range 220-570 mev: Topics by WorldWideScience.org

Sample records for range 220-570 mev

Recoil properties of antimony isotopes produced by the reaction of 570 MeV and 18.2 GeV protons with uranium

CERN Document Server

Hagebø, E

1969-01-01

Using the method of thick target and thick catchers, the ranges and other recoil properties of 13 (12) antimony isotopes between A = 115 and A = 131 (130) have been measured for the reaction of 570 MeV (18·2 GeV) protons with uranium. The kinetic energies T are almost independent of product mass number at 570 MeV but show a strong dependence at 18·2 GeV, the lightest isotopes having only about half the kinetic energy of the heavy ones. \\\\ \\\\The cascade deposition energies for production of antimony isotopes are almost equal at 570 MeV and 18·2 GeV and fit well to straight lines of the form E$^{∗}$ (A, Z) = E$^{∗}$ (A$_{0}$, Z) + b(A − A$_{0}$). Exceptions are the cascade deposition energies for $^{115}$Sb and $^{116}$Sb which seem to be somewhat too high at 18·2 GeV. By comparison with other work it seems that the slope $b$ of these lines is independent of product element, target and of proton irradiation energy above 450 MeV. \\\\ \\\\If we assume at 570 MeV, that the fissioning nucleus is a uranium ...
The reaction np→ pp π- from threshold up to 570 MeV

International Nuclear Information System (INIS)

Daum, M.; Finger, M.; Slunecka, M.; Finger, M. Jr.; Janata, A.; Franz, J.; Heinsius, F.H.; Koenigsmann, K.; Lacker, H.; Schmitt, H.; Schweiger, W.; Sereni, P.

2002-01-01

The reaction np→ppπ - has been studied in a kinematically complete measurement with a large acceptance time-of-flight spectrometer for incident neutron energies between threshold and 570 MeV. The proton-proton invariant mass distributions show a strong enhancement due to the pp( 1 S 0 ) final state interaction. A large anisotropy was found in the pion angular distributions in contrast to the reaction pp→ppπ 0 . At small energies, a large forward/backward asymmetry has been observed. From the measured integrated cross section σ(np→ppπ - ), the isoscalar cross section σ 01 has been extracted. Its energy dependence indicates that mainly partial waves with Sp final states contribute. (orig.)
Spallation of terbium by 170 MeV protons. First part: qualitative study

International Nuclear Information System (INIS)

Olkowsky, J.; Le Pape, M.; Gratot, I.; Cohen, L.

1959-01-01

The products of the reaction Tb+p (170 MeV) have been studied by radiochemical methods. For each element, α, β, γ and X rays have been studied and results compared to literature data. The cross sections will be given in a further work. We observe a new alpha emitter of gadolinium, half-life 7 h, with the following γ-rays: X (43 keV), 220 keV, 340 keV, 550 keV, 720 keV. New γ-rays are given: 155 Tb: 480 keV; 880 keV 146 Eu (38 h): 125 keV; 570 keV 147 Eu: 570 keV 145 Eu: 180 keV. Reprint of a paper published in 'Le journal de physique et le radium', tome 20, N. 5, may 1959, p. 549-556 [fr
Long-term strength of claddings made of E110 in the temperature range of 400-570 degrees C

International Nuclear Information System (INIS)

Kobylyansky, G.; Shamardin, V.; Eremin, S.

2003-01-01

This paper presents the data on the initial stage of the in-sight into the mechanism of long-term strength of spent fuel rod claddings in the temperature range 400-570 0 C and also their comparison with corresponding mechanism of irradiated in the inert environment specimens and unirradiated ones. A set of test results in the temperature range 400-570 0 C of non-irradiated and irradiated in BOR-60 specimens and also of the WWER-1000 fuel element claddings irradiated up to a burnup of 29-47 MWd/kgU is approximated by Larson-Miller parametric dependence in the first approximation that allows the long-term strength data to be extrapolated and interpolated onto the unknown value regions of stress, temperature and time. The time before damage of the fuel element claddings irradiated up to ∼ 29MWd/kgU in the temperature range 540-570 0 C is higher than that of non-irradiated tubular specimens and irradiated ones up to fast neutron fluence (1-2)x10 22 cm -2 (E >0.1 MeV). With temperature decreasing to 673 K, the long-term strength of the claddings irradiated up to ∼ 47 MWd/kgU is lower than it can be expected from the extrapolation of high-temperature data obtained with the irradiated specimens. Now, the bulk of experimental data on the long-term strength of the claddings made of E110 alloy makes it possible to provide only preliminary estimation for the validation of parameters typical of the deviation from the normal operation conditions; emergencies and accidental situations; dry and wet storage and also transportation. The experiments should be continued to accumulate missing data, in particular, tests of fuel element claddings irradiated up to high burnup at temperatures ranging 300-400 0 C and stresses, which are significantly lower than the yield stress
Neutron-proton elastic scattering between 200 and 500 MeV

International Nuclear Information System (INIS)

Clough, A.S.; Gibson, D.R.; Axen, D.

1979-01-01

Measurements over an extensive angular range of the Dsub(t) and P parameters in free neutron-proton elastic scattering at laboratory energies of 220, 325, 425 and 495 MeV are reported. Experimental and analytical details are given. (author)
Positron acceleration to 200 MeV

International Nuclear Information System (INIS)

Leboutet, H.

1983-01-01

220 MeV is the energy that has to be obtained in routine operation. A standard 12m girder with SLED II can give 220 MeV minus a few percent due to not riding at the crest of the wave. In order to have the 200 MeV with only one girder, a klystron at full power all the time would be required - kept brand new. Then, for safety it is necessary to use two klystrons as designated in the SLC design. Having two klystrons gives freedom for the choice of the best arrangement. Since there will be excess rf power, it can be traded against higher gradient, shorter waveguides, larger apertures (lower shunt impedence)
Gamma ray multiplicity study associated at fast fission in Ne + Re at 220 MeV and Ar + Ho at 315 MeV collisions

International Nuclear Information System (INIS)

Martin, V.

1987-11-01

Angular momentum transfer to fission fragments has been studied with the measurement of gamma-ray deexcitation in the 220 MeV Ne + Re and 315 MeV Ar + Ho systems. These reactions lead to the same fusion nucleus with the same excitation energy. The critical angular momentum for fission in the Ne + Re system is close to the angular momentum where the fission barrier of the fusion nucleus vanishes. In the Ar + Ho system, the critical angular momentum is much more larger than the angular momentum and the fast fission process is then expected to occur in that system. The measurement of the widths of the fission fragment mass distribution strengthens this hypothesis: the width is equal to 42 ± 2 u.m.a in the Ne + Re system and 56 ± 4 u.m.a in the Ar + Ho system. The results obtained by measuring the gamma-ray multiplicity associated with the fission modes show that the spin transferred to the fragments is large and confirm the excitation of some collective rotational modes in the exit channel such as bending and wriggling modes. The evolution of the gamma-ray multiplicity as a function of the total kinetic energy shows a marked behaviour in the two systems: in the Ne + Re system, the multiplicity decreases when the kinetic energy increases in the Ar + Ho system the multiplicity increases when the kinetic energy increases. The information extracted from these results show that the mass distribution associated with the fast fission process has a symetric shape, but this information is not sufficient to isolate unambiguously the partial wave domain associated with the conventional fission and the fast fission phenomena, respectively [fr
Recoil proton polarization of neutral pion photoproduction from proton in the energy range between 400 MeV and 1142 MeV

International Nuclear Information System (INIS)

Kato, S.; Miyachi, T.; Sugano, K.; Toshioka, K.; Ukai, K.

1979-08-01

The recoil proton polarization of the reaction γp → π 0 p were measured at a C.M. angle of 100 0 for incident photon energies between 451 and 1106 MeV, and at an angle of 130 0 for energies from 400 MeV to 1142 MeV. One photon decayed from a π 0 -meson and a recoil proton were detected in coincidence. Two kinds of polarization scatterers were employed. In the range of proton kinetic energy less than 420 MeV and higher than 346 MeV, carbon plates and liquid hydrogen were used for determining the polarization. Results are compared with recent phenomenological analyses. From the Comparison between the present data and the asymmetry data given by the polarized target, the contribution of the invariant amplitudes A 3 can be estimated to be small at 100 0 . (author)
Study of the thermal oxidation of titanium and zirconium under argon ion irradiation in the low MeV range (E = 15 MeV)

International Nuclear Information System (INIS)

Do, N.-L.

2012-01-01

We have shown that argon ion irradiation between 1 and 15 MeV produces damage on both titanium and zirconium surfaces, taking the form of accelerated oxidation and/or craterization effects, varying as a function of the projectile energy and the annealing atmosphere (temperature and pressure) simulating the environmental conditions of the fuel/cladding interface of PWR fuel rods. Using AFM, we have shown that the titanium and zirconium surface is attacked under light argon ion bombardment at high temperature (up to 500 C) in weakly oxidizing medium (under rarefied dry air pressure ranging from 5,7 10 -5 Pa to 5 10 -3 Pa) for a fixed fluence of about 5 10 14 ions.cm -2 . We observed the formation of nano-metric craters over the whole titanium surface irradiated between 2 and 9 MeV and the whole zirconium surface irradiated at 4 MeV, the characteristics of which vary depending on the temperature and the pressure. In the case of the Ar/Ti couple, the superficial damage efficiency increases when the projectile energy decreases from 9 to 2 MeV. Moreover, whereas the titanium surface seems to be transparent under the 15-MeV ion beam, the zirconium surface exhibits numerous micrometric craters surrounded by a wide halo. The crater characteristics (size and superficial density) differ significantly from that observed both in the low energy range (keV) where the energy losses are controlled by ballistic collisions (Sn) and in the high energy range (MeV - GeV) where the energy losses are controlled by electronic excitations (Se), which was not completely unexpected in this intermediate energy range for which combined Sn - Se stopping power effects are possibly foreseen. Using XPS associated to ionic sputtering, we have shown that there is an irradiation effect on thermal oxidation of titanium, enhanced under the argon ion beam between 2 and 9 MeV, and that there is also an energy effect on the oxide thickness and stoichiometry. The study conducted using Spectroscopic
Analyses of Alpha-Alpha Elastic Scattering Data in the Energy Range 140 - 280 MeV

Energy Technology Data Exchange (ETDEWEB)

Shehadeh, Zuhair F. [Taif University, Taif (Saudi Arabia)

2017-01-15

The differential and the reaction cross-sections for 4He-4He elastic scattering data have been nicely obtained at four energies ranging from 140 MeV to 280 MeV (lab system), namely, 140, 160, 198 and 280 MeV, by using a new optical potential with a short-range repulsive core. The treatment has been handled relativistically as υ/c > 0.25 for the two lower energies and υ/c > 0.31 for the two higher ones. In addition to explaining the elastic angular distributions, the adopted potentials accounted for the structure that may exist at angles close to 90◦ , especially for the 198 and the 280-MeV incident energies. No renormalization has been used, and all our potential parameters are new. The necessity of including a short-range repulsive potential term in our real nuclear potential part has been demonstrated. Our results contribute to solving a long-standing problem concerning the nature of the alpha-alpha potential. This is very beneficial in explaining unknown alpha-nucleus and nucleus-nucleus relativistic reactions by using the cluster formalism.
Investigation of the neutron-proton-interaction in the energy range from 20 to 50 MEV

International Nuclear Information System (INIS)

Wilczynski, J.

1984-07-01

In the framework of the investigation of the isospin singlet part of the nucleon-nucleon-interaction in the energy range below 100 MeV two experiments were conducted, which were selected by sensitivity calculations. At the Karlsruhe polarized neutron facility POLKA the analyzing powers Asub(y) and Asub(yy) of the elastic n vector-p- and n vector-p vector-scattering were measured in the energy range from 20 to 50 MeV. The results of this epxeriment are compared to older data. In the energy range from 20 to 50 MeV the new data were analyzed together with other selected data of the nucleon-nucleon-system in phase shift analyses. The knowledge of the isospin singlet phase shifts 1 P 1 and 3 D 3 was improved by the new data. (orig./HSI) [de
Measurements of the prompt neutron spectra in 233U, 235U, 239Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252Cf spontaneous fission in the energy range of 0.01-10 MeV

International Nuclear Information System (INIS)

Starostov, B.I.; Semenov, A.F.; Nefedov, V.N.

1978-01-01

The measurement results on the prompt neutron spectra in 233 U, 235 U, 239 Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252 Cf spontaneous fission in the energy range of 0.01-10 MeV are presented. The time-of-flight method was used. The exceeding of the spectra over the Maxwell distributions is observed at E 252 Cf neutron fission spectra. The spectra analysis was performed after normalization of the spectra and corresponding Maxwell distributions for one and the same area. In the range of 0.05-0.22 MeV the yield of 235 U + nsub(t) fission neutrons is approximately 8 and approximately 15 % greater than the yield of 252 Cf and 239 Pu + nsub(t) fission neutrons, respectively. In the range of 0.3-1.2 MeV the yield of 235 U + nsub(t) fission neutrons is 8 % greater than the fission neutron yield in case of 239 Pu + nsub(t) fission. The 235 U + nsub(t) and 233 U + nsub(t) fission neutron spectra do not differ from one another in the 0.05-0.6 MeV range
Range-energy relations and stopping power of water, water vapour and tissue equivalent liquid for α particles over the energy range 0.5 to 8 MeV

International Nuclear Information System (INIS)

Palmer, R.B.J.; Akhavan-Rezayat, Ahmad

1978-01-01

Experimental range-energy relations are presented for alpha particles in water, water vapour and tissue equivalent liquid at energies up to 8 MeV. From these relations differential stopping powers are derived at 0.25 MeV energy intervals. Consideration is given to sources of error in the range-energy measurements and to the uncertainties that these will introduce into the stopping power values. The ratio of the differential stopping power of muscle equivalent liquid to that of water over the energy range 0.5 to 7.5 MeV is discussed in relation to the specific gravity and chemical composition of the muscle equivalent liquid. Theoretical molecular stopping power calculations based upon the Bethe formula are also presented for water. The effect of phase upon the stopping power of water is discussed. The molecular stopping power of water vapour is shown to be significantly higher than that of water for energies below 1.25 MeV and above 2.5 MeV, the ratio of the two stopping powers rising to 1.39 at 0.5 MeV and to 1.13 at 7.0 MeV. Stopping power measurements for other liquids and vapours are compared with the results for water and water vapour and some are observed to have stopping power ratios in the vapour and liquid phases which vary with energy in a similar way to water. It is suggested that there may be several factors contributing to the increased stopping power of liquids. The need for further experimental results on a wider range of liquids is stressed
Gamma-ray astronomy in the medium energy (10-50 MeV) range

International Nuclear Information System (INIS)

Kniffen, D.A.; Bertsch, D.L.; Palmeira, R.A.R.; Rao, K.R.

1977-01-01

Gamma-ray astronomy in the medium energy (10-50 MeV) range can provide unique information with which to study many astrophysical problems. Observations in the 10-50 MeV range provide the cleanest window with which to view the isotropic diffuse component of the radiation and to study the possible cosmological implications of the spectrum. For the study of compact sources, this is the important region between the X-ray sky and the vastly different γ-ray sky seen by SAS-2 and COS-B. To understand the implications of medium energy γ-ray astronomy to the study of the galactic diffuse γ-radiation, the model developed to explain the high energy γ-ray observations of SAS-2 is extended to the medium energy range. This work illustrates the importance of medium energy γ-ray astronomy for studying the electromagnetic component of the galactic cosmic rays. To observe the medium energy component of the intense galactic center γ-ray emission, two balloon flights of a medium energy γ-ray spark chamber telescope were flown in Brazil in 1975. These results indicate the emission is higher than previously thought and above the predictions of the theoretical model
Measurement of Ay(θ) for n+208Pb from 6 to 10 MeV and the neutron-nucleus interaction over the energy range from bound states at -17 MeV up to scattering at 40 MeV

International Nuclear Information System (INIS)

Roberts, M.L.; Felsher, P.D.; Weisel, G.J.; Chen, Z.; Howell, C.R.; Tornow, W.; Walter, R.L.; Horen, D.J.

1991-01-01

High-accuracy measurements of A y (θ) data for elastic scattering and inelastic scattering to the first excited state for n+ 208 Pb have been performed at 6, 7, 8, 9, and 10 MeV. In addition, σ(θ) was measured at 8 MeV. These data provide an important subset for the growing database for the n+ 208 Pb system from bound-state energies to energies above 40 MeV, the limit of the range of interest here. This database has been interpreted via several approaches. First, a conventional Woods-Saxon spherical optical was used to obtain three potential representations for the energy range from 4 to 40 MeV: ''best fits'' at each energy, constant-geometry global fit with linear energy dependences for the potential strengths for the range 4.0--40 MeV, and an extension of the latter model to allow a linear energy dependence on the radii and diffuseness. A preference for a complex spin-orbit interaction was observed in all cases. Second, the dispersion relation was introduced into the spherical optical model to obtain a more ''realistic'' representation. In our approach, the strength and shape of the real potential was modified by calculating the dispersion-relation contributions that originate from the presence of the surface and volume imaginary terms. Two potentials were developed, one based only on the scattering data (from 4.0 to 40 MeV) and another based additionally on single-particle and single-hole information down to a binding energy of 17 MeV. In addition, the σ(θ) and A y (θ) measurements were compared to earlier conventional and dispersion-relation models. One of the latter of these included an l dependence in the absorptive surface term, and we applied this model in the 6- to 10-MeV region to describe all the σ(θ) and the new A y (θ)
NUCLEAR CROSS-SECTION CALCULATIONS IN THE 1 MEV TO 5 GEV RANGE WITH COMBINED SEMI-CLASSICAL AND QUANTUM MECHANICAL MODELS

Energy Technology Data Exchange (ETDEWEB)

Guimaraes, F.B.

2002-03-07

In this work we describe neutron and proton induced reaction cross-sections for iron produced by the codes TNG and CEM95 in the 5 to 300 MeV energy range. TNG calculations cover the 5-90 MeV range, while CEM95 covers the 50-300 MeV high energy range. The two codes show some disagreements in the overlap energy range, both among themselves and with the experimental data, which are presently being addressed. The experimental data used are from NNDC and/or from LA150 NSE references. We also describe some developments for combining TNG and CEM95 into a new code called CETNG (Cascade Exciton TNG).
(p,t) reaction on /sup 12/C, /sup 54/Fe and /sup 208/Pb at 80 MeV. [80 MeV, angular distributions, zerio-range DWBA

Energy Technology Data Exchange (ETDEWEB)

Shepard, J R; Anderson, R E; Kraushaar, J J; Ristinen, R A [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Comfort, J R [Pittsburgh Univ., PA (USA). Dept. of Physics; King, N S.P. [Los Alamos Scientific Lab., NM (USA); Bacher, A; Jacobs, W W [Indiana Univ., Bloomington (USA). Dept. of Physics

1979-06-11

Angular distributions have been measured for the low-lying levels of the residual nuclei for the /sup 12/C, /sup 54/Fe and /sup 208/Pb(p,t) reactions at E/sub p/ = 80 MeV. The shapes of these angular distributions are generally well reproduced by the zero-range distorted-wave Born approximation (DWBA). Enhancement factors extracted from the data show that the DWBA predicts relative strengths consistent with those observed at lower bombarding energies. However, the overall empirical DWBA normalization at E/sub p/ = 80 MeV is observed to be 1/12(1/4) of that required at 40 MeV for /sup 208/Pb(/sup 54/Fe).
Measurement of pair production cross sections in Ge for the 1. 238-3. 548 MeV energy range

Energy Technology Data Exchange (ETDEWEB)

Sharma, R K; Singh, K; Sahota, H S

1985-02-28

Pair production cross sections have been determined for the 1.238-3.548 MeV energy range in germanium (Z = 32) using a Ge(Li) gamma ray detector. The experimental results have been compared with the theoretical cross sections of previous workers. The results of the present measurements agree with the Bethe-Heitler results down to 1.771 MeV. However, at 1.238 MeV the experimental results are higher than all the theories.
33 CFR 334.220 - Chesapeake Bay, south of Tangier Island, Va.; naval firing range.

Science.gov (United States)

2010-07-01

... ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.220 Chesapeake Bay, south of Tangier Island, Va.; naval firing range. (a) The danger zone. Beginning... to latitude 37°45′00″, longitude 76°09′48″; thence to latitude 37°45′00″, longitude 76°08′51″; and...
Calibration of a large multi-element neutron counter in the energy range 85-430 MeV

CERN Document Server

Strong, J A; Esterling, R J; Garvey, J; Green, M G; Harnew, N; Jane, M R; Jobes, M; Mawson, J; McMahon, T; Robertson, A W; Thomas, D H

1978-01-01

Describes the calibration of a large 60 element neutron counter with a threshold of 2.7 MeV equivalent electron energy. The performance of the counter has been measured in the neutron kinetic energy range 8.5-430 MeV using a neutron beam at the CERN Synchrocyclotron. The results obtained for the efficiency as a function of energy are in reasonable agreement with a Monte Carlo calculation. (7 refs).

Deuteron stripping on beryllium target in the 100-2300 MeV energy range

International Nuclear Information System (INIS)

Lecolley, J.F.; Varignon, C.; Durand, D.; Le Brun, C.; Lecolley, F.R.; Lefebvres, F.; Louvel, M.; Thun, J.; Borne, F.; Martinez, E.; Menard, S.; Pras, P.; Boudard, A.; Duchazeaubeneix, J.C.; Durand, J.M.; Frehaut, J.; Hanappe, F.; Ledoux, X.; Legrain, R.; Leray, S.; Milleret, G.; Patin, Y.; Stuttge, L.; Terrien, Y.

1999-01-01

Cross sections for stripping and dissociation of deuterons interacting with Be targets in the 100-2300 MeV energy range have been measured. Comparisons with model calculations suggest a dominant contribution of the stripping process. It is also shown that the deuteron break-up cross section exhibits the same energy dependence as the nucleon-nucleon cross section. (orig.)
48 CFR 503.570 - Advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Advertising. 503.570 Section 503.570 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 503.570 Advertising. ...
24 CFR 570.507 - Reports.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Reports. 570.507 Section 570.507... COMMUNITY FACILITIES COMMUNITY DEVELOPMENT BLOCK GRANTS Grant Administration § 570.507 Reports. (a) Performance and evaluation report—(1) Entitlement grant recipients and HUD-administered small cities...
29 CFR 570.72 - Exemptions.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Exemptions. 570.72 Section 570.72 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR... the Employment of Children Below the Age of 16 § 570.72 Exemptions. (a) Student-learners. The findings...
24 CFR 570.426 - Program income.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Program income. 570.426 Section 570... in Hawaii and Insular Areas Programs § 570.426 Program income. (a) The provisions of § 570.504(b) apply to all program income generated by a specific grant and received prior to grant closeout. (b) If...
29 CFR 570.123 - Agriculture.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Agriculture. 570.123 Section 570.123 Labor Regulations... Provisions of the Fair Labor Standards Act of 1938, as Amended Exemptions § 570.123 Agriculture. (a) Section... agriculture outside of school hours for the school district where such employee is living while he is so...
Andromede project: Surface analysis and modification with probes from hydrogen to nano-particles in the MeV energy range

International Nuclear Information System (INIS)

Eller, Michael J.; Cottereau, Evelyne; Rasser, Bernard; Verzeroli, Elodie; Agnus, Benoit; Gaubert, Gabriel; Donzel, Xavier; Delobbe, Anne; Della-Negra, Serge

2015-01-01

The Andromede project is the center of a multi-disciplinary team which will build a new instrument for surface modification and analysis using the impact of probes from hydrogen to nano-particles (Au 400 +4 ) in the MeV range. For this new instrument a series of atomic, polyatomic, molecular and nano-particle ion beams will be delivered using two ion sources in tandem, a liquid metal ion source and an electron cyclotron resonance source. The delivered ion beams will be accelerated to high energy with a 4 MeV van de Graaff type accelerator. By using a suite of probes in the MeV energy range, ion beam analysis techniques, MeV atomic and cluster secondary ion mass spectrometry can all be performed in one location. A key feature of the instrument is its ability to produce an intense beam for injection into the accelerator. The commissioning of the two sources shows that intense beams from atomic ions to nano-particles can be delivered for subsequent acceleration. The calculations and measurements for the two sources are presented.
THE ORIGIN OF THE COSMIC GAMMA-RAY BACKGROUND IN THE MeV RANGE

International Nuclear Information System (INIS)

Ruiz-Lapuente, Pilar; The, Lih-Sin; Hartmann, Dieter H.; Ajello, Marco; Canal, Ramon; Röpke, Friedrich K.; Ohlmann, Sebastian T.; Hillebrandt, Wolfgang

2016-01-01

There has been much debate about the origin of the diffuse γ-ray background in the MeV range. At lower energies, AGNs and Seyfert galaxies can explain the background, but not above ≃0.3 MeV. Beyond ∼10 MeV blazars appear to account for the flux observed. That leaves an unexplained gap for which different candidates have been proposed, including annihilations of WIMPS. One candidate is Type Ia supernovae (SNe Ia). Early studies concluded that they were able to account for the γ-ray background in the gap, while later work attributed a significantly lower contribution to them. All those estimates were based on SN Ia explosion models that did not reflect the full 3D hydrodynamics of SN Ia explosions. In addition, new measurements obtained since 2010 have provided new, direct estimates of high-z SN Ia rates beyond z ∼ 2. We take into account these new advances to see the predicted contribution to the gamma-ray background. We use here a wide variety of explosion models and a plethora of new measurements of SN Ia rates. SNe Ia still fall short of the observed background. Only for a fit, which would imply ∼150% systematic error in detecting SN Ia events, do the theoretical predictions approach the observed fluxes. This fit is, however, at odds at the highest redshifts with recent SN Ia rate estimates. Other astrophysical sources such as flat-spectrum radio quasars do match the observed flux levels in the MeV regime, while SNe Ia make up to 30%–50% of the observed flux
THE ORIGIN OF THE COSMIC GAMMA-RAY BACKGROUND IN THE MeV RANGE

Energy Technology Data Exchange (ETDEWEB)

Ruiz-Lapuente, Pilar [Instituto de Física Fundamental, Consejo Superior de Investigaciones Científicas, c/. Serrano 121, E-28006, Madrid (Spain); The, Lih-Sin; Hartmann, Dieter H.; Ajello, Marco [Department of Physics and Astronomy, Clemson University, Clemson, SC 29634 (United States); Canal, Ramon [Institut de Ciències del Cosmos (UB-IEEC), c/. Martí i Franqués 1, E-08028, Barcelona (Spain); Röpke, Friedrich K.; Ohlmann, Sebastian T. [Institute of Theoretical Physics and Astrophysics, University of Würzburg, D-97074, Würzburg (Germany); Hillebrandt, Wolfgang [Max-Planck-Institut für Astrophysik, Karl-Schwarzschild-Str. 1, D-85748 Garching bei München (Germany)

2016-04-01

There has been much debate about the origin of the diffuse γ-ray background in the MeV range. At lower energies, AGNs and Seyfert galaxies can explain the background, but not above ≃0.3 MeV. Beyond ∼10 MeV blazars appear to account for the flux observed. That leaves an unexplained gap for which different candidates have been proposed, including annihilations of WIMPS. One candidate is Type Ia supernovae (SNe Ia). Early studies concluded that they were able to account for the γ-ray background in the gap, while later work attributed a significantly lower contribution to them. All those estimates were based on SN Ia explosion models that did not reflect the full 3D hydrodynamics of SN Ia explosions. In addition, new measurements obtained since 2010 have provided new, direct estimates of high-z SN Ia rates beyond z ∼ 2. We take into account these new advances to see the predicted contribution to the gamma-ray background. We use here a wide variety of explosion models and a plethora of new measurements of SN Ia rates. SNe Ia still fall short of the observed background. Only for a fit, which would imply ∼150% systematic error in detecting SN Ia events, do the theoretical predictions approach the observed fluxes. This fit is, however, at odds at the highest redshifts with recent SN Ia rate estimates. Other astrophysical sources such as flat-spectrum radio quasars do match the observed flux levels in the MeV regime, while SNe Ia make up to 30%–50% of the observed flux.
Theoretical study of cylindrical energy analyzers for MeV range heavy ion beam probes

International Nuclear Information System (INIS)

Fujisawa, A.; Hamada, Y.

1993-07-01

A cylindrical energy analyzer with drift spaces is shown to have a second order focusing for beam incident angle when the deflection angle is properly chosen. The analyzer has a possibility to be applied to MeV range heavy ion beam probes, and will be also available for accurate particle energy measurements in many other fields. (author)
Calculational methods used to obtain evaluated data above 3 MeV

International Nuclear Information System (INIS)

Arthur, E.D.

1980-01-01

Calculational methods used to provide evaluated neutron data for nuclei between A = 19 and 220 at incident energies above several MeV range from empirical techniques based on cross-section systematics to sophisticated nuclear-model codes that describe the major mechanisms governing neutron reactions in this mass and energy range. Examples of empirical approaches are given along with discussion concerning regions of applicability and accuracies that can be expected. The application of more sophisticated nuclear models (Hauser-Feshbach statistical, preequilibrium, and direct-reaction theories) is discussed, particularly with regard to improved parameter determinations that can be used in such calculations. Efforts to improve the consistency and to unify these theoretical approaches are addressed along with benefits to evaluated data that can be realized through careful application of such nuclear-model techniques. 76 references, 13 figures, 3 tables
Neutron radiative capture by the 241Am nucleus in the energy range 1 keV-20 MeV

International Nuclear Information System (INIS)

Zolotarev, K.I.; Ignatyuk, A.V.; Tolstikov, V.A.; Tertychnyj, G.Ya.

1998-01-01

Production of high actinides leads to many technological problems in the nuclear power. The 241 Am(n,γ) 242 Am reaction is one of the sources of high actinide buildup. So a knowledge of the radiative capture cross-section of 241 Am for neutron energies up to 20 MeV is of considerable important for present day fission reactors and future advanced reactors. The main goal of this paper is the evaluation of the excitation function for the reaction 241 Am(n,γ) 242 Am in the energy range 1 keV-20 MeV. The evaluation was done on the basis of analysed experimental data, data from theoretical model calculations and systematic predictions for 14.5 MeV and 20 MeV. Data from the present evaluation are compared with the cross-section values given in the evaluations carried out earlier. (author)
48 CFR 570.106 - Publicizing/Advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Publicizing/Advertising. 570.106 Section 570.106 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION SPECIAL CONTRACTING PROGRAMS ACQUIRING LEASEHOLD INTERESTS IN REAL PROPERTY General 570.106 Publicizing/Advertising...
Excitation Potentials and Shell Corrections for the Elements Z2=20 to Z2=30

DEFF Research Database (Denmark)

Andersen, H.H.; Sørensen, H.; Vadja, P.

1969-01-01

Excitation potentials and shell corrections for the elements Z 2=20 to Z2=30 are evaluated from experimental stopping-power data for 5-12-MeV protons and deuterons. Use is made of Walske's K- and L-shell corrections and shell corrections calculated by Bonderup (1967) on the basis of the Thomas-Fe...... are found by means of Bonderup's shell corrections. Within the Z2 interval treated here, it is found that I/Z2 increases with increasing Z2, contrary to the general trend through the periodic system of elements......Excitation potentials and shell corrections for the elements Z 2=20 to Z2=30 are evaluated from experimental stopping-power data for 5-12-MeV protons and deuterons. Use is made of Walske's K- and L-shell corrections and shell corrections calculated by Bonderup (1967) on the basis of the Thomas...
49 CFR 570.8 - Suspension systems.

Science.gov (United States)

2010-10-01

... 49 Transportation 6 2010-10-01 2010-10-01 false Suspension systems. 570.8 Section 570.8 Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... Pounds or Less § 570.8 Suspension systems. (a) Suspension condition. Ball joint seals shall not be cut or...
49 CFR 570.61 - Suspension system.

Science.gov (United States)

2010-10-01

... 49 Transportation 6 2010-10-01 2010-10-01 false Suspension system. 570.61 Section 570.61... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION VEHICLE IN USE INSPECTION STANDARDS Vehicles With GVWR of More Than 10,000 Pounds § 570.61 Suspension system. (a) Suspension condition. Ball joint seals shall not be cut...
24 CFR 570.504 - Program income.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Program income. 570.504 Section 570... income. (a) Recording program income. The receipt and expenditure of program income as defined in § 570... of program income received by recipients. (1) Program income received before grant closeout may be...
28 CFR 570.21 - Time-frames.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Time-frames. 570.21 Section 570.21... PROGRAMS Pre-Release Community Confinement § 570.21 Time-frames. (a) Community confinement. Inmates may be... inmate's term of imprisonment or six months. (c) Exceeding time-frames. These time-frames may be exceeded...
Commercial cyclotrons. Part I: Commercial cyclotrons in the energy range 10 30 MeV for isotope production

Science.gov (United States)

Papash, A. I.; Alenitsky, Yu. G.

2008-07-01

A survey of commercial cyclotrons for production of medical and industrial isotopes is presented. Compact isochronous cyclotrons which accelerate negative hydrogen ions in the energy range 10 30 MeV have been widely used over the last 25 years for production of medical isotopes and other applications. Different cyclotron models for the energy range 10 12 MeV with moderate beam intensity are used for production of 11C, 13N, 15O, and 18F isotopes widely applied in positron emission tomography. Commercial cyclotrons with high beam intensity are available on the market for production of most medical and industrial isotopes. In this work, the physical and technical parameters of different models are compared. Possibilities of improving performance and increasing intensity of H- beams up to 2 3 mA are discussed.
49 CFR 570.7 - Steering systems.

Science.gov (United States)

2010-10-01

... 49 Transportation 6 2010-10-01 2010-10-01 false Steering systems. 570.7 Section 570.7... Pounds or Less § 570.7 Steering systems. (a) System play. Lash or free play in the steering system shall... in the steering system. Table 1—Steering System Free Play Values Steering wheel diameter (inches...

The design and construction of a scintillation pair spectrometer for the detection of {gamma}-rays in the energy range 2-20 MeV; Realisation d'un spectrometre a scintillations et a paires pour la detection des rayonnements {gamma} d'energie comprise entre 2 et 20 MeV

Energy Technology Data Exchange (ETDEWEB)

Longequeue, J P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1958-07-15

The scintillation pair spectrometer is designed to allow the measurement of the energy of {gamma} rays in the range 2 to 20 MeV. Such an instrument is chosen because of its main features: high energy resolution and ease of working. Against this, however, the efficiency is low. It was possible to tolerate this low efficiency because of the facts that the {gamma}-rays studied emanated from (p, {gamma}) reactions and that the two electrostatic acceleration available could provide beams of 500 {mu}A having energy maxima at 300 and 600 keV. We used the {gamma} rays produced by the reactions {sup 23}Na (p, {gamma}) {sup 24}Mg, {sup 19}F (p, {alpha} {gamma}) {sup 16}O and {sup 7}Li (p, {gamma}) {sup 8}Be as well as the {gamma} rays emitted by sources of RTh and of {sup 24}Na. Under these conditions the spectrometer attained a resolving power of 6,5 {+-} 0,5 per cent at 6,1 MeV and it was able to separate the 14,8 and 17,6 MeV lines produced by the reaction {sup 7}Li (p, {gamma}) {sup 8}Be. As well as this, the efficiency which varied from 2.10{sup -4} to 1,7.10{sup -3} between 2 and 20 MeV was well above the efficiencies already obtained with this type of instrument. (author) [French] Le spectrometre a scintillations et a paires presente dans cette these a pour but de mesurer l'energie des rayonnements {gamma} dans la bande de 2 a 20 MeV. Le choix d'un tel appareil est du a ses caracteristiques essentielles: bonne resolution en energie et maniabilite. Par contre, son efficacite est faible. Nous avons pu tolerer cette faible efficacite car les rayonnements {gamma} que nous avons etudies provenaient de reactions (p, {gamma}) et les deux accelerateurs electrostatiques dont nous disposions pouvaient fournir des faisceaux de 500 {mu}A avec des energies maximum de 300 et 600 keV. Nous avons utilise les rayonnements {gamma} produits par les reactions {sup 23}Na (p, {gamma}) {sup 24}Mg, {sup 19}F (p, {alpha} {gamma}) {sup 16}O et {sup 7}Li (p, {gamma}) {sup 8}Be ainsi que les
49 CFR 570.10 - Wheel assemblies.

