling behaviour of two t - J chains with interchain single-electron hopping

    International Nuclear Information System (INIS)

    Zhang Guangming; Feng Shiping; Yu Lu.

    1994-01-01

    Using the fermion-spin transformation to implement spin-charge separation of constrained electrons, a model of two t - J chains with interchain single-electron hopping is studied by abelian bosonization. After spin-charge decoupling the charge dynamics can be trivially solved, while the spin dynamics is determined by a strong-coupling fixed point where the correlation functions can be calculated explicitly. This is a generalization of the Luther-Emery line for two-coupled t - J chains. The interchain single-electron hopping changes the asymptotic behaviour of the interchain spin-spin correlation functions and the electron Green function, but their exponents are independent of the coupling strength. (author). 25 refs

  4. A very general rate expression for charge hopping in semiconducting polymers

    Energy Technology Data Exchange (ETDEWEB)

    Fornari, Rocco P.; Aragó, Juan; Troisi, Alessandro [Department of Chemistry and Centre for Scientific Computing, University of Warwick, Coventry CV4 7AL (United Kingdom)

    2015-05-14

    We propose an expression of the hopping rate between localized states in semiconducting disordered polymers that contain the most used rates in the literature as special cases. We stress that these rates cannot be obtained directly from electron transfer rate theories as it is not possible to define diabatic localized states if the localization is caused by disorder, as in most polymers, rather than nuclear polarization effects. After defining the separate classes of accepting and inducing nuclear modes in the system, we obtain a general expression of the hopping rate. We show that, under the appropriate limits, this expression reduces to (i) a single-phonon rate expression or (ii) the Miller-Abrahams rate or (iii) a multi-phonon expression. The description of these limits from a more general expression is useful to interpolate between them, to validate the assumptions of each limiting case, and to define the simplest rate expression that still captures the main features of the charge transport. When the rate expression is fed with a range of realistic parameters the deviation from the Miller-Abrahams rate is large or extremely large, especially for hopping toward lower energy states, due to the energy gap law.

  5. Gold Digger or Video Girl: the salience of an emerging hip-hop sexual script.

    Science.gov (United States)

    Ross, Jasmine N; Coleman, Nicole M

    2011-02-01

    Concerns have been expressed in the common discourse and scholarly literature about the negative influence of Hip-Hop on its young listeners' ideas about sex and sexuality. Most of the scholarly literature has focused on the impact of this urban, Black media on young African American girls' sexual self-concept and behaviours. In response to this discourse, Stephens and Phillips (2003) proposed a Hip-Hop sexual scripting model that theorises about specific sexual scripts for young African American women. Their model includes eight different sexual scripts including the Gold Digger script. The present study proposes a ninth emerging script - the Video Girl. Participants were 18 female African American college students, between the ages of 18 and 30 years old from a large urban public university in the Southwest USA. Using q-methodology the present study found support for the existence of a Video Girl script. In addition, the data indicates that this script is distinct but closely related to Stephens and Phillips' Gold Digger script. These findings support their theory by suggesting that Hip-Hop sexual scripts are salient and hold real meaning for this sample.

  6. Statistical mechanics and dynamics of solvable models with long-range interactions

    International Nuclear Information System (INIS)

    Campa, Alessandro; Dauxois, Thierry; Ruffo, Stefano

    2009-01-01

    For systems with long-range interactions, the two-body potential decays at large distances as V(r)∼1/r α , with α≤d, where d is the space dimension. Examples are: gravitational systems, two-dimensional hydrodynamics, two-dimensional elasticity, charged and dipolar systems. Although such systems can be made extensive, they are intrinsically non additive: the sum of the energies of macroscopic subsystems is not equal to the energy of the whole system. Moreover, the space of accessible macroscopic thermodynamic parameters might be non convex. The violation of these two basic properties of the thermodynamics of short-range systems is at the origin of ensemble inequivalence. In turn, this inequivalence implies that specific heat can be negative in the microcanonical ensemble, and temperature jumps can appear at microcanonical first order phase transitions. The lack of convexity allows us to easily spot regions of parameter space where ergodicity may be broken. Historically, negative specific heat had been found for gravitational systems and was thought to be a specific property of a system for which the existence of standard equilibrium statistical mechanics itself was doubted. Realizing that such properties may be present for a wider class of systems has renewed the interest in long-range interactions. Here, we present a comprehensive review of the recent advances on the statistical mechanics and out-of-equilibrium dynamics of solvable systems with long-range interactions. The core of the review consists in the detailed presentation of the concept of ensemble inequivalence, as exemplified by the exact solution, in the microcanonical and canonical ensembles, of mean-field type models. Remarkably, the entropy of all these models can be obtained using the method of large deviations. Long-range interacting systems display an extremely slow relaxation towards thermodynamic equilibrium and, what is more striking, the convergence towards quasi-stationary states. The

  7. Predicting commuter flows in spatial networks using a radiation model based on temporal ranges

    Science.gov (United States)

    Ren, Yihui; Ercsey-Ravasz, Mária; Wang, Pu; González, Marta C.; Toroczkai, Zoltán

    2014-11-01

    Understanding network flows such as commuter traffic in large transportation networks is an ongoing challenge due to the complex nature of the transportation infrastructure and human mobility. Here we show a first-principles based method for traffic prediction using a cost-based generalization of the radiation model for human mobility, coupled with a cost-minimizing algorithm for efficient distribution of the mobility fluxes through the network. Using US census and highway traffic data, we show that traffic can efficiently and accurately be computed from a range-limited, network betweenness type calculation. The model based on travel time costs captures the log-normal distribution of the traffic and attains a high Pearson correlation coefficient (0.75) when compared with real traffic. Because of its principled nature, this method can inform many applications related to human mobility driven flows in spatial networks, ranging from transportation, through urban planning to mitigation of the effects of catastrophic events.

  8. First Experiences with Kinect v2 Sensor for Close Range 3d Modelling

    Science.gov (United States)

    Lachat, E.; Macher, H.; Mittet, M.-A.; Landes, T.; Grussenmeyer, P.

    2015-02-01

    RGB-D cameras, also known as range imaging cameras, are a recent generation of sensors. As they are suitable for measuring distances to objects at high frame rate, such sensors are increasingly used for 3D acquisitions, and more generally for applications in robotics or computer vision. This kind of sensors became popular especially since the Kinect v1 (Microsoft) arrived on the market in November 2010. In July 2014, Windows has released a new sensor, the Kinect for Windows v2 sensor, based on another technology as its first device. However, due to its initial development for video games, the quality assessment of this new device for 3D modelling represents a major investigation axis. In this paper first experiences with Kinect v2 sensor are related, and the ability of close range 3D modelling is investigated. For this purpose, error sources on output data as well as a calibration approach are presented.

  9. FIRST EXPERIENCES WITH KINECT V2 SENSOR FOR CLOSE RANGE 3D MODELLING

    Directory of Open Access Journals (Sweden)

    E. Lachat

    2015-02-01

    Full Text Available RGB-D cameras, also known as range imaging cameras, are a recent generation of sensors. As they are suitable for measuring distances to objects at high frame rate, such sensors are increasingly used for 3D acquisitions, and more generally for applications in robotics or computer vision. This kind of sensors became popular especially since the Kinect v1 (Microsoft arrived on the market in November 2010. In July 2014, Windows has released a new sensor, the Kinect for Windows v2 sensor, based on another technology as its first device. However, due to its initial development for video games, the quality assessment of this new device for 3D modelling represents a major investigation axis. In this paper first experiences with Kinect v2 sensor are related, and the ability of close range 3D modelling is investigated. For this purpose, error sources on output data as well as a calibration approach are presented.

  10. An isotherm-based thermodynamic model of multicomponent aqueous solutions, applicable over the entire concentration range.

    Science.gov (United States)

    Dutcher, Cari S; Ge, Xinlei; Wexler, Anthony S; Clegg, Simon L

    2013-04-18

    In previous studies (Dutcher et al. J. Phys. Chem. C 2011, 115, 16474-16487; 2012, 116, 1850-1864), we derived equations for the Gibbs energy, solvent and solute activities, and solute concentrations in multicomponent liquid mixtures, based upon expressions for adsorption isotherms that include arbitrary numbers of hydration layers on each solute. In this work, the long-range electrostatic interactions that dominate in dilute solutions are added to the Gibbs energy expression, thus extending the range of concentrations for which the model can be used from pure liquid solute(s) to infinite dilution in the solvent, water. An equation for the conversion of the reference state for solute activity coefficients to infinite dilution in water has been derived. A number of simplifications are identified, notably the equivalence of the sorption site parameters r and the stoichiometric coefficients of the solutes, resulting in a reduction in the number of model parameters. Solute concentrations in mixtures conform to a modified Zdanovskii-Stokes-Robinson mixing rule, and solute activity coefficients to a modified McKay-Perring relation, when the effects of the long-range (Debye-Hückel) term in the equations are taken into account. Practical applications of the equations to osmotic and activity coefficients of pure aqueous electrolyte solutions and mixtures show both satisfactory accuracy from low to high concentrations, together with a thermodynamically reasonable extrapolation (beyond the range of measurements) to extreme concentration and to the pure liquid solute(s).

  11. Long-range correlations in a simple stochastic model of coupled transport

    International Nuclear Information System (INIS)

    Larralde, Hernan; Sanders, David P

    2009-01-01

    We study coupled transport in the nonequilibrium stationary state of a model consisting of independent random walkers, moving along a one-dimensional channel, which carry a conserved energy-like quantity, with density and temperature gradients imposed by reservoirs at the ends of the channel. In our model, walkers interact with other walkers at the same site by sharing energy at each time step, but the amount of energy carried does not affect the motion of the walkers. We find that already in this simple model long-range correlations arise in the nonequilibrium stationary state which are similar to those observed in more realistic models of coupled transport. We derive an analytical expression for the source of these correlations, which we use to obtain semi-analytical results for the correlations themselves assuming a local-equilibrium hypothesis. These are in very good agreement with results from direct numerical simulations.

  12. Modeling the potential area of occupancy at fine resolution may reduce uncertainty in species range estimates

    DEFF Research Database (Denmark)

    Jiménez-Alfaro, Borja; Draper, David; Nogues, David Bravo

    2012-01-01

    and maximum entropy modeling to assess whether different sampling (expert versus systematic surveys) may affect AOO estimates based on habitat suitability maps, and the differences between such measurements and traditional coarse-grid methods. Fine-scale models performed robustly and were not influenced...... by survey protocols, providing similar habitat suitability outputs with high spatial agreement. Model-based estimates of potential AOO were significantly smaller than AOO measures obtained from coarse-scale grids, even if the first were obtained from conservative thresholds based on the Minimal Predicted...... permit comparable measures among species. We conclude that estimates of AOO based on fine-resolution distribution models are more robust tools for risk assessment than traditional systems, allowing a better understanding of species ranges at habitat level....

  13. A fire suppression model for forested range of the Beverly and Qamanirjuaq herds of caribou

    Directory of Open Access Journals (Sweden)

    Donald C. Thomas

    1996-01-01

    Full Text Available A fire suppression model was developed for forested winter range of the Beverly and Qamanirjuaq (formerly Kaminuriak herds of barren-ground caribou (Rangifer tarandus groenlandicus in north-central Canada. The model is a balance between total protection, as voiced by some aboriginal people, and a let-burn policy for natural fires advocated by some ecologists. Elements in the model were caribou ecology, lichen recovery after fire, burn history, community priorities for caribou hunting, and fire cycle lengths. The percent ratio of current productive caribou habitat to the goal for that habitat determines whether fire should be suppressed in a specific area. The goals for productive caribou habitat, defined as forests older than 50 years, were scaled by fire cycle length and community priority ranking. Thus, the model is an example of co-management: traditional knowledge combined with science in a joint forum, the Beverly and Qamanirjuaq Caribou Management Board.

  14. An Empirical Path-Loss Model for Wireless Channels in Indoor Short-Range Office Environment

    Directory of Open Access Journals (Sweden)

    Ye Wang

    2012-01-01

    Full Text Available A novel empirical path-loss model for wireless indoor short-range office environment at 4.3–7.3 GHz band is presented. The model is developed based on the experimental datum sampled in 30 office rooms in both line of sight (LOS and non-LOS (NLOS scenarios. The model is characterized as the path loss to distance with a Gaussian random variable X due to the shadow fading by using linear regression. The path-loss exponent n is fitted by the frequency using power function and modeled as a frequency-dependent Gaussian variable as the standard deviation σ of X. The presented works should be available for the research of wireless channel characteristics under universal indoor short-distance environments in the Internet of Things (IOT.

  15. Generalized Efficient Inference on Factor Models with Long-Range Dependence

    DEFF Research Database (Denmark)

    Ergemen, Yunus Emre

    . Short-memory dynamics are allowed in the common factor structure and possibly heteroskedastic error term. In the estimation, a generalized version of the principal components (PC) approach is proposed to achieve efficiency. Asymptotics for efficient common factor and factor loading as well as long......A dynamic factor model is considered that contains stochastic time trends allowing for stationary and nonstationary long-range dependence. The model nests standard I(0) and I(1) behaviour smoothly in common factors and residuals, removing the necessity of a priori unit-root and stationarity testing...

  16. Modeling of Graphene Planar Grating in the THz Range by the Method of Singular Integral Equations

    Science.gov (United States)

    Kaliberda, Mstislav E.; Lytvynenko, Leonid M.; Pogarsky, Sergey A.

    2018-04-01

    Diffraction of the H-polarized electromagnetic wave by the planar graphene grating in the THz range is considered. The scattering and absorption characteristics are studied. The scattered field is represented in the spectral domain via unknown spectral function. The mathematical model is based on the graphene surface impedance and the method of singular integral equations. The numerical solution is obtained by the Nystrom-type method of discrete singularities.

  17. Hops (Humulus lupulus) Content in Beer Modulates Effects of Beer on the Liver After Acute Ingestion in Female Mice.

    Science.gov (United States)

    Landmann, Marianne; Sellmann, Cathrin; Engstler, Anna Janina; Ziegenhardt, Doreen; Jung, Finn; Brombach, Christine; Bergheim, Ina

    2017-01-01

    Using a binge-drinking mouse model, we aimed to determine whether hops (Humulus lupulus) in beer is involved in the less damaging effects of acute beer consumption on the liver in comparison with ethanol. Female C57BL/6 J mice were either fed one iso-alcoholic and iso-caloric bolus dose of ethanol, beer, beer without hops (6 g ethanol/kg body weight) or an iso-caloric bolus of maltodextrin control solution. Markers of steatosis, intestinal barrier function, activation of toll-like receptor 4 signaling cascades, lipid peroxidation and lipogenesis were determined in liver, small intestine and plasma 2 h and 12 h after acute alcohol ingestion. Alcohol-induced hepatic fat accumulation was significantly attenuated in mice fed beer whereas in those fed beer without hops, hepatic fat accumulation was similar to that found in ethanol-fed mice. While markers of intestinal barrier function e.g. portal endotoxin levels and lipogenesis only differed slightly between groups, hepatic concentrations of myeloid differentiation primary response gene 88, inducible nitric oxide synthase (iNOS) and plasminogen-activator inhibitor 1 protein as well as of 4-hydroxynonenal and 3-nitrotyrosine protein adducts were similarly elevated in livers of mice fed ethanol or beer without hops when compared with controls. Induction of these markers was markedly attenuated in mice fed hops-containing beer. Taken together, our data suggest that hops in beer markedly attenuated acute alcohol-induced liver steatosis in female mice through mechanisms involving a suppression of iNOS induction in the liver. © The Author 2016. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  18. Use of agent-based modelling in emergency management under a range of flood hazards

    Directory of Open Access Journals (Sweden)

    Tagg Andrew

    2016-01-01

    Full Text Available The Life Safety Model (LSM was developed some 15 years ago, originally for dam break assessments and for informing reservoir evacuation and emergency plans. Alongside other technological developments, the model has evolved into a very useful agent-based tool, with many applications for a range of hazards and receptor behaviour. HR Wallingford became involved in its use in 2006, and is now responsible for its technical development and commercialisation. Over the past 10 years the model has been applied to a range of flood hazards, including coastal surge, river flood, dam failure and tsunami, and has been verified against historical events. Commercial software licences are being used in Canada, Italy, Malaysia and Australia. A core group of LSM users and analysts has been specifying and delivering a programme of model enhancements. These include improvements to traffic behaviour at intersections, new algorithms for sheltering in high-rise buildings, and the addition of monitoring points to allow detailed analysis of vehicle and pedestrian movement. Following user feedback, the ability of LSM to handle large model ‘worlds’ and hydrodynamic meshes has been improved. Recent developments include new documentation, performance enhancements, better logging of run-time events and bug fixes. This paper describes some of the recent developments and summarises some of the case study applications, including dam failure analysis in Japan and mass evacuation simulation in England.