Science.gov (United States)

2010-10-01

... bead through one full wheel revolution and note runout in excess of one-eighth of an inch. (c) Mounting... 49 Transportation 6 2010-10-01 2010-10-01 false Wheel assemblies. 570.10 Section 570.10... Pounds or Less § 570.10 Wheel assemblies. (a) Wheel integrity. A tire rim, wheel disc, or spider shall...
The H(n,n) cross section in the 20 MeV to 350 MeV range

International Nuclear Information System (INIS)

1997-01-01

The differential H(n,n) cross section has been used as a standard relative to which other neutron emission cross sections, e.g., elastic or inelastic scattering, have been measured in several Mev region and these measured values are compared with the VL40 solution of R. Arndt, and R.L. Workman, Nuclear Data Standards for Nuclear Measurements, H. Conde (ed.). NEANDC-311, INDC (SEC)-101, 1992, p. 17. For hydrogen, the differential elastic scattering cross section can be directly related to the total cross section, since no other channels of importance are open below the pion production threshold at about 280 MeV (the capture and Bremsstrahlung cross section are very small). 16 refs, 3 figs
Stopping power of liquid water for carbon ions in the energy range between 1 MeV and 6 MeV

International Nuclear Information System (INIS)

Rahm, J M; Baek, W Y; Rabus, H; Hofsäss, H

2014-01-01

The stopping power of liquid water was measured for the first time for carbon ions in the energy range between 1 and 6 MeV using the inverted Doppler shift attenuation method. The feasibility study carried out within the scope of the present work shows that this method is well suited for the quantification of the controversial condensed phased effect in the stopping power for heavy ions in the intermediate energy range. The preliminary results of this work indicate that the stopping power of water for carbon ions with energies prevailing in the Bragg-peak region is significantly lower than that of water vapor. In view of the relatively high uncertainty of the present results, a new experiment with uncertainties less than the predicted difference between the stopping powers of both water phases is planned. (paper)
48 CFR 570.402-2 - Publicizing/Advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Publicizing/Advertising. 570.402-2 Section 570.402-2 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION... for Continued Space Requirements 570.402-2 Publicizing/Advertising. Publish a notice if required by...
Characterization of 2 MeV, 4 MeV, 6 MeV and 18 MeV buildup caps for use with a 0.6 cubic centimeter thimble ionization chamber

International Nuclear Information System (INIS)

Salyer, R.L.; VanDenburg, J.W.; Prinja, A.K.; Kirby, T.; Busch, R.; Hong-Nian Jow

1996-07-01

The purpose of this research is to characterize existing 2 MeV, 4 MeV and 6 MeV buildup caps, and to determine if a buildup cap can be made for the 0.6 cm 3 thimble ionization chamber that will accurately measure exposures in a high-energy photon radiation field. Two different radiation transport codes were used to computationally characterize existing 2 MeV, 4 MeV, and 6 MeV buildup caps for a 0.6 cm 3 active volume thimble ionization chamber: ITS, The Integrated TIGER Series of Coupled Electron-Photon Monte Carlo Transport Codes; and CEPXS/ONEDANT, A One-Dimensional Coupled Electron-Photon Discrete Ordinates Code Package. These codes were also used to determine the design characteristics of a buildup cap for use in the 18 MeV photon beam produced by the 14 TW pulsed power HERMES-III electron accelerator. The maximum range of the secondary electron, the depth at which maximum dose occurs, and the point where dose and collision kerma are equal have been determined to establish the validity of electronic equilibrium. The ionization chamber with the appropriate buildup cap was then subjected to a 4 MeV and a 6 MeV bremmstrahlung radiation spectrum to determine the detector response
Results of TGE Study in 0.03-10 MeV Energy Range in Ground Experiments near Moscow and Aragats

International Nuclear Information System (INIS)

Bogomolov, V.; Kovalenko, A.; Panasyuk, M.; Saleev, K.; Svertilov, S.; Maximov, I.; Garipov, G.; Iyudin, A.; Chilingarian, A.; Hovsepyan, G.; Karapetyan, T.; Mntasakanyan, E.

2017-01-01

Ground-based experiments with scintillator gamma-spectrometers were conducted to study the spectral, temporal and spatial characteristics of TGES as well, as to search the fast hard X-ray and gamma-ray flashes possibly appearing at the moment of lightning. The time of each gamma-quantum interaction was recorded with ∼15 us accuracy together with detailed spectral data. The measurements are similar to ones reported at TEPA-2015 but some important improvement of the instruments was done for 2016 season. First, GPS module was used to synchronize the instrument time with UTC. The accuracy of such synchronization allows one to look at the gamma-ray data at the moment of lightning fixed by radio-wave detector or any other instrument. Second, the energy range of gamma-spectrometers was shifted to higher energies where the radiation of natural isotopes is absent. In this case one can see background changes connected with particles accelerated in thundercloud together with the background increases during the rain caused by Rn-222 daughters. Long-term measurements with two instruments placed in different points of Moscow region were done in 2016 season. First one based on CsI (Tl) 80x80 mm has energy range 0.03-6 MeV. The range of the second one based on CsI (Tl) 100x100 mm is 0.05-10 MeV. A dozen of thunderstorms with increase of Rn-222 radiation were detected but no significant increase of gamma-ray flux above 3.2 MeV was observed at these periods. A lot of data was obtained from the experiment with small gamma-ray spectrometer (40x40 mm NaI (T1) at mountain altitude in Armenia at Aragats station. The analysis of readings during the TGE periods indicates on the presence of Rn-222 radiation in low-energy range (E< l MeV). The detector was improved during TEPA-2016. New 50x50 mm NaI (Tl) crystal was used and the energy range was prolonged up to 5 MeV. Exact timing with GPS-sensor was added and fast recording of the output signal at the moments of triggers from UV flash
First measurement of the VESUVIO neutron spectrum in the 30-80 MeV energy range using a Proton Recoil Telescope technique

Science.gov (United States)

Cazzaniga, C.; Tardocchi, M.; Croci, G.; Frost, C.; Giacomelli, L.; Grosso, G.; Hjalmarsson, A.; Rebai, M.; Rhodes, N. J.; Schooneveld, E. M.; Gorini, G.

2013-11-01

Measurements of the fast neutron energy spectrum at the ISIS spallation source are reported. The measurements were performed with a Proton Recoil Telescope consisting of a thin plastic foil placed in the neutron beam and two scintillator detectors. Results in the neutron energy range 30 MeV < En < 80 MeV are in good agreement with Monte Carlo simulations of the neutron spectrum.
Model calculation of neutron reaction data for 31P in the energy range from 0.1 to 20 MeV

International Nuclear Information System (INIS)

Li Jiangting; Ge Zhigang; Sun Xiuquan

2006-01-01

The neutron data calculation of 31 P in the energy range from 0.1 to 20 MeV was carried out. The neutron optical potential parameters for 31 P in energy range from O.1 to 20 MeV were obtained, based on the fitting of the available neutron experimental data with the code APOM94. The DWUCK4 code was used to investigate the cross section for neutron direct inelastic scattering. The re-evaluated neutron data is based on the available measured data by using the UNF code. The theoretical results reproduce the experimental data well, and the results were given in ENDF/B-6 format. (authors)
Measurement of charge- and mass-changing cross sections for 4He+12C collisions in the energy range 80-220 MeV/u for applications in ion beam therapy

Science.gov (United States)

Horst, Felix; Schuy, Christoph; Weber, Uli; Brinkmann, Kai-Thomas; Zink, Klemens

2017-08-01

4He ions are considered to be used for hadron radiotherapy due to their favorable physical and radiobiological properties. For an accurate dose calculation the fragmentation of the primary 4He ions occurring as a result of nuclear collisions must be taken into account. Therefore precise nuclear reaction models need to be implemented in the radiation transport codes used for dose calculation. A fragmentation experiment using thin graphite targets was conducted at the Heidelberg Ion Beam Therapy Center (HIT) to obtain new and precise 4He-nucleus cross section data in the clinically relevant energy range. Measured values for the charge-changing cross section, mass-changing cross section, as well as the inclusive 3He production cross section for 4He+12C collisions at energies between 80 and 220 MeV /u are presented. These data are compared to the 4He-nucleus reaction model by DeVries and Peng as well as to the parametrizations by Tripathi et al. and by Cucinotta et al., which are implemented in the treatment planning code trip98 and several other radiation transport codes.
48 CFR 803.570 - Commercial advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Commercial advertising. 803.570 Section 803.570 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS GENERAL... Commercial advertising. ...
29 CFR 570.128 - Good faith defense.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Good faith defense. 570.128 Section 570.128 Labor... Provisions of the Fair Labor Standards Act of 1938, as Amended Enforcement § 570.128 Good faith defense. Link... commerce goods which he acquired in good faith in reliance on written assurance from the producer...
29 CFR 570.50 - General.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false General. 570.50 Section 570.50 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS... by the Bureau of Apprenticeship and Training of the United States Department of Labor as employed in...
48 CFR 1403.570 - Restrictions on contractor advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Restrictions on contractor advertising. 1403.570 Section 1403.570 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR... 1403.570 Restrictions on contractor advertising. ...
Measurement of double differential cross sections of secondary neutrons in the incident energy range 9-13 MeV

International Nuclear Information System (INIS)

Tang Hongqing; Qi Bujia; Zhou Zuying; Sa Jun; Ke Zunjian; Sui Qingchang; Xia Haihong; Shen Guanren

1992-01-01

The status and technique of double differential cross section measurement of secondary neutrons in the incident neutron energy range 9 to 13 MeV is reviewed with emphasis on the work done at CIAE. There are scarce measurements of secondary neutron double differential cross sections in this energy region up to now. A main difficulty for this is lack of an applicable monoenergetic neutron source. When monoenergetic neutron energy reaches 8 Me/v, the break-up neutrons from the d + D or p + T reaction starts to become significant. It is difficult to get a pure secondary neutron spectrum induced only by monoenergetic neutrons. To solve this problem an abnormal fast neutron TOF facility was designed and tested. Double differential neutron emission cross sections of 238 U and 209 Bi at 10 MeV were obtained by combining the data measured by both normal and abnormal TOF spectrometers and a good agreement between measurement and calculation was achieved
48 CFR 536.570-8 - Specifications and drawings.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Specifications and drawings. 536.570-8 Section 536.570-8 Federal Acquisition Regulations System GENERAL SERVICES... 536.570-8 Specifications and drawings. Insert the clause at 552.236-77, Specifications and Drawings...
First measurement of the VESUVIO neutron spectrum in the 30–80 MeV energy range using a Proton Recoil Telescope technique

International Nuclear Information System (INIS)

Cazzaniga, C; Tardocchi, M; Croci, G; Grosso, G; Rebai, M; Gorini, G; Frost, C; Rhodes, N J; Schooneveld, E M; Giacomelli, L; Hjalmarsson, A

2013-01-01

Measurements of the fast neutron energy spectrum at the ISIS spallation source are reported. The measurements were performed with a Proton Recoil Telescope consisting of a thin plastic foil placed in the neutron beam and two scintillator detectors. Results in the neutron energy range 30 MeV n < 80 MeV are in good agreement with Monte Carlo simulations of the neutron spectrum
48 CFR 223.570 - Drug-free work force.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Drug-free work force. 223.570 Section 223.570 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM... TECHNOLOGIES, OCCUPATIONAL SAFETY, AND DRUG-FREE WORKPLACE Drug-Free Workplace 223.570 Drug-free work force. ...
Model calculation of neutron reaction data for {sup 31}P in the energy range from 0.1 to 20 MeV

Energy Technology Data Exchange (ETDEWEB)

Jiangting, Li [Physics Department, Northwest Univ., Xi' an (China); Zhigang, Ge [China Nuclear Data Center, China Inst. of Atomic Energy, Beijing (China); Xiuquan, Sun [Engineering and Technology Department, Shenzhen University, Shenzhen (China)

2006-07-15

The neutron data calculation of {sup 31}P in the energy range from 0.1 to 20 MeV was carried out. The neutron optical potential parameters for {sup 31}P in energy range from O.1 to 20 MeV were obtained, based on the fitting of the available neutron experimental data with the code APOM94. The DWUCK4 code was used to investigate the cross section for neutron direct inelastic scattering. The re-evaluated neutron data is based on the available measured data by using the UNF code. The theoretical results reproduce the experimental data well, and the results were given in ENDF/B-6 format. (authors)
Extension of the energy range of experimental activation cross-sections data of deuteron induced nuclear reactions on indium up to 50MeV.

Science.gov (United States)

Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V

2015-11-01

The energy range of our earlier measured activation cross-sections data of longer-lived products of deuteron induced nuclear reactions on indium were extended from 40MeV up to 50MeV. The traditional stacked foil irradiation technique and non-destructive gamma spectrometry were used. No experimental data were found in literature for this higher energy range. Experimental cross-sections for the formation of the radionuclides (113,110)Sn, (116m,115m,114m,113m,111,110g,109)In and (115)Cd are reported in the 37-50MeV energy range, for production of (110)Sn and (110g,109)In these are the first measurements ever. The experimental data were compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS 1.6 nuclear model code as listed in the on-line library TENDL-2014. Copyright © 2015 Elsevier Ltd. All rights reserved.

28 CFR 570.45 - Violation of escorted trip.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Violation of escorted trip. 570.45 Section 570.45 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE COMMUNITY PROGRAMS Escorted Trips § 570.45 Violation of escorted trip. (a) Staff shall process as...
48 CFR 570.105-1 - Contracting by negotiation.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contracting by negotiation. 570.105-1 Section 570.105-1 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION SPECIAL CONTRACTING PROGRAMS ACQUIRING LEASEHOLD INTERESTS IN REAL PROPERTY General 570.105-1 Contracting by negotiation. Contracting by negotiation...
29 CFR 570.12 - Revoked certificates of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Revoked certificates of age. 570.12 Section 570.12 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of Age § 570.12 Revoked certificates of age...
48 CFR 2009.570 - NRC organizational conflicts of interest.

Science.gov (United States)

2010-10-01

... conflicts of interest. 2009.570 Section 2009.570 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION COMPETITION AND ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570 NRC organizational conflicts of interest. ...
VizieR Online Data Catalog: Spectrum of VY CMa in 220.65-224.25GHz range (Kaminski+, 2013)

Science.gov (United States)

Kaminski, T.; Gottlieb, C. A.; Menten, K. M.; Patel, N. A.; Young, K. H.; Brunken, S.; Muller, H. S. P.; McCarthy, M. C.; Winters, J. M.; Decin, L.

2013-02-01

A spectrum of VY Canis Majoris obtained with the Plateau de Bure Interferometer on 22 April and 13 October 2012 in the frequency range 220.65-224.25GHz. The interferometer was used in its D configuration with six antennas and the synthesized beam was 4.9x2.2-arcsec. The spectrum was extracted from the central pixel of the map obtained with the gridding of 0.65-arcsec. (2 data files).
Measurement of cross sections for the scattering of neutrons in the energy range from 2 MeV to 4 MeV with the 15N(p,n) reaction as neutron source

International Nuclear Information System (INIS)

Poenitz, Erik

2010-01-01

In future nuclear facilities, the materials lead and bismuth can play a more important role than in today's nuclear reactors. Reliable cross section data are required for the design of those facilities. In particular the neutron transport in the lead spallation target of an Accelerator-Driven Subcritical Reactor strongly depends on the inelastic neutron scattering cross sections in the energy region from 0.5 MeV to 6 MeV. In the recent 20 years, elastic and inelastic neutron scattering cross sections were measured with high precision for a variety of elements at the PTB time-of-flight spectrometer. The D(d,n) reaction was primarily used for the production of neutrons. Because of the Q value of the reaction and the available deuteron energies, neutrons in the energy range from 6 MeV to 16 MeV can be produced. For the cross section measurement at lower energies, however, another neutron producing reaction is required. The 15 N(p,n) 15 O reaction was chosen, as it allows the production of monoenergetic neutrons with up to 5.7MeV energy. In this work, the 15 N(p,n) reaction was studied with focus on the suitability as a source for monoenergetic neutrons in scattering experiments. This includes the measurement of differential cross sections for the neutron producing reaction and the choice of optimum target conditions. Differential elastic and inelastic neutron scattering cross sections were measured for lead at four energies in the region from 2 MeV to 4 MeV incident neutron energy using the time-of-flight technique. A lead sample with natural isotopic composition was used. NE213 liquid scintillation detectors with well-known detection efficiencies were used for the detection of the scattered neutrons. Angle-integrated cross sections were determined by a Legendre polynomial expansion using least-squares methods. Additionally, measurements were carried out for isotopically pure 209 Bi and 181 Ta samples at 4 MeV incident neutron energy. Results are compared with other
7 CFR 3560.570 - Construction financing.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Construction financing. 3560.570 Section 3560.570 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF... financing. The requirements established in § 3560.71 apply to all applications involving off-farm labor...
48 CFR 536.570-11 - Heat.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Heat. 536.570-11 Section... OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-11 Heat. Insert the clause at 552.236-80, Heat, in solicitations and contracts if construction, dismantling...
29 CFR 570.126 - Parental exemption.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Parental exemption. 570.126 Section 570.126 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor...
48 CFR 536.570-3 - Specialist.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Specialist. 536.570-3... CATEGORIES OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-3 Specialist. Insert 552.236-72, Specialist, in solicitations and contracts for construction if the technical sections...
24 CFR 241.570 - Insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance endorsement. 241.570... § 241.570 Insurance endorsement. (a) Initial endorsement. The Commissioner shall indicate his/her insurance of the mortgage by endorsing the original credit instrument and identifying the section of the Act...
48 CFR 570.306 - Evaluating offers.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Evaluating offers. 570.306... Real Property 570.306 Evaluating offers. (a) You must evaluate offers solely in accordance with the... solicitation. The file must include the basis for evaluation, an analysis of each offer, and a summary of...
48 CFR 570.401 - Renewal options.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Renewal options. 570.401... Requirements 570.401 Renewal options. (a) Exercise of options. Before exercising an option to renew, follow the... survey. Before exercising an option to renew a lease, review current market information to ensure the...
Investigation of transversal nuclear excitation in 208Pb at excitation energies between 6 MeV and 8 MeV using inelastic electron scattering

International Nuclear Information System (INIS)

Frey, R.W.

1978-01-01

Using high resolution inelastic electron scattering magnitic dipole and quadrupole excitations in 208 Pb were investigated in the energy range between 6 MeV and 8 MeV. The electron energy was 50 MeV and 63.5 MeV. With a mean absolute energy resolution of 33 kev. 44 excited states were found in the above energy range. The measured angular distributions were compared with DWBA-calculations using random phase approximated wave functions. (FKS)
Systematics of neutron-induced fission cross sections over the energy range 0.1 through 15 MeV, and at 0.0253 eV

International Nuclear Information System (INIS)

Behrens, J.W.

1977-01-01

Recent studies have shown straightforward systematic behavior as a function of constant proton and neutron number for neutron-induced fission cross sections of the actinide elements in the incident-neutron energy range 3 to 5 MeV. In this report, the second in a series, fission cross-section values are studied over the MeV incident-neutron energy range, and at 0.0253 eV. Fission-barrier heights and neutron-binding energies are correlated by constant proton and neutron number; however, these systematic behaviors alone do not explain the trends observed in the fission cross-section values
Physical design of 9 MeV travelling wave electron linac accelerating tube

International Nuclear Information System (INIS)

Chen Huaibi; Ding Xiaodong; Lin Yuzheng

2000-01-01

An accelerating tube is described. It is a part of an accelerator used for inspection of vehicle cargoes in rail cars, trucks, shipping containers, or airplanes in customs. A klystron with power of 4 MW and frequency of 2856 MHz will be applied to supply microwave power. The electrons can be accelerated by a travelling wave in the accelerating tube about 220 cm long, with a buncher whose capture efficiency is more than 80%. Energy of electrons after travelling through the tube can reach 9 MeV (pulse current intensity 170 mA) or 6 MeV (pulse current intensity 300 mA). Physical design of the accelerating tube, including the calculations of longitudinal particle dynamics, structure parameter and working character is carried out
48 CFR 570.203-3 - Soliciting offers.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Soliciting offers. 570.203... 570.203-3 Soliciting offers. (a) Solicit offers by providing each prospective offeror a proposed short..., evaluation procedures and submissions of offers. ...
Characterization and optimization of laser-driven electron and photon sources in keV and MeV energy ranges

International Nuclear Information System (INIS)

Bonnet, Thomas

2013-01-01

This work takes place in the framework of the characterization and the optimization of laser-driven electron and photon sources. With the goal of using these sources for nuclear physics experiments, we focused on 2 energy ranges: one around a few MeV and the other around a few tens of keV. The first part of this work is thus dedicated to the study of detectors routinely used for the characterization of laser-driven particle sources: Imaging Plates. A model has been developed and is fitted to experimental data. Response functions to electrons, photons, protons and alpha particles are established for SR, MS and TR Fuji Imaging Plates for energies ranging from a few keV to several MeV. The second part of this work present a study of ultrashort and intense electron and photon sources produced in the interaction of a laser with a solid or liquid target. An experiment was conducted at the ELFIE facility at LULI where beams of electrons and photons were accelerated up to several MeV. Energy and angular distributions of the electron and photons beams were characterized. The sources were optimized by varying the spatial extension of the plasma at both the front and the back end of the initial target position. In the optimal configuration of the laser-plasma coupling, more than 1011 electrons were accelerated. In the case of liquid target, a photon source was produced at a high repetition rate on an energy range of tens of keV by the interaction of the AURORE Laser at CELIA (10 16 W.cm -2 ) and a melted gallium target. It was shown that both the mean energy and the photon number can be increased by creating gallium jets at the surface of the liquid target with a pre-pulse. A physical interpretation supported by numerical simulations is proposed. (author)
21 CFR 570.18 - Tolerances for related food additives.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Tolerances for related food additives. 570.18 Section 570.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.18 Tolerances...
Experimental determination of the cross sections of the n-3He-system in the energy range of 1 to 40 MeV

International Nuclear Information System (INIS)

Haesner, B.

1982-08-01

Cross sections have been measured in the n+ 3 He-system over a broad energy range. The experiments were conducted using the pulsed white neutron beam at the Karlsruhe Neutron Time of Flight Facility. The total cross sections were measured from 1-40 MeV using the 190 m flight path with 1.5 ns time resolution. This represents a substantial improvement over previous measurements. Angular distributions (THETAsub(c.m.) = 33 0 -179 0 ) for the elastic n- 3 He scattering were measured simultaneously in the energy range from 5 to 30 MeV. A liquid 3 He scintillation detector was used as the scatterer. The statistical errors are less than 2% for most (> 90%) of the data. Through the use of the L 3 He detector absolute cross sections for the neutron induced reactions 3 He(n,p)T and 3 He(n,d)D could be measured from 1 to 30 MeV. These measurements are in good agreement with the results of the corresponding (p,n) and (d,n) reactions using detailed balance. (orig.) [de

Measurement of cross-sections for the reaction 103Rh (n,n')103mRh in the energy range 5.69 - 12 MeV and its evaluation from the threshold up to 20 MeV

International Nuclear Information System (INIS)

Hossain, M.M.M.

1995-05-01

The cross-sections for the reaction 103 R(n,n') 103m Rh were measured by the method of activation in the neutron energy range 5.69-12.00 MeV produced by the D(d,n) 3 He reaction. The irradiation of Rh foils was performed at zero degree to the incident beam direction and the activities of KX-rays from the decay of 103m Rh were measured by means of a calibrated Si(Li) detector. During irradiation, the neutron fluence was measured with a fission chamber in which a thin deposit of 238 U was located immediately behind the Rh foil. The measured cross-section with the corresponding uncertainty in the stated energy range is more accurate than all previous measurements in spite of rather large corrections due to break-up neutrons. The update of the evaluation for the same reaction in the energy range from threshold up to 20 MeV was carried out by using the weighted average of cross-sections based on both the experimental data including the present one and theoretical model calculations. The experimental data were renormalized with respect to the recent precision KX-ray emission probability (7.66 + 0.14) % where necessary. To perform the evaluation, the whole excitation function was divided into 33 energy groups of 0.2-1.0 MeV widths. The uncertainties of the evaluated cross-sections especially 6-12 MeV have been improved due to the inclusion of the new measurement. Overall, the results of the updated evaluation are a considerable improvement compared to the previous evaluation of this reaction and also to the recommended cross-section data of IRDF (International Reactor Dosimetry File). (author)
48 CFR 2009.570-5 - Contract clauses.

Science.gov (United States)

2010-10-01

... COMPETITION AND ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570-5 Contract clauses. (a) General contract clause. All contracts and simplified acquisitions of the types set forth in 2009.570-4(b) must include the clause entitled, “Contractor Organizational Conflicts of...
21 CFR 570.38 - Determination of food additive status.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Determination of food additive status. 570.38... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES Food Additive Safety § 570.38 Determination of food additive status. (a) The Commissioner may, in accordance with § 570.35 (b)(4) or (c)(5...
Elastic Scattering of 7Li+27Al at Backward Angles in the 7-11 MeV Energy Range for Application in RBS

International Nuclear Information System (INIS)

Carnelli, P. F. F.; Arazi, A.; Cardona, M. A.; Figueira, J. M.; Hojman, D.; Martinez Heimann, D.; Negri, A. E.; Pacheco, A. J.; Abriola, D.; Capurro, O. A.; Fimiani, L.; Grinberg, P.; Marti, G. V.; Fernandez Niello, J. O.

2010-01-01

We have measured elastic excitation functions for the 7 Li+ 27 Al system, in an energy range close to its Coulomb barrier (E lab = 8.4 MeV) in steps of 0.25 MeV. For this purpose, an array of eight surface-barrier detectors was used. To get an insight on the background composition (mainly α particles), a telescope-detector was used for atomic-number identification. Identical measurements for the 6 Li+ 27 Al system are planned for the near future.
Electrofission of 239Pu in the energy range 7 endash 12 MeV

International Nuclear Information System (INIS)

Arruda-Neto, J.D.; Yoneama, M.; Dias, J.F.; Garcia, F.; Reigota, M.A.; Likhachev, V.P.; Guzman, F.; Rodriguez, O.; Mesa, J.

1997-01-01

The electrofission cross section of 239 Pu(e,f) is measured between 7 and 12 MeV. The data are analyzed by means of the virtual photon formalism, assuming that E1, E2 (T=0), and M1 transitions are involved. Using known estimates for the E1 and E2 (T=0) fission strengths, it is deduced an M1 fission strength of 19±4μ N 2 concentrated near the fission barrier (between 5.4 and 5.8 MeV). The levels of the 239 Pu transition nucleus are theoretically obtained; a bunch of positive-parity levels shows up between 5.5 and 5.9 MeV, which might well be associated with the deduced M1 strength, since the E2 strength is negligible in this energy interval. copyright 1997 The American Physical Society
48 CFR 536.570-5 - Working hours.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Working hours. 536.570-5... CATEGORIES OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-5 Working hours. Insert 552.236-74, Working Hours, in solicitations and contracts if construction, dismantling...
29 CFR 570.53 - Coal-mine occupations (Order 3).

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Coal-mine occupations (Order 3). 570.53 Section 570.53... § 570.53 Coal-mine occupations (Order 3). (a) Finding and declaration of fact. All occupations in or about any coal mine, except the occupation of slate or other refuse picking at a picking table or...
28 CFR 570.37 - Violation of furlough.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Violation of furlough. 570.37 Section 570.37 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE.... (a) Staff shall process as an escapee an inmate who absconds from furlough. (b) Staff may take...
14 CFR 121.570 - Airplane evacuation capability.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airplane evacuation capability. 121.570... REQUIREMENTS: DOMESTIC, FLAG, AND SUPPLEMENTAL OPERATIONS Flight Operations § 121.570 Airplane evacuation capability. (a) No person may cause an airplane carrying passengers to be moved on the surface, take off, or...
48 CFR 1836.570 - NASA solicitation provisions and contract clause.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NASA solicitation provisions and contract clause. 1836.570 Section 1836.570 Federal Acquisition Regulations System NATIONAL... CONTRACTS Contract Clauses 1836.570 NASA solicitation provisions and contract clause. (a) The contracting...
24 CFR 570.611 - Conflict of interest.

Science.gov (United States)

2010-04-01

...: (i) A disclosure of the nature of the conflict, accompanied by an assurance that there has been... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Conflict of interest. 570.611... § 570.611 Conflict of interest. (a) Applicability. (1) In the procurement of supplies, equipment...
Energy-dependent etching-related impacts on CR-39 alpha detection efficiency for the Rn-222 and Rn-220 decay chains

Science.gov (United States)

Tan, Y.; Yuan, H.; Kearfott, K. J.

2018-04-01

CR-39 detectors are widely used to measure environmental levels of Rn-222, Rn-220 and their progeny. Prior research reported the CR-39 detection efficiency for alpha particles from Rn-222, Rn-220 and their progeny under a variety of etching conditions. This paper provides an explanation for interesting observations included in that work, namely that the critical incidence angle decreases with the increasing particle energy and the detection efficiency for 8.78 MeV alpha particles is zero. This paper explains these phenomena from a consideration of the interaction of alpha particles with the CR-39 detectors and the physics of etching dynamics. The proposed theory provides a rationale for an approach to optimizing the etching conditions of CR-39 detector for measuring Rn-222, Rn-220 and their progenies.
24 CFR 570.610 - Uniform administrative requirements and cost principles.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Uniform administrative requirements and cost principles. 570.610 Section 570.610 Housing and Urban Development Regulations Relating to... GRANTS Other Program Requirements § 570.610 Uniform administrative requirements and cost principles. The...
DM2 results on e+e- annihilation into multihadrons in the 1350-2400 MeV energy range

International Nuclear Information System (INIS)

Bisello, D.; Busetto, G.; Castro, A.; Nigro, M.; Pescara, L.; Sartori, P.; Stanco, L.; Antonelli, A.; Baldini, R.; Biagini, M.E.; Calcaterra, A.; Schioppa, M.; Augustin, J.E.; Cosme, G.; Couchot, F.; Fulda, F.; Grosdidier, G.; Jean-Marie, B.; Lepeltier, V.; Szklarz, G.

1990-06-01

We present preliminary results on the study of e + e - annihilation into π + π - π + π - , π + π - π 0 π 0 , π + π - π 0 , π + π - π + π - π 0 , K + K - π + π - and K s 0 K ± π -+ in the 1350-2400 MeV energy range. Data have been collected with the DM2 detector at DCI, the Orsay colliding ring, and refer to about 2 pb -1 integrated luminosity
24 CFR 570.613 - Eligibility restrictions for certain resident aliens.

Science.gov (United States)

2010-04-01

... certain resident aliens. 570.613 Section 570.613 Housing and Urban Development Regulations Relating to... GRANTS Other Program Requirements § 570.613 Eligibility restrictions for certain resident aliens. (a) Restriction. Certain newly legalized aliens, as described in 24 CFR part 49, are not eligible to apply for...
The e-ASTROGAM mission: Exploring the extreme Universe with gamma rays in the MeV – GeV range

DEFF Research Database (Denmark)

De Angelis, A.; Tatischeff, V.; Tavani, M.

2017-01-01

e-ASTROGAM (‘enhanced ASTROGAM’) is a breakthrough Observatory space mission, with a detector composed by a Silicon tracker, a calorimeter, and an anticoincidence system, dedicated to the study of the non-thermal Universe in the photon energy range from 0.3 MeV to 3 GeV – the lower energy limit c...
29 CFR 570.11 - Continued acceptability of certificates of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Continued acceptability of certificates of age. 570.11 Section 570.11 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of Age § 570.11...
29 CFR 570.70 - Purpose and scope.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Purpose and scope. 570.70 Section 570.70 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR... “provisions of section 12 [of the Act] relating to child labor shall apply to an employee below the age of 16...
29 CFR 570.71 - Occupations involved in agriculture.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations involved in agriculture. 570.71 Section 570.71... CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION 1-Occupations in Agriculture... agriculture. (a) Findings and declarations of fact as to specific occupations. The following occupations in...
Long range absorption in the scattering of 6He on 208Pb and 197Au at 27 MeV

International Nuclear Information System (INIS)

Kakuee, O.R.; Alvarez, M.A.G.; Andres, M.V.; Cherubini, S.; Davinson, T.; Di Pietro, A.; Galster, W.; Gomez-Camacho, J.; Laird, A.M.; Lamehi-Rachti, M.; Martel, I.; Moro, A.M.; Rahighi, J.; Sanchez-Benitez, A.M.; Shotter, A.C.; Smith, W.B.; Vervier, J.; Woods, P.J.

2006-01-01

Quasi-elastic scattering of 6 He at E lab =27 MeV from 197 Au has been measured in the angular range of 6 o -72 o in the laboratory system employing LEDA and LAMP detection systems. These data, along previously analysed data of 6 He+ 208 Pb at the same energy, are analysed using optical model calculations. The role of Coulomb dipole polarizability has been investigated. Large imaginary diffuseness parameters are required to fit the data. This result is an evidence for long range absorption mechanisms in 6 He induced reactions

9 CFR 590.570 - Pasteurization of liquid eggs.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Pasteurization of liquid eggs. 590.570..., Processing, and Facility Requirements § 590.570 Pasteurization of liquid eggs. (a) Pasteurization facilities: The facilities for pasteurization of egg products shall be adequate and of approved construction so...
Mean field for the p + 90Zr system in the energy range -60 MeV 90Zr from a dispersive optical-model analysis

International Nuclear Information System (INIS)

Romanovsky, E.A.; Bespalova, O.V.; Goncharov, S.A.; Pleshkov, D.V.; Spasskaya, T.I.

2000-01-01

Data on the scattering of protons with energies 5 MeV 90 Zr nuclei and data on the energies of proton particle and hole levels in the A + 1 and A - 1 systems with A = 90 are analyzed within the dispersive optical model. The parameters of the mean proton field for 90 Zr are determined in the energy range -60 MeV 3 He), ( 3 He, d), (n, d), and (d, n) reactions for levels near the Fermi surface and in (e, e'p) and (p, 2p) reactions for deep levels
Activation cross sections of deuteron induced reactions on niobium in the 30–50 MeV energy range

International Nuclear Information System (INIS)

Ditrói, F.; Tárkányi, F.; Takács, S.; Hermanne, A.; Ignatyuk, A.V.

2016-01-01

Highlights: • Deuteron induced nuclear reactions on natural niobium up to 50 MeV. • Stacked foil irradiation technique. • Comparison of results with the ALICE-D, EMPIRE-D and TENDL-2015 calculations. • Application of radioisotopes in medicine and industry. - Abstract: Activation cross-sections of deuterons induced reactions on Nb targets were determined with the aim of different applications and comparison with theoretical models. We present the experimental excitation functions of "9"3Nb(d,x)"9"3"m","9"0Mo, "9"2"m","9"1"m","9"0Nb, "8"9","8"8Zr and "8"8","8"7"m","8"7"gY in the energy range of 30–50 MeV. The results were compared with earlier measurements and with the cross-sections calculated by means of the theoretical model codes ALICE-D, EMPIRE-D and TALYS (on-line TENDL-2014 and TENDL-2015 libraries). Possible applications of the radioisotopes are discussed in detail.
The JHP 200-MeV proton linear accelerator

Energy Technology Data Exchange (ETDEWEB)

Kato, Takao [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan)

1997-11-01

A 200-MeV proton linear accelerator for the Japanese Hadron Project (JHP) has been designed. It consists of a 3-MeV radio-frequency quadrupole linac (RFQ), a 50-MeV drift tube linac (DTL) and a 200-MeV separated-type drift tube linac (SDTL). A frequency of 324 MHz has been chosen for all of the rf structures. A peak current of 30 mA (H{sup -} ions) of 400 {mu}sec pulse duration will be accelerated at a repetition rate of 25 Hz. A future upgrade plan up to 400 MeV is also presented, in which annular-coupled structures (ACS) of 972 MHz are used in an energy range of above 150 or 200 MeV. One of the design features is its high performance for a beam-loss problem during acceleration. It can be achieved by separating the transition point in the transverse motion from that of the longitudinal motion. The transverse transition at a rather low-energy range decreases the effects of space-charge, while the longitudinal transition at a rather high-energy range decreases the effects of nonlinear problems related to acceleration in the ACS. Coupled envelope equations and equipartitioning theory are used for the focusing design. The adoption of the SDTL structure improves both the effective shunt impedance and difficulties in fabricating drift tubes with focusing magnets. An accurate beam-simulation code on a parallel supercomputer was used for confirming any beam-loss problem during acceleration. (author)
Autophosphorylation of JAK2 on tyrosines 221 and 570 regulates its activity

DEFF Research Database (Denmark)

Argetsinger, Lawrence S; Kouadio, Jean-Louis K; Steen, Hanno

2004-01-01

or which of the 49 tyrosines in JAK2 are autophosphorylated. In this study, mass spectrometry and two-dimensional peptide mapping were used to determine that tyrosines 221, 570, and 1007 in JAK2 are autophosphorylated. Phosphorylation of tyrosine 570 is particularly robust. In response to growth hormone......, JAK2 was rapidly and transiently phosphorylated at tyrosines 221 and 570, returning to basal levels by 60 min. Analysis of the sequences surrounding tyrosines 221 and 570 in JAK2 and tyrosines in other proteins that are phosphorylated in response to ligands that activate JAK2 suggests that the YXX......[L/I/V] motif is one of the motifs recognized by JAK2. Experiments using JAK2 with tyrosines 221 and 570 mutated to phenylalanine suggest that tyrosines 221 and 570 in JAK2 may serve as regulatory sites in JAK2, with phosphorylation of tyrosine 221 increasing kinase activity and phosphorylation of tyrosine 570...
Dual sightline measurements of MeV range deuterons with neutron and gamma-ray spectroscopy at JET

DEFF Research Database (Denmark)

Eriksson, J.; Nocente, M.; Binda, F.

2015-01-01

Observations made in a JET experiment aimed at accelerating deuterons to the MeV range by third harmonic radio-frequency (RF) heating coupled into a deuterium beam are reported. Measurements are based on a set of advanced neutron and gamma-ray spectrometers that, for the first time, observe......-ray spectroscopy based on a one-dimensional model and by a consistency check among the individual measurement techniques. A systematic difference is seen between the two lines of sight and is interpreted to originate from the sensitivity of the oblique detectors to the pitch-angle structure of the distribution...
Optical model neutron cross sections calculations for Cu63, Cu65 and natural Cu in the energy range 1-15 Mev

International Nuclear Information System (INIS)

Iliescu, N.

1975-01-01

The theory of optical model and cross sections is developing. The neutron reactions considered in the high energy rate (0,1-15 MeV) were: total, elastic, elastic angular distributions, nonelastic, inelastic for resolved levels. This region was subdivided in two parts: in the first one, ranging from 0,1 to 1 MeV, the evaluation was mainly based on empirical fits of the experimental data, whereas in the second part the fits were carried out with theoretical models: optical and statistical. The potential parameters were obtained fitting the total, elastic, inelastic cross sections and elastic angular distributions. Using Hauser-Feshbach theory, angular distribution and cross sections for compound elastic scattering and inelastic scattering are calculated
Experimental and simulated efficiency of a HPGe detector in the energy range of 0.06∼11 MeV

International Nuclear Information System (INIS)

Park, Chang Su; Choi, H. D.; Sun, Gwang Min

2003-01-01

The full energy peak efficiency of a Hyper Pure Germanium (HPGe) detector was calibrated in a wide energy range from 0.06 to 11 MeV. Both the experimental technique and the Monte Carlo method were used for the efficiency calibration. The measurement was performed using the standard radioisotopes in the low energy region of 60∼1408 keV, which was further extended up to 11 MeV by using the 14 N(n,γ) and 35 Cl(n,γ) reactions. The GEANT Monte Carlo code was used for efficiency calculation. The calculated efficiency had the same dependency on the γ-ray energy with the measurement, and the discrepancy between the calculation and the measurement was minimized by fine-tuning of the detector geometry. From the calculated result, the efficiency curve of the HPGe detector was reliably determined particularly in the high energy region above several MeV, where the number of measured efficiency points is relatively small despite the wide energy region. The calculated efficiency agreed with the measurement within about 7%. In addition to the efficiency calculation, the origin of the local minimum near 600 keV on the efficiency curve was analyzed as a general characteristics of a HPGe detector
29 CFR 570.8 - Issuance of a Federal certificate of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Issuance of a Federal certificate of age. 570.8 Section 570.8 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of Age § 570.8...
Calculation of Multisphere Neutron Spectrometer Response Functions in Energy Range up to 20 MeV

CERN Document Server

Martinkovic, J

2005-01-01

Multisphere neutron spectrometer is a basic instrument of neutron measurements in the scattered radiation field at charged-particles accelerators for radiation protection and dosimetry purposes. The precise calculation of the spectrometer response functions is a necessary condition of the propriety of neutron spectra unfolding. The results of the response functions calculation for the JINR spectrometer with LiI(Eu) detector (a set of 6 homogeneous and 1 heterogeneous moderators, "bare" detector within cadmium cover and without it) at two geometries of the spectrometer irradiation - in uniform monodirectional and uniform isotropic neutron fields - are given. The calculation was carried out by the code MCNP in the neutron energy range 10$^{-8}$-20 MeV.
Measurement of cross sections for the scattering of neutrons in the energy range from 2 MeV to 4 MeV with the {sup 15}N(p,n) reaction as neutron source; Messung von Wirkungsquerschnitten fuer die Streuung von Neutronen im Energiebereich von 2 MeV bis 4 MeV mit der {sup 15}N(p,n)-Reaktion als Neutronenquelle

Energy Technology Data Exchange (ETDEWEB)

Poenitz, Erik

2010-04-26

In future nuclear facilities, the materials lead and bismuth can play a more important role than in today's nuclear reactors. Reliable cross section data are required for the design of those facilities. In particular the neutron transport in the lead spallation target of an Accelerator-Driven Subcritical Reactor strongly depends on the inelastic neutron scattering cross sections in the energy region from 0.5 MeV to 6 MeV. In the recent 20 years, elastic and inelastic neutron scattering cross sections were measured with high precision for a variety of elements at the PTB time-of-flight spectrometer. The D(d,n) reaction was primarily used for the production of neutrons. Because of the Q value of the reaction and the available deuteron energies, neutrons in the energy range from 6 MeV to 16 MeV can be produced. For the cross section measurement at lower energies, however, another neutron producing reaction is required. The {sup 15}N(p,n){sup 15}O reaction was chosen, as it allows the production of monoenergetic neutrons with up to 5.7MeV energy. In this work, the {sup 15}N(p,n) reaction was studied with focus on the suitability as a source for monoenergetic neutrons in scattering experiments. This includes the measurement of differential cross sections for the neutron producing reaction and the choice of optimum target conditions. Differential elastic and inelastic neutron scattering cross sections were measured for lead at four energies in the region from 2 MeV to 4 MeV incident neutron energy using the time-of-flight technique. A lead sample with natural isotopic composition was used. NE213 liquid scintillation detectors with well-known detection efficiencies were used for the detection of the scattered neutrons. Angle-integrated cross sections were determined by a Legendre polynomial expansion using least-squares methods. Additionally, measurements were carried out for isotopically pure {sup 209}Bi and {sup 181}Ta samples at 4 MeV incident neutron energy
29 CFR 570.32 - Effect of subpart C.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR... (Child Labor Reg. 3) § 570.32 Effect of subpart C. Link to an amendment published at 75 FR 28448, May 20... conditions specified in § 570.35 shall not be deemed to be oppressive child labor within the meaning of the...
Neutron-Neutron effective range from a comparison of n-n and n-p quasi-free scattering at 24 MeV

International Nuclear Information System (INIS)

Witsch, W. von; Gomez Moreno, B.; Rosenstock, W.; Franke, R.; Steinheuer, B.

1980-01-01

Neutron-neutron and neutron-proton quasi-free scattering have been measured at Esub(n) = 24 MeV the d + n reaction to deduce the n-n effective range from a comparison of relative cross sections, reducing considerably experimental as well as theoretical uncertainties. A Monte Carlo analysis with exact three-body calculations yields rsub(nn) = 2.65 +- 0.18 fm. (orig.)
Responses of conventional and extended-range neutron detectors in mixed radiation fields around a 150-MeV electron LINAC

International Nuclear Information System (INIS)

Lin, Yu-Chi; Sheu, Rong-Jiun; Chen, Ang-Yu

2015-01-01

This study analyzed the responses of two types of neutron detector in mixed gamma-ray and neutron radiation fields around a 150-MeV electron linear accelerator (LINAC). The detectors were self-assembled, high efficiency, and designed in two configurations: (1) a conventional moderated-type neutron detector based on a large cylindrical He-3 proportional counter; and (2) an extended-range version with an embedded layer of lead in the moderator to increase the detector’s sensitivity to high-energy neutrons. Two sets of the detectors were used to measure neutrons at the downstream and lateral locations simultaneously, where the radiation fields differed considerably in intensities and spectra of gamma rays and neutrons. Analyzing the detector responses through a comparison between calculations and measurements indicated that not only neutrons but also high-energy gamma rays (>5 MeV) triggered the detectors because of photoneutrons produced in the detector materials. In the lateral direction, the contribution of photoneutrons to both detectors was negligible. Downstream of the LINAC, where high-energy photons were abundant, photoneutrons contributed approximately 6% of the response of the conventional neutron detector; however, almost 50% of the registered counts of the extended-range neutron detector were from photoneutrons because of the presence of the detector rather than the effect of the neutron field. Dose readings delivered by extended-range neutron detectors should be interpreted cautiously when used in radiation fields containing a mixture of neutrons and high-energy gamma rays
The reaction p12C→ηX from Tp=800 MeV to Tp=1500 MeV

International Nuclear Information System (INIS)

Chiavassa, E.; Dellacasa, G.; De Marco, N.; De Oliveira Martins, O.; Gallio, M.; Guaita, P.; Musso, A.; Piccotti, A.; Scomparin, E.; Vercellin, E.

1998-01-01

The reaction p 12 C→nX has been studied, at several proton kinetic energies ranging from 800 MeV to 1500 MeV, at the proton synchrotron Saturne at Saclay. The measured doubly differential cross-sections are presented and discussed in the framework of a simple theoretical model. The model fails in describing the deepest subthreshold data while the above-threshold data are fairly well reproduced. (orig.)
570 miljonit Mondriani maali eest

Index Scriptorium Estoniae

1998-01-01

Hollandi maalikunsti fond ostis Piet Modigliani viimase maali ameerika ajakirja-kirjastaja S. I. Newhouse erakogult 80 miljoni kuldna (570 miljoni krooni) eest. 1944. a. valminud 'Victory Boogie Woogie' eksponeeritakse Haagi linnamuuseumis
Excitation functions for 121,123Sb(α,xn), (x=1-4) reactions in approx. 10-40 MeV range

International Nuclear Information System (INIS)

Prasad, R.; Bhardwaj, H.D.

1986-04-01

Excitation functions for 121 Sb(α,n), 121 Sb(α,2n), 123 Sb(α,n) and 123 Sb(α,3n) reactions in the energy range approx. 10 to 40 MeV have been measured using stacked-foil technique and are calculated theoretically using statistical model with and without the inclusion of pre-equilibrium emission. Inclusion of pre-equilibrium emission is found to give good agreement between the experimental and measured excitation functions. (author)
Study of the gamma spectra emitted in a nuclear reaction - Measurement of the half-lives of the levels 6.13 MeV, 6.92 MeV and 7.12 MeV of 16O

International Nuclear Information System (INIS)

Leccia, F.

1967-01-01

When the energy shifts of the gamma spectrum released during a nuclear reaction are important compared with the detector resolution, the comparison of the experimental spectrum with theoretical spectra allows us to determine the half-life of the initial state of the transition. The calculation of the experimental spectrum implies to know the slowing-down of the recoil nucleus in the matter in order to take into account the Doppler effect. For recoil energies in the range of the MeV and for solid media, the Lindhard theory agrees well with experimental data. The phenomenon of deflection which appears at very low energies must be taken into account by restraining the measurement domain. By choosing an adequate media we can measure half-lives in the domain 1 and 100 fs without needing to take into account deflection effects. We have measured the half-life of the first 3 energy levels of 16 O (6.135 MeV, 6.923 MeV and 7.121 MeV), these levels are reached through the reaction 19 F(p,αγ) 16 O with proton incident energies ranging from 0.872 MeV to 2.42 MeV. We have used a coaxial germanium semi-conductor with lithium additions that was connected to an amplification line of Ortec type. 2 kinds of target have been used: calcium fluoride and copper fluoride evaporated on tantalum support. We have obtained the following values for the half-life: (16±4) fs for the 6.923 MeV level, (18±4) fs for the 7.121 MeV level, and for the 6.135 MeV we can only give a lower limit since the gamma decay occurs when the nucleus is at rest τ > 200 fs
DEC VT220

CERN Multimedia

1983-01-01

The DEC (Digital Equipment Corporation) VT220 is a text terminal which uses an redesigned keyboard(LK201). The VT220 improved on the earlier VT100 series of terminals with much smaller physical packaging and and a much faster microprocessor.
Facility for the measurement of proton polarization in the range 50-70 MeV

Energy Technology Data Exchange (ETDEWEB)

Nakamura, M; Sakaguchi, H; Sakamoto, H; Ogawa, H; Cynshi, O; Kobayashi, S [Kyoto Univ. (Japan). Dept. of Physics; Kato, S [Osaka Univ., Toyonaka (Japan). Lab. of Nuclear Studies; Matsuoka, N; Hatanaka, K; Noro, T [Osaka Univ., Toyonaka (Japan). Research Center for Nuclear Physics

1983-07-01

A proton polarimetry facility based on silicon analyzers combined with high-purity germanium detectors is described. The scattering efficiency is 1.5 x 10/sup -5/ at 60 MeV with an effective analyzing power of 0.71 and the energy resolution is about 300 keV fwhm. The facility has succeeded in measuring the depolarization in p-/sup 13/C elastic scattering separated clearly from inelastic events. In order to use a silicon detector as an analyzer target, measurements of cross sections and analyzing powers have been performed at proton energies of 65, 60, 55, 50 and 45 MeV.

Measurement of (n,Xn) reaction cross sections at 96 MeV; Measure des sections efficaces (n,Xn) a 96 MeV

Energy Technology Data Exchange (ETDEWEB)

Sagrado Garcia, Melle Inmaculada C. [Ecole Doctorale: SINEM, U.F.R. de Sciences, Universite de Caen/Basse-Normandie, Esplanade Paix14000 Caen (France)

2006-10-15

Nucleon induced reactions in the 20-200 MeV energy range are intensively studied since a long time. The evaporation and the pre-equilibrium processes correspond to an important contribution of the production cross section in these reactions. Several theoretical approaches have been proposed and their predictions must be tested. The experimental results shown in this work are the only complete set of data for the (n,Xn) reactions in this energy range. Neutron double differential cross section measurements using lead and iron targets for an incident neutron beam at 96 MeV were carried out at TSL Laboratory in Uppsala, Sweden. The measurements have been performed for the first time with an energy threshold of 2 MeV and for a wide angular range (15 angle - 98 angle). Neutrons have been detected using two independent setups, DECOI and DEMON and CLODIA and SCANDAL, in order to cover the whole energy range (2-100) MeV. The angular distributions, the differential cross sections and the total inelastic production cross sections have been calculated using the double differential cross sections. The comparison between the experimental data and the predictions given by two of the most popular simulation codes, GEANT3 and MCNPX, have been performed, as well as the comparison with the predictions of the microscopic simulation model DYWAN, selected for its treatment of nucleon-nucleon reactions. (author)
20 CFR 410.570 - Underpayments.

Science.gov (United States)

2010-04-01

...-BLACK LUNG BENEFITS (1969- ) Payment of Benefits § 410.570 Underpayments. (a) General. As used in this... (ii) In the case of a deceased miner, entitled for the month of death to widow's black lung benefits...
Measurement of the uranium-235 fission cross section over the neutron energy range 1 to 6 MeV

International Nuclear Information System (INIS)

Barton, D.M.; Diven, B.C.; Hansen, G.E.; Jarvis, G.A.; Koontz, P.G.; Smith, R.K.

1976-01-01

The ratio of the fission cross section of 235 U to the scattering cross section of 1 H was measured in the 1- to 6-MeV range using monoenergetic neutrons from a pulsed 3 H(p,n) 3 He source. In this measurement, solid-state detectors determined fission fragment and recoil proton emissions from back-to-back U(99.7%) and polyethylene disks. Timing permitted discrimination against room-scattered neutron backgrounds. Absolute values for 235 U(n,f) are obtained using the Hopkins-Breit evaluation of the hydrogen-scattering cross section
Review of neutron data: 10 to 40 MeV

Energy Technology Data Exchange (ETDEWEB)

Haight, R.C.

1977-04-01

Neutron data are reviewed for incident neutron energies between 10 and 40 MeV. A census of the data shows that there are many gaps in this range and that the existing data are primarily for neutron energies around 14 MeV. Aside from total cross sections, there are few data between 10 and 13 MeV and between 15 and 40 MeV. Examples are presented to show the quality of selected data for total, elastic, inelastic, activation, and charged-particle and gamma-ray production cross sections. The spectra of emitted particles are also discussed.
Review of neutron data: 10 to 40 MeV

International Nuclear Information System (INIS)

Haight, R.C.

1977-04-01

Neutron data are reviewed for incident neutron energies between 10 and 40 MeV. A census of the data shows that there are many gaps in this range and that the existing data are primarily for neutron energies around 14 MeV. Aside from total cross sections, there are few data between 10 and 13 MeV and between 15 and 40 MeV. Examples are presented to show the quality of selected data for total, elastic, inelastic, activation, and charged-particle and gamma-ray production cross sections. The spectra of emitted particles are also discussed
Autophosphorylation of JAK2 on tyrosines 221 and 570 regulates its activity.

Science.gov (United States)

Argetsinger, Lawrence S; Kouadio, Jean-Louis K; Steen, Hanno; Stensballe, Allan; Jensen, Ole N; Carter-Su, Christin

2004-06-01

The tyrosine kinase JAK2 is a key signaling protein for at least 20 receptors in the cytokine/hematopoietin receptor superfamily and is a component of signaling by insulin receptor and several G-protein-coupled receptors. However, there is only limited knowledge of the physical structure of JAK2 or which of the 49 tyrosines in JAK2 are autophosphorylated. In this study, mass spectrometry and two-dimensional peptide mapping were used to determine that tyrosines 221, 570, and 1007 in JAK2 are autophosphorylated. Phosphorylation of tyrosine 570 is particularly robust. In response to growth hormone, JAK2 was rapidly and transiently phosphorylated at tyrosines 221 and 570, returning to basal levels by 60 min. Analysis of the sequences surrounding tyrosines 221 and 570 in JAK2 and tyrosines in other proteins that are phosphorylated in response to ligands that activate JAK2 suggests that the YXX[L/I/V] motif is one of the motifs recognized by JAK2. Experiments using JAK2 with tyrosines 221 and 570 mutated to phenylalanine suggest that tyrosines 221 and 570 in JAK2 may serve as regulatory sites in JAK2, with phosphorylation of tyrosine 221 increasing kinase activity and phosphorylation of tyrosine 570 decreasing kinase activity and thereby contributing to rapid termination of ligand activation of JAK2.
Microscopic analysis of proton elastic scattering in the range 80-200 MeV

International Nuclear Information System (INIS)

Dietrich, F.S.; Petrovich, F.

1983-01-01

A systematic comparison is made of differential cross-section and analyzing-power data on 12 C, 28 Si, 40 Ca, 90 Zr, and 208 Pb at 80-200 MeV with calculations based on the single-step folding-model approach to the optical potential. In these calculations, proton densities have been inferred from electron scattering results, with neutron densities either the same as for protons ( 12 C, 28 Si, 40 Ca) or with a small neutron skin consistent with 800-MeV proton scattering results ( 80 Zr, 208 Pb). The effective two-body interactions that have been used are the Love-Franey t-matrix, a density-dependent interaction based on the Paris potential (calculated by von Geramb), and finally the Brieva-Rook density-dependent central interaction used with the spin-orbit part of the Love-Franey interaction
Ion heating up to 1 MeV range with higher harmonic ICRF wave on JT-60U

International Nuclear Information System (INIS)

Nemoto, M.; Kusama, Y.; Hamamatsu, K.; Kimura, H.; Fujii, T.; Moriyama, S.; Saigusa, M.; Afanassiev, V.I.

1997-01-01

The properties of protons under accleration by an ion cyclotron range of frequency (ICRF) waves with the second to fourth hydrogen harmonics have been investigated in the JT-60U tokamak at the Japan Atomic Energy Research Institute (JAERI). Protons have been accelerated up to 1 MeV in the presence of an ICRF wave of fixed frequency, neutral beams (NB), and a fixed toroidal magnetic field which is scanned through several plasma discharges. The tail temperature of the protons, which is evaluated in the range 0.32-0.86 MeV, has been observed to increase in the second to third harmonics, however increase of the tail temperature in the third to fourth harmonics has not been observed clearly. Furthermore, the dependence of tail temperature on the harmonic number has been found to be in qualitative agreement with results from a simulation code analysis based upon the one-dimensional Fokker-Planck equation coupled with the kinetic wave equation. Experimental values for the stored energy of the accelerated ions have shown, however, that the response of stored energy to changes in absorbed ICRF power is much stronger than the response to changes in harmonic number. Also, the incremental energy confinement times for heating discharges matching the third and fourth harmonics (3 ω CH) and 4 ω CH) of hydrogen have been observed to be less than half that for those matching the second harmonic. It has been found that suppression of the absorbed ICRF power accompanied with the occurence of cavity resonance in the 3ω CH and 4ω CH heating discharges reduces the stored energy of the accelerated ions and the incremental energy confinement time. (Author)
24 CFR 570.513 - Lump sum drawdown for financing of property rehabilitation activities.

Science.gov (United States)

2010-04-01

... DEVELOPMENT BLOCK GRANTS Grant Administration § 570.513 Lump sum drawdown for financing of property... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Lump sum drawdown for financing of property rehabilitation activities. 570.513 Section 570.513 Housing and Urban Development Regulations...
NSRL 200 MeV linac beam energy stabilization system

International Nuclear Information System (INIS)

Huang Guirong; Pei Yuanji; Dong Sai

2001-01-01

By using the computer image processing technology and RF phase auto-shifting system, the ESS (Energy Stabilization System) was applied to 200 MeV Linac. the ESS adjusts beam energy automatically in a range of +-4 MeV. After adjustment beam energy stability is improved to +-6%
48 CFR 1403.570-2 - Procedures.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 1403.570-2... response shall be coordinated with the cognizant Public Affairs Office and Ethics Officer. ...
Elastic scattering of 7Li + 27Al at several angles in the 7-11 MeV energy range

International Nuclear Information System (INIS)

Abriola, D.; Carnelli, P.; Arazi, A.; Figueira, J.M.; Capurro, O.A.; Cardona, M.A.; Fernandez Niello, J.O.; Hojman, D.; Fimiani, L.; Grinberg, P.; Martinez Heimann, D.; Marti, G.V.; Negri, A.E.; Pacheco, A.J.

2010-01-01

Elastic cross sections for the 7 Li + 27 Al system were measured at laboratory energies between 7 and 11 MeV in steps of 0.25 MeV, and angles between 135 o and 170 o in steps of 5 o . Excitation functions for the elastic scattering were measured using an array of eight Si surface-barrier detectors whereas a solid-state telescope was used to estimate and subtract background from other reactions. Contamination from α particles arising from the 7 Li breakup process at E lab ≥ 10 MeV makes the use of these energies inadvisable for RBS applications. The present results are compared with previous data obtained at 165 o (E lab ≤ 6 MeV), 140 o and 170 o (E lab ≤ 8 MeV). The experimental data were analyzed in terms of the Optical Model. Two different energy-independent potentials were found. These optical potentials allow an interpolation with physical meaning to other energies and scattering angles. The experimental cross sections will be uploaded to the IBANDL database.
21 CFR 570.20 - General principles for evaluating the safety of food additives.

Science.gov (United States)

2010-04-01

... food additives. 570.20 Section 570.20 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES Food Additive Safety § 570.20 General principles for evaluating the safety of food additives. (a) In reaching a...
Calculated neutron-activation cross sections for E/sub n/ /le/ 100 MeV for a range of accelerator materials

International Nuclear Information System (INIS)

Bozoian, M.; Arthur, E.D.; Perry, R.T.; Wilson, W.B.; Young, P.G.

1988-01-01

Activation problems associated with particle accelerators are commonly dominated by reactions of secondary neutrons produced in reactions of beam particles with accelerator or beam stop materials. Measured values of neutron-activation cross sections above a few MeV are sparse. Calculations with the GNASH code have been made for neutrons incident on all stable nuclides of a range of elements common to accelerator materials. These elements include B, C, N, O, Ne, Mg, Al, Si, P, S, Ar, K, Ca, Cr, Mn, Fe, Co, Ni, Cu, Zn, Zr, Mo, Nd, and Sm. Calculations were made for a grid of incident neutron energies extending to 100 MeV. Cross sections leading to the direct production of as many as 87 activation products for each of 84 target nuclide were tabulated on this grid of neutron energies, each beginning with the threshold for the product nuclide's formation. Multigrouped values of these cross sections have been calculated and are being integrated into the cross-section library of the REAC-2 neutron activation code. Illustrative cross sections are presented. 20 refs., 6 figs., 1 tab
Dicty_cDB: SLH220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH220Q.Seq.d/ Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/
Quantum efficiency of cesium iodide photocathodes in the 120-220 nm spectral range traceable to a primary detector standard

CERN Document Server

Rabus, H; Richter, M; Ulm, G; Friese, J; Gernhäuser, R; Kastenmüller, A; Maier-Komor, P; Zeitelhack, K

1999-01-01

Differently prepared CsI samples have been investigated in the 120-220 nm spectral range for their quantum efficiency, spatial uniformity and the effect of radiation aging. The experiments were performed at the PTB radiometry laboratory at the Berlin synchrotron radiation facility BESSY. A calibrated GaAsP Schottky photodiode was used as transfer detector standard to establish traceability to the primary detector standard, because this type of photodiode - unlike silicon p-on-n photodiodes - proved to be of sufficiently stable response when exposed to vacuum ultraviolet radiation. The paper reviews the experimental procedures that were employed to characterize and calibrate the GaAsP photodiode and reports the results that were obtained on the investigated CsI photocathodes.
7 CFR 1280.220 - Collections.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Collections. 1280.220 Section 1280.220 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Assessments § 1280.220 Collections. (a) Each first handler and each exporter responsible for the collection of assessments under this subpart shall...
Exact finite range DWBA results for the /sup 12/C(p,d)/sup 11/C reaction at 700 MeV. [Differential cross sections

Energy Technology Data Exchange (ETDEWEB)

Rost, E; Shepard, J R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.

1975-12-08

The differential cross sections for the /sup 12/C(p,d)/sup 11/C(g.s.) reaction at 700 MeV have been calculated in a full finite range DWBA approach. The absolute cross sections agree with the data and are dominated by contributions arising from the deuteron D-state.
19 CFR 10.570 - Goods re-entered after repair or alteration in Singapore.

Science.gov (United States)

2010-04-01

... Singapore. 10.570 Section 10.570 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... States-Singapore Free Trade Agreement Goods Returned After Repair Or Alteration § 10.570 Goods re-entered after repair or alteration in Singapore. (a) General. This section sets forth the rules which apply for...
48 CFR 503.570-1 - Policy.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 503.570-1 Policy. GSA policy precludes contractors from making references to GSA contracts in commercial advertising in...

Development of an aerosol chamber for calibration of 220Rn progeny detectors

Science.gov (United States)

Sorimachi, Atsuyuki; Ishikawa, Tetsuo; Tokonami, Shinji

2014-09-01

This paper describes an aerosol chamber system that can be used for calibrations and performance experiments of passive 220Rn progeny detectors. For the purpose of this study, an aerosol generation system using carnauba wax as the aerosol material was mounted into the 220Rn chamber. We used the chamber to measure characteristics of the equilibrium factor (F) of 220Rn and unattached fraction (fp) of 220Rn progeny, which are important parameters for dose estimation. The first experiment showed that continuous and stable generation of the unattached and aerosol-attached 220Rn progeny concentrations was obtained. We observed that the spatial distributions in the chamber of the vertical profiles of the unattached and aerosol-attached 220Rn progeny concentrations were homogeneous, as were the particle number concentration and count median diameter. The values of F and fp and their characteristics observed in this study were in the same range as the values reported from indoor measurements. We found that the characteristics of F and fp were dependent on the aerosol conditions (particle diameter and particle number concentration).
(n, Xn) cross sections measurements at 96 MeV

International Nuclear Information System (INIS)

Sagrado Garcia, Inmaculada C.

2006-01-01

Nucleon induced reactions in the 20-200 MeV energy range are intensively studied since a long time. The evaporation and the pre-equilibrium processes correspond to an important contribution of the production cross section in these reactions. Several theoretical approaches have been proposed and their predictions must be tested. The experimental results shown in this work are the only complete set of data for the (n, Xn) reactions in this energy range. Neutron double differential cross sections measurements using lead and iron targets for an incident neutron beam at 96 MeV were carried out at TSL laboratory, in Uppsala (Sweden). The measurements have been performed for the first time with an energy threshold of 2 MeV and for a wide angular range (15 deg.-98 deg.). Neutrons have been detected using two independent setups, DECOI and DEMON and CLODIA and SCANDAL, in order to cover the whole energy range (2-100 MeV). The angular distributions, the differential cross sections and the total inelastic production cross sections have been calculated using the double differential cross sections. The comparisons between the experimental data and the predictions given by two of the most popular simulation codes, GEANT3 and MCNPX, have been performed, as well as the comparison with the predictions of the microscopic simulation model DYWAN, selected for its original treatment of nucleon-nucleus reactions. (author) [fr
14 CFR 13.220 - Discovery.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...
7 CFR 220.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 220.3 Section 220.3 Agriculture... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program covered by this part. Within...
20 CFR 663.570 - What is the consumer reports system?

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What is the consumer reports system? 663.570....570 What is the consumer reports system? The consumer reports system, referred to in WIA as... consumer reports system must contain the information necessary for an adult or dislocated worker customer...
28 CFR 570.43 - Inmates requiring a high degree of control and supervision.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Inmates requiring a high degree of control and supervision. 570.43 Section 570.43 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE COMMUNITY PROGRAMS Escorted Trips § 570.43 Inmates requiring a high degree of control and supervision. Only the...
49 CFR 220.7 - Penalty.

Science.gov (United States)

2010-10-01

..., or has caused death or injury, a penalty not to exceed $100,000 per violation may be assessed; and... 49 Transportation 4 2010-10-01 2010-10-01 false Penalty. 220.7 Section 220.7 Transportation Other... TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.7 Penalty. Any person (including but not limited to a...
9 CFR 354.220 - Buildings.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Buildings. 354.220 Section 354.220... CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Buildings and Plant Facilities § 354.220 Buildings. The buildings shall be of sound construction and kept in good repair, and shall be of...
30 CFR 220.032 - Inventories.

Science.gov (United States)

2010-07-01

... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...
SCANDAL -- A facility for elastic neutron scattering studies in the 50--130 MeV range

International Nuclear Information System (INIS)

Klug, J.; Blomgren, J.; Atac, A.; Bergenwall, B.; Dangtip, S.; Elmgren, K.; Johansson, C.; Olsson, N.; Prokofiev, A.V.; Rahm, J.; Oberstedt, A.; Tovesson, F.; Eudes, Ph.; Haddad, F.; Kerveno, M.; Kirchner, T.; Lebrun, C.; Stuttge, L.; Slypen, I.; Michel, R.; Neumann, S.; Herpers, U.

2001-01-01

A facility for detection of scattered neutrons in the energy interval 50--130 MeV, SCANDAL (SCAttered Nucleon Detection AssembLy), has recently been installed at the 20--180 MeV neutron beam facility of the The Svedberg Laboratory, Uppsala. It is primarily intended for studies of elastic neutron scattering, but can be used for the (n,p) and (n,d) reaction experiments as well. The performance of the spectrometer is illustrated in measurements of the (n,p) and (n,n) reactions on 1 H and 12 C. In addition, the neutron beam facility is described in some detail
SCANDAL--a facility for elastic neutron scattering studies in the 50-130 MeV range

CERN Document Server

Klug, J; Atac, A; Bergenwall, B; Dangtip, S; Elmgren, K; Johansson, C; Olsson, N; Pomp, S; Prokofiev, A V; Rahm, J; Tippawan, U; Jonsson, O; Nilsson, L; Renberg, P U; Nadel-Turonski, P; Ringbom, A; Oberstedt, A; Tovesson, F; Blideanu, V; Le Brun, C; Lecolley, J F; Lecolley, F R; Louvel, M; Marie, N; Schweitzer, C; Varignon, C; Eudes, P; Haddad, F; Kerveno, M; Kirchner, T; Lebrun, C; Stuttgé, L; Slypen, I; Smirnov, A N; Michel, R; Neumann, S; Herpers, U

2002-01-01

A facility for detection of scattered neutrons in the energy interval 50-130 MeV, SCAttered Nucleon Detection AssembLy (SCANDAL), has recently been installed at the 20-180 MeV neutron beam facility of The Svedberg Laboratory, Uppsala. It is primarily intended for studies of elastic neutron scattering, but can be used for (n,p) and (n,d) reaction experiments as well. The performance of the spectrometer is illustrated in measurements of the (n,p) and (n,n) reactions on sup 1 H and sup 1 sup 2 C. In addition, the neutron beam facility is described in some detail.
28 CFR 570.20 - Purpose.

Science.gov (United States)

2010-07-01

..., halfway house, restitution center, mental health facility, alcohol or drug rehabilitation center, or other... Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE COMMUNITY PROGRAMS Pre-Release Community Confinement § 570.20 Purpose. The purpose of this subpart is to provide the procedures...
48 CFR 570.102 - Definitions.

Science.gov (United States)

2010-10-01

... Section 570.102 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION SPECIAL CONTRACTING... lease, including option periods and excluding the cost of operational services. Small business means a..., principle, and substance of the FAR or GSAR provision or clause and related coverage on the subject matter. ...
Fission cross section measurements at the LLL 100-MeV linac

International Nuclear Information System (INIS)

Browne, J.C.

1975-01-01

The fission cross section for 235 U was measured from thermal energy to 20 MeV in several steps. First, the cross section was measured from 8 MeV to 20 MeV relative to the n,p scattering cross section and then from thermal to one MeV relative to 6 Li(n,α). In addition, a measurement of the ratio of the fission cross sections of 235 U and 238 U relative to 235 U has been completed in the range 1 keV to 30 MeV for 233 U and 100 keV to 30 MeV for 238 U. Statistical uncertainties are less than 4 percent. (U.S.)
21 CFR 570.6 - Opinion letters on food additive status.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Opinion letters on food additive status. 570.6... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.6 Opinion letters on food additive status. (a) Over the years the Food and Drug Administration has given informal...
48 CFR 3036.570 - Special precautions for work at operating airports.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Special precautions for work at operating airports. 3036.570 Section 3036.570 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY ACQUISITION REGULATION (HSAR) SPECIAL CATEGORIES OF...
29 CFR 570.117 - General.

Science.gov (United States)

2010-07-01

... to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Oppressive Child Labor § 570.117 General. (a...
48 CFR 570.303-3 - Late offers, modifications of offers, and withdrawals of offers.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Late offers, modifications of offers, and withdrawals of offers. 570.303-3 Section 570.303-3 Federal Acquisition Regulations... PROPERTY Contracting Procedures for Leasehold Interests in Real Property 570.303-3 Late offers...
Detection of electrons in the 10 MeV range by plastic scintillators

Energy Technology Data Exchange (ETDEWEB)

Beaudoin, G; Champagne, A; Jeremie, H; Lessard, L

1986-09-10

Response functions for electrons from 1 to 12 MeV have been measured with a plastic scintillator telescope. A parametrization model for these response functions has been found to give good results at all energies. Furthermore it was established that the type of reflector used for the scintillator has a considerable influence on the response functions. A mechanism for this influence has been proposed and tested by Monte Carlo calculations.
A measurement of auroral electrons in the 1–10 MeV range

NARCIS (Netherlands)

Gils, J.N. van; Beek, H.F. van; Fetter, L.D. de; Hendrickx, R.V.

Particle fluxes have been measured by means of shielded Geiger-Müller telescopes mounted m a rocket, which was launched from ESRANGE(Kiruna) into a diffuse aurora. The analysis of the dependence of the counting rates on altitude indicates that a weak flux of energetic electrons, 1–10 MeV, has been

Thermoluminescence response of Ge-, Al- and Nd- doped optical fibers by 6 MeV - electron and 6 MeV - photon irradiations

International Nuclear Information System (INIS)

Hossain, I.; Moburak, A. A.; Saeed, M.A.; Wagiran, H.; Hida, N.; Yaakob, H.N.

2015-01-01

In this paper, we report the prediction of thermoluminescence responses of Neodymium-doped SiO 2 optical fibre with various dose ranges from 0.5 Gy to 4.0 Gy by 6 MeV - electron irradiations without requirement for experimental measurements. A technique has been developed to calculate prediction of 6 MeV - electron response of Neodymium-doped SiO 2 optical fibre by observing the measured TL response of 6 MV - photon and the ratio of known measured photon/electron yield ratio distribution for Ge-doped, Al-doped optical fibre and standard TLD 100 dosimeter. The samples were kept in gelatin capsule an irradiated with 6 MV - photon at the dose range from 0.5 Gy to 4.0 Gy. Siemens model Primus 3368 linear accelerator located at Hospital Sultan Ismail, Johor Bahru has been used to deliver the photon beam to the samples. We found the average response ratio of 6 MV - photon and 6 MeV - electron in Ge-doped, Al-doped optical fibre and standard TLD-100 dosimeter are 0.83(3). Observing the measured value of 6 MV - photon irradiation this average ratio is useful to find the prediction of thermoluminescence responses by 6 MeV - electron irradiation of Neodymium-doped SiO 2 optical fibre by the requirement for experimental measurements with various dose ranges from 0.5 Gy to 4.0 Gy by 6 MV - photon irradiations.
Dicty_cDB: VHK220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
MeV fullerene impacts on mica

Energy Technology Data Exchange (ETDEWEB)

Doebeli, M.; Scandella, L. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Ames, F. [Eidgenoessische Technische Hochschule, Zurich (Switzerland)

1997-09-01

Hillock heights on mica irradiated with MeV C{sub 60} ions have been investigated systematically. Results show that the small range of secondary particles along the track plays a crucial role in defect production. (author) figs., tab., refs.
48 CFR 2009.570-4 - Representation.

Science.gov (United States)

2010-10-01

... type required by the organizational conflicts of interest representation provisions has previously been... ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570-4 Representation... whether situations or relationships exist which may constitute organizational conflicts of interest with...
29 CFR 570.25 - Effect on laws other than the Federal child labor standards.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Effect on laws other than the Federal child labor standards. 570.25 Section 570.25 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION... of Age Provisions of Other Laws § 570.25 Effect on laws other than the Federal child labor standards...
49 CFR 220.2 - Preemptive effect.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 220.2 Section 220.2 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.2 Preemptive effect. Link to an amendment...
29 CFR 570.122 - General.

Science.gov (United States)

2010-07-01

... newspapers to the consumer; (c) Employment of children as actors or performers in motion pictures or in... 28459, May 20, 2010, § 570.122 was revised, effective July 19, 2010. For the convenience of the user... engaged in the delivery of newspapers to the consumer; (3) Employment of children as actors or performers...
29 CFR 570.1 - Definitions.