  19. Use of a finite range nucleon-nucleon interaction in the continuum shell model

    International Nuclear Information System (INIS)

    Faes, Jean-Baptiste

    2007-01-01

    The unification of nuclear structure and nuclear reactions was always a great challenge of nuclear physics. The extreme complexity of finite quantum systems lead in the past to a separate development of the nuclear structure and the nuclear reactions. A unified description of structure and reactions is possible within the continuum shell model. All previous applications of this model used the zero-range residual interaction and the finite depth local potential to generate the single-particle basis. In the thesis, we have presented an extension of the continuum shell model for finite-range nucleon-nucleon interaction and an arbitrary number of nucleons in the scattering continuum. The great advantage of the present formulation is the same two-body interaction used both to generate the single-particle basis and to describe couplings to the continuum states. This formulation opens a possibility for an ab initio continuum shell model studies with the same nucleon-nucleon interaction generating the nuclear mean field, the configuration mixing and the coupling to the scattering continuum. First realistic applications of the above model has been shown for spectra of "1"7F and "1"7O, and elastic phase-shifts in the reaction "1"6O(p, p)"1"6O. (author)

  20. Progress in sensor performance testing, modeling and range prediction using the TOD method: an overview

    Science.gov (United States)

    Bijl, Piet; Hogervorst, Maarten A.; Toet, Alexander

    2017-05-01

    The Triangle Orientation Discrimination (TOD) methodology includes i) a widely applicable, accurate end-to-end EO/IR sensor test, ii) an image-based sensor system model and iii) a Target Acquisition (TA) range model. The method has been extensively validated against TA field performance for a wide variety of well- and under-sampled imagers, systems with advanced image processing techniques such as dynamic super resolution and local adaptive contrast enhancement, and sensors showing smear or noise drift, for both static and dynamic test stimuli and as a function of target contrast. Recently, significant progress has been made in various directions. Dedicated visual and NIR test charts for lab and field testing are available and thermal test benches are on the market. Automated sensor testing using an objective synthetic human observer is within reach. Both an analytical and an image-based TOD model have recently been developed and are being implemented in the European Target Acquisition model ECOMOS and in the EOSTAR TDA. Further, the methodology is being applied for design optimization of high-end security camera systems. Finally, results from a recent perception study suggest that DRI ranges for real targets can be predicted by replacing the relevant distinctive target features by TOD test patterns of the same characteristic size and contrast, enabling a new TA modeling approach. This paper provides an overview.

  1. Sabots, Obturator and Gas-In-Launch Tube Techniques for Heat Flux Models in Ballistic Ranges

    Science.gov (United States)

    Bogdanoff, David W.; Wilder, Michael C.

    2013-01-01

    For thermal protection system (heat shield) design for space vehicle entry into earth and other planetary atmospheres, it is essential to know the augmentation of the heat flux due to vehicle surface roughness. At the NASA Ames Hypervelocity Free Flight Aerodynamic Facility (HFFAF) ballistic range, a campaign of heat flux studies on rough models, using infrared camera techniques, has been initiated. Several phenomena can interfere with obtaining good heat flux data when using this measuring technique. These include leakage of the hot drive gas in the gun barrel through joints in the sabot (model carrier) to create spurious thermal imprints on the model forebody, deposition of sabot material on the model forebody, thereby changing the thermal properties of the model surface and unknown in-barrel heating of the model. This report presents developments in launch techniques to greatly reduce or eliminate these problems. The techniques include the use of obturator cups behind the launch package, enclosed versus open front sabot designs and the use of hydrogen gas in the launch tube. Attention also had to be paid to the problem of the obturator drafting behind the model and impacting the model. Of the techniques presented, the obturator cups and hydrogen in the launch tube were successful when properly implemented

  2. Involvement of TRPM2 in a wide range of inflammatory and neuropathic pain mouse models

    Directory of Open Access Journals (Sweden)

    Kanako So

    2015-03-01

    Full Text Available Recent evidence suggests a role of transient receptor potential melastatin 2 (TRPM2 in immune and inflammatory responses. We previously reported that TRPM2 deficiency attenuated inflammatory and neuropathic pain in some pain mouse models, including formalin- or carrageenan-induced inflammatory pain, and peripheral nerve injury-induced neuropathic pain models, while it had no effect on the basal mechanical and thermal nociceptive sensitivities. In this study, we further explored the involvement of TRPM2 in various pain models using TRPM2-knockout mice. There were no differences in the chemonociceptive behaviors evoked by intraplantar injection of capsaicin or hydrogen peroxide between wildtype and TRPM2-knockout mice, while acetic acid-induced writhing behavior was significantly attenuated in TRPM2-knockout mice. In the postoperative incisional pain model, no difference in mechanical allodynia was observed between the two genotypes. By contrast, mechanical allodynia in the monosodium iodoacetate-induced osteoarthritis pain model and the experimental autoimmune encephalomyelitis model were significantly attenuated in TRPM2-knockout mice. Furthermore, mechanical allodynia in paclitaxel-induced peripheral neuropathy and streptozotocin-induced painful diabetic neuropathy models were significantly attenuated in TRPM2-knockout mice. Taken together, these results suggest that TRPM2 plays roles in a wide range of pathological pain models based on peripheral and central neuroinflammation, rather than physiological nociceptive pain.

  3. A state-and-transition simulation modeling approach for estimating the historical range of variability

    Directory of Open Access Journals (Sweden)

    Kori Blankenship

    2015-04-01

    Full Text Available Reference ecological conditions offer important context for land managers as they assess the condition of their landscapes and provide benchmarks for desired future conditions. State-and-transition simulation models (STSMs are commonly used to estimate reference conditions that can be used to evaluate current ecosystem conditions and to guide land management decisions and activities. The LANDFIRE program created more than 1,000 STSMs and used them to assess departure from a mean reference value for ecosystems in the United States. While the mean provides a useful benchmark, land managers and researchers are often interested in the range of variability around the mean. This range, frequently referred to as the historical range of variability (HRV, offers model users improved understanding of ecosystem function, more information with which to evaluate ecosystem change and potentially greater flexibility in management options. We developed a method for using LANDFIRE STSMs to estimate the HRV around the mean reference condition for each model state in ecosystems by varying the fire probabilities. The approach is flexible and can be adapted for use in a variety of ecosystems. HRV analysis can be combined with other information to help guide complex land management decisions.

  4. Characterization of Hop-and-Sink Locomotion of Water Fleas

    Science.gov (United States)

    Skipper, A. N.; Murphy, D. W.; Webster, D. R.

    2017-11-01

    The freshwater crustacean Daphnia magna is a widely studied zooplankton in relation to food webs, predator-prey interactions, and other biological/ecological considerations; however, their locomotion is poorly quantified and understood. These water fleas utilize a hop-and-sink mechanism that consists of making quick, impulsive jumps by beating their antennae to propel themselves forward (roughly 1 body length). The animals then sink for a period, during which they stretch out their antennae to increase drag and thereby reduce their sinking velocity. Time-resolved three-dimensional flow fields surrounding the animals were quantified with a unique infrared tomographic particle image velocimetry (tomo-PIV) system. Three-dimensional kinematics data were also extracted from the image sequences. In the current work, we compared body kinematics and flow disturbance among organisms of size in the range of 1.3 to 2.8 mm. The stroke cycle averaged 150 +/- 20 ms, with each stroke cycle split nearly evenly between power and recovery strokes. The kinematics data collapsed onto a self-similar curve when properly nondimensionalized, and a general trend was shown to exist between the nondimensionalized peak body speed and body length. The fluid flow induced by each antennae consisted of a viscous vortex ring that demonstrated a slow decay in the wake. The viscous dissipation showed no clear dependence on body size, whereas the volume of fluid exceeding 5 mm/s (the speed near the sinking speed of the animal) decayed more slowly with increasing body size.

  5. Power and delay optimisation in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-02-05

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the ‘bang-bang’ control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  6. Astronomical Constraints on Some Long-Range Models of Modified Gravity

    Directory of Open Access Journals (Sweden)

    Lorenzo Iorio

    2007-01-01

    Full Text Available We use the corrections to the Newton-Einstein secular precessions of the longitudes of the perihelia of the inner planets, phenomenologically estimated E.V. Pitjeva by fitting almost one century of data with the EPM2004 ephemerides, to constrain some long-range models of modified gravity recently put forth to address the dark energy and dark matter problems. They are the four-dimensional ones obtained with the addition of inverse powers and logarithm of some curvature invariants, and the DGP multidimensional braneworld model. After working out the analytical expressions of the secular perihelion precessions induced by the corrections to the Newtonian potential of such models, we compare them to the estimated extra-rates of perihelia by taking their ratio for different pairs of planets instead of using one perihelion at a time for each planet separately, as done so far in literature. The curvature invariants-based models are ruled out, even by rescaling by a factor 10 the errors in the estimated planetary orbital parameters. Less neat is the situation for the DGP model. Only the general relativistic Lense-Thirring effect, not included, as the other exotic models considered here, by Pitjeva in the EPM force models, passes such a test.

  7. Feasibility of Close-Range Photogrammetric Models for Geographic Information System

    International Nuclear Information System (INIS)

    2011-01-01

    The objective of this project was to determine the feasibility of using close-range architectural photogrammetry as an alternative three dimensional modeling technique in order to place the digital models in a geographic information system (GIS) at SLAC. With the available equipment and Australis photogrammetry software, the creation of full and accurate models of an example building, Building 281 on SLAC campus, was attempted. After conducting several equipment tests to determine the precision achievable, a complete photogrammetric survey was attempted. The dimensions of the resulting models were then compared against the true dimensions of the building. A complete building model was not evidenced to be obtainable using the current equipment and software. This failure was likely attributable to the limits of the software rather than the precision of the physical equipment. However, partial models of the building were shown to be accurate and determined to still be usable in a GIS. With further development of the photogrammetric software and survey procedure, the desired generation of a complete three dimensional model is likely still feasible.

  8. Sensitivity of electrospray molecular dynamics simulations to long-range Coulomb interaction models.

    Science.gov (United States)

    Mehta, Neil A; Levin, Deborah A

    2018-03-01

    Molecular dynamics (MD) electrospray simulations of 1-ethyl-3-methylimidazolium tetrafluoroborate (EMIM-BF_{4}) ion liquid were performed with the goal of evaluating the influence of long-range Coulomb models on ion emission characteristics. The direct Coulomb (DC), shifted force Coulomb sum (SFCS), and particle-particle particle-mesh (PPPM) long-range Coulomb models were considered in this work. The DC method with a sufficiently large cutoff radius was found to be the most accurate approach for modeling electrosprays, but, it is computationally expensive. The Coulomb potential energy modeled by the DC method in combination with the radial electric fields were found to be necessary to generate the Taylor cone. The differences observed between the SFCS and the DC in terms of predicting the total ion emission suggest that the former should not be used in MD electrospray simulations. Furthermore, the common assumption of domain periodicity was observed to be detrimental to the accuracy of the capillary-based electrospray simulations.

  9. Comment on "Many-body localization in Ising models with random long-range interactions"

    Science.gov (United States)

    Maksymov, Andrii O.; Rahman, Noah; Kapit, Eliot; Burin, Alexander L.

    2017-11-01

    This Comment is dedicated to the investigation of many-body localization in a quantum Ising model with long-range power-law interactions r-α, relevant for a variety of systems ranging from electrons in Anderson insulators to spin excitations in chains of cold atoms. It has earlier been argued [arXiv:cond-mat/0611387 (2005); Phys. Rev. B 91, 094202 (2015), 10.1103/PhysRevB.91.094202] that this model obeys the dimensional constraint suggesting the delocalization of all finite-temperature states in the thermodynamic limit for α ≤2 d in a d -dimensional system. This expectation conflicts with the recent numerical studies of the specific interacting spin model of Li et al. [Phys. Rev. A 94, 063625 (2016), 10.1103/PhysRevA.94.063625]. To resolve this controversy we reexamine the model of Li et al. [Phys. Rev. A 94, 063625 (2016), 10.1103/PhysRevA.94.063625] and demonstrate that the infinite-temperature states there obey the dimensional constraint. The earlier developed scaling theory for the critical system size required for delocalization is extended to small exponents 0 ≤α ≤d . The disagreements between the two works are explained by the nonstandard selection of investigated states in the ordered phase in the work of Li et al. [Phys. Rev. A 94, 063625 (2016)type="doi" specific-use="suppress-display">10.1103/PhysRevA.94.063625].

  10. Modelling Vulnerability and Range Shifts in Ant Communities Responding to Future Global Warming in Temperate Forests.

    Science.gov (United States)

    Kwon, Tae-Sung; Li, Fengqing; Kim, Sung-Soo; Chun, Jung Hwa; Park, Young-Seuk

    2016-01-01

    Global warming is likely leading to species' distributional shifts, resulting in changes in local community compositions and diversity patterns. In this study, we applied species distribution models to evaluate the potential impacts of temperature increase on ant communities in Korean temperate forests, by testing hypotheses that 1) the risk of extinction of forest ant species would increase over time, and 2) the changes in species distribution ranges could drive upward movements of ant communities and further alter patterns of species richness. We sampled ant communities at 335 evenly distributed sites across South Korea and modelled the future distribution range for each species using generalized additive models. To account for spatial autocorrelation, autocovariate regressions were conducted prior to generalized additive models. Among 29 common ant species, 12 species were estimated to shrink their suitable geographic areas, whereas five species would benefit from future global warming. Species richness was highest at low altitudes in the current period, and it was projected to be highest at the mid-altitudes in the 2080s, resulting in an upward movement of 4.9 m yr-1. This altered the altitudinal pattern of species richness from a monotonic-decrease curve (common in temperate regions) to a bell-shaped curve (common in tropical regions). Overall, ant communities in temperate forests are vulnerable to the on-going global warming and their altitudinal movements are similar to other faunal communities.

  11. An interactive system for creating object models from range data based on simulated annealing

    International Nuclear Information System (INIS)

    Hoff, W.A.; Hood, F.W.; King, R.H.

    1997-01-01

    In hazardous applications such as remediation of buried waste and dismantlement of radioactive facilities, robots are an attractive solution. Sensing to recognize and locate objects is a critical need for robotic operations in unstructured environments. An accurate 3-D model of objects in the scene is necessary for efficient high level control of robots. Drawing upon concepts from supervisory control, the authors have developed an interactive system for creating object models from range data, based on simulated annealing. Site modeling is a task that is typically performed using purely manual or autonomous techniques, each of which has inherent strengths and weaknesses. However, an interactive modeling system combines the advantages of both manual and autonomous methods, to create a system that has high operator productivity as well as high flexibility and robustness. The system is unique in that it can work with very sparse range data, tolerate occlusions, and tolerate cluttered scenes. The authors have performed an informal evaluation with four operators on 16 different scenes, and have shown that the interactive system is superior to either manual or automatic methods in terms of task time and accuracy

  12. Fluctuations and pseudo long range dependence in network flows: A non-stationary Poisson process model

    International Nuclear Information System (INIS)

    Yu-Dong, Chen; Li, Li; Yi, Zhang; Jian-Ming, Hu

    2009-01-01

    In the study of complex networks (systems), the scaling phenomenon of flow fluctuations refers to a certain power-law between the mean flux (activity) (F i ) of the i-th node and its variance σ i as σ i α (F i ) α . Such scaling laws are found to be prevalent both in natural and man-made network systems, but the understanding of their origins still remains limited. This paper proposes a non-stationary Poisson process model to give an analytical explanation of the non-universal scaling phenomenon: the exponent α varies between 1/2 and 1 depending on the size of sampling time window and the relative strength of the external/internal driven forces of the systems. The crossover behaviour and the relation of fluctuation scaling with pseudo long range dependence are also accounted for by the model. Numerical experiments show that the proposed model can recover the multi-scaling phenomenon. (general)

  13. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    Directory of Open Access Journals (Sweden)

    Zhongcheng Wei

    2017-01-01

    Full Text Available As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs. However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  14. In Search of the Golden Age Hip-Hop Sound (1986–1996

    Directory of Open Access Journals (Sweden)

    Ben Duinker

    2017-09-01

    Full Text Available The notion of a musical repertoire's "sound" is frequently evoked in journalism and scholarship, but what parameters comprise such a sound? This question is addressed through a statistically-driven corpus analysis of hip-hop music released during the genre's Golden Age era. The first part of the paper presents a methodology for developing, transcribing, and analyzing a corpus of 100 hip-hop tracks released during the Golden Age. Eight categories of aurally salient musical and production parameters are analyzed: tempo, orchestration and texture, harmony, form, vocal and lyric profiles, global and local production effects, vocal doubling and backing, and loudness and compression. The second part of the paper organizes the analysis data into three trend categories: trends of change (parameters that change over time, trends of prevalence (parameters that remain generally constant across the corpus, and trends of similarity (parameters that are similar from song to song. These trends form a generalized model of the Golden Age hip-hop sound which considers both global (the whole corpus and local (unique songs within the corpus contexts. By operationalizing "sound" as the sum of musical and production parameters, aspects of popular music that are resistant to traditional music-analytical methods can be considered.