Science.gov (United States)

2010-07-01

... to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS...) Oppressive child labor means employment of a minor in an occupation for which he does not meet the minimum age standards of the Act, as set forth in § 570.2 of this subpart. (c) Oppressive child labor age...
Long range absorption in the scattering of {sup 6}He on {sup 208}Pb and {sup 197}Au at 27 MeV

Energy Technology Data Exchange (ETDEWEB)

Kakuee, O.R. [Van De Graaf Laboratory, Nuclear Research Centre, AEOI, P.O. Box 14155-1339, Tehran (Iran, Islamic Republic of)]|[Departamento de Fisica Atomica, Molecular y Nuclear, Apartado 1065, Universidad de Sevilla, E-41080 Sevilla (Spain); Alvarez, M.A.G. [Departamento de Fisica Atomica, Molecular y Nuclear, Apartado 1065, Universidad de Sevilla, E-41080 Sevilla (Spain); Andres, M.V. [Departamento de Fisica Atomica, Molecular y Nuclear, Apartado 1065, Universidad de Sevilla, E-41080 Sevilla (Spain); Cherubini, S. [Department de Physique Nucleaire, Universite Catholique, Louvain-la-Neuve (Belgium)]|[Institut fuer Experimentalphysik III, Ruhr-Universitaet Bochum (Germany); Davinson, T.; Di Pietro, A.; Laird, A.M.; Shotter, A.C.; Smith, W.B.; Woods, P.J. [Department of Physics and Astronomy, Edinburgh University, EH9 3JZ (United Kingdom); Galster, W. [Department de Physique Nucleaire, Universite Catholique, Louvain-la-Neuve (Belgium); Gomez-Camacho, J. [Departamento de Fisica Atomica, Molecular y Nuclear, Apartado 1065, Universidad de Sevilla, E-41080 Sevilla (Spain)]. E-mail: gomez@us.es; Lamehi-Rachti, M. [Van De Graaf Laboratory, Nuclear Research Centre, AEOI, P.O. Box 14155-1339, Tehran (Iran, Islamic Republic of); Martel, I. [Departamento de Fisica Aplicada, Universidad de Huelva, E-21819 Huelva (Spain); Moro, A.M. [Departamento de Fisica Atomica, Molecular y Nuclear, Apartado 1065, Universidad de Sevilla, E-41080 Sevilla (Spain); Rahighi, J. [Van De Graaf Laboratory, Nuclear Research Centre, AEOI, P.O. Box 14155-1339, Tehran (Iran, Islamic Republic of)]|[Department of Physics and Astronomy, Edinburgh University, EH9 3JZ (United Kingdom); Sanchez-Benitez, A.M. [Departamento de Fisica Aplicada, Universidad de Huelva, E-21819 Huelva (Spain); Vervier, J. [Department de Physique Nucleaire, Universite Catholique, Louvain-la-Neuve (Belgium)

2006-02-06

Quasi-elastic scattering of {sup 6}He at E{sub lab}=27 MeV from {sup 197}Au has been measured in the angular range of 6{sup o}-72{sup o} in the laboratory system employing LEDA and LAMP detection systems. These data, along previously analysed data of {sup 6}He+{sup 208}Pb at the same energy, are analysed using optical model calculations. The role of Coulomb dipole polarizability has been investigated. Large imaginary diffuseness parameters are required to fit the data. This result is an evidence for long range absorption mechanisms in {sup 6}He induced reactions.
46 CFR 129.220 - Basic safety.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Basic safety. 129.220 Section 129.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS ELECTRICAL INSTALLATIONS General Requirements § 129.220 Basic safety. (a) Electrical equipment and installations must be suitable...
Neutron radiative capture cross section of 232Th in the energy range 0.1 to 1.2 MeV

International Nuclear Information System (INIS)

Jain, H.M.; Kailas, S.

1987-01-01

Recently reported neutron radiative capture cross section of 232 Th measurements in the energy range 0.1 to 1.2 MeV are compared with the calculations based on the statistical model Hauser-Feshbach theory using the spherical optical model transmission coefficients and simple Fermi gas level density formula. The calculations are in good agreement with the recent experimental data, reproducing both the absolute magnitude and the shape exhibited by the excitation function. The results of this comparative study can be used for improving the evaluation of the neutron radiative capture cross section of 232 Th. 16 refs., 3 tables, 4 figures. (author)
Neutron radiative capture cross section of 232Th in the energy range 0.1 to 1.2 MeV

International Nuclear Information System (INIS)

Jain, H.M.; Kailas, S.

1987-03-01

Recently reported neutron radiative capture cross section of Th-232 measurements in the energy range 0.1 to 1.2 MeV are compared with the calculations based on the statistical model Hauser-Feshbach theory using the spherical optical model transmission coefficients and simple Fermi gas level density formula. The calculations are in good agreement with the recent experimental data, reproducing both the absolute magnitude and the shape exhibited by the excitation function. The results of this comparative study can be used for improving the evaluation of the neutron radiative capture cross section of Th-232. (author)
Calibration of gamma cell 220 excel irradiator using Fricke and alanine dosimeters

International Nuclear Information System (INIS)

Rushdi, M. A. H.

2006-06-01

Using of gamma cell 220 excel irradiators is widely spread in many countries. This type of irradiators is being used for research purposes. Gamma cell 220 excel was provided by the International Atomic Energy Agency (IAEA) to the radiation processing laboratory of Sudan Atomic Energy Commission (SAEC). It is a self-contained gamma irradiator and self shielded, this makes it operates safely. Dose calibration for this cell is important for samples irradiation. In this work, a dosimetry system for the GC220E of SAEC was established using Fricke dosimeter. Fricke dosimeter has a confidence 95% in the rang not exceed 400 Gy. To establish routine dosimetry at high doses up to 5000 Gy, alanine dosimeter was used. This range can demonstrate the ability of GC220E to deliver known controllable doses in reproducible manner for high doses. The irradiation specifications often include a lower and upper limit of absorbed dose or central target dose. Absorbed dose mapping was carried out by both dosimeters to determine the magnitude and locations of D.max and D.min in the irradiation chamber. The results are in good agreement with dose distribution given in the machine manual. A comparison between the tow dosimeters was done and explained.(Author)
36 CFR 223.220 - Quantity determination.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Quantity determination. 223.220 Section 223.220 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE SALE AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products § 223.220 Quantity determination...
48 CFR 3009.570-2 - Policy.

Science.gov (United States)

2010-10-01

... ACQUISITION REGULATION (HSAR) ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational and Consultant... took appropriate steps to prevent any organizational conflict of interest in the selection process; or... process over which the entity exercised no control. (c) CONSTRUCTION—Nothing in this section 3009.570...
Dicty_cDB: SFL220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 0Z (Link to Original site) Representative DNA sequence >SFL220 (SFL220Q) /CSM/SF/SFL2-A/SFL220Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA...end seq. - 3' end seq. ID SFL220Z 3' end seq. >SFL220Z.Seq ----------GTCCANATTTCCATANATGTGTTTAAAAACGTGGNGGNA
46 CFR 184.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...
Actinide neutron-induced fission up to 20 MeV

International Nuclear Information System (INIS)

Maslov, V.M.

2001-01-01

Fission and total level densities modelling along with double-humped fission barrier parameters allow to describe available actinide neutron-induced fission cross section data in the incident neutron energy range of ∼ 10 keV - 20 MeV. Saddle asymmetries relevant to shell correction model calculations influence fission barriers, extracted by cross section data analysis. The inner barrier was assumed axially symmetric in case of U, Np and Pu neutron-deficient nuclei. It is shown that observed irregularities in neutron-induced fission cross section data in the energy range of 0.5-3 MeV could be attributed to the interplay of few-quasiparticle excitations in the level density of fissioning and residual nuclei. Estimates of first-chance fission cross section and secondary neutron spectrum model were validated by 238 U fission, (n,2n) and (n,3n) data description up to 20 MeV. (author)
Actinide neutron-induced fission up to 20 MeV

Energy Technology Data Exchange (ETDEWEB)

Maslov, V M [Radiation Physics and Chemistry Problems Institute, Minsk-Sosny (Belarus)

2001-12-15

Fission and total level densities modelling along with double-humped fission barrier parameters allow to describe available actinide neutron-induced fission cross section data in the incident neutron energy range of {approx} 10 keV - 20 MeV. Saddle asymmetries relevant to shell correction model calculations influence fission barriers, extracted by cross section data analysis. The inner barrier was assumed axially symmetric in case of U, Np and Pu neutron-deficient nuclei. It is shown that observed irregularities in neutron-induced fission cross section data in the energy range of 0.5-3 MeV could be attributed to the interplay of few-quasiparticle excitations in the level density of fissioning and residual nuclei. Estimates of first-chance fission cross section and secondary neutron spectrum model were validated by {sup 238}U fission, (n,2n) and (n,3n) data description up to 20 MeV. (author)
48 CFR 803.570-2 - Contract clause.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 803.570-2 Contract clause. The contracting officer shall insert the clause at 852.203-70, Commercial advertising, in...

48 CFR 503.570-2 - Contract clause.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 503.570-2 Contract clause. Insert the clause at 552.203-71, Restriction on Advertising, in solicitations and contracts...
Cross-sections for formation of {sup 89}Zr{sup m} through {sup 90}Zr(n,2n){sup 89}Zr{sup m} reaction over neutron energy range 13.73 MeV to 14.77 MeV

Energy Technology Data Exchange (ETDEWEB)

Attar, F.M.D. [Department of Physics, University of Pune, Pune-411007 (India); Mandal, R. [Department of Physics, University of Pune, Pune-411007 (India); Indian Institute of Technology, Kharagpur (India); Dhole, S.D. [Department of Physics, University of Pune, Pune-411007 (India); Saxena, A. [Nuclear Physics Division, BARC, Mumbai (India); Ashokkumar,; Ganesan, S. [Reactor Physics Design Division, BARC, Mumbai (India); Kailas, S. [Nuclear Physics Division, BARC, Mumbai (India); Bhoraskar, V.N. [Department of Physics, University of Pune, Pune-411007 (India)], E-mail: vnb@physics.unipune.ernet.in

2008-04-01

The cross-sections for formation of metastable state of {sup 89}Zr ({sup 89}Zr{sup m}, 0.588 MeV, 4.16 m) through {sup 90}Zr(n,2n){sup 89}Zr{sup m} reaction induced by 13.73 MeV to 14.77 MeV neutrons were measured for the first time and also theoretically estimated using Empire-II and Talys programs. At 13.73 MeV neutron energy, the {sup 89}Zr nuclei can be excited to metastable state, {sup 89}Zr{sup m}, when the first and the second emitted neutrons have energies lower than the most probable energy {approx}0.64 MeV. The probability of exciting {sup 89}Zr nuclei to energy levels higher than 0.588 MeV and therefore of populating the metastable state through decay process increases with increasing neutron energy. The measured cross-sections vary from 41{+-}3mb to 221{+-}15mb over neutron energies 13.73 MeV to 14.77 MeV, and are in agreement with the cross-sections estimated using Empire-II code. The formation of {sup 89}Zr{sup m} is favoured when the first and the second reaction neutrons are emitted with the most probable energies rather than lower energy, except for 13.73 MeV neutrons.
45 CFR 148.220 - Excepted benefits.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Excepted benefits. 148.220 Section 148.220 Public... FOR THE INDIVIDUAL HEALTH INSURANCE MARKET Preemption; Excepted Benefits § 148.220 Excepted benefits... provision of the benefits described in paragraphs (a) and (b) of this section (or any combination of the...
Optimisation of 12 MeV electron beam simulation using variance reduction technique

International Nuclear Information System (INIS)

Jayamani, J; Aziz, M Z Abdul; Termizi, N A S Mohd; Kamarulzaman, F N Mohd

2017-01-01

Monte Carlo (MC) simulation for electron beam radiotherapy consumes a long computation time. An algorithm called variance reduction technique (VRT) in MC was implemented to speed up this duration. This work focused on optimisation of VRT parameter which refers to electron range rejection and particle history. EGSnrc MC source code was used to simulate (BEAMnrc code) and validate (DOSXYZnrc code) the Siemens Primus linear accelerator model with the non-VRT parameter. The validated MC model simulation was repeated by applying VRT parameter (electron range rejection) that controlled by global electron cut-off energy 1,2 and 5 MeV using 20 × 10 7 particle history. 5 MeV range rejection generated the fastest MC simulation with 50% reduction in computation time compared to non-VRT simulation. Thus, 5 MeV electron range rejection utilized in particle history analysis ranged from 7.5 × 10 7 to 20 × 10 7 . In this study, 5 MeV electron cut-off with 10 × 10 7 particle history, the simulation was four times faster than non-VRT calculation with 1% deviation. Proper understanding and use of VRT can significantly reduce MC electron beam calculation duration at the same time preserving its accuracy. (paper)
24 CFR 570.703 - Eligible activities.

Science.gov (United States)

2010-04-01

....705(b)(1). (l) Acquisition, construction, reconstruction, rehabilitation or historic preservation, or... the CDBG program account or line of credit for costs incurred by the public entity or designated... environmental assessment costs not otherwise eligible under § 570.205. (f) Site preparation, including...
Measurement of (n,/alpha/) cross sections of chromium, iron, and nickel in the 5- to 10-MeV neutron energy range

International Nuclear Information System (INIS)

Paulsen, A.; Liskien, H.; Arnotte, F.; Widera, R.

1981-01-01

A measuring program has been carried out at the Van de Graaff accelerator facility of the Central Bureau for Nuclear Measurements for the determination of (n,/alpha/) cross sections on the main constituents of fast reactor structural materials, namely the elements chromium, iron, and nickel. Results obtained in the energy range from 5 to 10 Mev are presented in terms of laboratory angle-differential cross sections, relative Legendre polynomial coefficients of angular distributions, angle-integrated cross sections, and average alpha energies. 13 refs
49 CFR 179.220-10 - Welding.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...
7 CFR 58.220 - Drying systems.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Drying systems. 58.220 Section 58.220 Agriculture....220 Drying systems. (a) Spray dryers. Spray dryers shall be of a continuous discharge type and all... filter system shall comply with the applicable requirements of the 3-A Accepted Practices for Milk and...
46 CFR 121.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Cooking equipment. 121.220 Section 121.220 Shipping... SYSTEMS AND EQUIPMENT Cooking and Heating § 121.220 Cooking equipment. (a) Doors on a cooking appliance... cooking appliance must be installed to prevent movement in heavy seas. (c) For a grill or similar type of...
Calibration of a dePangher long counter from 2 keV to 19 MeV

Energy Technology Data Exchange (ETDEWEB)

Slaughter, D R; Rueppel, D W [California Univ., Livermore (USA). Lawrence Livermore Lab.

1977-09-01

The authors have measured the sensitivity of a dePangher precision long counter (PLC) relative to /sup 7/Li(p,n), T(p,n), and T(d,n) differential cross sections over the neutron energy range 10 keV-19 MeV. Absolute sensitivity at 2 keV is also measured, using a scandium filtered beam at a reactor. Results obtained with errors in the range 5-30% are consistent with the assumption of a nearly constant sensitivity over the range 2 keV-6 MeV, but exhibit a reduction above 12 MeV.
49 CFR 570.59 - Service brake system.

Science.gov (United States)

2010-10-01

... 10,000 Pounds § 570.59 Service brake system. (a) Service brake performance. Compliance with any one of the following performance criteria will satisfy the requirements of this section. Verify that tire...
21 CFR 189.220 - Flectol H.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Flectol H. 189.220 Section 189.220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Addition to Human Food Through Food-Contact Surfaces § 189.220 Flectol H. (a) Flectol H is the chemical 1,2...
Inelastic proton scattering at 800 MeV to the 12C 15.11-MeV state: A search for nuclear critical opalescence

International Nuclear Information System (INIS)

Haji-Saeid, M.; Glashausser, C.; Igo, G.; Cornelius, W.; Gazzaly, M.; Irom, F.; McClelland, J.; Moss, J.M.; Pauletta, G.; Thiessen, H.A.; Whitten, C.A. Jr.

1980-01-01

The differential cross section for the reaction 12 C(p,p') 12 C* (15.11 MeV, 1 + , T=1) has been measured at 800 MeV; the range of the angular distribution corresponds to momentum transfers of 0.7--2.4 fm -1 [(1-3.3)m/sub π/]. The cross section decreases almost exponentially at large angles; no maximum is observed in the region where nuclear critical opalescence might be expected
Number transmission of 0.6 and 0.8MeV electrons in elemental materials

International Nuclear Information System (INIS)

Harami, Taikan; Takagaki, Torao; Matsuda, Koji; Nakai, Yohta.

1975-01-01

The number transmissions of electrons in Be, Al, Cu and Ag were obtained experimentally for well collimated electron beams of 0.6 and 0.8 MeV. Experimental results of the present work join smoothly to the previous ones of 1.0 MeV to 2.0 MeV electrons. The ratios of extrapolated range Rsub(ex) to true range R 0 give generally minimum values near 1 MeV (approximately 2mc 2 ) as well as the stopping power. An investigation was done for empirical equation of the form eta=exp(-xP/CEsup(m)), where E is the incident electron energy, x, penetration depth, and p, C and m are the parameters determined from experimental data. (author)
48 CFR 2009.570-2 - Definitions.

Science.gov (United States)

2010-10-01

... ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570-2 Definitions... concern or individual controls or has the power to control another, or when a third party controls or has the power to control both. Contract means any contractual agreement or other arrangement with the NRC...
29 CFR 570.115 - Joint applicability.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor... 12(a) and 12(c) § 570.115 Joint applicability. The child labor coverage provisions contained in...
Measurement of (n,Xn) reaction cross sections at 96 MeV

International Nuclear Information System (INIS)

Sagrado Garcia, Melle Inmaculada C.

2006-10-01

Nucleon induced reactions in the 20-200 MeV energy range are intensively studied since a long time. The evaporation and the pre-equilibrium processes correspond to an important contribution of the production cross section in these reactions. Several theoretical approaches have been proposed and their predictions must be tested. The experimental results shown in this work are the only complete set of data for the (n,Xn) reactions in this energy range. Neutron double differential cross section measurements using lead and iron targets for an incident neutron beam at 96 MeV were carried out at TSL Laboratory in Uppsala, Sweden. The measurements have been performed for the first time with an energy threshold of 2 MeV and for a wide angular range (15 angle - 98 angle). Neutrons have been detected using two independent setups, DECOI and DEMON and CLODIA and SCANDAL, in order to cover the whole energy range (2-100) MeV. The angular distributions, the differential cross sections and the total inelastic production cross sections have been calculated using the double differential cross sections. The comparison between the experimental data and the predictions given by two of the most popular simulation codes, GEANT3 and MCNPX, have been performed, as well as the comparison with the predictions of the microscopic simulation model DYWAN, selected for its treatment of nucleon-nucleon reactions. (author)
Response of E. coli AB2463 recA to fast neutron beams with mean energies in the range 4 to 27 MeV

Energy Technology Data Exchange (ETDEWEB)

Redpath, J L [Michael Reese Hospital, Chicago, Ill. (USA)

1978-07-01

The radiosensitivity of E.coli AB2463 recA, given as the reciprical of the mean lethal dose, Do/sup -1/, has been shown to be the same for four fast neutron beams with widely different energy spectra. It is proposed that this organism can be used to intercompare dosimetry on fast neutron beams with mean energies in the range 4 to 25 MeV with an accuracy of +- 5%.
Neutron scattering differential cross sections of carbon and bismuth at 37 MeV

International Nuclear Information System (INIS)

Zhou Zuying; Tang Hongqing; Qi Bujia; Zhou Chenwei; Du Yanfeng; Xia Haihong; Walter, R.L.; Tornow, W.; Howell, C.; Braun, R.; Roper, C.; Chen Zemin; Chen Zhengpeng; Chen Yingtang

1997-01-01

Elastic differential cross sections of 37 MeV neutrons scattered from carbon and bismuth were measured in the angular range 11 to 160 degrees by means of the multi-detector TOF facility. The 37 MeV neutrons were produced via the T(d,n) 4 He reaction in a tritium gas target. The pulsed 20 MeV deuteron beam was provided by the HI-13 tandem accelerator. The angular distribution of scattered neutrons from carbon and bismuth were measured in the angular range 11 degree to 145 degree and 11 degree to 160 degree respectively in steps of about 3 degree
2 CFR 801.220 - What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered...

Science.gov (United States)

2010-01-01

... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered transactions? 801.220 Section 801.220 Grants and... DEBARMENT AND SUSPENSION Covered Transactions § 801.220 What contracts and subcontracts, in addition to...

49 CFR 220.3 - Application.

Science.gov (United States)

2010-10-01

... general railroad system of transportation; or (2) Rapid transit operations in an urban area that are not... 49 Transportation 4 2010-10-01 2010-10-01 false Application. 220.3 Section 220.3 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF...
Scattering of 130 MeV helions on 58Ni

International Nuclear Information System (INIS)

Djaloeis, A.; Alderliesten, C.; Bojowald, J.; Oelert, W.; Turek, P.

1982-01-01

Angular distributions for the tau + 58 Ni scattering to the (g.s., 0 + ) (1.45 MeV, 2 + ) and giant resonance (Esub(x) approximately 63Asup(-1/3) MeV) states in 58 Ni have been measured at Esub(tau) = 130 MeV in an angular range thetasub(c.m.) = 6 0 -83 0 . Optical model and DWBA analyses have been performed. The use of helion optical potentials with either a volume (Woods-Saxon) or a surface (Woods-Saxon derivative) absorption results in good fits to the g.s. and 1.45 MeV data. However, the volume absorption gives consistently a better fit quality. The discrete ambiguity of the helion optical potential has been resolved in favour of the shallow potential family. The giant resonance is found to have a dominant quadrupole (L=2) character with about 6% (EWSR) L=4 admixture. (Auth.)
Cross sections and differential spectra for reactions of 2-20 MeV neutrons on /sup nat/Cr

International Nuclear Information System (INIS)

Blann, M.; Komoto, T.T.

1988-01-01

This report summarizes product yields, secondary n,p and α spectra, and γ-ray spectra calculated for incident neutrons of 2 to 20 MeV on /sup nat/Cr targets. Results are all from the code ALICE, using the version ALISO which does weighting of results for targets which are a mix of isotopes. Where natural isotopic targets are involved, yields and n,p,α spectra will be reported weighted over isotopic yields. Gamma-ray spectra, however, will be reported for the most abundant isotope. We present product yields versus incident neutron energy, n,p,α spectra versus incident neutron energy, and calculated γ-ray spectra
Energy dependence of relative abundances and periods of delayed neutron separate groups from neutron induced fission of 239Pu in the virgin neutron energy range 0.37-4.97 MeV

International Nuclear Information System (INIS)

Piksajkin, V.M.; Kazakov, L.E.; Isaev, S.T.; Korolev, G.G.; Roshchenko, V.A.; Tertychnyj, R.G.

2002-01-01

Relative yield and group period of delayed neutrons induced by the 239 Pu fission in the 0.37-4.97 MeV range were measured. Comparative analysis of experimental data was conducted in terms of middle period of half-life of delayed neutron nuclei-precursors. Character and scale of changing values of delayed neutron group parameters as changing excitation energy of fission compound-nucleus have been demonstrated for the first time. Considerable energy dependence of group parameters under the neutron induced 239 Pu fission that was expressed by the decreasing middle period of half-life of nuclei-precursors by 10 % in the 2.85 eV - 5 MeV range of virgin neutrons was detected [ru
24 CFR 570.482 - Eligible activities.

Science.gov (United States)

2010-04-01

... certification from the assisted business that neither it, nor any of its subsidiaries, has plans to relocate... Block Grant Program § 570.482 Eligible activities. (a) General. The choice of activities on which block... accordance with the state's program design and procedures, as to which approach or approaches will best serve...
48 CFR 803.570-1 - Policy.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 803.570-1 Policy. It is VA policy that contractors will not advertise the award of contracts or refer to VA contracts in contractors' commercial advertising in such a manner as to state or imply that VA endorses a...
Study of the /sup 12/N 2. 43 MeV level. [Differential cross sections; 44 MeV /sup 3/He; 52 MeV p

Energy Technology Data Exchange (ETDEWEB)

Cecil, F E; Shepard, J R; Sercely, R R; Peterson, R J [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; King, N S.P. [California Univ., Davis (USA). Crocker Nuclear Lab.

1976-10-11

The differential cross sections have been measured for the reactions /sup 12/C(/sup 3/He, /sup 3/He')/sup 12/C(17.77 MeV 0/sup +/ T = 1) and /sup 12/C(/sup 3/He, t)/sup 12/N(2.43 MeV) at Esub(/sup 3/He) = 44 MeV. The similar shapes of the angular distributions and the relative magnitudes of the cross sections suggest that the /sup 12/N 2.43 MeV level is the 0/sup +/ T = 1 analog to the /sup 12/C 17.77 MeV level. The reaction /sup 14/N(p, t)/sup 12/N(2.43 MeV) at Esub(p) = 52 MeV is also studied. The strength with which this level is excited in this reaction is consistent with reasonable two-step calculations assuming the 2.43 MeV level to have Jsup(..pi..) = 0/sup +/.
38 CFR 52.220 - Transportation.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Transportation. 52.220... FOR ADULT DAY HEALTH CARE OF VETERANS IN STATE HOMES Standards § 52.220 Transportation. Transportation... management must provide or contract for transportation to enable participants, including persons with...
Soil as a source of indoor 220Rn

International Nuclear Information System (INIS)

Li, Y.; Schery, S.D.; Turk, B.

1992-01-01

Two suggestions for sources of indoor 220Rn (thoron) have appeared in the literature: (1) building materials and outside air, and (2) soil beneath the house. Due to the difficulty of 220Rn measurement and limited data, both suggestions lack sufficient supporting evidence. We have investigated sources of indoor 220Rn in seven occupied houses in northern New Mexico, U.S. A two-filter system was used to measure indoor 220Rn levels continuously, and 220Rn progeny were measured with single filters and specialized alpha-track detectors. The amount of 220Rn entry from soil was curtailed by cutting off soil gas flow to the indoor air with subfloor depressurization mitigation systems. Four of the houses showed significant reductions in 220Rn with mitigation systems on. The average effect for these houses was to reduce indoor 220Rn levels by 70%. The other three houses had no clear reductions but in one of these houses, the mitigation system was not effective for stopping soil gas flow. Our results provide some of the most clear evidence to date supporting soil as an important source of indoor 220Rn
49 CFR 220.38 - Communication equipment failure.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Communication equipment failure. 220.38 Section 220.38 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... § 220.38 Communication equipment failure. (a) Any radio or wireless communication device found not to be...
24 CFR 220.801 - Initial insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Initial insurance endorsement. 220.801 Section 220.801 Housing and Urban Development Regulations Relating to Housing and Urban... AREAS Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.801 Initial...
Studying the Range of Incident Alpha Particles on Cu , Ge , Ag , Cd , Te and Au, With Energy (4-15 MeV)

International Nuclear Information System (INIS)

Kadhim, R.O.; Jasim, W.N.

2015-01-01

In this paper theoretical calculation of the range for alpha particles with the energy range (4 – 15)MeV when passing in some metallic media (Cu , Ge , Ag , Cd , Te and Au).Semi empirical formula was used in addition to (SRIM-2012) program. The Semi empirical equation was programmed to calculate the range using Matlab Language.The results of the range in these media were compared with the results obtained from SRIM-2012 and )(2011)Andnet) results.There was good agreement among the semi empirical equation result , SRIM- 2012 results and with )(2011)Andnet) results in the low energy.The results showed exponential relation between the range of alpha particles in these media and the velocity of the particles.By recourse with SRIM- 2012 results and application them in Matlab program and by using Curve Fitting Tool we extraction equation with its constants to calculate the range of alpha particles in any element of these six elements with the energy range (4 – 15)MeV.The maximum deviation between the results from the semi empirical calculation and SRIM-2012 results was calculated the statistical test ( kstest2) in Matlab program
48 CFR 570.110 - Cost or pricing data and information other than cost or pricing data.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Cost or pricing data and information other than cost or pricing data. 570.110 Section 570.110 Federal Acquisition Regulations System... PROPERTY General 570.110 Cost or pricing data and information other than cost or pricing data. (a) The...
49 CFR 220.301 - Purpose and application.

Science.gov (United States)

2010-10-01

... being distracted by the inappropriate use of electronic devices, such as mobile telephones (cell phones... 49 Transportation 4 2010-10-01 2010-10-01 false Purpose and application. 220.301 Section 220.301..., DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices § 220.301 Purpose and application. (a...
20 CFR 220.63 - Conflict of interest.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Conflict of interest. 220.63 Section 220.63 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.63 Conflict of interest. All implications of possible conflict of...
Measurement of neutron-induced fission cross-sections of Th232, U238, U233 and Np237 relative to U235 from 1 MeV to 200 MeV

Energy Technology Data Exchange (ETDEWEB)

Shcherbakov, O.A.; Laptev, A.B.; Petrov, G.A. [Petersburg Nuclear Physics Inst., Gatchina, Leningrad district (Russian Federation); Fomichev, A.V.; Donets, A.Y.; Osetrov, O.I.

1998-11-01

The measurements of neutron-induced cross-section ratios for Th232, U238, U233 and Np237 relative to U235 have been carried out in the energy range from 1 MeV up to 200 MeV using the neutron time-of-flight spectrometer GNEIS based on 1 GeV proton synchrocyclotron. Below 20 MeV, the results of present measurements are roughly in agreement with evaluated data though there are some discrepances to be resolved. (author)
29 CFR 570.106 - “Ship or deliver for shipment in commerce”.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false âShip or deliver for shipment in commerceâ. 570.106 Section 570.106 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of...
7 CFR 3052.220 - Frequency of audits.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Frequency of audits. 3052.220 Section 3052.220 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 3052.220...
Measurement of neutron activation cross sections in the energy range between 2 and 7 MeV by using a Ti-deuteron target and a deuteron gas target

Energy Technology Data Exchange (ETDEWEB)

Senga, T.; Sakane, H.; Shibata, M.; Yamamoto, H.; Kawade, K. [Nagoya Univ. (Japan); Kasugai, Yoshimi; Ikeda, Yujiro; Takeuchi, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

2000-03-01

Using a Ti-deuteron target in the neutron energy range between 2 and 4.5 MeV and a deuteron gas target between 4.5 and 7 MeV, mono-energetic neutrons could be generated enough for activation cross section measurements. The KN-3750 Van de Grraff accelerator at Nagoya University and the Fusion Neutronics Source (FNS) at Japan Atomic Energy Research Institute (JAERI) were used. Preliminary results of activation cross sections were obtained for reactions of {sup 27}Al(n,p){sup 27}Mg, {sup 47}Ti(n,p){sup 47}Sc, {sup 58}Ni(n,p){sup 58}Co. The evaluation data of JENDL-3.2 showed reasonable agreement with our results. (author)
Photon mass energy absorption coefficients from 0.4 MeV to 10 MeV for silicon, carbon, copper and sodium iodide

International Nuclear Information System (INIS)

Oz, H.; Gurler, O.; Gultekin, A.; Yalcin, S.; Gundogdu, O.

2006-01-01

The absorption coefficients have been widely used for problems and applications involving dose calculations. Direct measurements of the coefficients are difficult, and theoretical computations are usually employed. In this paper, analytical equations are presented for determining the mass energy absorption coefficients for gamma rays with an incident energy range between 0.4 MeV and 10 MeV in silicon, carbon, copper and sodium iodide. The mass energy absorption coefficients for gamma rays were calculated, and the results obtained were compared with the values reported in the literature.

Photon mass energy absorption coefficients from 0.4 MeV to 10 MeV for silicon, carbon, copper and sodium iodide

Energy Technology Data Exchange (ETDEWEB)

Oz, H.; Gurler, O.; Gultekin, A. [Uludag University, Bursa (Turkmenistan); Yalcin, S. [Kastamonu University, Kastamonu (Turkmenistan); Gundogdu, O. [University of Surrey, Guildford (United Kingdom)

2006-07-15

The absorption coefficients have been widely used for problems and applications involving dose calculations. Direct measurements of the coefficients are difficult, and theoretical computations are usually employed. In this paper, analytical equations are presented for determining the mass energy absorption coefficients for gamma rays with an incident energy range between 0.4 MeV and 10 MeV in silicon, carbon, copper and sodium iodide. The mass energy absorption coefficients for gamma rays were calculated, and the results obtained were compared with the values reported in the literature.
12 CFR 19.220 - Scope.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Scope. 19.220 Section 19.220 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Procedures for... the OCC pursuant to section 38 of the Federal Deposit Insurance Act and this part. ...
20 CFR 220.35 - Introduction.

Science.gov (United States)

2010-04-01

... term is defined in the Social Security Act. In making these decisions the Board must apply the... Services in making disability decisions under the Social Security Act. Regulations of the Social Security... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 220.35 Section 220.35 Employees...
XRD study of yttria stabilized zirconia irradiated with 7.3 MeV Fe, 10 MeV I, 16 MeV Au, 200 MeV Xe and 2.2 GeV Au ions

Energy Technology Data Exchange (ETDEWEB)

Nakano, K.; Yoshizaki, H. [Department of Materials Science, Osaka Prefecture University, Sakai, Osaka 599-8531 (Japan); Saitoh, Y. [Takasaki Advanced Radiation Research Institute, Japan Atomic Energy Agency, Takasaki, Gunma 370-1292 (Japan); Ishikawa, N. [Tokai Research and Development Center, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Iwase, A., E-mail: iwase@mtr.osakafu-u.ac.jp [Department of Materials Science, Osaka Prefecture University, Sakai, Osaka 599-8531 (Japan)

2016-03-01

To simulate energetic neutron irradiation effects, yttria-stabilized zirconia (YSZ) which is one of the major materials for electrical corrosion potential sensors (ECP sensors) was irradiated with heavy ions at energies ranging from 7.3 MeV to 2.2 GeV. Ion irradiation effects on the lattice structure were analyzed using the X-ray diffraction (XRD). The increase in lattice constant was induced by the ion irradiation. It was dominated by the elastic collision process and not by the electronic excitation process. The lattice disordering which was observed as a broadening of XRD peaks was also induced by the irradiation especially for 200 MeV Xe ion irradiation. The present result suggests that the expansion and/or the disordering of YSZ lattice induced by energetic neutrons may affect the durability of a joint interface between a metal housing and YSZ membrane for the usage of ECP sensors in nuclear power reactors.
Application of calorimeters for 5 MeV EB and bremsstrahlung dosimetry

DEFF Research Database (Denmark)

Sato, T.; Takahashi, T.; Saito, T.

1993-01-01

Graphite and water calorimeters, which were developed for use a 10 MeV electron beams (EB) at Riso National Laboratory, were used for process validation and routine dosimeter calibration at a 5 MeV EB. Water calorimeters were used for reference measurements for 5 MeV EB, the response was found...... to be directly proportional to the beam current and the variation among three water calorimeters was less than +/- 2 % in the range of 10 to 40 kGy. CTA, PMMA, RCD dosimeters were calibrated by irradiating the dosimeters and water calorimeters Simultaneously. The water calorimeter was proved to be an useful tool...... at 5 MeV EB. Graphite calorimeters gave reproducible readings within 3.3 % relative errors (95 % confidence level) for X-ray measurement....
Application of calorimeters for 5 MeV EB and bremsstrahlung dosimetry

International Nuclear Information System (INIS)

Sato, Toshio; Takahashi, Toru; Saito, Toshio; Takehisa, Masaaki; Miller, A.

1993-01-01

Graphite and water calorimeters, which were developed for use with 10 MeV electron beams (EB) at Riso National Laboratory, were used for process validation and routine dosimeter calibration at a 5 MeV EB. Water calorimeters were used for reference measurements for 5 MeV EB, the response was found to be directly proportional to the beam current and the variation among three water calorimeters was less than ± 2% in the range of 10 to 40 kGy. CTA PMMA RCD dosimeters were calibrated by irradiating the dosimeters and water calorimeters simultaneously. The water calorimeter was proved to be an useful tool at 5 MeV EB. Graphite calorimeters gave reproducible readings within 3.3 % relative errors (95% confidence level) for X-ray measurement. (Author)
46 CFR 402.220 - Registration of pilots.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 402.220 Section 402.220 Shipping... ORDERS Registration of Pilots § 402.220 Registration of pilots. (a) Each applicant pilot must complete the number of round trips specified in this section prior to registration as a U.S. registered pilot...
46 CFR 401.220 - Registration of pilots.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 401.220 Section 401.220 Shipping... Registration of Pilots § 401.220 Registration of pilots. (a) The Director shall determine the number of pilots... waters of the Great Lakes and to provide for equitable participation of United States Registered Pilots...
29 CFR 99.220 - Frequency of audits.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Frequency of audits. 99.220 Section 99.220 Labor Office of the Secretary of Labor AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 99.220 Frequency of audits. Except for the provisions for biennial audits provided in paragraphs (a) and...
Pion production from deuterium by the bombardment with polarized protons of 277 and 500 MeV

International Nuclear Information System (INIS)

Lolos, G.J.; Auld, E.G.; Giles, G.; Jones, G.; McParland, B.; Ottewell, D.; Walden, P.L.; Zeigler, W.