  15. Hydraulic Circuit of Mechanical Pruner Drive for Hops on Low Trellises

    Directory of Open Access Journals (Sweden)

    Hoffmann David

    2015-09-01

    Full Text Available A mechanical pruner serves for pruning new hopvine shoots in spring. The later yield depends on the right timing and quality of pruning. That is why hop pruning is one of the most important agrotechnical procedures. A double-disc mechanical pruner used on high trellises cannot be used on low trellises due to its large size. Abroad, for pruning hops on low trellises a specially adapted sprinkler is used (chemical pruning. With regard to the effort to minimize the chemical environmental burden, we opted for the design of the mechanical pruner. Firstly, the low trellis, mechanical pruner, and also elements used in the design of hydraulic circuit are described. Next part of the paper is devoted to the input requirements for both the hydraulic circuit and the mechanical pruner designs. Then a description of an adapted inter-axle carrier used for the experimental model of the hop mechanical pruner and of the effected field measurement follows, along with interpretation of the measured data. These data are depicted in clearly arranged graphs showing the dependency of pressure and hydraulic oil flow on the cutting disc rotational frequency.

  16. Crowding and hopping in a protein’s diffusive transport on DNA

    International Nuclear Information System (INIS)

    Koslover, Elena F; Spakowitz, Andrew J; Díaz de la Rosa, Mario

    2017-01-01

    Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work. (paper)

  17. A wide-range model of two-group gross sections in the dynamics code HEXTRAN

    International Nuclear Information System (INIS)

    Kaloinen, E.; Peltonen, J.

    2002-01-01

    In dynamic analyses the thermal hydraulic conditions within the reactor core may have a large variation, which sets a special requirement on the modeling of cross sections. The standard model in the dynamics code HEXTRAN is the same as in the static design code HEXBU-3D/MODS. It is based on a linear and second order fitting of two-group cross sections on fuel and moderator temperature, moderator density and boron density. A new, wide-range model of cross sections developed in Fortum Nuclear Services for HEXBU-3D/MOD6 has been included as an option into HEXTRAN. In this model the nodal cross sections are constructed from seven state variables in a polynomial of more than 40 terms. Coefficients of the polynomial are created by a least squares fitting to the results of a large number of fuel assembly calculations. Depending on the choice of state variables for the spectrum calculations, the new cross section model is capable to cover local conditions from cold zero power to boiling at full power. The 5. dynamic benchmark problem of AER is analyzed with the new option and results are compared to calculations with the standard model of cross sections in HEXTRAN (Authors)

  18. Aspects of Hydrological Modelling In The Punjab Himalayan and Karakoram Ranges, Pakistan

    Science.gov (United States)

    Loukas, A.; Khan, M. I.; Quick, M. C.

    Various aspects of hydrologic modelling of high mountainous basins in the Punjab Hi- malayan and Karakoram ranges of Northern Pakistan were studied. The runoff from three basins in this region was simulated using the U.B.C. watershed model, which re- quires limited meteorological data of minimum and maximum daily temperature and precipitation. The structure of the model is based on the concept that the hydrolog- ical behavior is a function of elevation and thus, a watershed is conceptualized as a number of elevational zones. A simplified energy budget approach, which is based on daily maximum and minimum temperature and can account for forested and open areas, and aspect and latitude, is used in the U.B.C. model for the estimation of the snowmelt and glacier melt. The studied basins have different hydrological responses and limited data. The runoff from the first basin, the Astore basin, is mainly gener- ated by snowmelt. In the second basin, the Kunhar basin, the runoff is generated by snowmelt but significant redistribution of snow, caused by snow avalanches, affect the runoff generation. The third basin, the Hunza basin, is a highly glacierized basin and its runoff is mainly generated by glacier melt. The application of the U.B.C. watershed model to these three basins showed that the model could estimate reasonably well the runoff generated by the different components.

  19. Research on three-phase traffic flow modeling based on interaction range

    Science.gov (United States)

    Zeng, Jun-Wei; Yang, Xu-Gang; Qian, Yong-Sheng; Wei, Xu-Ting

    2017-12-01

    On the basis of the multiple velocity difference effect (MVDE) model and under short-range interaction, a new three-phase traffic flow model (S-MVDE) is proposed through careful consideration of the influence of the relationship between the speeds of the two adjacent cars on the running state of the rear car. The random slowing rule in the MVDE model is modified in order to emphasize the influence of vehicle interaction between two vehicles on the probability of vehicles’ deceleration. A single-lane model which without bottleneck structure under periodic boundary conditions is simulated, and it is proved that the traffic flow simulated by S-MVDE model will generate the synchronous flow of three-phase traffic theory. Under the open boundary, the model is expanded by adding an on-ramp, the congestion pattern caused by the bottleneck is simulated at different main road flow rates and on-ramp flow rates, which is compared with the traffic congestion pattern observed by Kerner et al. and it is found that the results are consistent with the congestion characteristics in the three-phase traffic flow theory.

  20. Qualification of a Plant Disease Simulation Model: Performance of the LATEBLIGHT Model Across a Broad Range of Environments.

    Science.gov (United States)

    Andrade-Piedra, Jorge L; Forbes, Gregory A; Shtienberg, Dani; Grünwald, Niklaus J; Chacón, María G; Taipe, Marco V; Hijmans, Robert J; Fry, William E

    2005-12-01

    ABSTRACT The concept of model qualification, i.e., discovering the domain over which a validated model may be properly used, was illustrated with LATEBLIGHT, a mathematical model that simulates the effect of weather, host growth and resistance, and fungicide use on asexual development and growth of Phytophthora infestans on potato foliage. Late blight epidemics from Ecuador, Mexico, Israel, and the United States involving 13 potato cultivars (32 epidemics in total) were compared with model predictions using graphical and statistical tests. Fungicides were not applied in any of the epidemics. For the simulations, a host resistance level was assigned to each cultivar based on general categories reported by local investigators. For eight cultivars, the model predictions fit the observed data. For four cultivars, the model predictions overestimated disease, likely due to inaccurate estimates of host resistance. Model predictions were inconsistent for one cultivar and for one location. It was concluded that the domain of applicability of LATEBLIGHT can be extended from the range of conditions in Peru for which it has been previously validated to those observed in this study. A sensitivity analysis showed that, within the range of values observed empirically, LATEBLIGHT is more sensitive to changes in variables related to initial inoculum and to weather than to changes in variables relating to host resistance.

  1. Analog VLSI Models of Range-Tuned Neurons in the Bat Echolocation System

    Directory of Open Access Journals (Sweden)

    Horiuchi Timothy

    2003-01-01

    Full Text Available Bat echolocation is a fascinating topic of research for both neuroscientists and engineers, due to the complex and extremely time-constrained nature of the problem and its potential for application to engineered systems. In the bat's brainstem and midbrain exist neural circuits that are sensitive to the specific difference in time between the outgoing sonar vocalization and the returning echo. While some of the details of the neural mechanisms are known to be species-specific, a basic model of reafference-triggered, postinhibitory rebound timing is reasonably well supported by available data. We have designed low-power, analog VLSI circuits to mimic this mechanism and have demonstrated range-dependent outputs for use in a real-time sonar system. These circuits are being used to implement range-dependent vocalization amplitude, vocalization rate, and closest target isolation.

  2. Monte Carlo simulation of atomic short range order and cluster formation in two dimensional model alloys

    International Nuclear Information System (INIS)

    Rojas T, J.; Instituto Peruano de Energia Nuclear, Lima; Manrique C, E.; Torres T, E.

    2002-01-01

    Using monte Carlo simulation have been carried out an atomistic description of the structure and ordering processes in the system Cu-Au in a two-dimensional model. The ABV model of the alloy is a system of N atoms A and B, located in rigid lattice with some vacant sites. In the model we assume pair wise interactions between nearest neighbors with constant ordering energy J = 0,03 eV. The dynamics was introduced by means of a vacancy that exchanges of place with any atom of its neighbors. The simulations were carried out in a square lattice with 1024 and 4096 particles, using periodic boundary conditions to avoid border effects. We calculate the first two parameters of short range order of Warren-Cowley as function of the concentration and temperature. It was also studied the probabilities of formation of different atomic clusters that consist of 9 atoms as function of the concentration of the alloy and temperatures in a wide range of values. In some regions of temperature and concentration it was observed compositional and thermal polymorphism

  3. An End-to-End Model of Plant Pheromone Channel for Long Range Molecular Communication.

    Science.gov (United States)

    Unluturk, Bige D; Akyildiz, Ian F

    2017-01-01

    A new track in molecular communication is using pheromones which can scale up the range of diffusion-based communication from μm meters to meters and enable new applications requiring long range. Pheromone communication is the emission of molecules in the air which trigger behavioral or physiological responses in receiving organisms. The objective of this paper is to introduce a new end-to-end model which incorporates pheromone behavior with communication theory for plants. The proposed model includes both the transmission and reception processes as well as the propagation channel. The transmission process is the emission of pheromones from the leaves of plants. The dispersion of pheromones by the flow of wind constitutes the propagation process. The reception process is the sensing of pheromones by the pheromone receptors of plants. The major difference of pheromone communication from other molecular communication techniques is the dispersion channel acting under the laws of turbulent diffusion. In this paper, the pheromone channel is modeled as a Gaussian puff, i.e., a cloud of pheromone released instantaneously from the source whose dispersion follows a Gaussian distribution. Numerical results on the performance of the overall end-to-end pheromone channel in terms of normalized gain and delay are provided.

  4. Image simulation and a model of noise power spectra across a range of mammographic beam qualities

    Energy Technology Data Exchange (ETDEWEB)

    Mackenzie, Alistair, E-mail: alistairmackenzie@nhs.net; Dance, David R.; Young, Kenneth C. [National Coordinating Centre for the Physics of Mammography, Royal Surrey County Hospital, Guildford GU2 7XX, United Kingdom and Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Diaz, Oliver [Centre for Vision, Speech and Signal Processing, Faculty of Engineering and Physical Sciences, University of Surrey, Guildford GU2 7XH, United Kingdom and Computer Vision and Robotics Research Institute, University of Girona, Girona 17071 (Spain)

    2014-12-15

    Purpose: The aim of this work is to create a model to predict the noise power spectra (NPS) for a range of mammographic radiographic factors. The noise model was necessary to degrade images acquired on one system to match the image quality of different systems for a range of beam qualities. Methods: Five detectors and x-ray systems [Hologic Selenia (ASEh), Carestream computed radiography CR900 (CRc), GE Essential (CSI), Carestream NIP (NIPc), and Siemens Inspiration (ASEs)] were characterized for this study. The signal transfer property was measured as the pixel value against absorbed energy per unit area (E) at a reference beam quality of 28 kV, Mo/Mo or 29 kV, W/Rh with 45 mm polymethyl methacrylate (PMMA) at the tube head. The contributions of the three noise sources (electronic, quantum, and structure) to the NPS were calculated by fitting a quadratic at each spatial frequency of the NPS against E. A quantum noise correction factor which was dependent on beam quality was quantified using a set of images acquired over a range of radiographic factors with different thicknesses of PMMA. The noise model was tested for images acquired at 26 kV, Mo/Mo with 20 mm PMMA and 34 kV, Mo/Rh with 70 mm PMMA for three detectors (ASEh, CRc, and CSI) over a range of exposures. The NPS were modeled with and without the noise correction factor and compared with the measured NPS. A previous method for adapting an image to appear as if acquired on a different system was modified to allow the reference beam quality to be different from the beam quality of the image. The method was validated by adapting the ASEh flat field images with two thicknesses of PMMA (20 and 70 mm) to appear with the imaging characteristics of the CSI and CRc systems. Results: The quantum noise correction factor rises with higher beam qualities, except for CR systems at high spatial frequencies, where a flat response was found against mean photon energy. This is due to the dominance of secondary quantum noise

  5. Aggregate supply and demand modeling using GIS methods for the front range urban corridor, Colorado

    Science.gov (United States)

    Karakas, Ahmet; Turner, Keith

    2004-07-01

    The combined use of allocation modeling and geographical information system (GIS) technologies for providing quantitative assessments of aggregate supply and demand is evaluated using representative data for the Front Range Urban Corridor (FRUC) in Colorado. The FRUC extends from the Colorado-Wyoming border to south of Colorado Springs, and includes Denver and the major urban growth regions of Colorado. In this area, aggregate demand is high and is increasing in response to population growth. Neighborhood opposition to the establishment of new pits and quarries and the depletion of many deposits are limiting aggregate supplies. Many sources are already covered by urban development or eliminated from production by zoning. Transport of aggregate by rail from distant resources may be required in the future. Two allocation-modeling procedures are tested in this study. Network analysis procedures provided within the ARC/INFO software, are unsatisfactory. Further aggregate allocation modeling used a model specifically designed for this task; a modified version of an existing Colorado School of Mines allocation model allows for more realistic market analyses. This study evaluated four scenarios. The entire region was evaluated with a scenario reflecting the current market and by a second scenario in which some existing suppliers were closed down and new potential suppliers were activated. The conditions within the Denver metropolitan area were studied before and after the introduction of three possible rail-to-truck aggregate distribution centers. GIS techniques are helpful in developing the required database to describe the Front Range Urban Corridor aggregate market conditions. GIS methods allow the digital representation of the regional road network, and the development of a distance matrix relating all suppliers and purchasers.

  6. Clinical Prediction Model for Time in Therapeutic Range While on Warfarin in Newly Diagnosed Atrial Fibrillation.

    Science.gov (United States)

    Williams, Brent A; Evans, Michael A; Honushefsky, Ashley M; Berger, Peter B

    2017-10-12

    Though warfarin has historically been the primary oral anticoagulant for stroke prevention in newly diagnosed atrial fibrillation (AF), several new direct oral anticoagulants may be preferred when anticoagulation control with warfarin is expected to be poor. This study developed a prediction model for time in therapeutic range (TTR) among newly diagnosed AF patients on newly initiated warfarin as a tool to assist decision making between warfarin and direct oral anticoagulants. This electronic medical record-based, retrospective study included newly diagnosed, nonvalvular AF patients with no recent warfarin exposure receiving primary care services through a large healthcare system in rural Pennsylvania. TTR was estimated as the percentage of time international normalized ratio measurements were between 2.0 and 3.0 during the first year following warfarin initiation. Candidate predictors of TTR were chosen from data elements collected during usual clinical care. A TTR prediction model was developed and temporally validated and its predictive performance was compared with the SAMe-TT 2 R 2 score (sex, age, medical history, treatment, tobacco, race) using R 2 and c-statistics. A total of 7877 newly diagnosed AF patients met study inclusion criteria. Median (interquartile range) TTR within the first year of starting warfarin was 51% (32, 67). Of 85 candidate predictors evaluated, 15 were included in the final validated model with an R 2 of 15.4%. The proposed model showed better predictive performance than the SAMe-TT 2 R 2 score ( R 2 =3.0%). The proposed prediction model may assist decision making on the proper mode of oral anticoagulant among newly diagnosed AF patients. However, predicting TTR on warfarin remains challenging. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  7. The phase transition in the anisotropic Heisenberg model with long range dipolar interactions

    International Nuclear Information System (INIS)

    Mól, L.A.S.; Costa, B.V.