1982-11-01

Analyzing power measurements of the (anti) pd → tπ + reaction are reported at incident proton energies of 277 and 500 MeV. The 277 MeV results span the angular range from 70 0 to 130 0 in the centre of mass while the two 500 MeV measurements at large angles were taken as a check of published results. With the angular distribution of the analyzing power at 277 MeV being now available, an examination of the energy dependence of the analyzing power shows that it exhibits characteristics closely resembling the shape and magnitude of the distribution observed for nuclei in the 9-12 mass range
29 CFR 570.9 - States in which State certificates of age are accepted.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false States in which State certificates of age are accepted. 570.9 Section 570.9 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of...
Neutron-induced fission cross-section of 233U, 241Am and 243Am in the energy range 0.5 MeV ≤ En ≤ 20 MeV

International Nuclear Information System (INIS)

Belloni, F.; Milazzo, P.M.; Calviani, M.

2011-01-01

Neutron-induced fission cross-sections of 233 U, 241 Am and 243 Am relative to 235 U have been measured in a wide energy range at the neutron time of flight facility n-TOF in Geneva to address the present discrepancies in evaluated and experimental databases for reactions and isotopes relevant for transmutation and new generation fast reactors. A dedicated fast ionization chamber was used. Each isotope was mounted in a different cell of the modular detector. The measurements took advantage of the characteristics of the n-TOF installation. Its intrinsically low background, coupled to its high instantaneous neutron flux, results in high accuracy data. Its wide energy neutron spectrum helps to reduce systematic uncertainties due to energy-domain matching problems while the 185 m flight path and a 6 ns pulse width assure an excellent energy resolution. This paper presents results obtained between 500 keV and 20 MeV neutron energy. (authors)
12 CFR 220.6 - Good faith account.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Good faith account. 220.6 Section 220.6 Banks... BY BROKERS AND DEALERS (REGULATION T) § 220.6 Good faith account. In a good faith account, a creditor...) Securities entitled to good faith margin—(1) Permissible transactions. A creditor may effect and finance...
CSDA range, stopping power and mean penetration depth energy relationships in some hydrocarbons and biologic materials for 10 eV to 100 MeV with the modified Rohrlich-Carlson model

Energy Technology Data Exchange (ETDEWEB)

Guemues, Hasan [Ondokuz Mayis University, Department of Physics, Faculty of Sciences and Arts, Samsun (Turkey); Bentabet, Abdelouahab [Bordj Bou Arreridj University, LCVRN, SNVSTU Faculty, El Anasser (Algeria)

2017-05-15

In this study, for some hydrocarbons and biological compounds, stopping power formula are presented, being valid for low and intermediate electron energies. In addition, calculation of the continuous slowing down approximation range (CSDA range) from the stopping power is also made. Calculation of the CSDA range for some hydrocarbons: C{sub 2}H{sub 6} (ethane), C{sub 4}H{sub 10} (butane), C{sub 6}H{sub 14} (hexane) C{sub 8}H{sub 18} (octane), C{sub 5}H{sub 5}N{sub 5} (adenine) and C{sub 5}H{sub 5}N{sub 5}O (guanine) have been introduced for incident electrons in the energy range 30 eV to 1 MeV. The range of electrons has been calculated within the continuous slowing down approximation (CSDA) using modified Rohrlich and Carlson formula of stopping power. Besides, we have calculated the mean penetration depths using a spherical geometric model developed by Bentabet (Vacuum 86:1855-1859, 35). The results have been compared with the other theoretical results, Monte Carlo code such as PENELOPE predictions and semi-empirical results. The calculated results of CSDA ranges for electrons in the energy range from 20 eV to 100 MeV are found to be in good agreement to within 10% with available date. (orig.)
29 CFR 570.33 - Prohibited occupations for minors 14 and 15 years of age.

Science.gov (United States)

2010-07-01

... 28448, May 20, 2010, § 570.33 was revised, effective July 19, 2010. For the convenience of the user, the... as permitted by § 570.34(i). (j) Youth peddling, which entails the selling of goods or services to...
24 CFR 220.811 - Date of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Date of default. 220.811 Section... and Obligations-Projects Insured Project Improvement Loans § 220.811 Date of default. For the purposes of §§ 220.800 et seq., the date of default shall be considered as: (a) The date of the first...
24 CFR 220.812 - Notice of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Notice of default. 220.812 Section... and Obligations-Projects Insured Project Improvement Loans § 220.812 Notice of default. (a) If the default as defined in § 220.810 is not cured within the 30 day grace period, the lender shall, within 30...
Enhanced diffusion of dopants in vacancy supersaturation produced by MeV implantation

International Nuclear Information System (INIS)

Venezia, V.C.; Univ. of North Texas, Denton, TX; Haynes, T.E.; Agarwal, A.; Lucent Technologies, Murray Hill, NJ; Gossmann, H.J.; Eaglesham, D.J.

1997-04-01

The diffusion of Sb and B markers has been studied in vacancy supersaturations produced by MeV Si implantation in float zone (FZ) silicon and bonded etch-back silicon-on-insulator (BESOI) substrates. MeV Si implantation produces a vacancy supersaturated near-surface region and an interstitial-rich region at the projected ion range. Transient enhanced diffusion (TED) of Sb in the near surface layer was observed as a result of a 2 MeV Si + , 1 x 10 16 /cm 2 , implant. A 4x larger TED of Sb was observed in BESOI than in FZ silicon, demonstrating that the vacancy supersaturation persists longer in BESOI than in FZ. B markers in samples with MeV Si implant showed a factor of 10x smaller diffusion relative to markers without the MeV Si + implant. This data demonstrates that a 2 MeV Si + implant injects vacancies into the near surface region
Validering av Evolution 220

OpenAIRE

Krakeli, Tor-Arne

2013-01-01

- Det har blitt kjøpt inn et nytt spektrofotometer (Evolution 220, Thermo Scientific) til BioLab Nofima. I den forbindelsen har det blitt utført en validering som involverer kalibreringsstandarder fra produsenten og en test på normal distribusjon (t-test) på to metoder (Total fosfor, Tryptofan). Denne valideringen fant Evolution 220 til å være et akseptabelt alternativ til det allerede benyttede spektrofotometeret (Helios Beta). På bakgrunn av noen instrumentbegrensninger må de aktuelle an...
Calculation of the energy spectrum of atmospheric gamma-rays between 1 and 1000 MeV

International Nuclear Information System (INIS)

Martin, I.M.; Dutra, S.L.G.; Palmeira, R.A.R.

The energy spectrum of atmospheric gamma-rays at 4 g/cm 2 has been calculated for cut-off rigidities of 4.5, 10 and 16 GV. The considered processes for the production of these gamma-rays were the π 0 decay plus the bremsstrahlung from primary, secondary like splash and re-entrant albedo electrons. The calculations indicated that the spectrum could be fitted to a power law in energy, with the exponential index varying from 1.1 in the energy range 1 - 10 MeV, to 1.4 in the energy range 10 - 200 MeV and 1.8 in the energy range 200 - 1000 MeV. These results are discussed [pt

Measurement of activation yields for platinum group elements using Bremsstrahlung radiation with end-point energies in the range 11-14 MeV

Energy Technology Data Exchange (ETDEWEB)

Tickner, James, E-mail: james.tickner@csiro.a [CSIRO Process Science and Engineering, PMB 5, Menai, NSW 2234 (Australia); Bencardino, Raffaele; Roach, Greg [CSIRO Process Science and Engineering, PMB 5, Menai, NSW 2234 (Australia)

2010-01-15

Activation yields have been measured for (gamma,n) reactions of the elements Ru, Rh, Pd, Ir and Pt. Metallic foils of natural isotopic composition were irradiated using Bremsstrahlung radiation produced from an electron linear accelerator operated with electron beam energies in the range 11-14 MeV. Activation products, including both unstable ground states and metastates were measured using a high-purity germanium detector. Cross-sections were estimated from the yield data by assuming a simple two-parameter model for the shape of the cross-section with energy.
Measurement of activation yields for platinum group elements using Bremsstrahlung radiation with end-point energies in the range 11-14 MeV

International Nuclear Information System (INIS)

Tickner, James; Bencardino, Raffaele; Roach, Greg

2010-01-01

Activation yields have been measured for (γ,n) reactions of the elements Ru, Rh, Pd, Ir and Pt. Metallic foils of natural isotopic composition were irradiated using Bremsstrahlung radiation produced from an electron linear accelerator operated with electron beam energies in the range 11-14 MeV. Activation products, including both unstable ground states and metastates were measured using a high-purity germanium detector. Cross-sections were estimated from the yield data by assuming a simple two-parameter model for the shape of the cross-section with energy.
21 CFR 570.30 - Eligibility for classification as generally recognized as safe (GRAS).

Science.gov (United States)

2010-04-01

...), it may be used in food only within such limitation(s) (including the category of food(s), the... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Eligibility for classification as generally recognized as safe (GRAS). 570.30 Section 570.30 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF...
Amorphization kinetics of Zr3Fe under electron irradiation

International Nuclear Information System (INIS)

Motta, A.T.; Howe, L.M.; Okamoto, P.R.

1992-10-01

0.9 MeV electron irradiations were performed at 28--220 K in a high-voltage electron microscope (HVEM). By measuring onset, spread and final size of the amorphous region, factoring in the Guassian distribution of the beam, a kinetic description of the amorphization in terms of dose, dose rate and temperature was obtained. The critical temperature for amorphization by electron irradiation was found to be ∼220 K, compared to 570--625 K for 40 Ar ion irradiation. Also, the dose-to-amorphization increased exponentially with temperature. Results indicated that the rate of growth of the amorphous region under the electron beam decreased with increasing temperature and the does-to-amorphization decreased with increasing dose rate. The size of the amorphous region saturated after a region dose, the final size decreasing with increasing temperature, and it was argued that this is related to the existence of a critical dose rate, which increased with temperature, below which no amorphization occurred. The above observations can be understood in the framework of the kinetics of damage accumulation under irradiation
Liquid argon as an electron/photon detector in the energy range of 50 MeV to 2 GeV: a Monte Carlo investigation

International Nuclear Information System (INIS)

Goodman, M.S.; Denis, G.; Hall, M.; Karpovsky, A.; Wilson, R.; Gabriel, T.A.; Bishop, B.L.

1980-12-01

Monte Carlo techniques which have been used to study the characteristics of a proposed electron/photon detector based on the total absorption of electromagnetic showers in liquid argon have been investigated. The energy range studied was 50 MeV to 2 GeV. Results are presented on the energy and angular resolution predicted for the device, along with the detailed predictions of the transverse and longitudinal shower distributions. Comparisons are made with other photon detectors, and possible applications are discussed
Calculation of neutron cross sections on iron up to 40 MeV

International Nuclear Information System (INIS)

Arthur, E.D.; Young, P.G.

1980-01-01

The development of high energy d + Li neutron sources for fusion materials radiation damage studies will require neutron cross sections up to 40 MeV. Experimental data above 15 MeV are generally sparse or nonexistent, and reliance must be placed upon nuclear-model calculations to produce the needed cross sections. To satisfy such requirements for the Fusion Materials Irradiation Test Facility (FMIT), neutron cross sections have been calculated for 54 56 Fe between 3 and 40 MeV. These results were joined to the existing ENDF/B-V evaluation below 3 MeV. In this energy range, most neutron reactions can be described using the Hauser-Feshbach statistical model with corrections for preequilibrium and direct-reaction effects. To properly use these models to obtain realistic cross sections, emphasis must be placed upon the determination of suitable input parameters (optical model sets, gamma-ray strength functions, level densities) valid over the energy range of the calculation. To do this, several types of independent data were used to arrive at consistent parameter sets as described
Measurement of the neutron fields produced by a 62 MeV proton beam on a PMMA phantom using extended range Bonner sphere spectrometers

Energy Technology Data Exchange (ETDEWEB)

Amgarou, K. [Grup de Recerca en Radiacions Ionitzants, Departament de Fisica, Universitat Autonoma de Barcelona, E-08193 Bellaterra (Spain); Bedogni, R., E-mail: roberto.bedogni@lnf.infn.it [INFN-Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Frascati, Via E. Fermi n. 40, 00044 Frascati (Italy); Domingo, C. [Grup de Recerca en Radiacions Ionitzants, Departament de Fisica, Universitat Autonoma de Barcelona, E-08193 Bellaterra (Spain); Esposito, A.; Gentile, A.; Carinci, G. [INFN-Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Frascati, Via E. Fermi n. 40, 00044 Frascati (Italy); Russo, S. [INFN-Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali del Sud, via S. Sofia 44, 95123 Catania (Italy)

2011-10-21

The experimental characterization of the neutron fields produced as parasitic effect in medical accelerators is assuming an increased importance for either the patient protection or the facility design aspects. Medical accelerators are diverse in terms of particle type (electrons or hadrons) and energy, but the radiation fields around them have in common (provided that a given threshold energy is reached) the presence of neutrons with energy span over several orders of magnitude. Due to the large variability of neutron energy, field or dosimetry measurements in these workplaces are very complex, and in general, cannot be performed with ready-to-use commercial instruments. In spite of its poor energy resolution, the Bonner Sphere Spectrometer (BSS) is the only instrument able to simultaneously determine all spectral components in such workplaces. The energy range of this instrument is limited to E<20 MeV if only polyethylene spheres are used, but can be extended to hundreds of MeV by including metal-loaded spheres (extended range BSS, indicated with ERBSS). With the aim of providing useful data to the scientific community involved in neutron measurements at hadron therapy facilities, an ERBSS experiment was carried out at the Centro di AdroTerapia e Applicazioni Nucleari Avanzate (CATANA) of INFN-LNS (Laboratori Nazionali del Sud), where a proton beam routinely used for ophthalmic cancer treatments is available. The 62 MeV beam was directed towards a PMMA phantom, simulating the patient, and two neutron measurement points were established at 0{sup o} and 90{sup o} with respect to the beam-line. Here the ERBSS of UAB (Universidad Autonoma de Barcelona-Grup de Fisica de les Radiacions) and INFN (Istituto Nazionale di Fisica Nucleare-Laboratori Nazionali di Frascati) were exposed to characterize the 'forward' and 'sideward' proton-induced neutron fields. The use of two ERBSS characterized by different set of spheres, central detectors, and
CompTIA A+ complete study guide exams 220-801 and 220-802

CERN Document Server

Docter, Quentin; Skandier, Toby

2012-01-01

CompTIA Authorized, fully updated Study Guide for the leading IT certification: CompTIA A+ CompTIA A+ is the de facto certification for IT technicians. Some vendors even require employees to achieve certification as part of their job training. This book prepares you for both required exams: 220-801 and 220-802. Totally updated to cover the 2012 exams, this popular prep guide covers all the exam objectives. Readers will also have access to additional study tools, including the Sybex Test Engine with bonus practice exams, electronic flashcards, and a glossary of important terms in searchable PD
Two body photodisintegration of the deuteron from 100 to 800 MeV

International Nuclear Information System (INIS)

Crawford, R.; Annand, J.R.M.; Anthony, I.; Altieri, S.; Pavia Univ.; Audit, G.; D'Hose, N.

1996-01-01

The total and the differential cross sections for the D(γ,p)n reaction have been measured over the photon energy range 100-800 MeV at the 855 MeV MAMI Microtron in Mainz. The data are presented in the form of thirty-five angular distributions at c.m. proton angles between 30 deg-160 deg in 10 deg intervals and at photon energies in steps of 20 MeV. Previous experimental work is reassessed in the light of the present results and the results compared with some recent theoretical calculations. (author)
24 CFR 570.466 - Additional application submission requirements for Pockets of Poverty-employment opportunities.

Science.gov (United States)

2010-04-01

... requirements for Pockets of Poverty-employment opportunities. 570.466 Section 570.466 Housing and Urban... application submission requirements for Pockets of Poverty—employment opportunities. Applicants for Action Grants under the Pockets of Poverty provision must describe the number and, to the extent possible, the...
29 CFR 570.119 - Fourteen-year minimum.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Oppressive Child Labor § 570.119 Fourteen-year...
29 CFR 570.118 - Sixteen-year minimum.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Oppressive Child Labor § 570.118 Sixteen-year...
Violence of heavy-ion reactions from neutron multiplicity: 11 to 20A MeV /sup 20/Ne+ /sup 238/U

International Nuclear Information System (INIS)

Jahnke, U.; Ingold, G.; Hilscher, D.; Lehmann, M.; Schwinn, E.; Zank, P.

1986-01-01

The suitability of the neutron multiplicity as a gauge for the violence of medium-energy heavy-ion reactions is investigated for the first time. For this purpose the number of neutrons emitted from fission reactions induced by 220-, 290-, and 400-MeV /sup 20/Ne on /sup 238/U is registered event-by-event with a large 4π scintillator tank. It is shown that the neutron multiplicity is indeed closely related to the two quantities characterizing the violence: the induced total intrinsic excitation and the linear momentum transfer
Calorimetry for absorbed dose measurement at 1-4 MeV electron accelerators

International Nuclear Information System (INIS)

Miller, A.

2000-01-01

Calorimeters are used for dose measurement, calibration and intercomparisons at industrial electron accelerators, and their use at 10 MeV electron accelerators is well documented. The work under this research agreement concerns development of calorimeters for use at electron accelerators with energies in the range of 2-4 MeV. The dose range of the calorimeters is 3-40 kGy, and their temperature stability after irradiation was found to be sufficient for practical use in an industrial environment. Measurement uncertainties were determined to be 5% at k = 2. (author)
Towards tabletop production of intense quasimonochromatic X-ray beams using small 2-20 MeV accelerators

International Nuclear Information System (INIS)

Avakian, R.O.; Ispirian, K.A.

2004-01-01

Full text: The existing synchrotron radiation sources and the fourth generation x-ray sources, which are projected at SLAC, USA, and DESY, Germany, are very expensive. For this reason the search of the novel and cheaper sources using various types of radiation produced by 5-20 MeV electrons available at many hospitals, universities and firms in various countries is of great interest. In this article a review of the physics, history, new theoretical and experimental results and of some applications is given with a purpose to consider the possibilities of construction of small tabletop sources of quasimonochromatic X-ray photon beams necessary for scientific, industrial, medicine and other applications. Simple formulae for almost all types of radiation are given with the help of which one can estimate the expected useful yield and background. PACS: 41.60.-m; 43.35.Ty; 61.85+p;m 78.67.Pt; 78.70.-g. Key words: Bremsstrahlung/Cherenkov radiation/ Transition radiation / Parametric X-ray radiation / Channeling radiation/ Compton scattering
An assessment method of dose equivalent due to indoor 220Rn progeny by using 220Rn concentration measured at a 20 cm distance from wall

International Nuclear Information System (INIS)

Iida, T.; Ikebe, Y.; Okamoto, K.; Guo, Q.; Yamasaki, T.

1996-01-01

A pair of passive cup monitors with a different air exchange openings was developed for measuring simultaneously 222 Rn and 220 Rn concentrations. Indoor 220 Rn concentrations were very high in traditional Japanese dwellings with soil walls. The 220 Rn concentration decreases exponentially with the distance from wall. The effective diffusion coefficient of 220 Rn in dwelling and the exhalation rate of 220 Rn from wall were evaluated from the distribution of the 220 Rn concentrations. Then, indoor 220 Rn progeny concentration could be estimated from the 220 Rn concentration at a 20 cm distance from wall. From the results of the surveys. the average annual effective dose equivalent due to 220 Rn progeny was expected to be 0.67 mSv/year in the traditional Japanese dwellings. (author)
Measurement of neutron yield by 62 MeV proton beam on a thick beryllium target

Energy Technology Data Exchange (ETDEWEB)

Osipenko, M., E-mail: osipenko@ge.infn.it [INFN, sezione di Genova, 16146 Genova (Italy); Ripani, M. [INFN, sezione di Genova, 16146 Genova (Italy); Alba, R. [INFN, Laboratori Nazionali del Sud, 95123 Catania (Italy); Ricco, G. [INFN, sezione di Genova, 16146 Genova (Italy); Schillaci, M. [INFN, Laboratori Nazionali del Sud, 95123 Catania (Italy); Barbagallo, M. [INFN, sezione di Bari, 70126 Bari (Italy); Boccaccio, P. [INFN, Laboratori Nazionali di Legnaro, 35020 Legnaro (Italy); Celentano, A. [Dipartimento di Fisica dell' Università di Genova, 16146 Genova (Italy); Colonna, N. [INFN, sezione di Bari, 70126 Bari (Italy); Cosentino, L.; Del Zoppo, A.; Di Pietro, A. [INFN, Laboratori Nazionali del Sud, 95123 Catania (Italy); Esposito, J. [INFN, Laboratori Nazionali di Legnaro, 35020 Legnaro (Italy); Figuera, P.; Finocchiaro, P. [INFN, Laboratori Nazionali del Sud, 95123 Catania (Italy); Kostyukov, A. [Moscow State University, Moscow 119992 (Russian Federation); Maiolino, C.; Santonocito, D.; Scuderi, V. [INFN, Laboratori Nazionali del Sud, 95123 Catania (Italy); Viberti, C.M. [Dipartimento di Fisica dell' Università di Genova, 16146 Genova (Italy)

2013-09-21

The design of a low-power prototype of neutron amplifier recently proposed within the INFN-E project indicated the need for more accurate data on the neutron yield produced by a proton beam with energy of about 70 MeV impinging on a thick beryllium target. Such measurement was performed at the LNS superconducting cyclotron, covering a wide angular range from 0° to 150° and a complete neutron energy interval from thermal to beam energy. Neutrons with energy above 0.5 MeV were measured by liquid scintillators exploiting their time of flight to determine the kinetic energy. For lower energy neutrons, down to thermal energy, a {sup 3}He detector was used. The obtained data are in good agreement with previous measurements at 0° using 66 MeV proton beam, covering neutron energies >10MeV, as well as with measurements at few selected angles using protons of 46, 55 and 113 MeV energy. The present results extend the neutron yield data in the 60–70 MeV beam energy range. A comparison of measured yields to MCNP, FLUKA and Geant4 Monte Carlo simulations was performed.
40 CFR 300.220 - Related Title III issues.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Related Title III issues. 300.220 Section 300.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... PLAN Planning and Preparedness § 300.220 Related Title III issues. Other related Title III requirements...
24 CFR 570.205 - Eligible planning, urban environmental design and policy-planning-management-capacity building...

Science.gov (United States)

2010-04-01

... environmental design and policy-planning-management-capacity building activities. 570.205 Section 570.205..., urban environmental design and policy-planning-management-capacity building activities. (a) Planning... known or suspected environmental contamination. (5) [Reserved] (6) Policy—planning—management—capacity...
The SCANDAL facility - How to measure elastic neutron scattering in the 50-130 MeV range

International Nuclear Information System (INIS)

Klug, Joakim

2001-01-01

The interest in neutrons of energies above 20 MeV is growing rapidly, since new applications are being developed or have been identified. Transmutation of nuclear waste and cancer therapy with neutron beams are two research fields that would benefit from new neutron scattering data at these energies. A facility for detection of scattered neutrons in the energy interval 50-130 MeV, SCANDAL (SCAttered Nucleon Detection AssembLy), has been developed and installed at the neutron beam facility of the The Svedberg Laboratory in Uppsala. It can be used to study the (n,n), (n,p) and (n,d) reactions. This thesis describes the layout of the setup, the experimental procedure, and data analysis principles. The performance of the spectrometer is illustrated with measurements of the (n,p) and (n,n) reactions on 1 H and 12 C. In addition, the neutron beam facility is described in some detail

29 CFR 570.7 - Documentary evidence required for issuance of a certificate of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Documentary evidence required for issuance of a certificate of age. 570.7 Section 570.7 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates...
0,01-5 MeV heavy ion accelerators

International Nuclear Information System (INIS)

Golubev, V.P.; Ivanov, A.S.; Nikiforov, S.A.; Svin'in, M.P.; Tarvid, G.V.; Troshikhin, A.G.; Fedotov, M.T.

1983-01-01

The results of development of an accelerating complex on the base of the UP-2-1 heavy ion charge exchange accelerator and IMPLANT-500 high-voltage heavy ion accelerator are given. The accelerating complex provides overlapping of the 0.01 MeV to 5 MeV energy range at accelerated beam currents of 10 -3 -10 -6 A order. The structural features of accelerators and their basic units and systems are considered. The UP-2-1 accelerator is designed for researches in the field of experimental physics and applied problem solutions. The IMPLANT-500 accelerator is designed for commercial ion-beam facilities with closed loop of silicon plate treatment
X-ray diffraction studies of 145MeV proton-irradiated AlBeMet 162

Directory of Open Access Journals (Sweden)

Mohamed Elbakhshwan

2016-08-01

Full Text Available AlBeMet 162 (Materion Co., formerly Brush Wellman has been irradiated with 145MeV protons up to 1.2×1020cm−2 fluence, with irradiation temperatures in the range of 100–220°C. Macroscopic post-irradiation evaluation on the evolution of mechanical and thermal properties was integrated with a comprehensive X-ray- diffraction study using high-energy monochromatic and polychromatic X-ray beams, which offered a microscopic view of the irradiation damage effects on AlBeMet. The study confirmed the stability of the metal–matrix composite, its resistance to proton damage, and the continuing separation of the two distinct phases, fcc aluminum and hcp beryllium, following irradiation. Furthermore, based on the absence of inter-planar distance change during proton irradiation, it was confirmed that the stacking faults and clusters on the Al (111 planes are stable, and thus can migrate from the cascade region and be absorbed at various sinks. XRD analysis of the unirradiated AlBeMet 162 showed clear change in the texture of the fcc phase with orientation especially in the Al (111 reflection which exhibits a “non-perfect” six-fold symmetry, implying lack of isotropy in the composite.
7 CFR 220.1 - General purpose and scope.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 220.1 Section 220.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.1 General purpose and scope. This part...
Factorisation of RSA-220 with CADO-NFS

OpenAIRE

Bai , Shi; Gaudry , Pierrick; Kruppa , Alexander; Thomé , Emmanuel; Zimmermann , Paul

2016-01-01

We give details of the factorization of RSA-220 with CADO-NFS. This is a new record computation with this open-source software. We report on the factorization of RSA-220 (220 decimal digits), which is the 3rd largest integer factorization with the General Number Field Sieve (GNFS), after the factorization of RSA-768 (232 digits) in December 2009 [3], and that of 3 697 + 1 (221 digits) in February 2015 by NFS@home.
HIGH ENERGY RADIOGRAPHY-1-30 Mev

Energy Technology Data Exchange (ETDEWEB)

Bly, James H.

1963-10-15

From 1963 American Society of Metals/Materials Show, Cleveland, Oct. 1963. A survey of the field of radiographic inspection of thick sections, at one million volts energy or more, shows that this field has become a major branch of radiographic testing. More than a dozen models of x-ray generators are now commercially available in this field, over the range from 1 to 31 Mev, with outputs up to more than two orders of magnitude greater than can be obtained from radiographic isotope sources, and with smaller spot size. A study of the radiographic characteristics of x rays in this region shows that energies available cover the range of minimum absorption and scattering for most materials and approach this range for solid propellant; at higher energies severe coverage restrictions are imposed; output powers on small spots are near the limits of present target technology. It would appear that some degree of technological maturity'' has been achieved. Radiographic technique at 1 to 30 Mev is straightforward, following the same basic principles as in conventional radiography. Specialized aspects of technique are individually discussed. The wellknown 1 and 2 million volt equlpments are supplemented by a wide variety of higher-energy machines, with energy and output ratings to satisfy almost any radiographic need. Some examples are epitomized, and a brief discussion of possible future developments is presented. (auth)
Scattering of antiprotons from carbon at 46.8 MeV

International Nuclear Information System (INIS)

Garetta, D.; Birien, P.; Bruge, G.; Chaumeaux, A.; Janouin, S.; Legrand, D.; Mallet-Lemaire, M.C.; Mayer, B.; Pain, J.; Drake, D.M.; Peng, J.C.

1984-01-01

Antiproton-carbon elastic and inelastic scattering cross sections have been measured at 46.8 MeV over an angular range 6 0 0 with a magnetic spectrometer. Fits to the elastic and inelastic 4.44 MeV excited state cross sections put realistic limits on the strengths of the real and imaginary parts of the antiproton-carbon optical potential. The continuum cross section due to carbon break-up appears to be smaller than it is for corresponding proton data. (orig.)
Non-Rutherford cross-sections for alpha elastic scattering off Z = 28-38 elements in the energy range up to 10 MeV

Science.gov (United States)

Gurbich, A. F.; Bokhovko, M. V.

2018-04-01

The alpha elastic scattering cross-sections for Ni, Cu, and Y were measured at the energies above the onset of the non-Rutherford scattering. The obtained experimental data along with data from literature were incorporated into the theoretical analysis in the framework of the optical model. The optimization of the model parameters provided a basis for the calculations of the differential cross-sections for Z = 28-38 elements in the energy range up to 10 MeV. The obtained cross sections were made available for common use through the SigmaCalc web site at http://sigmacalc.iate.obninsk.ru/.
24 CFR 91.220 - Action plan.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Action plan. 91.220 Section 91.220 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development..., evaluate and reduce lead-based paint hazards, reduce the number of poverty-level families, develop...
40 CFR 86.220-94 - [Reserved

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false [Reserved] 86.220-94 Section 86.220-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...
24 CFR 220.804 - Insurance premiums.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance premiums. 220.804 Section... and Obligations-Projects Insured Project Improvement Loans § 220.804 Insurance premiums. (a) First premium. The lender, upon the initial endorsement of the loan for insurance, shall pay to the Commissioner...
Two body photodisintegration of the deuteron from 100 to 800 MeV

Energy Technology Data Exchange (ETDEWEB)

Crawford, R.; Annand, J.R.M.; Anthony, I. [Glasgow Univ. (United Kingdom). Dept. of Physics and Astronomy; Ahrens, J.; Beck, R. [Mainz Univ. (Germany). Inst. fuer Kernphysik; Braghieri, A.; Pedroni, P. [Istituto Nazionale di Fisica Nucleare, Pavia (Italy); Altieri, S. [Istituto Nazionale di Fisica Nucleare, Pavia (Italy)]|[Pavia Univ. (Italy). Ist. di Fisica Nucleare; Audit, G.; D`Hose, N. [CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France). Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee] [and others

1996-01-01

The total and the differential cross sections for the D({gamma},p)n reaction have been measured over the photon energy range 100-800 MeV at the 855 MeV MAMI Microtron in Mainz. The data are presented in the form of thirty-five angular distributions at c.m. proton angles between 30 deg-160 deg in 10 deg intervals and at photon energies in steps of 20 MeV. Previous experimental work is reassessed in the light of the present results and the results compared with some recent theoretical calculations. (author). Submitted to Nuclear Physics, B (NL); 23 refs.
Development of quasi-monochromatic p-7Li neutron generating system for 80-210 MeV

International Nuclear Information System (INIS)

Nakao, Noriaki; Shibata, Tokushi; Nakamura, Takashi; Uwamino, Yoshitomo; Nakanishi, Noriyoshi; Kurosawa, Tadahiro; Kim, Unju.

1996-01-01

Recently the requirements for the experimental data on the response characteristics of neutron detector and the cross section for neutron generation by charged particles have been increasing for shield designing. Here, a system for quasi-monochromatic neutron generation was developed in the facility of ring-cyclotron in Institute of Physical and Chemical Sciences. In this study, H 2 + accelerated to an energy range of 80-135 MeV/n and P + to 150-210 MeV was irradiated to E4 beam course and NE102A plastic scintillator was used for monitoring the neutron flux. The amount of neutrons generated was estimated from the radioactivity of 7 Be produced in 7 Li-target. The neutron spectres thus estimated as an energy range of 80-210 MeV were presented and the lower limit of these spectres was about 20 MeV. The peaks in the range of 150 and 210 MeV were comparatively wide because of the inferiority of energy resolving power at a higher energy level. (M.N.)
Polarization measurements for P-12C elastic scattering between 40-75 MeV

International Nuclear Information System (INIS)

Kato, S.; Okada, K.; Kondo, M.; Shimizu, A.; Hosono, K.; Saito, T.; Matsuoka, N.; Nagamachi, S.; Nisimura, K.; Tamura, N.

1980-01-01

Absolute values of the polarization in p- 12 C elastic scattering have been measured at 60.0 and 64.5 MeV at 47.5 0 in the laboratory system using a double scattering method and a method to measure an asymmetry with a polarized beam. The results are P(60.0 MeV, 47.5 0 ) = 0.965 +- 0.011 and P(64.5 MeV, 47.5 0 ) = 0.975 +- 0.011. Based on these values, the polarization measurements have been extended to the energy range from 40-75 MeV at several angles around 47.5 0 using the polarized proton beam and the energy degrader. Differential cross sections and polarizations from 15-115 0 are also presented at 65 MeV. These data will be valuable for the monitoring of beam polarization in this energy region. (orig.)
24 CFR 570.506 - Records to be maintained.

Science.gov (United States)

2010-04-01

... (Continued) OFFICE OF ASSISTANT SECRETARY FOR COMMUNITY PLANNING AND DEVELOPMENT, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT COMMUNITY FACILITIES COMMUNITY DEVELOPMENT BLOCK GRANTS Grant Administration § 570.506...) which are projected to become available to low and moderate income persons through job turnover within...
Evidence for two narrow pp resonances at 2020 MeV and 2200 MeV

CERN Document Server

Benkheiri, P; Bouquet, B; Briandet, P; D'Almagne, B; Dang-Vu, C; De Rosny, G; Eisenstein, B I; Ferrer, A; Fleury, P; Grossetête, B; Irwin, G; Jacholkowski, A; Lahellec, A; Nguyen, H; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Rumpf, M; Six, J; Thénard, J M; Treille, D; Volte, A; Yaffe, D; Yiou, T P; Yoshida, H

1977-01-01

From the study of the reaction pi /sup -/p to p/sub F/pp pi /sup -/ using a fast proton (p/sub F/) trigger device in the CERN Omega spectrometer, the authors find evidence for two narrow pp states produced mainly in association with a Delta degrees (1232) and a N degrees (1520). The statistical significance of each peak is greater than 6 standard deviations. Masses and natural widths of these resonances are respectively M/sub 1/=2020+or-3 MeV, Gamma /sub 1 /=24+or-12 MeV and M/sub 2/=2204+or-5 MeV, Gamma /sub 2/=16/sub -16 //sup +20/ MeV. The data are consistent with a small production of the narrow approximately 1935 MeV resonance already reported. Production cross sections for these new pp resonances are given. (8 refs).
Comparison of Sampling Probe and Thermal Desorber in Hazardous Air Pollutants on Site (HAPSITE) Extended Range (ER) for Analysis of Toxic Organic (TO)-15 Compounds

Science.gov (United States)

2014-03-01

compounds in a bag To prepare 20 ppbv TO-15 compounds in a 5 L ALTEF polypropylene bag (Jensen Inert Products , Coral Springs, FL, USA), 100 mL was taken...Bromopentafluorobenzene (BPFB; an IS) 117 5.70 6,730,000 8,500,000 11,400,000 8,876,667 1,220,000 1,200,000 1,190,000 1,203,333 Ethylbenzene 91 5.91 136 1,960,000...Trichloroethane Toluene Methyl Butyl Ketone (2-Hexanone) Dibromochloromethane 12-Dibromoethane Tetrachloroethylene Chlorobenzene Ethylbenzene p/m
Kerma factors and reaction cross sections for n + 12C between 15 and 18 MeV

International Nuclear Information System (INIS)

Tornow, W.; Chen, Z.M.; Baird, K.; Walter, R.L.

1988-01-01

Differential elastic and inelastic (4.44 MeV) neutron scattering cross sections from 12 C are presented at 15.6, 16.8 and 17.3 MeV. The existing 18.2 MeV differential cross-section data were combined with newly measured analysing power data to parametrise neutron scattering at this energy. The 12 C recoil kerma factors were calculated and reaction cross sections were obtained from a phase-shift analysis and coupled channel analyses in the 15.6-18.2 MeV energy range. (author)
Neutron total cross section measurements in the energy region from 47 keV to 20 MeV

International Nuclear Information System (INIS)

Poenitz, W.P.; Whalen, J.F.

1983-05-01

Neutron total cross sections were measured for 26 elements. Data were obtained in the energy range from 47 keV to 20 MeV for 11 elements in the range of light-mass fission products. Previously reported measurements for eight heavy and actinide isotopes were extended to 20 MeV. Data were also obtained for Cu (47 keV to 1.4 MeV) and for Sc, Zn, Nd, Hf, and Pt (1.8 to 20 MeV). The present work is part of a continuing effort to provide accurate neutron total cross sections for evaluations and for optical-model parameteriztions. The latter are required for the derivation of other nuclear-data information of importance to applied programs. 37 references
Design of the MYRRHA 17-600 MeV Superconducting Linac

CERN Document Server

Biarrotte, J-L; Bouly, F; Carneiro, J-P; Vandeplassche, D

2013-01-01

The goal of the MYRRHA project is to demonstrate the technical feasibility of transmutation in a 100MWth Accelerator Driven System (ADS) by building a new flexible irradiation complex in Mol (Belgium). The MYRRHA facility requires a 600 MeV accelerator delivering a maximum proton flux of 4 mA in continuous operation, with an additional requirement for exceptional reliability. This paper will briefly describe the beam dynamics design of the main superconducting linac section which covers the 17 to 600 MeV energy range and requires enhanced fault-tolerance capabilities.

24 CFR 232.570 - Endorsement of credit instrument.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Endorsement of credit instrument... of Fire Safety Equipment Eligible Security Instruments § 232.570 Endorsement of credit instrument. The Commissioner shall indicate his insurance of the loan by endorsing the credit instrument and...
24 CFR 570.203 - Special economic development activities.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Special economic development... § 570.203 Special economic development activities. A recipient may use CDBG funds for special economic... part of an economic development project. Guidelines for selecting activities to assist under this...
Evaluation of the ID220 single photon avalanche diode for extended spectral range of photon time-of-flight spectroscopy

DEFF Research Database (Denmark)

Nielsen, Otto Højager Attermann; Dahl, Anders Bjorholm; Anderson-Engels, Stefan

This paper describe the performance of the ID220 single photon avalanche diode for single photon counting, and investigates its performance for photon time-of-flight (PToF) spectroscopy. At first this report will serve as a summary to the group for PToF spectroscopy at the Department of Physics...
21 CFR 111.570 - Under this subpart O, what records must you make and keep?

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Under this subpart O, what records must you make and keep? 111.570 Section 111.570 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING PRACTICE IN...
MeV ion-beam analysis of optical data storage films

Science.gov (United States)

Leavitt, J. A.; Mcintyre, L. C., Jr.; Lin, Z.

1993-01-01

Our objectives are threefold: (1) to accurately characterize optical data storage films by MeV ion-beam analysis (IBA) for ODSC collaborators; (2) to develop new and/or improved analysis techniques; and (3) to expand the capabilities of the IBA facility itself. Using H-1(+), He-4(+), and N-15(++) ion beams in the 1.5 MeV to 10 MeV energy range from a 5.5 MV Van de Graaff accelerator, film thickness (in atoms/sq cm), stoichiometry, impurity concentration profiles, and crystalline structure were determined by Rutherford backscattering (RBS), high-energy backscattering, channeling, nuclear reaction analysis (NRA) and proton induced X-ray emission (PIXE). Most of these techniques are discussed in detail in the ODSC Annual Report (February 17, 1987), p. 74. The PIXE technique is briefly discussed in the ODSC Annual Report (March 15, 1991), p. 23.
36 CFR 2.20 - Skating, skateboards, and similar devices.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Skating, skateboards, and similar devices. 2.20 Section 2.20 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.20 Skating, skateboards, and...
48 CFR 2103.570 - Misleading, Deceptive, or Unfair Advertising.

Science.gov (United States)

2010-10-01

... MANAGEMENT, FEDERAL EMPLOYEES GROUP LIFE INSURANCE FEDERAL ACQUISITION REGULATION GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 2103.570 Misleading..., serves as certification of the employee's coverage under the FEGLI Program. Any marketing/advertising...
Environmental thoron (220Rn): a review

International Nuclear Information System (INIS)

Ramachandran, T.V.

2013-01-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment and considerable data is generated on the levels of 222 Rn in the environment across the worlds and is periodically reported by UNSCEAR. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. Many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. This component is not adequately estimated for any country so far on a national level. 220 Rn problem will also be a problem in industries which uses thorium nitrate. Including India lamps using thoriated gas mantles are being still used for indoor and outdoor lighting and hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this article current status of 220 Rn levels in the indoor environment workplaces as well as in other industries where large amount of 232 Th is being handled are being summarized. (author)
Extension of the energy range of the experimental activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium up to 65MeV.

Science.gov (United States)

Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V

2015-04-01

Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides (159)Dy, (157)Dy, (155)Dy, (161)Tb, (160)Tb, (156)Tb, (155)Tb, (154m2)Tb, (154m1)Tb, (154g)Tb, (153)Tb, (152)Tb and (151)Tb are reported in the 36-65MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013. Copyright © 2015. Published by Elsevier Ltd.
36 CFR 220.7 - Environmental assessment and decision notice.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental assessment and decision notice. 220.7 Section 220.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.7 Environmental assessment and decision notice. (a) Environmental assessment...
Kerma factors and reaction cross sections for n + /sup 12/C between 15 and 18 MeV

Energy Technology Data Exchange (ETDEWEB)

Tornow, W.; Chen, Z.M.; Baird, K.; Walter, R.L.

1988-07-01

Differential elastic and inelastic (4.44 MeV) neutron scattering cross sections from /sup 12/C are presented at 15.6, 16.8 and 17.3 MeV. The existing 18.2 MeV differential cross-section data were combined with newly measured analysing power data to parametrise neutron scattering at this energy. The /sup 12/C recoil kerma factors were calculated and reaction cross sections were obtained from a phase-shift analysis and coupled channel analyses in the 15.6-18.2 MeV energy range.
Environmental thoron (220Rn): a review

International Nuclear Information System (INIS)

Ramachandran, T.V.

2008-01-01

Studies on natural background radiation is a topic, which evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true from the recent studies resulted in observing high 220 Rn levels in living environments and work places in various countries and it is increasingly felt that it may be necessary to have data on 220 Rn levels in environment for obtaining a complete picture of inhalation dose. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products, like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. Due to this it was necessary to supplement the external component with inhalation component. This component is not
Two-body photodisintegration of the deuteron from 100 to 800 MeV

Energy Technology Data Exchange (ETDEWEB)

Crawford, R.; Ahrens, J.; Altieri, S.; Annand, J.R.M.; Anthony, I.; Audit, G.; Beck, R.; Braghieri, A.; D`Hose, N.; Hall, S.; Isbert, V.; Kellie, J.D.; Kerhoas, S.; MacCormick, M.; MacGeorge, J.C.; Medaglia, R.; Miller, G.J.; Murphy, L.Y.; Owens, R.O.; Pedroni, P.; Pinelli, T.; Tamas, G.; Wallace, P.A. [Glasgow Univ. (United Kingdom). Dept. of Phys. and Astron.]|[Mainz Univ. (Germany). Inst. fuer Kernphys.]|[INFN, Sezione di Pavia (Italy)]|[Pavia Univ. (Italy). Dipartimento di Fisica Nucleare e Teorica]|[CEA-DAPNIA/SPhN, 91 - Gif-sur-Yvette (France)

1996-06-24

The total and the differential cross sections for the D({gamma},p)n reaction have been measured over the photon energy range 100-800 MeV at the 855 MeV MAMI Microtron in Mainz. Using the large acceptance detector DAPHNE in conjunction with the Glasgow tagging spectrometer, high precision results with small systematic errors were obtained. The data are presented in the form of thirty-five angular distributions at c.m. proton angles between 30 {sup circle} -160 {sup circle} in 10 {sup circle} intervals and at photon energies in steps of 20 MeV. Previous experimental work is reassessed in the light of the present results and comparison with some recent theoretical calculations. (orig.).
20 CFR 220.132 - Physical exertion requirements.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Physical exertion requirements. 220.132 Section 220.132 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... of walking and standing is often necessary in carrying out job duties. Jobs are sedentary if walking...
Cross section for the 103Rh(n,n')103Rhm reaction in the energy range 5.7 endash 12 MeV

International Nuclear Information System (INIS)

Miah, M.M.; Strohmaier, B.; Vonach, H.; Mannhart, W.; Schmidt, D.

1996-01-01

The 103 Rh(n,n ' ) 103 Rh m cross section was measured by the activation method in the neutron energy range 5.7 endash 12 MeV with an uncertainty of ≅5%. Monoenergetic neutrons produced by the D(d,n) 3 He reaction were used to irradiate metallic Rh samples at 0 degree relative to the deuteron beam. The K x rays from 103 Rh m were measured with a calibrated Si detector, and the neutron fluence was determined by means of a 238 U fission chamber. The measured cross sections resolve the discrepancies in previous data and agree with the results of recent statistical model calculations of the fast-neutron cross sections of rhodium. copyright 1996 The American Physical Society
7 CFR 220.5 - Method of payment to States.

Science.gov (United States)

2010-01-01

... reimbursement to School Food Authorities through presentation by designated State officials of a payment Voucher... 7 Agriculture 4 2010-01-01 2010-01-01 false Method of payment to States. 220.5 Section 220.5... AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.5 Method of payment to States. Funds to be...
12 CFR 220.132 - Credit to brokers and dealers.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Credit to brokers and dealers. 220.132 Section 220.132 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T) Interpretations § 220.132 Credit to brokers and...
Negative pion-nucleus elastic scattering at 30 and 50 MeV

International Nuclear Information System (INIS)

Seth, K.K.; Barlow, D.; Iversen, S.; Kaletka, M.; Nann, H.; Smith, D.; Artuso, M.; Burleson, G.; Blanpied, G.; Daw, G.; Burger, W.J.; Redwine, R.P.; Saghai, B.; Anderson, R.

1990-01-01

Differential cross sections for the elastic scattering of 30 and 50 MeV π - by nuclei ranging from 12 C to 208 Pb have been measured using a range spectrometer. Comparison is made with the predictions of a recent optical-model calculation and the general nature of discrepancies is discussed
Study of two photon production process in proton-proton collisions at 216 MeV

International Nuclear Information System (INIS)

Khrykin, A.S.

2002-01-01

The energy spectrum for high energy γ-rays (Eγ ≥ 10 MeV) from the process pp → γγX emitted at 90 deg. in the laboratory frame has been measured at 216 MeV. The resulting photon energy spectrum extracted from γ - γ coincidence events consists of a narrow peak (5.3σ) at a photon energy of about 24 MeV and a relatively broad peak (3.5σ) in the energy range of (50 - 70) MeV. This behavior of the photon energy spectrum is interpreted as a signature of the exotic dibaryon resonance d 1 * with a mass of about 1956 MeV which is assumed to be formed in the radiative process pp → γd 1 * followed by its electromagnetic decay via the d 1 * → ppγ mode. The experimental spectrum is compared with those obtained by means of Monte Carlo simulations
43 CFR 17.220 - Preschool, elementary, and secondary education.

Science.gov (United States)

2010-10-01

... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Preschool, elementary, and secondary education. 17.220 Section 17.220 Public Lands: Interior Office of the Secretary of the Interior NONDISCRIMINATION IN FEDERALLY ASSISTED PROGRAMS OF THE DEPARTMENT OF THE INTERIOR Nondiscrimination on the Basis of Handicap § 17.220 Preschool, elementary,...

48 CFR 504.570 - Procedures for using the EPS.

Science.gov (United States)

2010-10-01

... GENERAL ADMINISTRATIVE MATTERS Electronic Commerce in Contracting 504.570 Procedures for using the EPS. (a... [Identify address block in the solicitation]. (e) The Electronic Posting System Manual provides detailed... that electronic access to a solicitation will result in adequate competition, distribute the...
Neutron-proton scattering experiments and phase analyses for the n-p system in the energy range from 17 to 50 MeV

International Nuclear Information System (INIS)

Krupp, H.

1986-01-01

In the framework of the study of the nucleon-nucleon interaction neutron-proton scattering experiments were performed at the neutron collimator POLKA of the Karlsruhe cyclotron. Neutrons were produced by the source reaction D(d,n)X in the energy range between 17 and 50 MeV. Measured were the differential cross section, the analyzing power, and the spin correlation coefficient of the elastic n-p scattering. By means of the new data the knowledge of the isospin T=0 scattering phases could be improved. It is for the first time possible to determine the scattering phases for T=1 independently from n-p and p-p data with comparable accuracy. (orig./HSI) [de
24 CFR 220.810 - Definition of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Definition of default. 220.810... Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.810 Definition of default... note or security instrument and such default continues for a period of 30 days, the note or security...
33 CFR 2.20 - Territorial sea baseline.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Territorial sea baseline. 2.20... JURISDICTION Jurisdictional Terms § 2.20 Territorial sea baseline. Territorial sea baseline means the line.... Normally, the territorial sea baseline is the mean low water line along the coast of the United States...
Dimensional verification and location of the reactive static compensator in 220 kV; Verificacion del dimensionamiento y ubicacion del compensador estatico de reactivos en 220 kV

Energy Technology Data Exchange (ETDEWEB)

Fernandez Krekeler, Ubaldo [Administracion Nacional de Electricidad (ANDE), Asuncion (Paraguay)]. E-mail: ufernandez@ieee.org; Cardozo Sanchez, Freddy [Mirant Americas (United States)

2001-07-01

This work presents a determination verification of the compensation range and the location of reactive static compensator (RSC) in 220 kV. The verification is accomplished by analyses of the RSC effects in relation to the losses, loading and system voltage stability. The needed compensation range is investigated in full details, whereas that the required conversion level is directly related to this range. It is concluded that the RSC installation, foreseen for 2002, might be postponed for 2005/10 still without reinforcements in 500 kV. The Limpio substation seems to be the more suitable location in relation to the most analysed cases.
Calculation of equivalent dose index for electrons from 5,0 to 22,0 MeV by the Monte Carlo method

International Nuclear Information System (INIS)

Peixoto, J.E.

1979-01-01

The index of equivalent dose in depth and in a sphere surface of a soft tissue equivalent material were determined by Monte Carlo method for electron irradiations from 5,0 to 22.00 MeV. The effect of different irradiation geometries which simulate the incidence of onedirectional opposite rotational and isotropic beams was studied. It is also shown that the detector of wall thickness with 0.5g/cm 2 and isotropic response com be used to measure index of equivalent dose for fast electrons. The alternative concept of average equivalent dose for radiation protection is discussed. (M.C.K.) [pt
e+e- annihilation into multihadrons in the 1350-2400 MeV energy range

International Nuclear Information System (INIS)

Bisello, D.

1990-11-01

In the study of e + e - annihilation into multihadrons, evidence is found for a resonant state around 1650 MeV/c 2 in the π + π - π + π - π 0 and K S 0 K ± π -+ channels. The π + π - π + π - channel shows the well known ρ'(1600) signal with a significant a 1 π and ρε dynamics while the π + π - π 0 π 0 , without ωπ 0 dynamics, shows a wide bump around 1650 MeV/c 2 with a main ρ ± π -+ π 0 dynamics. Data have been collected with the DM2 detector at DCI, the Orsay colliding ring, and refer to about 2 pb -1 luminosity in the 1350 - 2400 MeV energy interval
Measurements of activation cross-sections for the 101Ru(n,p)101Tc reaction for neutrons with energies between 13 and 15 MeV

International Nuclear Information System (INIS)

Junhua Luo; Peking University, Beijing; Jiuning Han; Suhong Ge; Zhenlai Liu; Guihua Sun; Rong Liu; Li Jiang

2013-01-01

In this study, activation cross-sections were measured for the 101 Ru(n,p) 101 Tc reaction at three different neutron energies from 13.5 to 14.8 MeV. The fast neutrons were produced via the 3 H(d,n) 4 He reaction on K-400 neutron generator. Induced gamma activities were measured by a high-resolution gamma-ray spectrometer with high-purity germanium detector. Measurements were corrected for gamma-ray attenuations, random coincidence (pile-up), dead time and fluctuation of neutron flux. The data for 101 Ru(n,p) 101 Tc reaction cross-sections are reported to be 15.7 ± 2.0, 18.4 ± 2.7 and 22.0 ± 2.4 mb at 13.5 ± 0.2, 14.1 ± 0.2, and 14.8 ± 0.2 MeV incident neutron energies, respectively. Results were compared with the previous works. (author)
Physics design of a 70 MeV high intensity cyclotron, CYCIAE-70

International Nuclear Information System (INIS)

Zhang Tianjue; An Shizhong; Wang Chuan; Yin Zhiguo; Wei Sumin; Li Ming; Yang Jianjun; Ji Bin; Jia Xianlu; Zhong Junqing; Yang Fang

2011-01-01

This paper introduces the physics design of a 70 MeV high intensity cyclotron at China Institute of Atomic Energy (CIAE), which is aimed for multiple uses including radioactive ion-beam (RIB) production. The machine adopts a compact structure of four straight sectors, capable of accelerating two kinds of beams, i.e. H − and D − . The proton and deuteron beam will be extracted in dual opposite directions by charge exchange stripping devices. The energy of the extracted proton beam is in the range 35–70 MeV with an intensity up to 700 μA. The corresponding values for the deuteron beam are 18–33 MeV and 40 μA. This paper will present the main characteristics and parameters in the design of the 70 MeV cyclotron, the results of the basic beam dynamics study, as well as the physics in the design of the different systems, including the main magnet, RF, injection and extraction systems, etc.
Electromagnetic form factors for the 14.39 and 17.50 MeV levels of 9Be

International Nuclear Information System (INIS)

Nascimento, I.C.; Wong, C.F.; Caplan, H.S.

1974-01-01

The form factors for the 14.39 and 17.50 MeV levels of 9 Be have been measured for momentum transfer in the range between 0.47 and 1.08 fm -1 . Radiative widths for the transitions and the transition radii were also obtained. The results are consistent with the attribution of an M1 transition to the 14.39 MeV level and an M2 to the 17.50 MeV level [pt
Measurement of secondary neutrons and gamma rays produced by neutron interactions in aluminum over the incident energy range 1 to 20 MeV

International Nuclear Information System (INIS)

Morgan, G.L.

1975-11-01

The spectra of secondary neutrons and gamma rays produced by neutron interaction in a thin sample (approximately 1/6 mean free path) of aluminum have been measured as a function of the incident neutron energy over the range 1 to 20 MeV. Data were taken at an angle of 125 0 . A linac (ORELA) was used as a neutron source with a 47-m flight path. Incident energy was determined by time-of-flight, while secondary spectra were determined by pulse-height unfolding techniques. The results of the measurements are presented in forms suitable for comparison to calculations based on the evaluated data files. (6 tables, 4 figures)
Study of the /sup 58/Ni, /sup 90/Zr and /sup 208/Pb(p,d) reactions at 121 MeV. [DWBA, angular distributions, spectroscopic factors, finite range calculations

Energy Technology Data Exchange (ETDEWEB)

Anderson, R E; Kraushaar, J J; Shepard, J R [Colorado Univ., Boulder (USA). Nuclear Physics Lab.; Comfort, J R [Indiana Univ., Bloomington (USA). Dept. of Physics

1978-01-01

The (p,d) reaction has been studied on /sup 58/Ni, /sup 90/Zr and /sup 208/Pb at 121 MeV in order to test the applicability of the usual DWBA methods to higher energy data. The calculations describe the angular distribution for the strongly excited low-lying states reasonably well when adiabatic-deuteron optical potentials are used. Some discrepancies in shape persist, however, and some values of the spectroscopic factors differ from lower energy data in spite of many variations in the calculations. By use of exact finite-range calculations a value of D/sup 2//sub 0/ = 1.23 x 10/sup 4/ MeV/sup 2/.fm/sup 3/ was found for use at 121 MeV. Deuteron D-state contributions were negligible at forward angles and two-step contributions do not appear more significant than for data at lower energy.
Application of PWO crystals for detection of low-activity gamma- radiation in the energy range above 3 MeV

CERN Document Server

Drobychev, G Yu; Fedorov, A A; Khruschinsky, A A; Korjik, M V; Lecoq, P; Missevitch, O V; 10.1016/j.nima.2004.08.059

2005-01-01

Lead tungstate PbWO4 (PWO) scintillator was developed during the R&D project initiated in a frame of preparation of experiments in high- energy physics to be carried out at new generation of colliders like LHC (CERN, Geneva, Switzerland). Compared to other promising fast and dense scintillators, PWO is an optimal compromise to make a very compact detector with good performance and the best price/performance ratio. Moreover, the results of PWO development carried out by the INP team together with collaborators show that scintillation parameters of PWO crystals can be further modified, which significantly extends opportunities of PWO application. One such field where an application of PWO scintillator can be very advantageous is a detection of low-activity gamma-radiation in the energy range above 3 MeV. Application of heavy scintillator allows to decrease a detector volume and therefore to reduce background. According to our preliminary estimations, PWO scintillation crystal will allow to reach significant...
High-resolution integrated germanium Compton polarimeter for the γ-ray energy range 80 keV-1 MeV

Science.gov (United States)

Sareen, R. A.; Urban, W.; Barnett, A. R.; Varley, B. J.

1995-06-01

Parameters which govern the choice of a detection system to measure the linear polarization of γ rays at low energies are discussed. An integrated polarimeter is described which is constructed from a single crystal of germanium. It is a compact planar device with the sectors defined electrically, and which gives an energy resolution in the add-back mode of 1 keV at 300 keV. Its performance is demonstrated in a series of calibration measurements using both unpolarized radiation from radioactive sources and polarized γ rays from the 168Er(α,2n)170Yb reaction at Eα=25 MeV. Polarization measurements at energies as low as 84 keV have been achieved, where the sensitivity was 0.32±0.09. The sensitivity, efficiency, and energy resolution are reported. Our results indicate that energy resolution should be included in the definition of the figure of merit and we relate the new definition to earlier work. The comparisons show the advantages of the present design in the energy range below 300 keV and its competitiveness up to 1500 keV.
29 CFR 570.58 - Occupations involved in the operation of power-driven hoisting apparatus (Order 7).

Science.gov (United States)

2010-07-01

... hoisting apparatus (Order 7). 570.58 Section 570.58 Labor Regulations Relating to Labor (Continued) WAGE... trucks, or stacking trucks, but shall not mean low-lift trucks or low-lift platform trucks that are... stacking trucks, but shall not mean low-lift trucks or low-lift platform trucks that are designed for the...
29 CFR 570.55 - Occupations involved in the operation of power-driven woodworking machines (Order 5).

Science.gov (United States)

2010-07-01

... woodworking machines (Order 5). 570.55 Section 570.55 Labor Regulations Relating to Labor (Continued) WAGE AND... woodworking machines (Order 5). Link to an amendment published at 75 FR 28455, May 20, 2010. (a) Finding and declaration of fact. The following occupations involved in the operation of power-driven wood-working machines...
50 CFR 665.220 - Hawaii coral reef ecosystem fisheries. [Reserved

Science.gov (United States)

2010-10-01

... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii coral reef ecosystem fisheries. [Reserved] 665.220 Section 665.220 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... PACIFIC Hawaii Fisheries § 665.220 Hawaii coral reef ecosystem fisheries. [Reserved] ...
50 MeV Run of the IOTA / FAST Electron Accelerator

Energy Technology Data Exchange (ETDEWEB)

Edstrom Jr., D.; et al.

2017-02-02

The low-energy section of the photoinjector-based electron linear accelerator at the Fermilab Accelerator Science & Technology (FAST) facility was recently commissioned to an energy of 50 MeV. This linear accelerator relies primarily upon pulsed SRF acceleration and an optional bunch compressor to produce a stable beam within a large operational regime in terms of bunch charge, total average charge, bunch length, and beam energy. Various instrumentation was used to characterize fundamental properties of the electron beam including the intensity, stability, emittance, and bunch length. While much of this instrumentation was commissioned in a 20 MeV running period prior, some (including a new Martin- Puplett interferometer) was in development or pending installation at that time. All instrumentation has since been recommissioned over the wide operational range of beam energies up to 50 MeV, intensities up to 4 nC/pulse, and bunch structures from ~1 ps to more than 50 ps in length.
The Karlsruhe Neutron Transmission Experiment (KANT): Spherical shell transmission measurements with 14 MeV neutrons on beryllium

International Nuclear Information System (INIS)

Moellendorff, U. von; Fischer, U.; Giese, H.; Kappler, F.; Tayama, R.; Wiegner, E.; Klein, H.; Alevra, A.

1996-01-01

This is a set of viewgraphs (no additional text) of a presentation on spherical shell transmission measurements with 14 MeV neutrons on beryllium; the cross for 9 Be(n,2n)2α for the energy range between threshold (1.85 MeV) and 20 MeV neutron energy is measured and the measurement is compared with the literature. Also, neutron leakage multiplication in spherical Be shells with various thicknesses are presented. Figs, tabs
Measurement of excitation yields of low energy prompt γ-ray from proton bombardment of Cr-foils with energies ranging between 1.0 and 3.0 MeV

International Nuclear Information System (INIS)

Goncharov, A.

2014-01-01

The goal of this work is measurement of differential cross sections for the production of 378 keV γ-rays from the reactions 52 Cr(p,γ1) 53 Mn and 53 Cr(p,nγ1) 53 Mn for proton energies ranging between 1.0 and 3.0 MeV at the laboratory angle of 90° using foils with thickness ∼1.9×10 18 at/cm 2 (∼ 0.23 μm) of nat Cr.

POST-STARBURST TIDAL TAILS IN THE ARCHETYPICAL ULTRA LUMINOUS INFRARED GALAXY Arp 220

International Nuclear Information System (INIS)

Taniguchi, Y.; Matsubayashi, K.; Kajisawa, M.; Shioya, Y.; Ideue, Y.; Ohyama, Y.; Nagao, T.; Murayama, T.; Koda, J.

2012-01-01

We present our new deep optical imaging and long-slit spectroscopy for Arp 220, the archetypical ultra luminous infrared galaxy in the local universe. Our sensitive Hα imaging has newly revealed large-scale Hα absorption, i.e., post-starburst regions in this merger. One is found in the eastern superbubble and the other is in the two tidal tails that are clearly revealed in our deep optical imaging. The size of the Hα absorption region in the eastern bubble is 5 kpc × 7.5 kpc, and the observed Hα equivalent widths are ∼2 Å ± 0.2 Å. The sizes of the northern and southern Hα-absorption tidal tails are ∼5 kpc × 10 kpc and ∼6 kpc × 20 kpc, respectively. The observed Hα equivalent widths range from 4 Å to 7 Å. In order to explain the presence of the two post-starburst tails, we suggest a possible multiple-merger scenario for Arp 220 in which two post-starburst disk-like structures merged into one, causing the two tails. This favors Arp 220 as a multiple merging system composed of four or more galaxies arising from a compact group of galaxies. Taking our new results into account, we discuss a star formation history in the last 1 Gyr in Arp 220.
Elastic scattering of antiprotons from carbon, calcium, and lead at 180 MeV

International Nuclear Information System (INIS)

Garreta, D.; Birien, P.; Bruge, G.; Chaumeaux, A.; Drake, D.M.; Janouin, S.; Legrand, D.; Lemaire, M.C.; Mayer, B.; Pain, J.; Peng, J.C.

1984-01-01

Angular distributions for elastic scattering of 180 MeV antiprotons from 12 C, 40 Ca, and 208 Pb have been measured over a wide angular range with a magnetic spectrometer. In general, microscopic calculations agree fairly well with the data. Optical-model fits with Woods-Saxon parametrization determine the magnitude and the relative strength of the real and imaginary potentials at the nuclear surface. When the shape of the potentials is derived from that of the charge distribution, the depth of the real potential is found to be shallow (30 MeV 0 12 C scattering at 46.8 MeV and with a recent analysis of anti p-atom data. (orig.)
Measurement of the stopping power of water for carbon ions in the energy range of 1 MeV-6 MeV using the inverted Doppler-shift attenuation method

Energy Technology Data Exchange (ETDEWEB)

Rahm, Johannes Martin

2016-10-31

Cancer therapy using carbon ions has gained increasing interest in the last decade due to its advantageous dose distributions. For the dosimetry and treatment planning, the accurate knowledge of the stopping power of water for carbon ions is of crucial importance. In the high energy region, the stopping power can be calculated rather accurately by means of the Bethe-Bloch formula. In the case of projectile velocities comparable to those of the valence electrons of the target, these calculations are subject to large uncertainties. There exist no experimental data for the stopping power of water for projectile energies prevailing in the so-called Bragg peak region. The currently available stopping power data for water are derived from measurements in water vapour or D{sub 2}O ice and, hence, neglect the dependence on the state of aggregation. The stopping power of water for charged particles is of high interest not only for practical applications but also to consider how physical and chemical state of the target influence the collisional energy transfer. For the measurement of the stopping power of water, the inverted Doppler-shift attenuation method was used in this work. This method has the advantage that the projectile itself is not needed to be detected and can be slowed down entirely in the target. In this method, the stopping power is determined from the Doppler-shift of the gamma-quanta emitted by projectiles during their slow down. This experiment can be performed at atmospheric pressure and consequently, the stopping power of water can be measured in its real physiological condition. In this work, the stopping power of water for carbon ions was measured for the first time in the energy range between 1 MeV and 6 MeV covering the kinetic energies of carbon ions in the Bragg peak region. The experimental method is presented in detail along with the design of the apparatus and of the data acquisition system. A comprehensive analysis of instrumental effects
Finite-density transition line for QCD with 695 MeV dynamical fermions

Science.gov (United States)

Greensite, Jeff; Höllwieser, Roman

2018-06-01

We apply the relative weights method to SU(3) gauge theory with staggered fermions of mass 695 MeV at a set of temperatures in the range 151 ≤T ≤267 MeV , to obtain an effective Polyakov line action at each temperature. We then apply a mean field method to search for phase transitions in the effective theory at finite densities. The result is a transition line in the plane of temperature and chemical potential, with an end point at high temperature, as expected, but also a second end point at a lower temperature. We cannot rule out the possibilities that a transition line reappears at temperatures lower than the range investigated, or that the second end point is absent for light quarks.
First studies of 500-nm Cherenkov radiation from 255-MeV electrons in a diamond crystal

Energy Technology Data Exchange (ETDEWEB)

Takabayashi, Y., E-mail: takabayashi@saga-ls.jp [SAGA Light Source, 8-7 Yayoigaoka, Tosu, Saga 841-0005 (Japan); Fiks, E.I. [National Research Tomsk Polytechnic University, 634050 Tomsk (Russian Federation); Pivovarov, Yu.L. [National Research Tomsk Polytechnic University, 634050 Tomsk (Russian Federation); National Research Tomsk State University, 634050 Tomsk (Russian Federation)

2015-06-12

The first experiment on Cherenkov light from 255-MeV electrons passing through a 50-μm-thick diamond crystal in a special geometry allowing extraction of 500-nm Cherenkov light at a right angle with respect to the electron beam direction has been performed at the injector linac of SAGA Light Source accelerator facility. The dependence of 500-nm Cherenkov light intensity (separated by a band-pass filter) on the crystal rotation angle was measured by a CCD detector. The experimentally obtained rocking curve with an intense maximum is theoretically explained as the projector effect of Cherenkov light deflected by the exit surface of the crystal. The width of the rocking curve is explained by the convolution of the standard Tamm–Frank angular distribution of Cherenkov radiation with chromatic aberration, the multiple scattering of electrons in a crystal, and initial electron beam angular divergence. In addition, it is found that the Cherenkov light intensity did not change under the (220) planar channeling condition, which is consistent with a recent theory. - Highlights: • Cherenkov light from 255-MeV electrons in a diamond crystal has been investigated. • The Cherenkov light from channeled electrons has been observed for the first time. • The experimental results are in good agreement with theory.
48 CFR 1823.570 - Drug- and alcohol-free workforce.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Drug- and alcohol-free..., OCCUPATIONAL SAFETY, AND DRUG-FREE WORKPLACE Drug-Free Workplace 1823.570 Drug- and alcohol-free workforce. This section sets sets forth NASA requirements for mandatory drug and alcohol testing of certain...
Energy dependence of relative abundances and periods of separate groups of delayed neutrons at neutron induced fission of 239Pu in a range of neutrons energies 0.37 - 5 MeV

International Nuclear Information System (INIS)

Roschenko, V.A.; Piksaikin, V.M.; Kazakov, L.E.; Isaev, S.G.; Korolev, G.G.; Tarasko, M.Z.; Tertychnyi, R.G.

2001-01-01

The fundamental role of delayed neutrons in behavior, control and safety of reactors is well known today. Delayed neutron data are of great interest not only for reactor physics but also for nuclear fission physics and astrophysics. The purpose of the present work was the measurement of energy dependence of delayed neutrons (DN) group parameters at fission of nuclei 239 Pu in a range of energies of primary neutrons from 0.37 up to 5 MeV. The measurements were executed on installation designed on the basis of the electrostatic accelerator of KG - 2.5 SSC RF IPPE. The data are obtained in 6-group representation. It is shown, that there is a significant energy dependence of DN group parameters in a range of primary neutrons energies from thermal meanings up to 5 MeV, which is expressed in reduction of the average half-life of nuclei of the DN precursors on 10 %. The data, received in the present work, can be used at creation of a set of group constants for reactors with an intermediate spectrum of neutrons. (authors)
Measured neutron carbon kerma factors from 14.1 MeV to 18 MeV

International Nuclear Information System (INIS)

Deluca, P.M.; Barschall, H.H.; McDonald, J.C.

1985-01-01

For A-150 tissue-equivalent plastic, the total neutron kerma is dominated by the hydrogen kerma. Tissue kerma is inferred with reasonable accuracy by normalization to the kerma factor ratio between tissue and A-150 plastic. Because of the close match in the hydrogen abundance in these materials, the principal uncertainty is due to the kerma factors of carbon and oxygen. We have measured carbon kerma factor values of 0.183+-0.015 10 -8 cGy cm 2 and 0.210+-0.016 10 -8 cGy cm 2 at 14.1-MeV and 15-MeV neutron energy, respectively. A preliminary value of 0.297+-0.03 10 -8 cGy cm 2 has been determined at 17.9 MeV. A recent microscopic cross section measurement of the (n,n'3α) reaction in carbon at 14.1-MeV energy gives a kerma factor of 0.184+-0.019 10 -8 cGy cm 2 in agreement with the present result
Design Concept of a Seal-off Type 14 MeV Neutron Generator of 10''1''1n/s Range

Energy Technology Data Exchange (ETDEWEB)

In, S. R.; Oh, B. H. [KAERI, Daejeon (Korea, Republic of)

2015-05-15

The total neutron fluence during the life time is expected to be around 10MW·yr/m''2 which may cause a damage of -100 dpa in materials. To estimate the adaptability of candidate materials in a few years, a 14MeV neutron source with a flux level of 3 - 5 x 10''1''8 n/s·m''2, which is the goal of the IFMIF facility costing more than ¤1000M, is necessitated. The problem in making an intense neutron generator of beam target type is really not on the neutron production rate, but on the huge heat generated in the target, because the fusion power is only one of thousands of beam power exerted on the target. We have a plan to develop neutron generators step by step from a 10''8 n/s level. The final goal is establishing a 14MeV neutron irradiation facility at 10''1''4 intensity level.. Up to the 10''1''0 n/s level, there occurs basically no critical thermal problem, because beam power density is in the range of tens W/cm''2. The neutron generator designed in a sealed-off type because of tritium safety is mainly composed of an ion source, target, reaction chamber, and getter pump.. The major design concepts for the neutron generator with the neutron production rate of 10''1''1 n/s range were presented. The specifications of the ion source, target and getter have been determined for attaining the goal of the neutron generation rate.
Upper limit on the inner radiation belt MeV electron intensity

Science.gov (United States)

Li, X; Selesnick, RS; Baker, DN; Jaynes, AN; Kanekal, SG; Schiller, Q; Blum, L; Fennell, J; Blake, JB

2015-01-01

No instruments in the inner radiation belt are immune from the unforgiving penetration of the highly energetic protons (tens of MeV to GeV). The inner belt proton flux level, however, is relatively stable; thus, for any given instrument, the proton contamination often leads to a certain background noise. Measurements from the Relativistic Electron and Proton Telescope integrated little experiment on board Colorado Student Space Weather Experiment CubeSat, in a low Earth orbit, clearly demonstrate that there exist sub-MeV electrons in the inner belt because their flux level is orders of magnitude higher than the background, while higher-energy electron (>1.6 MeV) measurements cannot be distinguished from the background. Detailed analysis of high-quality measurements from the Relativistic Electron and Proton Telescope on board Van Allen Probes, in a geo-transfer-like orbit, provides, for the first time, quantified upper limits on MeV electron fluxes in various energy ranges in the inner belt. These upper limits are rather different from flux levels in the AE8 and AE9 models, which were developed based on older data sources. For 1.7, 2.5, and 3.3 MeV electrons, the upper limits are about 1 order of magnitude lower than predicted model fluxes. The implication of this difference is profound in that unless there are extreme solar wind conditions, which have not happened yet since the launch of Van Allen Probes, significant enhancements of MeV electrons do not occur in the inner belt even though such enhancements are commonly seen in the outer belt. Key Points Quantified upper limit of MeV electrons in the inner belt Actual MeV electron intensity likely much lower than the upper limit More detailed understanding of relativistic electrons in the magnetosphere PMID:26167446
Spin and isospin characteristics of the excited states of 36Ar through the reaction 32S(α,γ)36Ar in the bombarding energy range E/sub α/ = 4 to 5 MeV

International Nuclear Information System (INIS)

Chakrabarty, D.R.; Eswaran, M.A.; Ragoowansi, N.L.

1983-01-01

The α capture reaction 32 S(α,γ) 36 Ar was studied in the bombarding energy range of E/sub α/ = 4.13 to 5.00 MeV corresponding to the excitation energy range of E/sub x/ = 10.31 to 11.08 MeV in 36 Ar. Seven resonances have been located and their resonance strengths determined. Two of the resonances decay predominantly to the ground state while the other five decay predominantly to the first excited state of 36 Ar. Angular distribution measurements of the predominant decay gamma ray have been performed and the spin and parity of all the resonances assigned. The isospin of two of the resonances have been assigned as T = 0 while T = 1 has been assigned for three others. Evidence has been obtained for the operation of the isospin selection rule for the dipole (E1 and M1) and quadrupole (E2) gamma decay
42 CFR 403.220 - Supplemental Health Insurance Panel.

Science.gov (United States)

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Supplemental Health Insurance Panel. 403.220... Programs § 403.220 Supplemental Health Insurance Panel. (a) Membership. The Supplemental Health Insurance... determines whether or not a State regulatory program for Medicare supplemental health insurance policies...
Kilovoltage energy imaging with a radiotherapy linac with a continuously variable energy range.