    2014-01-01

    In this work we have used extensive Monte Carlo calculations to study the planar to paramagnetic phase transition in the two-dimensional anisotropic Heisenberg model with dipolar interactions (AHd) considering the true long-range character of the dipolar interactions by means of the Ewald summation. Our results are consistent with an order–disorder phase transition with unusual critical exponents in agreement with our previous results for the Planar Rotator model with dipolar interactions. Nevertheless, our results disagree with the Renormalization Group results of Maier and Schwabl [Phys. Rev. B, 70, 134430 (2004)] [13] and the results of Rapini et al. [Phys. Rev. B, 75, 014425 (2007)] [12], where the AHd was studied using a cut-off in the evaluation of the dipolar interactions. We argue that besides the long-range character of dipolar interactions their anisotropic character may have a deeper effect in the system than previously believed. Besides, our results show that the use of a cut-off radius in the evaluation of dipolar interactions must be avoided when analyzing the critical behavior of magnetic systems, since it may lead to erroneous results. - Highlights: • The anisotropic Heisenberg model with dipolar interactions is studied. • True long-range interactions were considered by means of Ewald summation. • We found an order–disorder phase transition with unusual critical exponents. • Previous results show a different behavior when a cut-off radius is introduced. • The use of a cut-off radius must be avoided when dealing with dipolar systems

  8. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  9. Characteristics of alternating current hopping conductivity in DNA sequences

    International Nuclear Information System (INIS)

    Song-Shan, Ma; Hui, Xu; Huan-You, Wang; Rui, Guo

    2009-01-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of ø ac (ω) ∼ ω 2 ln 2 (1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p ≥ 0.5, the conductivity increases with the increase of p. (cross-disciplinary physics and related areas of science and technology)

  10. Characteristics of alternating current hopping conductivity in DNA sequences

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui

    2009-01-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)~ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p<0.5,the conductivity of DNA sequence decreases with the increase of p,while for p > 0.5,the conductivity increases with the increase of p.

  11. Model Study of Wave Overtopping of Marine Structure for a Wide Range of Geometric Parameters

    DEFF Research Database (Denmark)

    Kofoed, Jens Peter

    2000-01-01

    The objective of the study described in this paper is to enable estimation of wave overtopping rates for slopes/ramps given by a wide range of geometric parameters when subjected to varying wave conditions. To achieve this a great number of model tests are carried out in a wave tank using irregul...... 2-D waves. On the basis of the first part of these tests an exponential overtopping expression for a linear slope, including the effect of limited draught and varying slope angle, is presented. The plans for further tests with other slope geometries are described....

  12. 3D MODELLING BY LOW-COST RANGE CAMERA: SOFTWARE EVALUATION AND COMPARISON

    Directory of Open Access Journals (Sweden)

    R. Ravanelli

    2017-11-01

    Full Text Available The aim of this work is to present a comparison among three software applications currently available for the Occipital Structure SensorTM; all these software were developed for collecting 3D models of objects easily and in real-time with this structured light range camera. The SKANECT, itSeez3D and Scanner applications were thus tested: a DUPLOTM bricks construction was scanned with the three applications and the obtained models were compared to the model virtually generated with a standard CAD software, which served as reference. The results demonstrate that all the software applications are generally characterized by the same level of geometric accuracy, which amounts to very few millimetres. However, the itSeez3D software, which requires a payment of $7 to export each model, represents surely the best solution, both from the point of view of the geometric accuracy and, mostly, at the level of the color restitution. On the other hand, Scanner, which is a free software, presents an accuracy comparable to that of itSeez3D. At the same time, though, the colors are often smoothed and not perfectly overlapped to the corresponding part of the model. Lastly, SKANECT is the software that generates the highest number of points, but it has also some issues with the rendering of the colors.

  13. Surface hopping simulation of vibrational predissociation of methanol dimer

    Science.gov (United States)

    Jiang, Ruomu; Sibert, Edwin L.

    2012-06-01

    The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

  14. Particle trapping and hopping in an optofluidic fishnet

    Science.gov (United States)

    Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.

    2017-08-01

    Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

  15. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  16. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  17. Circuit model optimization of a nano split ring resonator dimer antenna operating in infrared spectral range

    International Nuclear Information System (INIS)

    Gneiding, N.; Zhuromskyy, O.; Peschel, U.; Shamonina, E.

    2014-01-01

    Metamaterials are comprised of metallic structures with a strong response to incident electromagnetic radiation, like, for example, split ring resonators. The interaction of resonator ensembles with electromagnetic waves can be simulated with finite difference or finite elements algorithms, however, above a certain ensemble size simulations become inadmissibly time or memory consuming. Alternatively a circuit description of metamaterials, a well developed modelling tool at radio and microwave frequencies, allows to significantly increase the simulated ensemble size. This approach can be extended to the IR spectral range with an appropriate set of circuit element parameters accounting for physical effects such as electron inertia and finite conductivity. The model is verified by comparing the coupling coefficients with the ones obtained from the full wave numerical simulations, and used to optimize the nano-antenna design with improved radiation characteristics.

  18. Long-range transmission of pollutants simulated by a two-dimensional pseudospectral dispersion model

    International Nuclear Information System (INIS)

    Prahm, L.P.; Christensen, O.

    1977-01-01

    The pseudospectral dispersion model (Christensen and Prahm, 1976) is adapted for simulation of the long-range transmission of sulphur pollutants in the European region, covering an area of about 4000 km x 4000 km. Regional ''background'' concentrations of sulphur oxides are found to be highly dependent on distant sources and to correlate poorly with local source strength during the considered three- and four-day episodes. The simulation is based on emission data, given in squares of about 50 km x 50 km and on synoptic wind fields derived from observed wind velocities of the 850 mb level and the surface level. The two-dimensional model includes a constant vertical mixing depth. Appropriate values for the deposition and the transformation rates of SO 2 and SO/sup 4 are used. The concentration of pollutants computed from the two-dimensional pseudospectral dispersion model reflects the variable meteorological conditions. Computed concentrations are compared with measurements, giving spatial correlations between 0.4 and 0.8 for more than 400 ground-based 24 h mean values, and a spatial correlation of 0.9 for eight aircraft samples averaged over approx.30 min. A discussion of the influence of different sources of error in the model simulation is given. The high numerical accuracy of the pseudospectral model is combined with a modest consumption of CPU computer time. This study is the first application of the pseudospectral dispersion model which compares computed concentrations with measured field data. The model has possible applications as a tool for assessment of the impact of both national and international emission regulation strategies

  19. Model-based restoration using light vein for range-gated imaging systems.

    Science.gov (United States)

    Wang, Canjin; Sun, Tao; Wang, Tingfeng; Wang, Rui; Guo, Jin; Tian, Yuzhen

    2016-09-10

    The images captured by an airborne range-gated imaging system are degraded by many factors, such as light scattering, noise, defocus of the optical system, atmospheric disturbances, platform vibrations, and so on. The characteristics of low illumination, few details, and high noise make the state-of-the-art restoration method fail. In this paper, we present a restoration method especially for range-gated imaging systems. The degradation process is divided into two parts: the static part and the dynamic part. For the static part, we establish the physical model of the imaging system according to the laser transmission theory, and estimate the static point spread function (PSF). For the dynamic part, a so-called light vein feature extraction method is presented to estimate the fuzzy parameter of the atmospheric disturbance and platform movement, which make contributions to the dynamic PSF. Finally, combined with the static and dynamic PSF, an iterative updating framework is used to restore the image. Compared with the state-of-the-art methods, the proposed method can effectively suppress ringing artifacts and achieve better performance in a range-gated imaging system.

  20. Salinity/temperature ranges for application of seawater SA-T-P models

    Science.gov (United States)

    Marion, G. M.; Millero, F. J.; Feistel, R.

    2009-01-01

    At the present time, little is known about how broad salinity and temperature ranges are for seawater thermodynamic models that are functions of absolute salinity (SA), temperature (T) and pressure (P). Such models rely on fixed compositional ratios of the major components (e.g. Na/Cl, Mg/Cl, Ca/Cl, SO4/Cl, etc.). As seawater evaporates or freezes, solid phases (e.g. CaCO3(s) or CaSO42H2O(s)) will eventually precipitate. This will change the compositional ratios, and these salinity models will no longer be applicable. A future complicating factor is the lowering of seawater pH as the atmospheric concentrations of CO2 increase. A geochemical model (FREZCHEM) was used to quantify the SA-T boundaries at P=0.1 MPa and the range of these boundaries for future atmospheric CO2 increases. An omega supersaturation model for CaCO3 minerals based on homogeneous nucleation was extended from 25-40°C to 3°C. CaCO3 minerals were the boundary defining minerals (first to precipitate) between 3°C (at SA=104 g kg-1 and 40°C (at SA=66 g kg-1. At 2.82°C, calcite(CaCO3) transitioned to ikaite(CaCO36H2O) as the dominant boundary defining mineral for colder temperatures, which culminated in a low temperature boundary of -4.93°C. Increasing atmospheric CO2 from 385 μatm (in Year 2008) to 550 μatm (in Year 2100) would increase the SA and t boundaries as much as 11 g kg-1 and 0.66°C, respectively. The model-calculated calcite-ikaite transition temperature of 2.82°C is in excellent agreement with ikaite formation in natural environments that occurs at temperatures of 3°C or lower. Furthermore, these results provide a quantitative theoretical explanation (FREZCHEM model calculations) for why ikaite is the solid phase CaCO3 mineral that precipitates during seawater freezing.

  1. A new generic model potential for mesogenic systems: square well line potential of variable range.

    Science.gov (United States)

    Varga, Szabolcs; Vesely, Franz J

    2009-11-21

    A single-site pair potential is derived to approximate the linear n-site square well interaction. The resulting square well line (SWL) potential is analytical, fairly smooth, and reproduces the distance and orientation dependence of the multisite pair energy. It contains only three control parameters n, L, and s(2), in addition to the units of length s(1) and energy epsilon. The advantages of the new model over the traditional potentials such as Gay-Berne and Kihara are that n, L, and s(2) are physically meaningful quantities and that no additional adjustable parameters are introduced. With the SWL potential even very long square well chain molecules may be treated in Monte Carlo (MC) simulations; moreover the model is well suited for perturbation theory. Using Onsager-like theories we test the effect of molecular elongation, temperature, and the range of the square well potential on the vapor-liquid and nematic-smectic A (NS) phase transitions. We find that the vapor-liquid binodal of the SWL fluid is in good agreement with MC results for square well dumbbells. For repulsive SWL particles, varying the interaction range s(2) results in a similar effect on the NS transition as the change in the ionic strength in a real suspension of fd viruses.

  2. Mesoscale influence on long-range transport — evidence from ETEX modelling and observations

    Science.gov (United States)

    Sørensen, Jens Havskov; Rasmussen, Alix; Ellermann, Thomas; Lyck, Erik

    During the first European Tracer Experiment (ETEX) tracer gas was released from a site in Brittany, France, and subsequently observed over a range of 2000 km. Hourly measurements were taken at the National Environmental Research Institute (NERI) located at Risø, Denmark, using two measurement techniques. At this location, the observed concentration time series shows a double-peak structure occurring between two and three days after the release. By using the Danish Emergency Response Model of the Atmosphere (DERMA), which is developed at the Danish Meteorological Institute (DMI), simulations of the dispersion of the tracer gas have been performed. Using numerical weather-prediction data from the European Centre for Medium-Range Weather Forecast (ECMWF) by DERMA, the arrival time of the tracer is quite well predicted, so also is the duration of the passage of the plume, but the double-peak structure is not reproduced. However, using higher-resolution data from the DMI version of the HIgh Resolution Limited Area Model (DMI-HIRLAM), DERMA reproduces the observed structure very well. The double-peak structure is caused by the influence of a mesoscale anti-cyclonic eddy on the tracer gas plume about one day earlier.

  3. Modelling the evolution of solar-mass stars with a range of metallicities using MESA

    Directory of Open Access Journals (Sweden)

    Jones E.F.

    2015-01-01

    Full Text Available The nuclides 1,2H, 3,4He, 7Li, 7Be, 8B, 12,13C, 13-15N, 14-18O, 17-19F, 18-22Ne, 22Mg, and 24Mg were used in the code package MESA (Modules for Experiments in Stellar Astrophysics[Paxton] to model a one-solar-mass star with a range of metallicities, z, from 0 to 0.1. On HR diagrams of each star model’s luminosity and effective temperature from before zero-age main sequence (pre-ZAMS to white dwarf, oscillations were noted in the horizontal branch at intervals from z = 0 to 0.0070. At z, = 0, the calculated stellar lifetime is 6.09x109 years. The calculated lifetime of the model stars increases to a maximum of 1.25x1010 years at z = 0.022 and then decreases to 2.59x109 years at z = 0.1. A piecewise fit of the model lifetimes vs. metallicity was obtained.

  4. Phenomenological modeling of long range noncontact friction in micro- and nanoresonators

    International Nuclear Information System (INIS)

    Gusso, Andre

    2011-01-01

    Motivated by the results of an experiment using atomic force microscopy performed by Gotsmann and Fuchs [Phys. Rev. Lett. 86, 2597 (2001)], where a strong energy loss due to the tip-sample interaction was measured, we investigate the potential implications of this energy loss channel to the quality factor of suspended micro- and nanoresonators. Because the observed tip-sample dissipation remains without a satisfactory theoretical explanation, two phenomenological models are proposed to generalize the experimental observations. In the minimal phenomenological model the range of validity of the power law found experimentally for the damping coefficient is assumed to be valid for larger separations. A more elaborate phenomenological model assumes that the noncontact friction is a consequence of the Casimir force acting between the closely spaced surfaces. Both models provide quantitative results for the noncontact friction between any two objects which are then used to estimate the energy loss for suspended bar micro- and nanoresonators. It is concluded that the energy loss due to the unknown mechanism has the potential to seriously restrict the quality factor of both micro- and nanoresonators.

  5. Evaluation of tranche in securitization and long-range Ising model

    Science.gov (United States)

    Kitsukawa, K.; Mori, S.; Hisakado, M.

    2006-08-01

    This econophysics work studies the long-range Ising model of a finite system with N spins and the exchange interaction J/N and the external field H as a model for homogeneous credit portfolio of assets with default probability Pd and default correlation ρd. Based on the discussion on the (J,H) phase diagram, we develop a perturbative calculation method for the model and obtain explicit expressions for Pd,ρd and the normalization factor Z in terms of the model parameters N and J,H. The effect of the default correlation ρd on the probabilities P(Nd,ρd) for Nd defaults and on the cumulative distribution function D(i,ρd) are discussed. The latter means the average loss rate of the“tranche” (layered structure) of the securities (e.g. CDO), which are synthesized from a pool of many assets. We show that the expected loss rate of the subordinated tranche decreases with ρd and that of the senior tranche increases linearly, which are important in their pricing and ratings.

  6. Constitutive modeling of polycarbonate over a wide range of strain rates and temperatures

    Science.gov (United States)

    Wang, Haitao; Zhou, Huamin; Huang, Zhigao; Zhang, Yun; Zhao, Xiaoxuan

    2017-02-01

    The mechanical behavior of polycarbonate was experimentally investigated over a wide range of strain rates (10^{-4} to 5× 103 s^{-1}) and temperatures (293 to 353 K). Compression tests under these conditions were performed using a SHIMADZU universal testing machine and a split Hopkinson pressure bar. Falling weight impact testing was carried out on an Instron Dynatup 9200 drop tower system. The rate- and temperature-dependent deformation behavior of polycarbonate was discussed in detail. Dynamic mechanical analysis (DMA) tests were utilized to observe the glass (α ) transition and the secondary (β ) transition of polycarbonate. The DMA results indicate that the α and β transitions have a dramatic influence on the mechanical behavior of polycarbonate. The decompose/shift/reconstruct (DSR) method was utilized to decompose the storage modulus into the α and β components and extrapolate the entire modulus, the α-component modulus and the β-component modulus. Based on three previous models, namely, Mulliken-Boyce, G'Sell-Jonas and DSGZ, an adiabatic model is proposed to predict the mechanical behavior of polycarbonate. The model considers the contributions of both the α and β transitions to the mechanical behavior, and it has been implemented in ABAQUS/Explicit through a user material subroutine VUMAT. The model predictions are proven to essentially coincide with the experimental results during compression testing and falling weight impact testing.

  7. A range of complex probabilistic models for RNA secondary structure prediction that includes the nearest-neighbor model and more.

    Science.gov (United States)

    Rivas, Elena; Lang, Raymond; Eddy, Sean R

    2012-02-01

    The standard approach for single-sequence RNA secondary structure prediction uses a nearest-neighbor thermodynamic model with several thousand experimentally determined energy parameters. An attractive alternative is to use statistical approaches with parameters estimated from growing databases of structural RNAs. Good results have been reported for discriminative statistical methods using complex nearest-neighbor models, including CONTRAfold, Simfold, and ContextFold. Little work has been reported on generative probabilistic models (stochastic context-free grammars [SCFGs]) of comparable complexity, although probabilistic models are generally easier to train and to use. To explore a range of probabilistic models of increasing complexity, and to directly compare probabilistic, thermodynamic, and discriminative approaches, we created TORNADO, a computational tool that can parse a wide spectrum of RNA grammar architectures (including the standard nearest-neighbor model and more) using a generalized super-grammar that can be parameterized with probabilities, energies, or arbitrary scores. By using TORNADO, we find that probabilistic nearest-neighbor models perform comparably to (but not significantly better than) discriminative methods. We find that complex statistical models are prone to overfitting RNA structure and that evaluations should use structurally nonhomologous training and test data sets. Overfitting has affected at least one published method (ContextFold). The most important barrier to improving statistical approaches for RNA secondary structure prediction is the lack of diversity of well-curated single-sequence RNA secondary structures in current RNA databases.

  8. Miedema model based methodology to predict amorphous-forming-composition range in binary and ternary systems

    Energy Technology Data Exchange (ETDEWEB)

    Das, N., E-mail: nirupamd@barc.gov.in [Materials Science Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India); Mittra, J. [Materials Science Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India); Murty, B.S. [Department of Metallurgical and Materials Engineering, IIT Madras, Chennai 600 036 (India); Pabi, S.K. [Department of Metallurgical and Materials Engineering, IIT Kharagpur, Kharagpur 721 302 (India); Kulkarni, U.D.; Dey, G.K. [Materials Science Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India)

    2013-02-15

    Highlights: Black-Right-Pointing-Pointer A methodology was proposed to predict amorphous forming compositions (AFCs). Black-Right-Pointing-Pointer Chemical contribution to enthalpy of mixing {proportional_to} enthalpy of amorphous for AFCs. Black-Right-Pointing-Pointer Accuracy in the prediction of AFC-range was noticed in Al-Ni-Ti system. Black-Right-Pointing-Pointer Mechanical alloying (MA) results of Al-Ni-Ti followed the predicted AFC-range. Black-Right-Pointing-Pointer Earlier MA results of Al-Ni-Ti also conformed to the predicted AFC-range. - Abstract: From the earlier works on the prediction of amorphous forming composition range (AFCR) using Miedema based model and also, on mechanical alloying experiments it has been observed that all amorphous forming compositions of a given alloy system falls within a linear band when the chemical contribution to enthalpy of the solid solution ({Delta}H{sup ss}) is plotted against the enthalpy of mixing in the amorphous phase ({Delta}H{sup amor}). On the basis of this observation, a methodology has been proposed in this article to identify the AFCR of a ternary system that is likely to be more precise than what can be obtained using {Delta}H{sup amor} - {Delta}H{sup ss} < 0 criterion. MA experiments on various compositions of Al-Ni-Ti system, producing amorphous, crystalline, and mixture of amorphous plus crystalline phases have been carried out and the phases have been characterized using X-ray diffraction and transmission electron microscopy techniques. Data from the present MA experiments and, also, from the literature have been used to validate the proposed approach. Also, the proximity of compositions, producing a mixture of amorphous and crystalline phases to the boundary of AFCR in the Al-Ni-Ti ternary has been found useful to validate the effectiveness of the prediction.

  9. Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

    Science.gov (United States)

    Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

    2012-05-04

    In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

  10. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed...... contributes to the early EMG burst, then advancing or delaying the touch-down without the subject's knowledge should similarly advance or delay the burst. This was indeed the case when touch-down was advanced or delayed by shifting the height of a programmable platform up or down between two hops...... and this resulted in a correspondent shift of the early EMG burst. Our second hypothesis was that the motor cortex contributes to the first EMG burst during hopping. If so, inhibition of the motor cortex would reduce the magnitude of the burst. By applying a low-intensity magnetic stimulus it was possible...

  11. Polaron Hopping in Nano-scale Poly(dA–Poly(dT DNA

    Directory of Open Access Journals (Sweden)

    Singh Mahi

    2010-01-01

    Full Text Available Abstract We investigate the current–voltage relationship and the temperature-dependent conductance of nano-scale samples of poly(dA–poly(dT DNA molecules. A polaron hopping model has been used to calculate the I–V characteristic of nano-scale samples of DNA. This model agrees with the data for current versus voltage at temperatures greater than 100 K. The quantities G 0 , i 0 , and T 1d are determined empirically, and the conductivity is estimated for samples of poly(dA–poly(dT.

  12. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

    2017-01-01

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

  13. Higher measured than modeled ozone production at increased NOx levels in the Colorado Front Range

    Directory of Open Access Journals (Sweden)

    B. C. Baier

    2017-09-01

    Full Text Available Chemical models must correctly calculate the ozone formation rate, P(O3, to accurately predict ozone levels and to test mitigation strategies. However, air quality models can have large uncertainties in P(O3 calculations, which can create uncertainties in ozone forecasts, especially during the summertime when P(O3 is high. One way to test mechanisms is to compare modeled P(O3 to direct measurements. During summer 2014, the Measurement of Ozone Production Sensor (MOPS directly measured net P(O3 in Golden, CO, approximately 25 km west of Denver along the Colorado Front Range. Net P(O3 was compared to rates calculated by a photochemical box model that was constrained by measurements of other chemical species and that used a lumped chemical mechanism and a more explicit one. Median observed P(O3 was up to a factor of 2 higher than that modeled during early morning hours when nitric oxide (NO levels were high and was similar to modeled P(O3 for the rest of the day. While all interferences and offsets in this new method are not fully understood, simulations of these possible uncertainties cannot explain the observed P(O3 behavior. Modeled and measured P(O3 and peroxy radical (HO2 and RO2 discrepancies observed here are similar to those presented in prior studies. While a missing atmospheric organic peroxy radical source from volatile organic compounds co-emitted with NO could be one plausible solution to the P(O3 discrepancy, such a source has not been identified and does not fully explain the peroxy radical model–data mismatch. If the MOPS accurately depicts atmospheric P(O3, then these results would imply that P(O3 in Golden, CO, would be NOx-sensitive for more of the day than what is calculated by models, extending the NOx-sensitive P(O3 regime from the afternoon further into the morning. These results could affect ozone reduction strategies for the region surrounding Golden and possibly other areas that do not comply with national ozone

  14. From Broken Glass to Ruf Diamonds: Manchester Hip Hop

    OpenAIRE

    de Paor-Evans, Adam

    2018-01-01

    When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

  15. A model for short and medium range dispersion of radionuclides released to the atmosphere

    International Nuclear Information System (INIS)

    Clarke, R.H.

    1979-09-01

    A Working Group was established to give practical guidance on the estimation of the dispersion of radioactive releases to the atmosphere. The dispersion is estimated in the short and medium range, that is from about 100 m to a few tens of kilometres from the source, and is based upon a Gaussian plume model. A scheme is presented for categorising atmospheric conditions and values of the associated dispersion parameters are given. Typical results are presented for releases in specific meteorological conditions and a scheme is included to allow for durations of release of up to 24 hours. Consideration has also been given to predicting longer term average concentrations, typically annual averages, and results are presented which facilitate site specific calculations. The results of the models are extended to 100 km from the source, but the increasing uncertainty with which results may be predicted beyond a few tens of kilometres from the source is emphasised. Three technical appendices provide some of the rationale behind the decisions made in adopting the various models in the proposed dispersion scheme. (author)

  16. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  17. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Directory of Open Access Journals (Sweden)

    María Pilar Castañeda-Ojeda

    2017-05-01

    Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

  18. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  19. Modelling the recruitment of European eel (Anguilla anguilla) throughout its European range

    DEFF Research Database (Denmark)

    Bornarel, Virginie; Lambert, Patrick; Briand, Cédric

    2018-01-01

    phase remains difficult given its widespread distribution among heterogeneous and separate river catchments. Hence, it is currently considered by the International Council for the Exploration of the Sea (ICES) more feasible to use glass eel recruitment data to assess the status of the overall population......European eel (Anguilla anguilla) recruitment has been declining at least since the early 1980s at the scale of its distribution area. Since the population is panmictic, its stock assessment should be carried out on a range-wide basis. However, assessing the overall stock during the continental....... In this study, we used Glass Eel Recruitment Estimation Model (GEREM) to estimate annual recruitment (i) at the river catchment level, a scale for which data are available, (ii) at an intermediate scale (6 European regions), and (iii) at a larger scale (Europe). This study provides an estimate of the glass eel...

  20. Application of Back Trajectory Model to Predict Long Range Transport of Pollutant

    International Nuclear Information System (INIS)

    Shamsiah Abdul Rahman; Mohd Suhaimi Hamzah; Mohd Suhaimi Elias

    2011-01-01

    Trans-boundary haze pollution in Malaysia has become an issue that created a public attention over the past several years. The presence of haze not only caused by internal and external sources but it sometime coincided with the El Nino phenomenon which prolonged the dry season during the southwest monsoon in May to September. In this study fine particulate data (PM 2.5) of Klang Valley region covering the period from 1997 to 2008 were used to investigate the source location that responsible for the long range transport of pollutant. Back trajectory model the Hybrid Single-Particle Lagrangian Integrated Trajectory (HYSPLIT) was used to calculate the air mass backward trajectories up to 120 hours (5 days) for the days when fine particle were sampled. (author)

  1. About long range pairing correlations in the Hubbard U-t-t' models

    International Nuclear Information System (INIS)

    Moreo, A.

    1991-01-01

    Using a quantum Monte Carlo method the authors measured pair correlation functions with different symmetries as a function of the filling, U/t and t'/t for the Hubbard and U-t-t' models. For the first time the Monte Carlo results are presented for U/t larger than the bandwidth 8t, away from half-filling. D-wave and extended S-wave pairing correlations are enhanced. D-wave pairing is stronger at half-filling but this behavior is reversed when the filling decreases. However, none of the eight pairing correlations that were studied increases as a function of lattice size, which makes the existence of long range superconducting order unlikely. (author). 10 refs.; 5 figs

  2. Close-range geophotogrammetric mapping of trench walls using multi-model stereo restitution software

    International Nuclear Information System (INIS)

    Coe, J.A.; Taylor, E.M.; Schilling, S.P.

    1991-01-01

    Methods for mapping geologic features exposed on trench walls have advanced from conventional gridding and sketch mapping to precise close-range photogrammetric mapping. In our study, two strips of small-format (60 x 60) stereo pairs, each containing 42 photos and covering approximately 60 m of nearly vertical trench wall (2-4 m high), were contact printed onto eight 205 x 255-mm transparent film sheets. Each strip was oriented in a Kern DSR15 analytical plotter using the bundle adjustment module of Multi-Model Stereo Restitution Software (MMSRS). We experimented with several systematic-control-point configurations to evaluate orientation accuracies as a function of the number and position of control points. We recommend establishing control-point columns (each containing 2-3 points) in every 5th photo to achieve the 7-mm Root Mean Square Error (RMSE) accuracy required by our trench-mapping project. 7 refs., 8 figs., 1 tab

  3. Close-range geophotogrammetric mapping of trench walls using multi-model stereo restitution software

    Energy Technology Data Exchange (ETDEWEB)

    Coe, J.A.; Taylor, E.M.; Schilling, S.P.

    1991-06-01

    Methods for mapping geologic features exposed on trench walls have advanced from conventional gridding and sketch mapping to precise close-range photogrammetric mapping. In our study, two strips of small-format (60 {times} 60) stereo pairs, each containing 42 photos and covering approximately 60 m of nearly vertical trench wall (2-4 m high), were contact printed onto eight 205 {times} 255-mm transparent film sheets. Each strip was oriented in a Kern DSR15 analytical plotter using the bundle adjustment module of Multi-Model Stereo Restitution Software (MMSRS). We experimented with several systematic-control-point configurations to evaluate orientation accuracies as a function of the number and position of control points. We recommend establishing control-point columns (each containing 2-3 points) in every 5th photo to achieve the 7-mm Root Mean Square Error (RMSE) accuracy required by our trench-mapping project. 7 refs., 8 figs., 1 tab.

  4. Historical, observed, and modeled wildfire severity in montane forests of the Colorado Front Range.

    Science.gov (United States)

    Sherriff, Rosemary L; Platt, Rutherford V; Veblen, Thomas T; Schoennagel, Tania L; Gartner, Meredith H

    2014-01-01

    Large recent fires in the western U.S. have contributed to a perception that fire exclusion has caused an unprecedented occurrence of uncharacteristically severe fires, particularly in lower elevation dry pine forests. In the absence of long-term fire severity records, it is unknown how short-term trends compare to fire severity prior to 20th century fire exclusion. This study compares historical (i.e. pre-1920) fire severity with observed modern fire severity and modeled potential fire behavior across 564,413 ha of montane forests of the Colorado Front Range. We used forest structure and tree-ring fire history to characterize fire severity at 232 sites and then modeled historical fire-severity across the entire study area using biophysical variables. Eighteen (7.8%) sites were characterized by low-severity fires and 214 (92.2%) by mixed-severity fires (i.e. including moderate- or high-severity fires). Difference in area of historical versus observed low-severity fire within nine recent (post-1999) large fire perimeters was greatest in lower montane forests. Only 16% of the study area recorded a shift from historical low severity to a higher potential for crown fire today. An historical fire regime of more frequent and low-severity fires at low elevations (historically and continue to be so today. Thinning treatments at higher elevations of the montane zone will not return the fire regime to an historic low-severity regime, and are of questionable effectiveness in preventing severe wildfires. Based on present-day fuels, predicted fire behavior under extreme fire weather continues to indicate a mixed-severity fire regime throughout most of the montane forest zone. Recent large wildfires in the Front Range are not fundamentally different from similar events that occurred historically under extreme weather conditions.

  5. High Resolution Habitat Suitability Modelling For Restricted-Range Hawaiian Alpine Arthropod Species

    Science.gov (United States)

    Stephenson, N. M.