Science.gov (United States)

Roberts, D A; Hansen, V N; Thompson, M G; Poludniowski, G; Niven, A; Seco, J; Evans, P M

2012-03-01

In this paper, the effect on image quality of significantly reducing the primary electron energy of a radiotherapy accelerator is investigated using a novel waveguide test piece. The waveguide contains a novel variable coupling device (rotovane), allowing for a wide continuously variable energy range of between 1.4 and 9 MeV suitable for both imaging and therapy. Imaging at linac accelerating potentials close to 1 MV was investigated experimentally and via Monte Carlo simulations. An imaging beam line was designed, and planar and cone beam computed tomography images were obtained to enable qualitative and quantitative comparisons with kilovoltage and megavoltage imaging systems. The imaging beam had an electron energy of 1.4 MeV, which was incident on a water cooled electron window consisting of stainless steel, a 5 mm carbon electron absorber and 2.5 mm aluminium filtration. Images were acquired with an amorphous silicon detector sensitive to diagnostic x-ray energies. The x-ray beam had an average energy of 220 keV and half value layer of 5.9 mm of copper. Cone beam CT images with the same contrast to noise ratio as a gantry mounted kilovoltage imaging system were obtained with doses as low as 2 cGy. This dose is equivalent to a single 6 MV portal image. While 12 times higher than a 100 kVp CBCT system (Elekta XVI), this dose is 140 times lower than a 6 MV cone beam imaging system and 6 times lower than previously published LowZ imaging beams operating at higher (4-5 MeV) energies. The novel coupling device provides for a wide range of electron energies that are suitable for kilovoltage quality imaging and therapy. The imaging system provides high contrast images from the therapy portal at low dose, approaching that of gantry mounted kilovoltage x-ray systems. Additionally, the system provides low dose imaging directly from the therapy portal, potentially allowing for target tracking during radiotherapy treatment. There is the scope with such a tuneable system
Comprehensive Measurement of Neutron Yield Produced by 62 MeV Protons on Beryllium Target

International Nuclear Information System (INIS)

Osipenko, M.; Ripani, M.; Ricco, G.; Alba, R.; Schillaci, M.; Cosentino, L.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Finocchiaro, P.; Maiolino, C.; Santonocito, D.; Scuderi, V.; Barbagallo, M.; Colonna, N.; Boccaccio, P.; Esposito, J.; Celentano, A.; Viberti, C.M.; Kostyukov, A.

2013-06-01

A low-power prototype of neutron amplifier, based on a 70 MeV, high current proton cyclotron being installed at LNL for the SPES RIB facility, was recently proposed within INFN-E project. This prototype uses a thick Beryllium converter to produce a fast neutron spectrum feeding a sub-critical reactor core. To complete the design of such facility the new measurement of neutron yield from a thick Beryllium target was performed at LNS. This measurement used liquid scintillator detectors to identify produced neutrons by Pulse Shape Discrimination and Time of Flight technique to measure neutron energy in the range 0.5-62 MeV. To extend the covered neutron energy range 3 He detector was used to measure neutrons below 0.5 MeV. The obtained yields were normalized to the charge deposited by the proton beam on the metallic Beryllium target. These techniques allowed to achieve a wide angular coverage from 0 to 150 degrees and to explore almost complete neutron energy interval. (authors)
Measurements of pp→π+d between 398 MeV and 572 MeV

International Nuclear Information System (INIS)

Aebischer, D.; Favier, B.; Greeniaus, L.G.; Hess, R.; Junod, A.; Lechanoine, C.; Nikles, J.-C.; Rapin, D.; Werren, D.W.

1976-01-01

The reaction pp→π + d was studied at incident proton energies of 398, 455, 497, 530 and 572 MeV. Measurements of dsigma/dΩ at 455 and 572 MeV show the presence of pion d-waves in the pion-deuteron system. Asymmetry measurements yield similar conclusions. Total cross-section measurements agree with recent fits to earlier data. (Auth.)
Coupled-channel analysis of nucleon scattering from sup40Ca up to 80 MeV

International Nuclear Information System (INIS)

Honore, G.M.; Tornow, W.; Howell, C.R.; Pedroni, R.S.; Byrd, R.C.; Walter, R.L.; Delaroche, J.P.

1986-01-01

Differential cross sections sigma(theta) and analyzing powers A/sub y/(theta) for neutron scattering to the ground and first 3 - excited state of 40 Ca have been measured in the energy range from 11 to 17 MeV. Elastic and inelastic scattering measurements have been obtained for A/sub y/(theta) at energies of 11.0, 13.9, and 16.9 MeV, the inelastic scattering data representing the first (n,n') measurements of A/sub y/(theta) for this nucleus. Differential cross sections for (n,n) and (n,n') have been obtained at 13.9 and 16.9 MeV. Both the sigma(theta) and A/sub y/(theta) data at 13.9 MeV have been compared with previous measurements at this energy and the agreement is good, typically within less than 3%. These results have been combined with other sigma(theta) and A/sub y/(theta) data and total cross section sigma/sub T/ measurements to form a large set of scattering and reaction data for incident energies up to 80 MeV. This data set, along with sigma(theta) and A/sub y/(theta) measurements available for proton scattering in this energy range, has been described in the framework of the coupled-channel formalism. This highly constrained analysis has led to a precise determination of geometries, energy dependencies, and deformation parameters
Elastic scattering of 90 - 120 MeV 3He particles and unique optical potential

International Nuclear Information System (INIS)

Hyakutake, M.; Matoba, M.; Kumabe, I.; Fukada, M.; Komatuzaki, T.

1978-01-01

The elastic scattering of 109.2 MeV 3 He particles by 40 Ca, 58 Ni, 90 Zr and 116 Sn has been investigated over a wide angular range. The elastic scattering cross sections have been analyzed in terms of the optical model. The data for each nucleus studied were sufficient to eliminate the discrete ambiguity in the strength of the optical potential; the unique potential which fits the data has real well depth of about 100 MeV and a corresponding volume integral per nucleon pair of about 310 MeV fm 3 . The elastic scattering of 3 He particles by 58 Ni has been further measured at bombarding energies of 89.3 and 118.5 MeV, and the incident-energy dependence of the optical potential of 3 He particles for 58 Ni was obtained. (author)
29 CFR 570.102 - General scope of statutory provisions.

Science.gov (United States)

2010-07-01

... REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended General § 570.... The most important of the child labor provisions are contained in sections 12(a), 12(c), and 3(l) of...
A direct electron detector for time-resolved MeV electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Vecchione, T.; Denes, P.; Jobe, R. K.; Johnson, I. J.; Joseph, J. M.; Li, R. K.; Perazzo, A.; Shen, X.; Wang, X. J.; Weathersby, S. P.; Yang, J.; Zhang, D.

2017-03-01

The introduction of direct electron detectors enabled the structural biology revolution of cryogenic electron microscopy. Direct electron detectors are now expected to have a similarly dramatic impact on time-resolved MeV electron microscopy, particularly by enabling both spatial and temporal jitter correction. Here we report on the commissioning of a direct electron detector for time-resolved MeV electron microscopy. The direct electron detector demonstrated MeV single electron sensitivity and is capable of recording megapixel images at 180 Hz. The detector has a 15-bit dynamic range, better than 30-μmμm spatial resolution and less than 20 analogue-to-digital converter count RMS pixel noise. The unique capabilities of the direct electron detector and the data analysis required to take advantage of these capabilities are presented. The technical challenges associated with generating and processing large amounts of data are also discussed.
Probing the Cosmic X-Ray and MeV Gamma-Ray Background Radiation through the Anisotropy

Energy Technology Data Exchange (ETDEWEB)

Inoue, Yoshiyuki [Stanford Univ., CA (United States). Kavli Inst. for Particle Astrophysics and Cosmology; SLAC National Accelerator Lab., Menlo Park, CA (United States); Murase, Kohta [Inst. for Advanced Study, Princeton, NJ (United States). School of Natural Sciences; Madejski, Grzegorz M. [Stanford Univ., CA (United States). Kavli Inst. for Particle Astrophysics and Cosmology; SLAC National Accelerator Lab., Menlo Park, CA (United States); Uchiyama, Yasunobu [Stanford Univ., CA (United States). Kavli Inst. for Particle Astrophysics and Cosmology; SLAC National Accelerator Lab., Menlo Park, CA (United States); Rikkyo Univ., Tokyo (Japan). Dept. of Physics

2013-09-24

While the cosmic soft X-ray background is very likely to originate from individual Seyfert galaxies, the origin of the cosmic hard X-ray and MeV gamma-ray background is not fully understood. It is expected that Seyferts including Compton thick population may explain the cosmic hard X-ray background. At MeV energy range, Seyferts having non-thermal electrons in coronae above accretion disks or MeV blazars may explain the background radiation. We propose that future measurements of the angular power spectra of anisotropy of the cosmic X-ray and MeV gamma-ray backgrounds will be key to deciphering these backgrounds and the evolution of active galactic nuclei (AGNs). As AGNs trace the cosmic large-scale structure, spatial clustering of AGNs exists. We show that e-ROSITA will clearly detect the correlation signal of unresolved Seyferts at 0.5-2 keV and 2-10 keV bands and will be able to measure the bias parameter of AGNs at both bands. Once the future hard X-ray all sky satellites achieve the sensitivity better than 10^-12 erg/cm²/s^-1 at 10-30 keV or 30-50 keV - although this is beyond the sensitivities of current hard X-ray all sky monitors - angular power spectra will allow us to independently investigate the fraction of Compton-thick AGNs in all Seyferts. We also find that the expected angular power spectra of Seyferts and blazars in the MeV range are different by about an order of magnitude, where the Poisson term, so-called shot noise, is dominant. Current and future MeV instruments will clearly disentangle the origin of the MeV gamma-ray background through the angular power spectrum.

Probing the cosmic x-ray and MeV gamma ray background radiation through the anisotropy

Energy Technology Data Exchange (ETDEWEB)

Inoue, Yoshiyuki [Stanford Univ., CA (United States); Murase, Kohta [Inst. for Advanced Study, Princeton, NJ (United States); Madejski, Grzegorz M. [Stanford Univ., CA (United States); Uchiyama, Yasunobu [Stanford Univ., CA (United States); Rikkyo Univ., Tokyo (Japan)

2013-09-24

While the cosmic soft X-ray background is very likely to originate from individual Seyfert galaxies, the origin of the cosmic hard X-ray and MeV gamma-ray background is not fully understood. It is expected that Seyferts including Compton thick population may explain the cosmic hard X-ray background. At MeV energy range, Seyferts having non-thermal electrons in coronae above accretion disks or MeV blazars may explain the background radiation. We propose that future measurements of the angular power spectra of anisotropy of the cosmic X-ray and MeV gamma-ray backgrounds will be key to deciphering these backgrounds and the evolution of active galactic nuclei (AGNs). As AGNs trace the cosmic large-scale structure, spatial clustering of AGNs exists. We show that e-ROSITA will clearly detect the correlation signal of unresolved Seyferts at 0.5-2 keV and 2-10 keV bands and will be able to measure the bias parameter of AGNs at both bands. Once future hard X-ray all sky satellites achieve a sensitivity better than 10–12 erg cm–2 s–1 at 10-30 keV or 30-50 keV—although this is beyond the sensitivities of current hard X-ray all sky monitors—angular power spectra will allow us to independently investigate the fraction of Compton-thick AGNs in all Seyferts. We also find that the expected angular power spectra of Seyferts and blazars in the MeV range are different by about an order of magnitude, where the Poisson term, so-called shot noise, is dominant. Current and future MeV instruments will clearly disentangle the origin of the MeV gamma-ray background through the angular power spectrum.
Comparison of biological and genomic characteristics between a newly isolated mink enteritis parvovirus MEV-LHV and an attenuated strain MEV-L.

Science.gov (United States)

Mao, Yaping; Wang, Jigui; Hou, Qiang; Xi, Ji; Zhang, Xiaomei; Bian, Dawei; Yu, Yongle; Wang, Xi; Liu, Weiquan

2016-06-01

A virus isolated from mink showing clinical signs of enteritis was identified as a high virulent mink enteritis parvovirus (MEV) based on its biological characteristics in vivo and in vitro. Mink, challenged with this strain named MEV-LHV, exhibited severe pathological lesions as compared to those challenged with attenuated strain MEV-L. MEV-LHV also showed higher infection and replication efficiencies in vitro than MEV-L. Sequence of the complete genome of MEV-LHV was determined and analyzed in comparison with those in GenBank, which revealed that MEV-LHV shared high homology with virulent strain MEV SD12/01, whereas MEV-L was closely related to Abashiri and vaccine strain MEVB, and belonged to a different branch of the phylogenetic tree. The genomes of the two strains differed by insertions and deletions in their palindromic termini and specific unique mutations (especially VP2 300) in coding sequences which may be involved in viral replication and pathogenicity. The results of this study provide a better understanding of the biological and genomic characteristics of MEV and identify certain regions and sites that may be involved in viral replication and pathogenicity.
Negative pion-nucleus elastic scattering at 20 and 40 MeV

International Nuclear Information System (INIS)

Burleson, G.; Blanpied, G.; Cottingame, W.; Daw, G.; Park, B.; Seth, K.K.; Barlow, D.; Iversen, S.; Kaletka, M.; Nann, H.; Saha, A.; Smith, D.; Redwine, R.P.; Burger, W.; Farkhondeh, M.; Saghai, B.; Anderson, R.

1994-01-01

Differential cross sections for the elastic scattering of 20 and 40 MeV π - by nuclei ranging from 12 C to 208 Pb are reported. Comparisons are made with the predictions of the Michigan State University (MSU) optical potential
Exclusive measurements of light fragment production at forward angles in Ne-Pb and Ne-NaF collisions at E/A=400 MeV and 800 MeV

International Nuclear Information System (INIS)

Bastid, N.; Alard, J.P.; Arnold, J.; Augerat, J.; Biagi, F.; Crouau, M.; Charmensat, P.; Dupieux, P.; Fraysse, L.; Marroncle, J.; Montarou, G.; Parizet, M.J.; Qassoud, D.; Rahmani, A.; Schimmerling, W.

1990-01-01

Emission of light fragments at small angles is studied in relativistic heavy ion collisions using the Diogene plastic wall for both symmetrical and non-symmetrical target-projectile systems with 400 MeV per nucleon and 800 MeV per nucleon incident neon nuclei. Efficiency of multiplicity measurements in the small angle range for the selection of central or peripheral collisions is confirmed for asymmetric systems. Differential production cross sections of Z=1 fragments show evidence for the existence of two emitting sources. The apparent temperature of each source is obtained from comparison with a thermodynamical model. (orig.)
29Si(d,3He)28Al reaction at 29 MeV

International Nuclear Information System (INIS)

Vernotte, J.; Berrier-Ronsin, G.; Fortier, S.; Hourani, E.; Kalifa, J.; Khendriche, A.; Maison, J.M.; Rosier, L.H.; Rotbard, G.

1994-01-01

The 29 Si(d, 3 He) 28 Al reaction has been investigated at 29 MeV incident energy. Observations using a split-pole magnetic spectrograph have been made of 55 levels of 28 Al in the range of excitation energy between 0 and 6.7 MeV. Most of them have been identified with 28 Al levels which have been previously observed by other techniques. The spectroscopic factors have been obtained for 23 of these levels through distorted-wave Born approximation analyses of measured angular distributions. The levels at E x =3.105 and 3.762 MeV have been definitely assigned J π =1 + and 0 + , respectively. Four levels which are populated through the pickup of a l p =1 proton have been observed at E x =4.998, 5.406, 6.021, and 6.652 MeV. The excitation energies and spectroscopic factors for positive-parity states were compared with the results of a recent, complete sd-shell space, shell-model calculation. This comparison led to the identification of 21 shell-model levels with experimental levels. This comparison seems accurate enough to make very likely the J π =3 + assignment for the levels at E x =2.988 and 4.597 MeV which were previously assigned J π =(1,3) +
Spin decomposition of the responses of 44Ca and 48Ca to 300 MeV protons

International Nuclear Information System (INIS)

Baker, F.T.; Bimbot, L.; Fergerson, R.W.; Glashausser, C.; Green, A.; Haeusser, O.; Hicks, K.; Jones, K.; Miller, C.A.; Vetterli, M.; Abegg, R.; Beatty, D.; Bonin, B.; Castel, B.; Chen, X.Y.; Cupps, V.; Djalali, C.; Henderson, R.; Jackson, K.P.; Jeppesen, R.; Nakayama, K.; Nanda, S.K.; Sawafta, R.; Yen, S.; Institut de Physique Nucleaire, F-91406 Orsay, France; Rutgers University, Piscataway, New Jersey 08854; Simon Fraser University, Burnaby, Canada V5A1S6; TRIUMF, 4004 Westbrook Mall, Vancouver, Canada V6T2A3; Los Alamos National Laboratory, Los Alamos, New Mexico 87544; Centre d'Etudes Nucleaires de Saclay, 91191 Gif sur Yvette, CEDEX, France; Queen's University, Kingston, Canada K7L3N6; University of Colorado, Boulder, Colorado 80309; University of South Carolina, Columbia, South Carolina 29208; Continuous Electron Beam Accelerator Facility, 12000 Jefferson Ave., Newport News, Virginia 23606; University of Alberta, Edmonton, Canada T6G2J1)

1991-01-01

Angular distributions of the double-differential cross section d 2 σ/dΩ dE(σ) and the spin-flip probability S nn have been measured for inclusive proton inelastic scattering from 44 Ca at 290 MeV and from 48 Ca at 318 MeV. Excitation energies up to about 50 MeV for 44 Ca and 40 MeV for 48 Ca have been investigated over the laboratory angular ranges of 3 degree to 12 degree for 44 Ca and 3 degree to 9 degree for 48 Ca. Multipole decompositions of angular distributions of both the spin-flip cross section σS nn and the estimated cross section for ΔS=0 transitions have been performed. Distributions of strengths were deduced for ΔL=1, ΔS=0 (the giant dipole), ΔL=2, ΔS=0 (the giant quadrupole), ΔL=0, ΔS=1 (the magnetic dipole), ΔL=1, ΔS=1 (the spin dipole), and ΔL=2, ΔS=1 (the spin quadrupole). The ΔS=0 summed strengths for 44 Ca are lower than for 40 Ca and 48 Ca. The spin-dipole summed strengths are found to be approximately independent of A. For 48 Ca, essentially all M1 strength observed was in the 10.23 MeV 1 + state; for 44 Ca, M1 strength was observed to be fragmented over a range of 7 to 18 Mev
Measurement of photon showers in lead produced by electrons of 150 MeV

International Nuclear Information System (INIS)

Goeringer, H.; Eyss, H.J. von; Schoch, B.

1976-01-01

The photon energy spectra induced by 150 MeV electrons in lead were measured in the energy range from 40 MeV up to the primary electron energy. The target thickness was varied between 0.1 and 2.5 radiation lengths X 0 . The photons were analyzed by use of a technique based on deuteron photodisintegration. Differential and integral shower spectra are presented and compared with Monte Carlo calculations of Nagel and Messel et al., both interpolated to our primary energy of 150 MeV. The measured spectra show good agreement with these Monte Carlo calculations for the thickest target of 2.5X 0 and with calculated bremsstrahlung spectra for the thinnest target of 0.1X 0 . Considerable discrepancies, however, are found for medium target thicknesses in the range 0 . Around the shower maxima, the shower spectra are narrower and the maxima are shifted about 0.3-0.4X 0 to lower target thicknesses, furthermore the number of photons at the shower maxima are up to 50% higher than calculated. (Auth.)
Sustained >100 MeV Gamma-Ray Emission: A Monitor for >300 MeV SEP Protons at the Sun

Science.gov (United States)

Share, G. H.; Murphy, R. J.

2017-12-01

Solar γ radiation is the product of proton and ion interactions in the solar atmosphere. The spectrum and temporal characteristics of the emission provides fundamental information on the ions at the Sun. Until the launch of the Fermi satellite, with its Large Area Telescope (LAT) sensitive to radiation above 100 MeV, most of the γ-ray observations were made in the nuclear energy range with radiation arising from interaction of one to tens of MeV ions produced in solar flares. Since 2008 the LAT has detected 30 high-energy γ-ray events with temporal and spectral characteristics that are distinct from the associated solar flare. We call this radiation Sustained Gamma-Ray Emission (SGRE) and briefly summarize its characteristics reported in a recent paper. The γ-ray spectra are consistent with pion decay radiation produced by protons above 300 MeV. The onset of the radiation most often occurs after the impulsive flare and the emission can last several hours. We find that the number of protons responsible for the SGRE is typically more than 10 times the number of flare-accelerated protons. These characteristics require that there be an additional source of energy to accelerate the protons to hundreds of MeV to produce the SGRE. As 28 of the 30 SGRE events are accompanied by fast CMEs, it is likely that these protons are accelerated by the same shock that produces gradual SEPs. We find that the number of protons >500 MeV in the accompanying SEPs is typically about 50-100 times the number of protons that return to the Sun to produce the SGRE. There also appear to be correlations between the numbers of SEP and SGRE protons and durations of >100 MeV SEP proton and SGRE events. We find that for all SGRE events where there were flare observations, the accompanying impulsive X-radiation reached energies >100 keV. In a limited study of 18 solar events with CME speeds >800 km/s we also find that the median SEP proton flux is 25 times higher when flare hard X-rays exceed 100
49 CFR 220.23 - Publication of radio information.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Publication of radio information. 220.23 Section... § 220.23 Publication of radio information. Each railroad shall designate where radio base stations are.... The publication shall indicate the periods during which base and wayside radio stations are...
Effect of substrate temperature on the radiation damage from MeV Si implantation in Si

International Nuclear Information System (INIS)

Yu, X.K.; Shao Lin; Rusakova, Irene; Wang, X.M.; Ma, K.B.; Chen, H.; Liu, Jiarui; Chu, W.-K.

2006-01-01

We have investigated the radiation damage by MeV implantation of Si in Si and its evolution under thermal annealing. Si wafers were implanted with MeV Si at various substrate temperatures. Damages were characterized by Rutherford-backscattering (RBS) channeling and by transmission electron microscopy (TEM). Defect formation after post-implantation annealing is very sensitive to the substrate temperatures during implantation. When the substrate temperature was decreased to 200 K, TEM revealed two distinct bands of damage after annealing: one around the mean projected ion range and another at half the projected range. Our study indicates that the formation of defects at half range results from the solid phase epitaxy growth of initial buried amorphous layers
Measurement of activation cross-section of long-lived products in deuteron induced nuclear reactions on palladium in the 30-50MeV energy range.

Science.gov (United States)

Ditrói, F; Tárkányi, F; Takács, S; Hermanne, A; Ignatyuk, A V

2017-10-01

Excitation functions were measured in the 31-49.2MeV energy range for the nat Pd(d,xn) 111,110m,106m,105,104g,103 Ag, nat Pd(d,x) 111m,109,101,100 Pd, nat Pd(d,x), 105,102m,102g,101m,101g,100,99m,99g Rh and nat Pd(d,x) 103,97 Ru nuclear reactions by using the stacked foil irradiation technique. The experimental results are compared with our previous results and with the theoretical predictions calculated with the ALICE-D, EMPIRE-D and TALYS (TENDL libraries) codes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Neutron response matrix for unfolding NE-213 measurements to 21 MeV

International Nuclear Information System (INIS)

Ingersoll, D.T.; Wehring, B.W.; Johnson, R.H.

1976-01-01

A neutron response matrix from measured neutron responses of NE-213 in the energy range of 0.2 to 22 MeV is presented. An interpolation scheme was used to construct an 81-column matrix from the data of Verbinski, Burrus, Love, Zobel, and Hill. As a test of the new response matrix, the Cf-252 neutron spectrum was measured and unfolded using the new response matrix and the FORIST unfolding code. The spectrum agrees well with previous measurements at lower energies, while providing new information above 8 MeV
Intensity maps of MeV electrons and protons below the radiation belt

International Nuclear Information System (INIS)

Kohno, T.; Munakata, K.; Murakami, H.; Nakamoto, A.; Hasebe, N.; Kikuchi, J.; Doke, T.

1988-01-01

The global distributions of energetic electrons (0.19 - 3.2 MeV) and protons (0.64 - 35 MeV) are shown in the form of contour maps. The data were obtained by two sets of energetic particle telescopes on board the satellite OHZORA. The observed altitude range is 350 - 850 Km. Ten degress meshes in longitude and latitude were used to obtain the intensity contours. A pitch angle distribution of J(α) = J(90). sin n α with n = 5 A is assumed to get the average intensity in each mesh. (author) [pt
Fusion with projectiles from carbon to argon at energies between 20A MeV and 60A MeV

International Nuclear Information System (INIS)

Galin, J.

1986-01-01

Fusion reactions are known to be the dominant reaction channel at low bombarding energies and can now be investigated with a large variety of projectiles at several tens of MeV per nucleon. The gross characteristics of the fusion process can be studied by measuring global quantities, such as the linear momentum transferred from projectile to target and the dissipated energy of the reaction. The strong correlation between these two quantities is demonstrated at moderate bombarding energies, with a Ne projectile on a U target. It is expected that light particle (charged or neutron) multiplicity measurements can be extended to this higher energy domain and be used to selectively filter these collisions, according to their degree of violence. A review of the linear momentum transfer is made, considering essentially heavy targets and two important parameters in the entrance channel: the projectile energy and its mass. Over a broad mass range, and for energies up to 30A MeV, the momentum transfer scales with the mass of the projectile. At 30A MeV, the most probable value of projectile momentum transferred to the fused system is 80%, and this represents roughly 180 MeV/c per projectile nucleon. At higher bombarding energies, the momentum distribution in the fused systems, as observed from binary fission events, seems to depend on the mass of the projectile. Further studies are still needed to understand this behavior. Finally, the decay of highly excited (E* similarly ordered 500-800 MeV) fused systems, with masses close to 270 amu, is studied from the characteristics of both fusion fragments and light charged particles. It is shown that thermal equilibrium is reached before fission, even for such high energy deposition. However, the decay sequence is sensitive to dynamical effects and does not depend only on available phase space
Neutron total and scattering cross sections of 6Li in the few MeV region

International Nuclear Information System (INIS)

Smith, A.; Guenther, P.; Whalen, J.

1980-02-01

Neutron total cross sections of 6 Li are measured from approx. 0.5 to approx. 4.8 MeV at intervals of approx. 10 scattering angles and at incident-neutron intervals of approx.< 100 keV. Neutron differential inelastic-scattering cross sections are measured in the incident-energy range 3.5 to 4.0 MeV. The experimental results are extended to lower energies using measured neutron total cross sections recently reported elsewhere by the authors. The composite experimental data (total cross sections from 0.1 to 4.8 MeV and scattering cross sections from 0.22 to 4.0 MeV) are interpreted in terms of a simple two-level R-matrix model which describes the observed cross sections and implies the reaction cross section in unobserved channels; notably the (n;α)t reaction (Q = 4.783 MeV). The experimental and calculational results are compared with previously reported results as summarized in the ENDF/B-V evaluated nuclear data file
Integral activation experiment of fusion reactor materials with d-Li neutrons up to 55 MeV

Energy Technology Data Exchange (ETDEWEB)

Maekawa, Fujio; Ikeda, Yujiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Moellendorff, Ulrich von [Forschungszentrum Karlsruhe, Karlsruhe (Germany); Wada, Masayuki [Business Automation Co., Ltd., Tokyo (Japan)

2000-03-01

An integral activation experiment of fusion reactor materials with a deuteron-lithium neutron source was performed. Since the maximum energy of neutrons produced was 55 MeV, the experiment with associated analysis was one of the first attempts for extending the energy range beyond 20 MeV. The following keywords represent the present study: d-Li neutrons, 55 MeV, dosimetry, SAND-II, spectrum adjustment, LA-150, MCNP, McDeLi, IFMIF, fusion reactor materials, integral activation experiment, low-activation, F82H, vanadium-alloy, IEAF, ALARA, and sequential charged particle reaction. (author)
31 CFR 515.570 - Remittances to Nationals of Cuba.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Remittances to Nationals of Cuba. 515..., Authorizations, and Statements of Licensing Policy § 515.570 Remittances to Nationals of Cuba. (a) Family... older are authorized to make remittances to nationals of Cuba who are close relatives, as defined in...
20 CFR 404.220 - Average-monthly-wage method.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Average-monthly-wage method. 404.220 Section... INSURANCE (1950- ) Computing Primary Insurance Amounts Average-Monthly-Wage Method of Computing Primary Insurance Amounts § 404.220 Average-monthly-wage method. (a) Who is eligible for this method. You must...
Measured neutron carbon kerma factors from 14.1 MeV to 18 MeV

International Nuclear Information System (INIS)

Deluca, P.M. Jr.; Barschall, H.H.; Haight, R.C.; McDonald, J.C.

1984-01-01

For A-150 tissue-equivalent plastic, the total neutron kerma is dominated by the hydrogen kerma. Tissue kerma is inferred with reasonable accuracy by normalization to the kerma factor ratio between tissue and A-150 plastic. Because of the close match in the hydrogen abundance in these materials, the principal uncertainty is due to the kerma factors of carbon and oxygen. We have measured carbon kerma factor values of 0.183 +- 0.015 10 -8 cGy cm 2 and 0.210 +- 0.16 10 -8 cGy cm 2 at 14.1-MeV and 15-MeV neutron energy, respectively. A preliminary value of 0.297 +- 0.03 10 -8 cGy cm 2 has been determined at 17.9 MeV. A recent microscopic cross section measurement of the (n,n'3α) reaction in carbon at 14.1-MeV energy gives a kerma factor of 0.184 +- 0.019 10 8 cGy cm 2 in agreement with the present result. 9 refs., 4 figs., 2 tabs
47 CFR 25.220 - Non-conforming transmit/receive earth station operations.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 2 2010-10-01 2010-10-01 false Non-conforming transmit/receive earth station operations. 25.220 Section 25.220 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Standards § 25.220 Non-conforming transmit/receive...

High-resolution integrated germanium Compton polarimeter for the γ-ray energy range 80 keV--1 MeV

International Nuclear Information System (INIS)

Sareen, R.A.; Urban, W.; Barnett, A.R.; Varley, B.J.

1995-01-01

Parameters which govern the choice of a detection system to measure the linear polarization of γ rays at low energies are discussed. An integrated polarimeter is described which is constructed from a single crystal of germanium. It is a compact planar device with the sectors defined electrically, and which gives an energy resolution in the add-back mode of 1 keV at 300 keV. Its performance is demonstrated in a series of calibration measurements using both unpolarized radiation from radioactive sources and polarized γ rays from the 168 Er(α,2n) 170 Yb reaction at E α =25 MeV. Polarization measurements at energies as low as 84 keV have been achieved, where the sensitivity was 0.32±0.09. The sensitivity, efficiency, and energy resolution are reported. Our results indicate that energy resolution should be included in the definition of the figure of merit and we relate the new definition to earlier work. The comparisons show the advantages of the present design in the energy range below 300 keV and its competitiveness up to 1500 keV. copyright 1995 American Institute of Physics
Construction of a 1 MeV Electron Accelerator for High Precision Beta Decay Studies

Science.gov (United States)

Longfellow, Brenden

2014-09-01

Beta decay energy calibration for detectors is typically established using conversion sources. However, the calibration points from conversion sources are not evenly distributed over the beta energy spectrum and the foil backing of the conversion sources produces perturbations in the calibration spectrum. To improve this, an external, tunable electron beam coupled by a magnetic field can be used to calibrate the detector. The 1 MeV electron accelerator in development at Triangle Universities Nuclear Laboratory (TUNL) utilizes a pelletron charging system. The electron gun shoots 104 electrons per second with an energy range of 50 keV to 1 MeV and is pulsed at a 10 kHz rate with a few ns width. The magnetic field in the spectrometer is 1 T and guiding fields of 0.01 to 0.05 T for the electron gun are used to produce a range of pitch angles. This accelerator can be used to calibrate detectors evenly over its energy range and determine the detector response over a range of pitch angles. Beta decay energy calibration for detectors is typically established using conversion sources. However, the calibration points from conversion sources are not evenly distributed over the beta energy spectrum and the foil backing of the conversion sources produces perturbations in the calibration spectrum. To improve this, an external, tunable electron beam coupled by a magnetic field can be used to calibrate the detector. The 1 MeV electron accelerator in development at Triangle Universities Nuclear Laboratory (TUNL) utilizes a pelletron charging system. The electron gun shoots 104 electrons per second with an energy range of 50 keV to 1 MeV and is pulsed at a 10 kHz rate with a few ns width. The magnetic field in the spectrometer is 1 T and guiding fields of 0.01 to 0.05 T for the electron gun are used to produce a range of pitch angles. This accelerator can be used to calibrate detectors evenly over its energy range and determine the detector response over a range of pitch angles
Spin-flip (p,n) reactions on 26Mg, 54Fe, and 56Fe at selected proton bombarding energies in the range of 17 to 25 MeV

International Nuclear Information System (INIS)

Aron, D.L.

1985-06-01

New data are presented for the 26 Mg(p,n) 26 Al reaction at E/sub p/ = 19.12 and 24.97 MeV, for the 54 Fe(p,n) 54 Co reaction at E/sub p/ = 17.20, 18.60, and 24.60 MeV, and for the 56 Fe(p,n) 56 Co reaction at E/sub p/ = 19.12 and 24.59 MeV. Data were taken with the LLNL Cyclograaff at 16 angles from 3.5 0 to 159.0 0 . A large detector at 23.8 0 with a long neutron flight path collected high resolution spectra. This large detector also collected separate 0 0 high resolution data on the 26 Mg and 56 Fe(p,n) reactions at E/sub p/ = 19 MeV. Absolute differential (p,n) cross sections were extracted for 1 + states in 26 Al, 54 Co, and 56 Co, for the 0 + isobaric analong state (IAS) in 54 Co and 56 Co, for a 2 + state in each residual nucleus, and for the 0.199 MeV 7 + state of 54 Co. No new experimental states were identified. Only relative cross sections were extracted at 0 0 . Experimental angle-integrated cross sections were obtained for all but one state. DWBA79 was used, with the G-matrix effective nucleon-nucleon interaction of Bertsch et al. (with the central triplet-odd component V/sub to/ = O) and the Livermore shell model wave functions to calculate differential (p,n) cross sections to 1 + states and to the 54 Co and 56 Co IAS. Normalization of the DWBA angle-integrated cross sections to measurements for the 54 Co and 56 Co IAS (at E/sub p/ = 24.6 MeV) yielded the renormalized V/sub tau/ = 21.4 +- 2.1 MeV. Normalization of the DWBA angle-integrated cross sections to measurements for the 24.6 MeV 54 Co and 56 Co 1 + states, coupled with the normalization of the wave functions to previously experimentally determined GT strength, yield the renormalized V/sub sigmatau/ = 12.3 +- 1.2 MeV. The experimental Gamow-Teller strength B(GT)/sub exp./ of the T = 1 26 Al state at 9.44 MeV was found to be 0.69; B(GT)/sub exp/ of the T = 1 26 Al state at 10.47 MeV was found to be 0.39
Attenuation of 10 MeV electron beam energy to achieve low doses does not affect Salmonella spp. inactivation kinetics

International Nuclear Information System (INIS)

Hieke, Anne-Sophie Charlotte; Pillai, Suresh D.

2015-01-01

The effect of attenuating the energy of a 10 MeV electron beam on Salmonella inactivation kinetics was investigated. No statistically significant differences were observed between the D 10 values of either Salmonella 4,[5],12:i:- or a Salmonella cocktail (S. 4,[5],12:i:-, Salmonella Heidelberg, Salmonella Newport, Salmonella Typhimurium, Salmonella) when irradiated with either a non-attenuated 10 MeV eBeam or an attenuated 10 MeV eBeam (~2.9±0.22 MeV). The results show that attenuating the energy of a 10 MeV eBeam to achieve low doses does not affect the inactivation kinetics of Salmonella spp. when compared to direct 10 MeV eBeam irradiation. - Highlights: • 10 MeV eBeam energy was attenuated to 2.9±0.22 MeV using HDPE sheets. • Attenuation of eBeam energy does not affect the inactivation kinetics of Salmonella. • Microbial inactivation is independent of eBeam energy in the range of 3–10 MeV
Simulations of Beam Quality in a 13 MeV PET Cyclotron

Directory of Open Access Journals (Sweden)

A. Pramudita

2015-12-01

Full Text Available Simulation of the trajectories of negative hydrogen ion (H− beam in a 13 MeV PET cyclotron (DECY-13 were carried out by using the Runge-Kutta (RK4 approximation method and Scilab 5.4.1. The magnetic and electric fields were calculated using Opera-3d/TOSCA softwares at 1 mm resolution. The cyclotron is of a fourth-harmonics type, meaning that the acceleration occurs four times per cycle, with a radiofrequency (RF field of 77.66 MHz frequency and 40 kV amplitude. The calculations and simulations show that the maximum distance between the ion source and the puller is about 6 mm, while the maximum width of the beam at 13 MeV is about 10 mm, and the initial phase between the RF field and the beam ranges from -10° to 10°, with a yield of about 10% of the beam from the ion source getting accelerated to 13 MeV.
High-resolution Auger spectroscopy on 79 MeV Ar5+, 89 MeV Ar6+, and 136 MeV Ar7+ ions after excitation by helium

International Nuclear Information System (INIS)

Schneider, T.