    2016-12-01

    Mapping potentially suitable habitat is critical for effective species conservation and management but can be challenging in areas exhibiting complex heterogeneity. An approach that combines non-intrusive spatial data collection techniques and field data can lead to a better understanding of landscapes and species distributions. Nysius wekiuicola, commonly known as the wēkiu bug, is the most studied arthropod species endemic to the Maunakea summit in Hawai`i, yet details about its geographic distribution and habitat use remain poorly understood. To predict the geographic distribution of N. wekiuicola, MaxEnt habitat suitability models were generated from a diverse set of input variables, including fifteen years of species occurrence data, high resolution digital elevation models, surface mineralogy maps derived from hyperspectral remote sensing, and climate data. Model results indicate that elevation (78.2 percent), and the presence of nanocrystalline hematite surface minerals (13.7 percent) had the highest influence, with lesser contributions from aspect, slope, and other surface mineral classes. Climatic variables were not included in the final analysis due to auto-correlation and coarse spatial resolution. Biotic factors relating to predation and competition also likely dictate wēkiu bug capture patterns and influence our results. The wēkiu bug range and habitat suitability models generated as a result of this study will be directly incorporated into management and restoration goals for the summit region and can also be adapted for other arthropod species present, leading to a more holistic understanding of metacommunity dynamics. Key words: Microhabitat, Structure from Motion, Lidar, MaxEnt, Habitat Suitability

  6. Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

    NARCIS (Netherlands)

    van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

    2015-01-01

    Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

  7. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  8. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  9. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  10. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  11. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  12. GPS, BDS and Galileo ionospheric correction models: An evaluation in range delay and position domain

    Science.gov (United States)

    Wang, Ningbo; Li, Zishen; Li, Min; Yuan, Yunbin; Huo, Xingliang

    2018-05-01

    The performance of GPS Klobuchar (GPSKlob), BDS Klobuchar (BDSKlob) and NeQuick Galileo (NeQuickG) ionospheric correction models are evaluated in the range delay and position domains over China. The post-processed Klobuchar-style (CODKlob) coefficients provided by the Center for Orbit Determination in Europe (CODE) and our own fitted NeQuick coefficients (NeQuickC) are also included for comparison. In the range delay domain, BDS total electrons contents (TEC) derived from 20 international GNSS Monitoring and Assessment System (iGMAS) stations and GPS TEC obtained from 35 Crust Movement Observation Network of China (CMONC) stations are used as references. Compared to BDS TEC during the short period (doy 010-020, 2015), GPSKlob, BDSKlob and NeQuickG can correct 58.4, 66.7 and 54.7% of the ionospheric delay. Compared to GPS TEC for the long period (doy 001-180, 2015), the three ionospheric models can mitigate the ionospheric delay by 64.8, 65.4 and 68.1%, respectively. For the two comparison cases, CODKlob shows the worst performance, which only reduces 57.9% of the ionospheric range errors. NeQuickC exhibits the best performance, which outperforms GPSKlob, BDSKlob and NeQuickG by 6.7, 2.1 and 6.9%, respectively. In the position domain, single-frequency stand point positioning (SPP) was conducted at the selected 35 CMONC sites using GPS C/A pseudorange with and without ionospheric corrections. The vertical position error of the uncorrected case drops significantly from 10.3 m to 4.8, 4.6, 4.4 and 4.2 m for GPSKlob, CODKlob, BDSKlob and NeQuickG, however, the horizontal position error (3.2) merely decreases to 3.1, 2.7, 2.4 and 2.3 m, respectively. NeQuickG outperforms GPSKlob and BDSKlob by 5.8 and 1.9% in vertical component, and by 25.0 and 3.2% in horizontal component.

  13. Use of medium-range numerical weather prediction model output to produce forecasts of streamflow

    Science.gov (United States)

    Clark, M.P.; Hay, L.E.

    2004-01-01

    This paper examines an archive containing over 40 years of 8-day atmospheric forecasts over the contiguous United States from the NCEP reanalysis project to assess the possibilities for using medium-range numerical weather prediction model output for predictions of streamflow. This analysis shows the biases in the NCEP forecasts to be quite extreme. In many regions, systematic precipitation biases exceed 100% of the mean, with temperature biases exceeding 3??C. In some locations, biases are even higher. The accuracy of NCEP precipitation and 2-m maximum temperature forecasts is computed by interpolating the NCEP model output for each forecast day to the location of each station in the NWS cooperative network and computing the correlation with station observations. Results show that the accuracy of the NCEP forecasts is rather low in many areas of the country. Most apparent is the generally low skill in precipitation forecasts (particularly in July) and low skill in temperature forecasts in the western United States, the eastern seaboard, and the southern tier of states. These results outline a clear need for additional processing of the NCEP Medium-Range Forecast Model (MRF) output before it is used for hydrologic predictions. Techniques of model output statistics (MOS) are used in this paper to downscale the NCEP forecasts to station locations. Forecasted atmospheric variables (e.g., total column precipitable water, 2-m air temperature) are used as predictors in a forward screening multiple linear regression model to improve forecasts of precipitation and temperature for stations in the National Weather Service cooperative network. This procedure effectively removes all systematic biases in the raw NCEP precipitation and temperature forecasts. MOS guidance also results in substantial improvements in the accuracy of maximum and minimum temperature forecasts throughout the country. For precipitation, forecast improvements were less impressive. MOS guidance increases

  14. Solar Flash Sub-Millimeter Wave Range Spectrum Part Radiation Modeling

    Directory of Open Access Journals (Sweden)

    V. Yu. Shustikov

    2015-01-01

    Full Text Available Currently, solar flares are under observation on the RT-7.5 radio telescope of BMSTU. This telescope operates in a little-studied range of the spectrum, at wavelengths of 3.2 and 2.2 mm (93 and 140 GHz, thereby providing unique information about parameters of the chromosphere plasma and zone of the temperature minimum. Observations on various instruments provided relatively small amount of data on the radio emission flare at frequencies close to 93 GHz, and at frequency of 140 GHz such observations were not carried out. For these reasons, data collected from the RT-7.5 radio telescope are of high value (Shustikov et al., 2012.This work describes modeling and gives interpretation of the reason for raising flux density spectrum of sub-millimeter radio frequency emission using as an example the GOES flare of class M 5.3 occurred on 04.07.2012 in the active region 11515. This flare was observed on the RT-7.5 radio telescope of BMSTU and was described by Shustikov et al. (2012 and by Smirnova et al. (2013, where it has been suggested that the reason for raising radio frequency emission is a bremsstrahlung of the thermal electrons in the hot plasma of the solar chromosphere. Rough estimates of the plasma temperature at the flare source were obtained.This paper proposes model calculations of the flux density spectrum of the sub-millimeter radio emission based on the gyrosynchrotron Fleischman-Kuznetsov code (Fleishman & Kuznetsov, 2010. Section 1 briefly describes observational data, tools and processing methods used in the work. Section 2 shows results of modeling the flare radio emission. Section 3 discusses results and conclusions.Numerical modeling the sub-millimeter part of the spectrum of the radio flux density for the GOES flare of class M5.3 has been carried out. This flare occurred in the active region 11515 on 04.07.2012. Modeling was based on the observations on the BMSTU’s RT-7.5 radio telescope.The paper draws conclusion based on the

  15. Modeling Culex tarsalis abundance on the northern Colorado front range using a landscape-level approach.

    Science.gov (United States)

    Schurich, Jessica A; Kumar, Sunil; Eisen, Lars; Moore, Chester G

    2014-03-01

    Remote sensing and Geographic Information System (GIS) data can be used to identify larval mosquito habitats and predict species distribution and abundance across a landscape. An understanding of the landscape features that impact abundance and dispersal can then be applied operationally in mosquito control efforts to reduce the transmission of mosquito-borne pathogens. In an effort to better understand the effects of landscape heterogeneity on the abundance of the West Nile virus (WNV) vector Culex tarsalis, we determined associations between GIS-based environmental data at multiple spatial extents and monthly abundance of adult Cx. tarsalis in Larimer County and Weld County, CO. Mosquito data were collected from Centers for Disease Control and Prevention miniature light traps operated as part of local WNV surveillance efforts. Multiple regression models were developed for prediction of monthly Cx. tarsalis abundance for June, July, and August using 4 years of data collected over 2007-10. The models explained monthly adult mosquito abundance with accuracies ranging from 51-61% in Fort Collins and 57-88% in Loveland-Johnstown. Models derived using landscape-level predictors indicated that adult Cx. tarsalis abundance is negatively correlated with elevation. In this case, low-elevation areas likely more abundantly include habitats for Cx. tarsalis. Model output indicated that the perimeter of larval sites is a significant predictor of Cx. tarsalis abundance at a spatial extent of 500 m in Loveland-Johnstown in all months examined. The contribution of irrigated crops at a spatial extent of 500 m improved model fit in August in both Fort Collins and Loveland-Johnstown. These results emphasize the significance of irrigation and the manual control of water across the landscape to provide viable larval habitats for Cx. tarsalis in the study area. Results from multiple regression models can be applied operationally to identify areas of larval Cx. tarsalis production

  16. PROCESSING OF UAV BASED RANGE IMAGING DATA TO GENERATE DETAILED ELEVATION MODELS OF COMPLEX NATURAL STRUCTURES

    Directory of Open Access Journals (Sweden)

    T. K. Kohoutek

    2012-07-01

    Full Text Available Unmanned Aerial Vehicles (UAVs are more and more used in civil areas like geomatics. Autonomous navigated platforms have a great flexibility in flying and manoeuvring in complex environments to collect remote sensing data. In contrast to standard technologies such as aerial manned platforms (airplanes and helicopters UAVs are able to fly closer to the object and in small-scale areas of high-risk situations such as landslides, volcano and earthquake areas and floodplains. Thus, UAVs are sometimes the only practical alternative in areas where access is difficult and where no manned aircraft is available or even no flight permission is given. Furthermore, compared to terrestrial platforms, UAVs are not limited to specific view directions and could overcome occlusions from trees, houses and terrain structures. Equipped with image sensors and/or laser scanners they are able to provide elevation models, rectified images, textured 3D-models and maps. In this paper we will describe a UAV platform, which can carry a range imaging (RIM camera including power supply and data storage for the detailed mapping and monitoring of complex structures, such as alpine riverbed areas. The UAV platform NEO from Swiss UAV was equipped with the RIM camera CamCube 2.0 by PMD Technologies GmbH to capture the surface structures. Its navigation system includes an autopilot. To validate the UAV-trajectory a 360° prism was installed and tracked by a total station. Within the paper a workflow for the processing of UAV-RIM data is proposed, which is based on the processing of differential GNSS data in combination with the acquired range images. Subsequently, the obtained results for the trajectory are compared and verified with a track of a UAV (Falcon 8, Ascending Technologies carried out with a total station simultaneously to the GNSS data acquisition. The results showed that the UAV's position using differential GNSS could be determined in the centimetre to the decimetre

  17. Computational micromechanics analysis of electron hopping and interfacial damage induced piezoresistive response in carbon nanotube-polymer nanocomposites

    International Nuclear Information System (INIS)

    Chaurasia, A K; Seidel, G D; Ren, X

    2014-01-01

    Carbon nanotube (CNT)-polymer nanocomposites have been observed to exhibit an effective macroscale piezoresistive response, i.e., change in macroscale resistivity when subjected to applied deformation. The macroscale piezoresistive response of CNT-polymer nanocomposites leads to deformation/strain sensing capabilities. It is believed that the nanoscale phenomenon of electron hopping is the major driving force behind the observed macroscale piezoresistivity of such nanocomposites. Additionally, CNT-polymer nanocomposites provide damage sensing capabilities because of local changes in electron hopping pathways at the nanoscale because of initiation/evolution of damage. The primary focus of the current work is to explore the effect of interfacial separation and damage at the nanoscale CNT-polymer interface on the effective macroscale piezoresistive response. Interfacial separation and damage are allowed to evolve at the CNT-polymer interface through coupled electromechanical cohesive zones, within a finite element based computational micromechanics framework, resulting in electron hopping based current density across the separated CNT-polymer interface. The macroscale effective material properties and gauge factors are evaluated using micromechanics techniques based on electrostatic energy equivalence. The impact of the electron hopping mechanism, nanoscale interface separation and damage evolution on the effective nanocomposite electrostatic and piezoresistive response is studied in comparison with the perfectly bonded interface. The effective electrostatic/piezoresistive response for the perfectly bonded interface is obtained based on a computational micromechanics model developed in the authors’ earlier work. It is observed that the macroscale effective gauge factors are highly sensitive to strain induced formation/disruption of electron hopping pathways, interface separation and the initiation/evolution of interfacial damage. (paper)

  18. Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation

    Directory of Open Access Journals (Sweden)

    Gang Wang

    2018-05-01

    Full Text Available As the application of a coal mine Internet of Things (IoT, mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

  19. Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation.

    Science.gov (United States)

    Wang, Gang; Zhao, Zhikai; Ning, Yongjie

    2018-05-28

    As the application of a coal mine Internet of Things (IoT), mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH) is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

  20. Normal social seeking behavior, hypoactivity and reduced exploratory range in a mouse model of Angelman syndrome

    Directory of Open Access Journals (Sweden)

    Reiter Lawrence T

    2011-01-01

    Full Text Available Abstract Background Angelman syndrome (AS is a neurogenetic disorder characterized by severe developmental delay with mental retardation, a generally happy disposition, ataxia and characteristic behaviors such as inappropriate laughter, social-seeking behavior and hyperactivity. The majority of AS cases are due to loss of the maternal copy of the UBE3A gene. Maternal Ube3a deficiency (Ube3am-/p+, as well as complete loss of Ube3a expression (Ube3am-/p-, have been reproduced in the mouse model used here. Results Here we asked if two characteristic AS phenotypes - social-seeking behavior and hyperactivity - are reproduced in the Ube3a deficient mouse model of AS. We quantified social-seeking behavior as time spent in close proximity to a stranger mouse and activity as total time spent moving during exploration, movement speed and total length of the exploratory path. Mice of all three genotypes (Ube3am+/p+, Ube3am-/p+, Ube3am-/p- were tested and found to spend the same amount of time in close proximity to the stranger, indicating that Ube3a deficiency in mice does not result in increased social seeking behavior or social dis-inhibition. Also, Ube3a deficient mice were hypoactive compared to their wild-type littermates as shown by significantly lower levels of activity, slower movement velocities, shorter exploratory paths and a reduced exploratory range. Conclusions Although hyperactivity and social-seeking behavior are characteristic phenotypes of Angelman Syndrome in humans, the Ube3a deficient mouse model does not reproduce these phenotypes in comparison to their wild-type littermates. These phenotypic differences may be explained by differences in the size of the genetic defect as ~70% of AS patients have a deletion that includes several other genes surrounding the UBE3A locus.

  1. Export of earthquake-triggered landslides in active mountain ranges: insights from 2D morphodynamic modelling.

    Science.gov (United States)

    Croissant, Thomas; Lague, Dimitri; Davy, Philippe; Steer, Philippe

    2016-04-01

    In active mountain ranges, large earthquakes (Mw > 5-6) trigger numerous landslides that impact river dynamics. These landslides bring local and sudden sediment piles that will be eroded and transported along the river network causing downstream changes in river geometry, transport capacity and erosion efficiency. The progressive removal of landslide materials has implications for downstream hazards management and also for understanding landscape dynamics at the timescale of the seismic cycle. The export time of landslide-derived sediments after large-magnitude earthquakes has been studied from suspended load measurements but a full understanding of the total process, including the coupling between sediment transfer and channel geometry change, still remains an issue. Note that the transport of small sediment pulses has been studied in the context of river restoration, but the magnitude of sediment pulses generated by landslides may make the problem different. Here, we study the export of large volumes (>106 m3) of sediments with the 2D hydro-morphodynamic model, Eros. This model uses a new hydrodynamic module that resolves a reduced form of the Saint-Venant equations with a particle method. It is coupled with a sediment transport and lateral and vertical erosion model. Eros accounts for the complex retroactions between sediment transport and fluvial geometry, with a stochastic description of the floods experienced by the river. Moreover, it is able to reproduce several features deemed necessary to study the evacuation of large sediment pulses, such as river regime modification (single-thread to multi-thread), river avulsion and aggradation, floods and bank erosion. Using a synthetic and simple topography we first present how granulometry, landslide volume and geometry, channel slope and flood frequency influence 1) the dominance of pulse advection vs. diffusion during its evacuation, 2) the pulse export time and 3) the remaining volume of sediment in the catchment

  2. Costs and returns of producing hops in established tree plantations

    Science.gov (United States)

    Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith. Woeste

    2017-01-01

    This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...

  3. Wireless multi-hop networks with stealing : large buffer asymptotics

    NARCIS (Netherlands)

    Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.

    2010-01-01

    Wireless networks equipped with CSMA are scheduled in a fully distributed manner. A disadvantage of such distributed control in multi-hop networks is the hidden node problem that causes the effect of stealing, in which a downstream node steals the channel from an upstream node with probability p.

  4. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  5. Crossing the Lexicon: Anglicisms in the German Hip Hop Community

    Science.gov (United States)

    Garley, Matthew E.

    2012-01-01

    The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…

  6. Powdery mildew reaction of hop cultivars and USDA germplasm, 2015

    Science.gov (United States)

    This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

  7. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz; Svensson, Tommy; Brandt-Pearce, Maite; Alouini, Mohamed-Slim

    2017-01-01

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking

  8. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  9. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  10. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  11. High Order Differential Frequency Hopping: Design and Analysis

    Directory of Open Access Journals (Sweden)

    Yong Li

    2015-01-01

    Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

  12. Product/Process (P/P) Models For The Defense Waste Processing Facility (DWPF): Model Ranges And Validation Ranges For Future Processing

    Energy Technology Data Exchange (ETDEWEB)

    Jantzen, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Edwards, T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-09-25

    Radioactive high level waste (HLW) at the Savannah River Site (SRS) has successfully been vitrified into borosilicate glass in the Defense Waste Processing Facility (DWPF) since 1996. Vitrification requires stringent product/process (P/P) constraints since the glass cannot be reworked once it is poured into ten foot tall by two foot diameter canisters. A unique “feed forward” statistical process control (SPC) was developed for this control rather than statistical quality control (SQC). In SPC, the feed composition to the DWPF melter is controlled prior to vitrification. In SQC, the glass product would be sampled after it is vitrified. Individual glass property-composition models form the basis for the “feed forward” SPC. The models transform constraints on the melt and glass properties into constraints on the feed composition going to the melter in order to guarantee, at the 95% confidence level, that the feed will be processable and that the durability of the resulting waste form will be acceptable to a geologic repository.

  13. Long-range planning cost model for support of future space missions by the deep space network

    Science.gov (United States)

    Sherif, J. S.; Remer, D. S.; Buchanan, H. R.

    1990-01-01

    A simple model is suggested to do long-range planning cost estimates for Deep Space Network (DSP) support of future space missions. The model estimates total DSN preparation costs and the annual distribution of these costs for long-range budgetary planning. The cost model is based on actual DSN preparation costs from four space missions: Galileo, Voyager (Uranus), Voyager (Neptune), and Magellan. The model was tested against the four projects and gave cost estimates that range from 18 percent above the actual total preparation costs of the projects to 25 percent below. The model was also compared to two other independent projects: Viking and Mariner Jupiter/Saturn (MJS later became Voyager). The model gave cost estimates that range from 2 percent (for Viking) to 10 percent (for MJS) below the actual total preparation costs of these missions.

  14. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  15. Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2016-06-07

    Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

  16. 3D indoor modeling using a hand-held embedded system with multiple laser range scanners

    Science.gov (United States)

    Hu, Shaoxing; Wang, Duhu; Xu, Shike

    2016-10-01

    Accurate three-dimensional perception is a key technology for many engineering applications, including mobile mapping, obstacle detection and virtual reality. In this article, we present a hand-held embedded system designed for constructing 3D representation of structured indoor environments. Different from traditional vehicle-borne mobile mapping methods, the system presented here is capable of efficiently acquiring 3D data while an operator carrying the device traverses through the site. It consists of a simultaneous localization and mapping(SLAM) module, a 3D attitude estimate module and a point cloud processing module. The SLAM is based on a scan matching approach using a modern LIDAR system, and the 3D attitude estimate is generated by a navigation filter using inertial sensors. The hardware comprises three 2D time-flight laser range finders and an inertial measurement unit(IMU). All the sensors are rigidly mounted on a body frame. The algorithms are developed on the frame of robot operating system(ROS). The 3D model is constructed using the point cloud library(PCL). Multiple datasets have shown robust performance of the presented system in indoor scenarios.

  17. Generalized Cauchy model of sea level fluctuations with long-range dependence

    Science.gov (United States)

    Li, Ming; Li, Jia-Yue

    2017-10-01

    This article suggests the contributions with two highlights. One is to propose a novel model of sea level fluctuations (sea level for short), which is called the generalized Cauchy (GC) process. It provides a new outlook for the description of local and global behaviors of sea level from a view of fractal in that the fractal dimension D that measures the local behavior of sea level and the Hurst parameter H which characterizes the global behavior of sea level are independent of each other. The other is to show that sea level appears multi-fractal in both spatial and time. Such a meaning of multi-fractal is new in the sense that a pair of fractal parameters (D, H) of sea level is varying with measurement sites and time. This research exhibits that the ranges of D and H of sea level, in general, are 1 ≤ D sea level, we shall show that H > 0 . 96 for all data records at all measurement sites, implying that strong LRD may be a general phenomenon of sea level. On the other side, regarding with the local behavior, we will reveal that there appears D = 1 or D ≈ 1 for data records at a few stations and at some time, but D > 0 . 96 at most stations and at most time, meaning that sea level may appear highly local irregularity more frequently than weak local one.

  18. Defining the range of pathogens susceptible to Ifitm3 restriction using a knockout mouse model.

    Directory of Open Access Journals (Sweden)

    Aaron R Everitt

    Full Text Available The interferon-inducible transmembrane (IFITM family of proteins has been shown to restrict a broad range of viruses in vitro and in vivo by halting progress through the late endosomal pathway. Further, single nucleotide polymorphisms (SNPs in its sequence have been linked with risk of developing severe influenza virus infections in humans. The number of viruses restricted by this host protein has continued to grow since it was first demonstrated as playing an antiviral role; all of which enter cells via the endosomal pathway. We therefore sought to test the limits of antimicrobial restriction by Ifitm3 using a knockout mouse model. We showed that Ifitm3 does not impact on the restriction or pathogenesis of bacterial (Salmonella typhimurium, Citrobacter rodentium, Mycobacterium tuberculosis or protozoan (Plasmodium berghei pathogens, despite in vitro evidence. However, Ifitm3 is capable of restricting respiratory syncytial virus (RSV in vivo either through directly restricting RSV cell infection, or by exerting a previously uncharacterised function controlling disease pathogenesis. This represents the first demonstration of a virus that enters directly through the plasma membrane, without the need for the endosomal pathway, being restricted by the IFITM family; therefore further defining the role of these antiviral proteins.

  19. Effect of long-range interactions on the phase transition of Axelrod's model

    Science.gov (United States)

    Reia, Sandro M.; Fontanari, José F.

    2016-11-01

    Axelrod's model with F =2 cultural features, where each feature can assume k states drawn from a Poisson distribution of parameter q , exhibits a continuous nonequilibrium phase transition in the square lattice. Here we use extensive Monte Carlo simulations and finite-size scaling to study the critical behavior of the order parameter ρ , which is the fraction of sites that belong to the largest domain of an absorbing configuration averaged over many runs. We find that it vanishes as ρ ˜(qc0-q )β with β ≈0.25 at the critical point qc0≈3.10 and that the exponent that measures the width of the critical region is ν0≈2.1 . In addition, we find that introduction of long-range links by rewiring the nearest-neighbors links of the square lattice with probability p turns the transition discontinuous, with the critical point qcp increasing from 3.1 to 27.17, approximately, as p increases from 0 to 1. The sharpness of the threshold, as measured by the exponent νp≈1 for p >0 , increases with the square root of the number of nodes of the resulting small-world network.

  20. An exclusion process on a tree with constant aggregate hopping rate

    International Nuclear Information System (INIS)

    Mottishaw, Peter; Waclaw, Bartlomiej; Evans, Martin R

    2013-01-01

    We introduce a model of a totally asymmetric simple exclusion process (TASEP) on a tree network where the aggregate hopping rate is constant from level to level. With this choice for hopping rates the model shows the same phase diagram as the one-dimensional case. The potential applications of our model are in the area of distribution networks, where a single large source supplies material to a large number of small sinks via a hierarchical network. We show that mean-field theory (MFT) for our model is identical to that of the one-dimensional TASEP and that this MFT is exact for the TASEP on a tree in the limit of large branching ratio, b (or equivalently large coordination number). We then present an exact solution for the two level tree (or star network) that allows the computation of any correlation function and confirm how mean-field results are recovered as b → ∞. As an example we compute the steady-state current as a function of branching ratio. We present simulation results that confirm these results and indicate that the convergence to MFT with large branching ratio is quite rapid. (paper)

  1. Using a data-constrained model of home range establishment to predict abundance in spatially heterogeneous habitats.

    Directory of Open Access Journals (Sweden)

    Mark C Vanderwel

    Full Text Available Mechanistic modelling approaches that explicitly translate from individual-scale resource selection to the distribution and abundance of a larger population may be better suited to predicting responses to spatially heterogeneous habitat alteration than commonly-used regression models. We developed an individual-based model of home range establishment that, given a mapped distribution of local habitat values, estimates species abundance by simulating the number and position of viable home ranges that can be maintained across a spatially heterogeneous area. We estimated parameters for this model from data on red-backed vole (Myodes gapperi abundances in 31 boreal forest sites in Ontario, Canada. The home range model had considerably more support from these data than both non-spatial regression models based on the same original habitat variables and a mean-abundance null model. It had nearly equivalent support to a non-spatial regression model that, like the home range model, scaled an aggregate measure of habitat value from local associations with habitat resources. The home range and habitat-value regression models gave similar predictions for vole abundance under simulations of light- and moderate-intensity partial forest harvesting, but the home range model predicted lower abundances than the regression model under high-intensity disturbance. Empirical regression-based approaches for predicting species abundance may overlook processes that affect habitat use by individuals, and often extrapolate poorly to novel habitat conditions. Mechanistic home range models that can be parameterized against abundance data from different habitats permit appropriate scaling from individual- to population-level habitat relationships, and can potentially provide better insights into responses to disturbance.

  2. Sensitivity analysis of nacelle lidar free stream wind speed measurements to wind-induction reconstruction model and lidar range configuration

    DEFF Research Database (Denmark)

    Svensson, Elin; Borraccino, Antoine; Meyer Forsting, Alexander Raul

    The sensitivity of nacelle lidar wind speed measurements to wind-induction models and lidar range configurations is studied using experimental data from the Nørrekær Enge (NKE) measurement campaign and simulated lidar data from Reynold-Averaged Navier Stokes (RANS) aerodynamic computational fluid...... the ZDM was configured to measure at five distances. From the configured distances, a large number of range configurations were created and systematically tested to determine the sensitivity of the reconstructed wind speeds to the number of ranges, minimum range and maximum range in the range......) of the fitting residuals. The results demonstrate that it is not possible to use RANS CFD simulated lidar data to determine optimal range configurations for real-time nacelle lidars due to their perfect (unrealistic) representation of the simulated flow field. The recommended range configurations are therefore...

  3. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  4. Piezo activated mode tracking system for widely tunable mode-hop-free external cavity mid-IR semiconductor lasers

    Science.gov (United States)

    Wysocki, Gerard (Inventor); Tittel, Frank K. (Inventor); Curl, Robert F. (Inventor)

    2010-01-01

    A widely tunable, mode-hop-free semiconductor laser operating in the mid-IR comprises a QCL laser chip having an effective QCL cavity length, a diffraction grating defining a grating angle and an external cavity length with respect to said chip, and means for controlling the QCL cavity length, the external cavity length, and the grating angle. The laser of claim 1 wherein said chip may be tuned over a range of frequencies even in the absence of an anti-reflective coating. The diffraction grating is controllably pivotable and translatable relative to said chip and the effective QCL cavity length can be adjusted by varying the injection current to the chip. The laser can be used for high resolution spectroscopic applications and multi species trace-gas detection. Mode-hopping is avoided by controlling the effective QCL cavity length, the external cavity length, and the grating angle so as to replicate a virtual pivot point.

  5. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  6. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  7. 1/J2 corrections to BMN energies from the quantum long range Landau-Lifshitz model

    International Nuclear Information System (INIS)

    Minahan, Joseph A.; Tirziu, Alin; Tseytlin, Arkady A.

    2005-01-01

    In a previous paper [hep-th/0509071], it was shown that quantum 1/J corrections to the BMN spectrum in an effective Landau-Lifshitz (LL) model match with the results from the one-loop gauge theory, provided one chooses an appropriate regularization. In this paper we continue this study for the conjectured Bethe ansatz for the long range spin chain representing perturbative large-N N = 4 Super Yang-Mills in the SU(2) sector, and the 'quantum string' Bethe ansatz for its string dual. The comparison is carried out for corrections to BMN energies up to order λ-tilde 3 in the effective expansion parameter λ-tilde = λ/J 2 . After determining the 'gauge-theory' LL action to order λ-tilde 3 , which is accomplished indirectly by fixing the coefficients in the LL action so that the energies of circular strings match with the energies found using the Bethe ansatz, we find perfect agreement. We interpret this as further support for an underlying integrability of the system. We then consider the 'string-theory' LL action which is a limit of the classical string action representing fast string motion on an S 3 subspace of S 5 and compare the resulting λ-tilde 3 /J 2 corrections to the prediction of the 'string' Bethe ansatz. As in the gauge case, we find precise matching. This indicates that the LL hamiltonian supplemented with a normal ordering prescription and ζ-function regularization reproduces the full superstring result for the 1/J 2 corrections, and also signifies that the string Bethe ansatz does describe the quantum BMN string spectrum to order 1/J 2 . We also comment on using the quantum LL approach to determine the non-analytic contributions in λ that are behind the strong to weak coupling interpolation between the string and gauge results

  8. Prospects for bioenergy use in Ghana using Long-range Energy Alternatives Planning model

    International Nuclear Information System (INIS)

    Kemausuor, Francis; Nygaard, Ivan; Mackenzie, Gordon

    2015-01-01

    As Ghana's economy grows, the choice of future energy paths and policies in the coming years will have a significant influence on its energy security. A Renewable Energy Act approved in 2011 seeks to encourage the influx of renewable energy sources in Ghana's energy mix. The new legal framework combined with increasing demand for energy has created an opportunity for dramatic changes in the way energy is generated in Ghana. However, the impending changes and their implication remain uncertain. This paper examines the extent to which future energy scenarios in Ghana could rely on energy from biomass sources, through the production of biogas, liquid biofuels and electricity. Analysis was based on moderate and high use of bioenergy for transportation, electricity generation and residential fuel using the LEAP (Long-range Energy Alternatives Planning) model. Results obtained indicate that introducing bioenergy to the energy mix could reduce GHG (greenhouse gas) emissions by about 6 million tonnes CO_2e by 2030, equivalent to a 14% reduction in a business-as-usual scenario. This paper advocates the use of second generation ethanol for transport, to the extent that it is economically exploitable. Resorting to first generation ethanol would require the allocation of over 580,000 ha of agricultural land for ethanol production. - Highlights: • This paper examines modern bioenergy contribution to Ghana's future energy mix. • Three scenarios are developed and analysed. • Opportunities exist for modern bioenergy to replace carbon intensive fuels. • Introducing modern bioenergy to the mix could result in a 14% reduction in GHG.

  9. Uncertainties in predicting rice yield by current crop models under a wide range of climatic conditions

    NARCIS (Netherlands)

    Li, T.; Hasegawa, T.; Yin, X.; Zhu, Y.; Boote, K.; Adam, M.; Bregaglio, S.; Buis, S.; Confalonieri, R.; Fumoto, T.; Gaydon, D.; Marcaida III, M.; Nakagawa, H.; Oriol, P.; Ruane, A.C.; Ruget, F.; Singh, B.; Singh, U.; Tang, L.; Yoshida, H.; Zhang, Z.; Bouman, B.

    2015-01-01

    Predicting rice (Oryza sativa) productivity under future climates is important for global food security. Ecophysiological crop models in combination with climate model outputs are commonly used in yield prediction, but uncertainties associated with crop models remain largely unquantified. We

  10. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

    Science.gov (United States)

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-09-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

  11. A Hybrid Finite Element/Helmholtz-Kirchhoff-Integral Model for Shooting Range Sound Prediction

    NARCIS (Netherlands)

    Nijhof, M.J.J.; Eerden, F.J.M. van der

    2013-01-01

    National legislation enforces a limit on the Sound Levels of outdoor military shooting ranges observed in nearby residential areas. These restrictions directly influence the number of shots that may be fired at a specific shooting range, which may conflict with the required/ scheduled training

  12. A No-Arbitrage Fractional Cointegration Model for Futures and Spot Daily Ranges

    DEFF Research Database (Denmark)

    Rossi, Eduardo; Santucci de Magistris, Paolo

    2013-01-01

    The no-arbitrage relation between futures and spot prices implies an analogous relation between futures and spot daily ranges. The long-memory features of the range-based volatility estimators are analyzed, and fractional cointegration is tested in a semi-parametric framework. In particular, the no...

  13. Two-phase 1D+1D model of a DMFC: development and validation on extensive operating conditions range

    Energy Technology Data Exchange (ETDEWEB)

    Casalegno, A.; Marchesi, R.; Parenti, D. [Dipartimento di Energetica, Politecnico di Milano (Italy)

    2008-02-15

    A two-phase 1D+1D model of a direct methanol fuel cell (DMFC) is developed, considering overall mass balance, methanol transport in gas phase through anode diffusion layer, methanol and water crossover. The model is quantitatively validated on an extensive range of operating conditions, 24 polarisation curves. The model accurately reproduces DMFC performance in the validation range and, outside this, it is able to predict values under feasible operating conditions. Finally, the estimations of methanol crossover flux are qualitatively and quantitatively similar to experimental measures and the main local quantities' trends are coherent with results obtained with more complex models. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  14. Range performance calculations using the NVEOL-Georgia Tech Research Institute 0.1- to 100-GHz radar performance model

    Science.gov (United States)

    Rodak, S. P.; Thomas, N. I.

    1983-05-01

    A computer model that can be used to calculate radar range performance at any frequency in the 0.1-to 100-GHz electromagnetic spectrum is described. These different numerical examples are used to demonstrate how to use the radar range performance model. Input/output documentation are included for each case that was run on the MERADCOM CDC 6600 computer at Fort Belvoir, Virginia.

  15. Stochastic Models of Plant Diversity: Application to White Sands Missile Range

    Science.gov (United States)

    2000-02-01

    decades and its models have been well developed. These models fall in the categories: dynamic models and stochastic models. In their book , Modeling...Gelb 1974), and dendro- climatology (Visser and Molenaar 1988). Optimal Estimation An optimal estimator is a computational algorithm that...Evaluation, M.B. Usher, ed., Chapman and Hall, London. Visser, H., and J. Molenaar . 1990. "Estimating Trends in Tree-ring Data." For. Sei. 36(1): 87

  16. A Large-Scale Multi-Hop Localization Algorithm Based on Regularized Extreme Learning for Wireless Networks.

    Science.gov (United States)

    Zheng, Wei; Yan, Xiaoyong; Zhao, Wei; Qian, Chengshan

    2017-12-20

    A novel large-scale multi-hop localization algorithm based on regularized extreme learning is proposed in this paper. The large-scale multi-hop localization problem is formulated as a learning problem. Unlike other similar localization algorithms, the proposed algorithm overcomes the shortcoming of the traditional algorithms which are only applicable to an isotropic network, therefore has a strong adaptability to the complex deployment environment. The proposed algorithm is composed of three stages: data acquisition, modeling and location estimation. In data acquisition stage, the training information between nodes of the given network is collected. In modeling stage, the model among the hop-counts and the physical distances between nodes is constructed using regularized extreme learning. In location estimation stage, each node finds its specific location in a distributed manner. Theoretical analysis and several experiments show that the proposed algorithm can adapt to the different topological environments with low computational cost. Furthermore, high accuracy can be achieved by this method without setting complex parameters.

  17. Energy-Efficient Algorithm for Sensor Networks with Non-Uniform Maximum Transmission Range

    Directory of Open Access Journals (Sweden)

    Yimin Yu

    2011-06-01

    Full Text Available In wireless sensor networks (WSNs, the energy hole problem is a key factor affecting the network lifetime. In a circular multi-hop sensor network (modeled as concentric coronas, the optimal transmission ranges of all coronas can effectively improve network lifetime. In this paper, we investigate WSNs with non-uniform maximum transmission ranges, where sensor nodes deployed in different regions may differ in their maximum transmission range. Then, we propose an Energy-efficient algorithm for Non-uniform Maximum Transmission range (ENMT, which can search approximate optimal transmission ranges of all coronas in order to prolong network lifetime. Furthermore, the simulation results indicate that ENMT performs better than other algorithms.

  18. Parallel deposition, sorting, and reordering methods in the Hybrid Ordered Plasma Simulation (HOPS) code

    International Nuclear Information System (INIS)

    Anderson, D.V.; Shumaker, D.E.

    1993-01-01

    From a computational standpoint, particle simulation calculations for plasmas have not adapted well to the transitions from scalar to vector processing nor from serial to parallel environments. They have suffered from inordinate and excessive accessing of computer memory and have been hobbled by relatively inefficient gather-scatter constructs resulting from the use of indirect indexing. Lastly, the many-to-one mapping characteristic of the deposition phase has made it difficult to perform this in parallel. The authors' code sorts and reorders the particles in a spatial order. This allows them to greatly reduce the memory references, to run in directly indexed vector mode, and to employ domain decomposition to achieve parallelization. In this hybrid simulation the electrons are modeled as a fluid and the field equations solved are obtained from the electron momentum equation together with the pre-Maxwell equations (displacement current neglected). Either zero or finite electron mass can be used in the electron model. The resulting field equations are solved with an iteratively explicit procedure which is thus trivial to parallelize. Likewise, the field interpolations and the particle pushing is simple to parallelize. The deposition, sorting, and reordering phases are less simple and it is for these that the authors present detailed algorithms. They have now successfully tested the parallel version of HOPS in serial mode and it is now being readied for parallel execution on the Cray C-90. They will then port HOPS to a massively parallel computer, in the next year

  19. Predicting muscle forces during the propulsion phase of single leg triple hop test.

    Science.gov (United States)

    Alvim, Felipe Costa; Lucareli, Paulo Roberto Garcia; Menegaldo, Luciano Luporini

    2018-01-01

    Functional biomechanical tests allow the assessment of musculoskeletal system impairments in a simple way. Muscle force synergies associated with movement can provide additional information for diagnosis. However, such forces cannot be directly measured noninvasively. This study aims to estimate muscle activations and forces exerted during the preparation phase of the single leg triple hop test. Two different approaches were tested: static optimization (SO) and computed muscle control (CMC). As an indirect validation, model-estimated muscle activations were compared with surface electromyography (EMG) of selected hip and thigh muscles. Ten physically healthy active women performed a series of jumps, and ground reaction forces, kinematics and EMG data were recorded. An existing OpenSim model with 92 musculotendon actuators was used to estimate muscle forces. Reflective markers data were processed using the OpenSim Inverse Kinematics tool. Residual Reduction Algorithm (RRA) was applied recursively before running the SO and CMC. For both, the same adjusted kinematics were used as inputs. Both approaches presented similar residuals amplitudes. SO showed a closer agreement between the estimated activations and the EMGs of some muscles. Due to inherent EMG methodological limitations, the superiority of SO in relation to CMC can be only hypothesized. It should be confirmed by conducting further studies comparing joint contact forces. The workflow presented in this study can be used to estimate muscle forces during the preparation phase of the single leg triple hop test and allows investigating muscle activation and coordination. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Complex fragments from excited actinide nuclei. A new test of the finite range model

    International Nuclear Information System (INIS)

    Sarantities, D.G.; Bowman, D.R.; Wozniak, G.J.; Charity, R.J.; Liu, Z.H.; McDonald, R.J.; McMahan, M.A.; Moretto, L.G.

    1989-01-01

    Complex fragments ranging in charge from 7 ≤ Z ≤ 45 have been detected in binary coincidence following the reaction of 8.4 MeV/u 232 Th+ 12 C, and are shown to arise from the binary decay of a 244 Cm compound nucleus. This work confirms earlier radiochemical observations of very light fragments in the fission fragment mass distribution, establishes their binary character, and interprets their yield in terms of finite range potential energy barriers. (orig.)

  1. Complex fragments from excited actinide nuclei: A new test of the finite range model

    International Nuclear Information System (INIS)

    Sarantities, D.G.; Bowman, D.R.; Wozniak, G.J.; Charity, R.J.; Liu, Z.H.; McDonald, R.J.; McMahan, M.A.; Moretto, L.G.

    1988-05-01

    Complex fragments ranging in charge from 7≤Z≤45 have been detected in binary coincidence following the reaction of 8.4 MeV/u 232 Th+ 12 C, and are shown to arise from the binary decay of a 244 Cm compound nucleus. This work confirms earlier radiochemical observations of very light fragments in the fission fragment mass distribution, establishes their binary character, and interprets their yield in terms of finite range potential energy barriers. 15 refs., 3 figs

  2. Modelling of thermoelectric generator with heat pipe assist for range extender application

    OpenAIRE

    Brito, F. P.; Martins, Jorge; Gonçalves, L. M.; Sousa, R.

    2011-01-01

    Recent trends towards electrification of vehicles favour the adoption of waste energy recovery into electricity. Battery-only Electric Vehicles (BEV) need a very large energy storage system so the use of a Range Extender (RE) may allow a significant downsizing of these bulky components. The Internal Combustion Engines (ICE) have two major discarded energy fluxes, engine cooling and exhaust gas. In Extended Range Electric Vehicles (EREV) and hybrids the potential for heat conversion into elect...

  3. Mixed quantum-classical equilibrium in global flux surface hopping

    International Nuclear Information System (INIS)

    Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.

    2015-01-01

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

  4. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  5. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  6. Hopping mixed hybrid excitations in multiple composite quantum wire structures

    International Nuclear Information System (INIS)

    Nguyen Ba An; Tran Thai Hoa

    1995-10-01

    A structure consisting of N pairs of inorganic semiconductor and organic quantum wires is considered theoretically. In such an isolated pair of wires, while the intrawire coupling forms Wannier-Mott exciton in an inorganic semiconductor quantum wire and Frenkel exciton in an organic one, the interwire coupling gives rise to hybrid excitons residing within the pair. When N pairs of wires are packed together 2N new mixed hybrid modes appear that are the true elementary excitations and can hop throughout the whole structure. Energies and wave functions of such hopping mixed hybrid excitations are derived analytically in detail accounting for the global interwire coupling and the different polarization configurations. (author). 19 refs

  7. Rend og hop - Vi si´r stop

    DEFF Research Database (Denmark)

    Lund, Ole

    Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere......Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere...

  8. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  9. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  10. Cross-layer optimization of wireless multi-hop networks

    OpenAIRE

    Soldati, Pablo

    2007-01-01

    The interest in wireless communications has grown constantly for the past decades, leading to an enormous number of applications and services embraced by billions of users. In order to meet the increasing demand for mobile Internet access, several high data-rate radio networking technologies have been proposed to offer wide area high-speed wireless communications, eventually replacing fixed (wired) networks for many applications. This thesis considers cross-layer optimization of multi-hop rad...

  11. Nonlinearity, Breaks, and Long-Range Dependence in Time-Series Models

    DEFF Research Database (Denmark)

    Hillebrand, Eric Tobias; Medeiros, Marcelo C.

    We study the simultaneous occurrence of long memory and nonlinear effects, such as parameter changes and threshold effects, in ARMA time series models and apply our modeling framework to daily realized volatility. Asymptotic theory for parameter estimation is developed and two model building...

  12. Organogenic nodule formation in hop: a tool to study morphogenesis in plants with biotechnological and medicinal applications.

    Science.gov (United States)

    Fortes, Ana M; Santos, Filipa; Pais, Maria S

    2010-01-01

    The usage of Humulus lupulus for brewing increased the demand for high-quality plant material. Simultaneously, hop has been used in traditional medicine and recently recognized with anticancer and anti-infective properties. Tissue culture techniques have been reported for a wide range of species, and open the prospect for propagation of disease-free, genetically uniform and massive amounts of plants in vitro. Moreover, the development of large-scale culture methods using bioreactors enables the industrial production of secondary metabolites. Reliable and efficient tissue culture protocol for shoot regeneration through organogenic nodule formation was established for hop. The present review describes the histological, and biochemical changes occurring during this morphogenic process, together with an analysis of transcriptional and metabolic profiles. We also discuss the existence of common molecular factors among three different morphogenic processes: organogenic nodules and somatic embryogenesis, which strictly speaking depend exclusively on intrinsic developmental reprogramming, and legume nitrogen-fixing root nodules, which arises in response to symbiosis. The review of the key factors that participate in hop nodule organogenesis and the comparison with other morphogenic processes may have merit as a study presenting recent advances in complex molecular networks occurring during morphogenesis and together, these provide a rich framework for biotechnology applications.

  13. The effect of neighbourhood definitions on spatio-temporal models of disease outbreaks: Separation distance versus range overlap.

    Science.gov (United States)

    Laffan, Shawn W; Wang, Zhaoyuan; Ward, Michael P

    2011-12-01

    The definition of the spatial relatedness between infectious and susceptible animal groups is a fundamental component of spatio-temporal modelling of disease outbreaks. A common neighbourhood definition for disease spread in wild and feral animal populations is the distance between the centroids of neighbouring group home ranges. This distance can be used to define neighbourhood interactions, and also to describe the probability of successful disease transmission. Key limitations of this approach are (1) that a susceptible neighbour of an infectious group with an overlapping home range - but whose centroid lies outside the home range of an infectious group - will not be considered for disease transmission, and (2) the degree of overlap between the home ranges is not taken into account for those groups with centroids inside the infectious home range. We assessed the impact of both distance-based and range overlap methods of disease transmission on model-predicted disease spread. Range overlap was calculated using home ranges modelled as circles. We used the Sirca geographic automata model, with the population data from a nine-county study area in Texas that we have previously described. For each method we applied 100 model repetitions, each of 100 time steps, to 30 index locations. The results show that the rate of disease spread for the range-overlap method is clearly less than the distance-based method, with median outbreaks modelled using the latter being 1.4-1.45 times larger. However, the two methods show similar overall trends in the area infected, and the range-overlap median (48 and 120 for cattle and pigs, respectively) falls within the 5th-95th percentile range of the distance-based method (0-96 and 0-252 for cattle and pigs, respectively). These differences can be attributed to the calculation of the interaction probabilities in the two methods, with overlap weights generally resulting in lower interaction probabilities. The definition of spatial

  14. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  15. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  16. Nonlinear propagation model for ultrasound hydrophones calibration in the frequency range up to 100 MHz.

    Science.gov (United States)

    Radulescu, E G; Wójcik, J; Lewin, P A; Nowicki, A

    2003-06-01

    To facilitate the implementation and verification of the new ultrasound hydrophone calibration techniques described in the companion paper (somewhere in this issue) a nonlinear propagation model was developed. A brief outline of the theoretical considerations is presented and the model's advantages and disadvantages are discussed. The results of simulations yielding spatial and temporal acoustic pressure amplitude are also presented and compared with those obtained using KZK and Field II models. Excellent agreement between all models is evidenced. The applicability of the model in discrete wideband calibration of hydrophones is documented in the companion paper somewhere in this volume.

  17. Fast and robust wavelet-based dynamic range compression and contrast enhancement model with color restoration

    Science.gov (United States)

    Unaldi, Numan; Asari, Vijayan K.; Rahman, Zia-ur

    2009-05-01

    Recently we proposed a wavelet-based dynamic range compression algorithm to improve the visual quality of digital images captured from high dynamic range scenes with non-uniform lighting conditions. The fast image enhancement algorithm that provides dynamic range compression, while preserving the local contrast and tonal rendition, is also a good candidate for real time video processing applications. Although the colors of the enhanced images produced by the proposed algorithm are consistent with the colors of the original image, the proposed algorithm fails to produce color constant results for some "pathological" scenes that have very strong spectral characteristics in a single band. The linear color restoration process is the main reason for this drawback. Hence, a different approach is required for the final color restoration process. In this paper the latest version of the proposed algorithm, which deals with this issue is presented. The results obtained by applying the algorithm to numerous natural images show strong robustness and high image quality.

  18. Models with short- and long-range interactions: the phase diagram and the reentrant phase

    International Nuclear Information System (INIS)

    Dauxois, Thierry; Lori, Leonardo; Ruffo, Stefano; De Buyl, Pierre

    2010-01-01

    We study the phase diagram of two different Hamiltonians with competing local, nearest-neighbour, and mean-field couplings. The first example corresponds to the HMF Hamiltonian with an additional short-range interaction. The second example is a reduced Hamiltonian for dipolar layered spin structures, with a new feature with respect to the first example: the presence of anisotropies. The two examples are solved in both the canonical and the microcanonical ensemble using a combination of the min–max method with the transfer operator method. The phase diagrams present typical features of systems with long-range interactions: ensemble inequivalence, negative specific heat and temperature jumps. Moreover, for a given range of parameters, we report the signature of phase reentrance. This can also be interpreted as the presence of azeotropy with the creation of two first-order phase transitions with ensemble inequivalence, as one parameter is varied continuously

  19. The 120° Ordered Phase of Triangular Lattice Antiferromagnetic Heisenberg Model with Long Range Couplings

    International Nuclear Information System (INIS)

    Zhan-Hai, Dong

    2009-01-01

    In order to look for the 120° order phase of triangular lattice Heisenberg antiferromagnet with long range couplings, the Hamiltonian is diagonalized with the Bogoliubov transformation within linear spin-wave approximation. It is found that when the long range spin couplings are taken into account, the transformation is valid only for certain regions in the spin coupling parameter space. These regions just correspond to the 120° (or Néel) ordered phase, which is very different from square lattice in terms of shape, size and topological property

  20. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).