1988-01-01

In this thesis the atomic structure of highly excited Ar 6+ and Ar 7+ ions was studied. For this 79 MeV Ar 5+ , 89 MeV Ar 6+ , and 136 MeV Ar 7+ ions of a heavy ion accelerator were excited by a He gas target to autoionizing states and the Auger electrons emitted in the decay were measured in highly-resolving state. The spectra were taken under an observational angle of zero degree relative to the beam axis in order to minimize the kinematical broadening of the Auger lines. (orig./HSI) [de
Scattering of 14.2 MeV polarized neutrons from 12C

International Nuclear Information System (INIS)

Casparis, R.; Leemann, B.Th.; Preiswerk, M.; Rudin, H.; Wagner, R.; Zupranski, P.

1976-01-01

Polarized 14.2 MeV neutrons with a polarization of approximately 50% were produced in the 3 H(d(pol),n(pol)) 4 He reaction using vector polarized deuterons from an 'atomic beam' source of polarized ions. The angular distributions of the analyzing power in the elastic and inelastic (Q = -4.43 MeV) scattering of neutrons from carbon have been measured at ten angles in the range from 22 0 to 152 0 c.m. A time-of-flight technique was used to separate elastically and inelastically scattered neutrons. The results have been compared with theoretical calculations obtained with the DWBA and the coupled channels method. (Auth.)
Cross sections and analyzing powers of 15N(p,n)15O at 200 MeV and 494 MeV

International Nuclear Information System (INIS)

Ciskowski, D.E.

1989-11-01

Differential cross sections and analyzing powers have been measured for the 15 N(p,n) 15 O(g.s.) reaction at bombarding energies of 200 MeV and 494 MeV. The 494 MeV data were obtained at the LAMPF Neutron Time-Of-Flight Facility on an 82 m flight path with a resolution of about 2.7 MeV. The 200 MeV data were obtained at IUCF on a 76m flight path with a resolution of about 1.1 MeV. At both energies, the measured analyzing power is small, the magnitude is less than .2 for momentum transfers of less than 1 fm -1 . In contrast, both Relativistic and standard DWIA calculations predict a maximum of A=-.7 near q=0.7 fm -1 . 53 refs., 44 figs
Chandra Observations of Extended X-Ray Emission in ARP 220

Science.gov (United States)

McDowell, J. C.; Clements, D. L.; Lamb, S. A.; Shaked, S.; Hearn, N. C.; Colina, L.; Mundell, C.; Borne, K.; Baker, A. C.; Arribas, S.

2003-01-01

We resolve the extended X-ray emission from the prototypical ultraluminous infrared galaxy Arp 220. Extended, faint, edge-brightened, soft X-ray lobes outside the optical galaxy are observed to a distance of 1CL 15 kpc on each side of the nuclear region. Bright plumes inside the optical isophotes coincide with the optical line emission and extend 1 1 kpc from end to end across the nucleus. The data for the plumes cannot be fitted by a single-temperature plasma and display a range of temperatures from 0.2 to 1 keV. The plumes emerge from bright, diffuse circumnuclear emission in the inner 3 kpc centered on the Ha peak, which is displaced from the radio nuclei. There is a close morphological correspondence between the Ha and soft X-ray emission on all spatial scales. We interpret the plumes as a starburst-driven superwind and discuss two interpretations of the emission from the lobes in the context of simulations of the merger dynamics of Arp 220.
Near-infrared light and the morphology of Arp 220

International Nuclear Information System (INIS)

Smith, J.; Grasdalen, G.L.; Gehrz, R.D.; Hackwell, J.A.; Dietz, R.D.

1988-01-01

This paper presents 2.2 micron imaging and a near-IR energy distribution for the luminous galaxy Arp 220. In the near-IR, Arp 220 appears as a single isolated galaxy with the projected axial symmetry of either a face-on disk or spheroid. The near-IR images contradict the original interpretation of the galaxy as the ongoing collision of two galaxies. No single component morphology can explain the galaxy adequately; this paper explains it as a hybrid galaxy form related to the class of radio galaxies with dust lanes. Some radio galaxies have properties in common with Arp 220. Hot stars are probable sources for heating of the diffuse dust in Arp 220 and perhaps some portion of a nuclear component. Heating by a nonstellar source of ultraviolet radiation is possible at the nucleus. 31 references
Non-elastic cross-sections for neutron interactions with carbon and oxygen above 14 MeV

International Nuclear Information System (INIS)

Brenner, D.J.; Prael, R.E.

1985-01-01

In the light of the new generation of high energy (less than or equal to 80 MeV) neutron therapy facilities currently being tested, the need for neutron kerma factors in the range from 15 to 80 MeV on carbon and oxygen has become of urgent importance. Not enough experimental data currently exist or are likely to be measured soon, so a nuclear model is essential for interpolation or, less satisfactorily, extrapolation of available data. The use of a suitable model, applicable to light nuclei, is shown to be crucial. Such a model is described, and good agreement between its results and the experimental data in the energy range of interest is reported. Comparisons between the model predictions and the ENDF/B-V evaluation of the non-elastic cross section for carbon between 15 and 20 MeV indicate that a re-evaluation of ENDF is required. 35 refs., 12 figs., 6 tabs
A novel source of MeV positron bunches driven by energetic protons for PAS application

Energy Technology Data Exchange (ETDEWEB)

Tan, Zongquan, E-mail: tqq1123@mail.ustc.edu.cn [State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Xu, Wenzhen; Liu, Yanfen; Xiao, Ran; Kong, Wei [State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Ye, Bangjiao, E-mail: bjye@ustc.edu.cn [State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China)

2014-11-01

This paper proposes a novel methodology of MeV positrons generation for PAS application. Feasibility of this proposal analyzed by G4Beamline and Transport have shown reasonable success. Using 2 Hz, 1.6 GeV, 100 ns and 1.5 μC/bunch proton bunches for bombarding a graphite target, about 100 ns e{sup +} bunches are generated. Quasi-monochromatic positrons in the range of 1–10 MeV included in these bunches have a flux of >10{sup 7}/s, peak brightness of 10{sup 14}/s. A magnetic-confinement beamline is utilized to transport the positrons and a “Fast Beam Chopper” is unprecedentedly extended to chop those relativistic bunches. The positron beam can be finally characterized by the energy range of 1–10 MeV and bunch width from one hundred ps up to 1 ns. Such ultrashort bunches can be useful in tomography-type positron annihilation spectroscopy (PAS) as well as other applications.
A novel source of MeV positron bunches driven by energetic protons for PAS application

Science.gov (United States)

Tan, Zongquan; Xu, Wenzhen; Liu, Yanfen; Xiao, Ran; Kong, Wei; Ye, Bangjiao

2014-11-01

This paper proposes a novel methodology of MeV positrons generation for PAS application. Feasibility of this proposal analyzed by G4Beamline and Transport have shown reasonable success. Using 2 Hz, 1.6 GeV, 100 ns and 1.5 μC/bunch proton bunches for bombarding a graphite target, about 100 ns e+ bunches are generated. Quasi-monochromatic positrons in the range of 1-10 MeV included in these bunches have a flux of >107/s, peak brightness of 1014/s. A magnetic-confinement beamline is utilized to transport the positrons and a "Fast Beam Chopper" is unprecedentedly extended to chop those relativistic bunches. The positron beam can be finally characterized by the energy range of 1-10 MeV and bunch width from one hundred ps up to 1 ns. Such ultrashort bunches can be useful in tomography-type positron annihilation spectroscopy (PAS) as well as other applications.
Energy monitoring device for 1.5-2.4 MeV electron beams

Energy Technology Data Exchange (ETDEWEB)

Fuochi, P.G., E-mail: fuochi@isof.cnr.i [CNR-ISOF, Via P. Gobetti 101, I-40129 Bologna (Italy); Lavalle, M.; Martelli, A. [CNR-ISOF, Via P. Gobetti 101, I-40129 Bologna (Italy); Kovacs, A. [Institute of Isotopes, HAS, P.O.Box 77, H-1525 Budapest (Hungary); Mehta, K. [Arbeiterstrandbad Strasse 72, Vienna, A-1210 (Austria); Kuntz, F.; Plumeri, S. [Aerial, Parc d' Innovation Rue Laurent Fries F-67400 Illkirch (France)

2010-03-11

An easy-to-use and robust energy monitoring device has been developed for reliable detection of day-to-day small variations in the electron beam energy, a critical parameter for quality control and quality assurance in industrial radiation processing. It has potential for using on-line, thus providing real-time information. Its working principle is based on the measurement of currents, or charges, collected by two aluminium absorbers of specific thicknesses (dependent on the beam energy), insulated from each other and positioned within a faraday cup-style aluminium cage connected to the ground. The device has been extensively tested in the energy range of 4-12 MeV under standard laboratory conditions at Institute of Isotopes and CNR-ISOF using different types of electron accelerators; namely, a TESLA LPR-4 LINAC (3-6 MeV) and a L-band Vickers LINAC (7-12 MeV), respectively. This device has been also tested in high power electron beam radiation processing facilities, one equipped with a 7-MeV LUE-8 linear accelerator used for crosslinking of cables and medical device sterilization, and the other equipped with a 10 MeV Rhodotron TT100 recirculating accelerator used for in-house sterilization of medical devices. In the present work, we have extended the application of this method to still lower energy region, i.e. from 1.5 to 2.4 MeV. Also, we show that such a device is capable of detecting deviation in the beam energy as small as 40 keV.
Energy monitoring device for 1.5-2.4 MeV electron beams

Science.gov (United States)

Fuochi, P. G.; Lavalle, M.; Martelli, A.; Kovács, A.; Mehta, K.; Kuntz, F.; Plumeri, S.

2010-03-01

An easy-to-use and robust energy monitoring device has been developed for reliable detection of day-to-day small variations in the electron beam energy, a critical parameter for quality control and quality assurance in industrial radiation processing. It has potential for using on-line, thus providing real-time information. Its working principle is based on the measurement of currents, or charges, collected by two aluminium absorbers of specific thicknesses (dependent on the beam energy), insulated from each other and positioned within a faraday cup-style aluminium cage connected to the ground. The device has been extensively tested in the energy range of 4-12 MeV under standard laboratory conditions at Institute of Isotopes and CNR-ISOF using different types of electron accelerators; namely, a TESLA LPR-4 LINAC (3-6 MeV) and a L-band Vickers LINAC (7-12 MeV), respectively. This device has been also tested in high power electron beam radiation processing facilities, one equipped with a 7-MeV LUE-8 linear accelerator used for crosslinking of cables and medical device sterilization, and the other equipped with a 10 MeV Rhodotron TT100 recirculating accelerator used for in-house sterilization of medical devices. In the present work, we have extended the application of this method to still lower energy region, i.e. from 1.5 to 2.4 MeV. Also, we show that such a device is capable of detecting deviation in the beam energy as small as 40 keV.
29 CFR 570.63 - Occupations involved in the operation of paper-products machines, scrap paper balers, and paper...

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations involved in the operation of paper-products machines, scrap paper balers, and paper box compactors (Order 12). 570.63 Section 570.63 Labor Regulations... involved in the operation of paper-products machines, scrap paper balers, and paper box compactors (Order...
Theoretical calculation of n + {sup 59}Co reaction in energy region up to 100 MeV

Energy Technology Data Exchange (ETDEWEB)

Qingbiao, Shen; Baosheng, Yu; Dunjiu, Cai [Chinese Nuclear Data Center, Beijing, BJ (China)

1996-06-01

A set of neutron optical potential parameters for {sup 59}Co in energy region of 2{approx}100 MeV was obtained based on concerned experimental data. Various cross sections of n + {sup 59}Co reactions were calculated and predicted. The calculated results show that the activation products {sup 58,57}Co, {sup 59}Fe and {sup 56}Mn are main neutron monitor reaction products for n + {sup 59}Co reaction in energy range up to 100 MeV. {sup 54}Mn production reaction can be a promising neutron monitor reaction in the energy region from 30 to 100 MeV. (6 figs.).
25 CFR 1000.220 - What regulations apply to self-governance Tribes?

Science.gov (United States)

2010-04-01

... 25 Indians 2 2010-04-01 2010-04-01 false What regulations apply to self-governance Tribes? 1000.220 Section 1000.220 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE...-DETERMINATION AND EDUCATION ACT Waiver of Regulations § 1000.220 What regulations apply to self-governance...
33 CFR 96.220 - What makes up a safety management system?

Science.gov (United States)

2010-07-01

... system? 96.220 Section 96.220 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY VESSEL OPERATING REGULATIONS RULES FOR THE SAFE OPERATION OF VESSELS AND SAFETY MANAGEMENT SYSTEMS Company and Vessel Safety Management Systems § 96.220 What makes up a safety management system? (a) The...
Evidence for detection of 1--10 MeV emission from the Taurus region in 1971 August

International Nuclear Information System (INIS)

Gruber, D.E.; Ling, J.C.

1977-01-01

The Taurus region was scanned in mid-1971 during three balloon flights with an actively shielded NaI detector sensitive between 0.2 and 10 MeV. Below 1 MeV, these observations yielded measurements and upper limits consistent with extensions of the X-ray power laws of 0.0035 (E/1 MeV) -2 /sup ./ 2 photons (cm 2 s MeV) -1 and 0.0008(E/1 MeV) -2 /sup ./ 1 photons (cm 2 s MeV) -1 for the Crab Nebula and NP 0532, respectively. Above 1 MeV an apparent unpulsed flux, enhanced well above the extrapolated Crab Nebula power law, was observed during the 1971 August 8 flight; it was the most sensitive of the three. For the NP 0532 above 1 MeV on the same date, the measured upper limit of a factor of 8 above the extrapolated power law excludes only the possibility of a large flare-up. The possibility that the observation reported here for 1971 August 8 was a purely instrumental effect, or was produced by environmental radiations, is thoroughly examined, with negative results. If of cosmic origin, the emission must have been short-term (approx.days, months), because other observations in 1973 and 1974 have shown null results. The possibility of variable MeV range emission is discussed in the context of other reported variable emissions in recent years from the Crab and the Taurus region

Comparison of the BNAB-78 and ENDF/B-V evaluated 238U radiative capture data in the energy range from 0.5 to 15 MeV

International Nuclear Information System (INIS)

Tolstikov, V.A.

1991-01-01

Evaluations of the 238 U capture cross-section as given in the BNAB-78 and ENDF/B-V evaluated data libraries are intercompared and their values compared to recently published data which had not been included in these evaluations. It is concluded that there is a need to re-assess the earlier experimental data, particularly those based on activation measurements, taking secondary neutron reactions and scattering effects into account. It is recommended that a precision measurement of the capture cross-section and its dependence on energy be done in the 1-7 MeV energy range. (author). 18 refs, 1 fig
Monte Carlo simulation of channeled and random profiles of heavy ions implanted in silicon at high energy (1.2 MeV)

International Nuclear Information System (INIS)

Mazzone, A.M.

1987-01-01

In order to study channeling effects and implants of heavy ions with energy of few MeV in silicon, ion distributions are calculated with a Monte Carlo method for axial [(001) axis], planar, and nominally random directions for As + and P + ions implanted into silicon with energies in the range 100 keV to 2 MeV. The calculation indicates an appreciable channeling at the higher energy only for the (001) axis and the (110) planes. For heavy ions with energy in the MeV range the subsidence of channeling into major channels and the disappearance of minor channels are shown
14 MeV neutrons physics and applications

CERN Document Server

Valkovic, Vladivoj

2015-01-01

Despite the often difficult and time-consuming effort of performing experiments with fast (14 MeV) neutrons, these neutrons can offer special insight into nucleus and other materials because of the absence of charge. 14 MeV Neutrons: Physics and Applications explores fast neutrons in basic science and applications to problems in medicine, the environment, and security.Drawing on his more than 50 years of experience working with 14 MeV neutrons, the author focuses on:Sources of 14 MeV neutrons, including laboratory size accelerators, small and sealed tube generators, well logging sealed tube ac
20 CFR 220.131 - Work which exists in the national economy.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work which exists in the national economy. 220.131 Section 220.131 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Vocational Considerations § 220.131 Work which exists in the national economy. (a) General. The Board considers...
20 CFR 220.102 - Non-severe impairment(s), defined.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Non-severe impairment(s), defined. 220.102 Section 220.102 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... these include— (1) Physical functions such as walking, standing, sitting, lifting, pushing, pulling...
Annealing behaviour of MeV erbium implanted lithium niobate

Energy Technology Data Exchange (ETDEWEB)

Gortmaker, P.; McCallum, J.C. [Royal Melbourne Inst. of Tech., VIC (Australia)

1993-12-31

Lithium niobate (LiNbO{sub 3}) is a crystalline ceramic commonly used in the fabrication of optoelectronic devices. Recently, rare earth doping of LiNbO{sub 3} has become a topic of particular interest. The electronic configuration of rare earth elements such as Erbium (Er) and Neodymium (Nd) allows them to lase in nearly any host matrix making fabrication of a whole range of new optoelectronic devices possible. At present, the doping technique, for LiNbO{sub 3} are centred upon diffusion technology, but the diffusion profiles for the rare earths are not generally well-matched to the optical modes of the device. The aim of this research is to develop MeV implantation and annealing conditions of rare earth doped LiNbO{sub 3} that would be compatible with optoelectronic device fabrication. To determine the characteristics of the rare earth elements in the LiNbO{sub 3} host material over the depth range of interest in optoelectronic device applications, high energy Rutherford backscattering spectrometry and ion channeling (RBS-C) must be used. Presented here are the Er depth profile and lattice damage results obtained from 5 MeV RBS-C measurements on samples of LiNbO{sub 3} implanted with various doses of MeV Erbium and subsequently thermally annealed at a temperature of 1000 deg C. It was found that there is a peak implant concentration (2 x 10{sup 16} Er/cm{sup 2}) for which erbium no longer goes substitutional in the lattice, and the implantation damage is not fully removed by annealing. 8 refs., 3 figs.
Annealing behaviour of MeV erbium implanted lithium niobate

Energy Technology Data Exchange (ETDEWEB)

Gortmaker, P; McCallum, J C [Royal Melbourne Inst. of Tech., VIC (Australia)

1994-12-31

Lithium niobate (LiNbO{sub 3}) is a crystalline ceramic commonly used in the fabrication of optoelectronic devices. Recently, rare earth doping of LiNbO{sub 3} has become a topic of particular interest. The electronic configuration of rare earth elements such as Erbium (Er) and Neodymium (Nd) allows them to lase in nearly any host matrix making fabrication of a whole range of new optoelectronic devices possible. At present, the doping technique, for LiNbO{sub 3} are centred upon diffusion technology, but the diffusion profiles for the rare earths are not generally well-matched to the optical modes of the device. The aim of this research is to develop MeV implantation and annealing conditions of rare earth doped LiNbO{sub 3} that would be compatible with optoelectronic device fabrication. To determine the characteristics of the rare earth elements in the LiNbO{sub 3} host material over the depth range of interest in optoelectronic device applications, high energy Rutherford backscattering spectrometry and ion channeling (RBS-C) must be used. Presented here are the Er depth profile and lattice damage results obtained from 5 MeV RBS-C measurements on samples of LiNbO{sub 3} implanted with various doses of MeV Erbium and subsequently thermally annealed at a temperature of 1000 deg C. It was found that there is a peak implant concentration (2 x 10{sup 16} Er/cm{sup 2}) for which erbium no longer goes substitutional in the lattice, and the implantation damage is not fully removed by annealing. 8 refs., 3 figs.
45 CFR 400.220 - Counting time-eligibility of refugees.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false Counting time-eligibility of refugees. 400.220 Section 400.220 Public Welfare Regulations Relating to Public Welfare OFFICE OF REFUGEE RESETTLEMENT, ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES REFUGEE RESETTLEMENT PROGRAM...
Measurement of 222Rn and 220Rn exhalation rate from soil samples of Kumaun Hills, India

Science.gov (United States)

Semwal, Poonam; Singh, Kuldeep; Agarwal, T. K.; Joshi, Manish; Pant, Preeti; Kandari, Tushar; Ramola, R. C.

2018-03-01

The source terms, i.e., exhalation and emanation from soil and building materials are the primary contributors to the radon (222Rn)/thoron (220Rn) concentration levels in the dwellings, while the ecological constraints like ventilation rate, temperature, pressure, humidity, etc., are the influencing factors. The present study is focused on Almora District of Kumaun, located in Himalayan belt of Uttarakhand, India. For the measurement of 222Rn and 220Rn exhalation rates, 24 soil samples were collected from different locations. Gamma radiation level was measured at each of these locations. Chamber technique associated with Smart Rn Duo portable monitor was employed for the estimation of 222Rn and 220Rn exhalation rates. Radionuclides (226Ra, 232Th and 40K) concentrations were also measured in soil samples using NaI(Tl) scintillation based gamma ray spectrometry. The mass exhalation rate for 222Rn was varying between 16 and 54 mBq/kg/h, while the 220Rn surface exhalation rate was in the range of 0.65-6.43 Bq/m2/s. Measured gamma dose rate for the same region varied from 0.10 to 0.31 µSv/h. Inter-correlation of exhalation rates and intra-correlation with background gamma levels were studied.
40 CFR 415.220 - Applicability; description of the titanium dioxide production subcategory.

Science.gov (United States)

2010-07-01

... titanium dioxide production subcategory. 415.220 Section 415.220 Protection of Environment ENVIRONMENTAL... SOURCE CATEGORY Titanium Dioxide Production Subcategory § 415.220 Applicability; description of the titanium dioxide production subcategory. This subpart applies to discharges to waters of the United States...
Theoretical detection limit of PIXE analysis using 20 MeV proton beams

Science.gov (United States)

Ishii, Keizo; Hitomi, Keitaro

2018-02-01

Particle-induced X-ray emission (PIXE) analysis is usually performed using proton beams with energies in the range 2∼3 MeV because at these energies, the detection limit is low. The detection limit of PIXE analysis depends on the X-ray production cross-section, the continuous background of the PIXE spectrum and the experimental parameters such as the beam currents and the solid angle and detector efficiency of X-ray detector. Though the continuous background increases as the projectile energy increases, the cross-section of the X-ray increases as well. Therefore, the detection limit of high energy proton PIXE is not expected to increase significantly. We calculated the cross sections of continuous X-rays produced in several bremsstrahlung processes and estimated the detection limit of a 20 MeV proton PIXE analysis by modelling the Compton tail of the γ-rays produced in the nuclear reactions, and the escape effect on the secondary electron bremsstrahlung. We found that the Compton tail does not affect the detection limit when a thin X-ray detector is used, but the secondary electron bremsstrahlung escape effect does have an impact. We also confirmed that the detection limit of the PIXE analysis, when used with 4 μm polyethylene backing film and an integrated beam current of 1 μC, is 0.4∼2.0 ppm for proton energies in the range 10∼30 MeV and elements with Z = 16-90. This result demonstrates the usefulness of several 10 MeV cyclotrons for performing PIXE analysis. Cyclotrons with these properties are currently installed in positron emission tomography (PET) centers.
Evaluation of the 237Np neutron cross sections in the energy range from 10-5 eV to 5 MeV

International Nuclear Information System (INIS)

Derrien, H.; Fort, E.

1979-01-01

The 237 Np neutron cross-sections have been evaluated in the energy range from thermal to 5 MeV. A set of resonance parameters including a negative level, is recommanded after examination of the available experimental data. This set is used 1) to calculate the cross-sections from the thermal region to 150 ev, and 2) to provide the statistical parameters suitable to the calculations in the unresolved region. At higher energies, the transmission coefficients Te are calculated by the coupled channel optical model code ECIS. They are then used as input in the statistical model code FISINGA. The optical model parameters, including the deformation parameters, are those used by Lagrange for the Pu isotopes, slightly modified to reproduce at 40 KeV the total cross-sections obtained from the pure statistical parameters. The recommendations of Lynn concerning the level density parameters have been used. In this paper we describe the various steps of the evaluation
220 Names/Faces 220 Dolch Words Are Too Many for Students with Memories Like Mine. AVKO "Great Idea" Reprint Series No. 601.

Science.gov (United States)

McCabe, Don

This booklet discusses a procedure to assist students experiencing difficulty in learning the "Dolch Basic Sight Vocabulary of 220 Words" and rearranges a list of 220 words to make it easier for students to learn. The procedure discussed in the booklet is based on the "word family" approach, in which words like "all call,…
Amorphization kinetics of Zr3Fe under electron irradiation

International Nuclear Information System (INIS)

Motta, A.T.; Howe, L.M.; Okamoto, P.R.

1994-11-01

Previous investigations using 40 Ar ion bombardments have revealed that Zr 3 Fe, which has an orthorhombic crystal structure, undergoes an irradiation-induced transformation from the crystalline to the amorphous state. In the present investigation, 0.9 MeV electron irradiations were performed at 28 - 220 K in a high-voltage electron microscope (HVEM). By measuring the onset, spread and final size of the amorphous region, factoring in the Gaussian distribution of the beam, a kinetic description of the amorphization in terms of dose, dose rate and temperature was obtained. The critical temperature for amorphization by electron irradiation was found to be ∼ 220 K, compared with 570 - 625 K for 40 Ar ion irradiation. Also, the dose-to-amorphization increased exponentially with temperature. Results indicated that the rate of growth of the amorphous region under the electron beam decreased with increasing temperature and the dose-to-amorphization decreased with increasing dose rate. The size of the amorphous region saturated after a given dose, the final size decreasing with increasing temperature, and it is argued that this is related to the existence of a critical dose rate, which increases with temperature, and below which no amorphization occurs. (author). 26 refs., 6 figs
Direct determination of k Q factors for cylindrical and plane-parallel ionization chambers in high-energy electron beams from 6 MeV to 20 MeV

Science.gov (United States)

Krauss, A.; Kapsch, R.-P.

2018-02-01

For the ionometric determination of the absorbed dose to water, D w, in high-energy electron beams from a clinical accelerator, beam quality dependent correction factors, k Q, are required. By using a water calorimeter, these factors can be determined experimentally and potentially with lower standard uncertainties than those of the calculated k Q factors, which are tabulated in various dosimetry protocols. However, one of the challenges of water calorimetry in electron beams is the small measurement depths in water, together with the steep dose gradients present especially at lower energies. In this investigation, water calorimetry was implemented in electron beams to determine k Q factors for different types of cylindrical and plane-parallel ionization chambers (NE2561, NE2571, FC65-G, TM34001) in 10 cm × 10 cm electron beams from 6 MeV to 20 MeV (corresponding beam quality index R 50 ranging from 1.9 cm to 7.5 cm). The measurements were carried out using the linear accelerator facility of the Physikalisch-Technische Bundesanstalt. Relative standard uncertainties for the k Q factors between 0.50% for the 20 MeV beam and 0.75% for the 6 MeV beam were achieved. For electron energies above 8 MeV, general agreement was found between the relative electron energy dependencies of the k Q factors measured and those derived from the AAPM TG-51 protocol and recent Monte Carlo-based studies, as well as those from other experimental investigations. However, towards lower energies, discrepancies of up to 2.0% occurred for the k Q factors of the TM34001 and the NE2571 chamber.
Direct determination of k Q factors for cylindrical and plane-parallel ionization chambers in high-energy electron beams from 6 MeV to 20 MeV.

Science.gov (United States)

Krauss, A; Kapsch, R-P

2018-02-06

For the ionometric determination of the absorbed dose to water, D w , in high-energy electron beams from a clinical accelerator, beam quality dependent correction factors, k Q , are required. By using a water calorimeter, these factors can be determined experimentally and potentially with lower standard uncertainties than those of the calculated k Q factors, which are tabulated in various dosimetry protocols. However, one of the challenges of water calorimetry in electron beams is the small measurement depths in water, together with the steep dose gradients present especially at lower energies. In this investigation, water calorimetry was implemented in electron beams to determine k Q factors for different types of cylindrical and plane-parallel ionization chambers (NE2561, NE2571, FC65-G, TM34001) in 10 cm × 10 cm electron beams from 6 MeV to 20 MeV (corresponding beam quality index R 50 ranging from 1.9 cm to 7.5 cm). The measurements were carried out using the linear accelerator facility of the Physikalisch-Technische Bundesanstalt. Relative standard uncertainties for the k Q factors between 0.50% for the 20 MeV beam and 0.75% for the 6 MeV beam were achieved. For electron energies above 8 MeV, general agreement was found between the relative electron energy dependencies of the k Q factors measured and those derived from the AAPM TG-51 protocol and recent Monte Carlo-based studies, as well as those from other experimental investigations. However, towards lower energies, discrepancies of up to 2.0% occurred for the k Q factors of the TM34001 and the NE2571 chamber.
29 CFR 570.10 - Rules for certificates of age in the State of Alaska and the Territory of Guam.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Rules for certificates of age in the State of Alaska and the Territory of Guam. 570.10 Section 570.10 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF...
On the Design and Test of a Neutron Collimator for Real-time Neutron Imaging in the MeV Energy Range

International Nuclear Information System (INIS)

Beaumont, Jonathan; Colling, Bethany; Joyce, Malcolm J.; Mellor, M.

2013-06-01

A neutron collimator has been designed in MCNP5 and tested for feasibility of use in imaging applications. Tungsten, polyethylene, PVC and lead have been compared as collimating materials for neutrons in the MeV energy range; tungsten is predicted to be the most successful material for a restricted volume, giving the highest signal-to-noise ratio and the best resolving power. Experimental data has been used to confirm that tungsten works effectively as a neutron collimator although some discrepancies between real and MCNP5 results were observed. A suspension of tungsten powder in polyethylene has also been tested to address the machining difficulties, mass and cost issues associated with tungsten. This material performs midway between tungsten and polyethylene for a constant volume, and more successfully than tungsten for a constant mass therefore giving this material potential as a collimation material in some scenarios. Further MCNP5 modelling has been performed by varying model parameters and monitoring the collimator functions produced by these changes. These results are conclusive but dependent on the applications of the imaging system. (authors)
Differential production cross sections for charged particles produced by 590 MeV proton bombardment of thin metal targets

International Nuclear Information System (INIS)

Howe, S.D.; Cierjacks, S.; Hino, Y.; Raupp, F.; Rainbow, M.T.; Swinhoe, M.T.; Buth, L.

1981-01-01

Differential production cross sections have been measured for the reactions (p,p), (p,d), (p,t) and (p,π+-) using the 590 MeV proton beam at SIN. Here we report measurements made on thin targets of aluminium, niobium, lead, and uranium at laboratory angles of 90 0 and 157 0 . The data were taken over a proton energy range of about 50 MeV to 590 MeV. Differential cross sections are reported along with predictions by the intranuclear-cascade/evaporation model as computed by HETC. (orig.)
The measurement of neutron differential scattering cross sections for 12C, 14N and 16O in the energy range 20-26 Mev

International Nuclear Information System (INIS)

Petler, J.S.; Finlay, R.W.; Meigooni, A.S.; Islam, M.S.; Rapaport, J.

1985-01-01

The Ohio University Beam Swinger provides a high resolution, low back-ground time-of-flight facility for the measurement of elastic and inelastic neutron scattering. It has been used to obtain a comprehensive set of differential scattering cross sections for 12 C, 14 N, 16 O and 40 Ca between 18 and 26 MeV. The elastic cross sections can be used directly to obtain partial kerma factors and, combined with the known total cross sections, provide accurate values for the reaction cross sections. Angular distributions have been measured for inelastic scattering from all the nuclear levels that cannot decay by particle emission thus providing (by subtraction) a limit on the sum of all charged-particle producing reactions. The integrated cross sections for inelastic scattering from some particle-unstable states in 12 C are in excellent agreement with the cross sections for three-body breakup obtained by Antolkovic et al. The differential data have been used, together with higher energy proton scattering data to produce energy-dependent optical model parameters for each of these nuclei in the energy range 20-60 MeV. It has been found that the elastic differential cross sections at theta > 100 0 for 12 C, 14 N and 16 O cannot be well described by a spherical optical model. Explicit consideration of coupled-channel effects, and in the case of 12 C, deformation of the ground state, improves the agreement between calculation and experiment. Heavy ion recoil kerma factors and reaction cross sections have been obtained for each element and compared with previous calculations and measurements

5 CFR 591.220 - How does OPM calculate energy utility cost indexes?

Science.gov (United States)

2010-01-01

... cost indexes? 591.220 Section 591.220 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ALLOWANCES AND DIFFERENTIALS Cost-of-Living Allowance and Post Differential-Nonforeign Areas Cost-Of-Living Allowances § 591.220 How does OPM calculate energy utility cost indexes? (a) OPM...
Temperature and 8 MeV electron irradiation effects on GaAs solar cells

Indian Academy of Sciences (India)

1Department of Physics, Mangalore Institute of Technology and Engineering, ... strate were irradiated with 1 MeV electrons, they showed high radiation tolerance ... under both forward and reverse bias in the temperature range of 270–315 K ...
Fast neutron relaxation length in concretes in the range of neutron energies En=0.5 - 17.5 MeV

International Nuclear Information System (INIS)

Desdin, L.F.; Garcia, L.; Perez, G.; Hernandez, A.; Herrera, E.; Tellez, E.

1998-01-01

In the present research were determined the fast neutron relaxation length y in different type of concretes, having special interest for biological shielding as well as for ordinary construction purposes, in the energy interval of 0.5-17.5 MeV. The values of Y concrete are reported with an accuracy of 6 %
Phenomenological optical model for p-/sup 4/He elastic scattering. [560 to 1730 MeV: Dirac equation optical model analysis

Energy Technology Data Exchange (ETDEWEB)

Mercer, R L [International Business Machines Corp., Yorktown Heights, N.Y. (USA); Arnold, L G; Clark, B C [Ohio State Univ., Columbus (USA). Dept. of Physics

1978-01-30

The results of a Dirac equation optical model analysis of p-/sup 4/He elastic scattering data are reported. The optical potential obtained at 1029 MeV reproduces the systematics of p-/sup 4/He data over the energy range from 560 to 1730 MeV.
Measurements of the Fe-54 (n,p) Mn-54 Reaction Cross Section in the Neutron Energy Range 2.3-3.8 MeV

International Nuclear Information System (INIS)

Lauber, A.; Malmskog, S.

1964-10-01

We have measured the 54 Fe (n, p) 54 Mn reaction cross section using a surface barrier detector to record the number of protons released in the reaction. The neutron flux was determined by means of a hydrogenous radiator, detecting the scattered protons with the solid state detector, and calculating the number of impinging neutrons from the well known n-p scattering cross section. The 54 Fe (n, p) 54 Mn reaction cross section is found to increase from 25 mb at 2.3 MeV to 208 mb at 3.5 MeV
Cross section of the {sup 11}B(n,p) {sup 11}Be reaction for 14.7-16.9 MeV neutrons

Energy Technology Data Exchange (ETDEWEB)

Stepancinc, B Z; Stanojevic, D M; Popic, V R; Aleksic, M R [Institute of nuclear sciences Boris Kidric, Vinca, Beograd (Serbia and Montenegro)

1966-07-15

The cross section of the {sup 11}B(n,p){sup 11}Be reaction was determined for neutron energy range from 14.7 to 16.9 MeV using the activation method. Activity measurements were done by using a coincidence spectrometer essentially consisting of two plastic scintillators. Energy dependent cross section values are presented together with the previously measured values for the energy range 14.5 - 16.9 MeV.
(γ,n) reaction in nuclei of the 12<=A<=238 interval in the intermediate energy region (300 MeV-1000MeV)

International Nuclear Information System (INIS)

Martins, J.B.

1974-01-01

The absolute cross section of the 12 C(γ,n) 11 C, 19 F(γ,n) 18 F, 23 Na(γ,n) 22 Na, 31 P(γ,n) 30 P, 52 Cr(γ,n) 51 Cr, 55 Mn(γ,n) 54 Mn, 59 Co(γ,n) 58 Co, 75 As(γ,n) 74 As, 103 Rh(γn) 102 Rh, 127 I(γ,n) 126 I, 197 Au(γ,n) 196 Au and 238 U(γ,n) 237 U reactions were determined, experimentally, in the energy range from 300 MeV to 1000 MeV, using Bremsstrahlung photons. The measured cross sections were compared with results estimated by Monte Carlo Method applied to intranuclear cascades initiated by phothons. A functional dependence between the average value of (γ,n) absolute cross section and the mass number, were established. The (γ,n) absolute cross sections from simple relations, which transparencies of complexe nuclei for mesons and nucleons photo produced were also determined. (M.C.K.) [pt
Development of polystyrene calorimeter for application at electron energies down to 1.5 MeV

DEFF Research Database (Denmark)

Miller, A.; Kovacs, A.; Kuntz, F.

2002-01-01

Polystyrene (PS) calorimeters developed at Riso National Laboratory for use below 4 MeV have been modified due to irradiation technology requirements concerning both design principles and dimensions. The temperature-time relationship after irradiation was measured, and two ways of dose measurement...... the average and the surface dose and to prove the applicability of the new low energy calorimeter for calibration purposes at 1.5 and 2 MeV electron energy. Alanine dosimeters of 2 mm thickness were used to calibrate the calorimeters and their use for nominal dose measurements was demonstrated in a series...... of intercomparisons. The use as routine dosimeters at electron accelerators operating in the energy range of 1.5-4 MeV was also demonstrated. (C) 2002 Elsevier Science Ltd. All rights reserved....
Trace element analysis with PIXE using Trombay 5.5 MeV Van de Graaff accelerator

International Nuclear Information System (INIS)

Govil, Rekha; Kataria, S.K.; Kapoor, S.S.; Madan Lal; Nadkarni, D.M.; Rama Rao, P.N.; Viswanathan, K.V.

1980-01-01

The work on trace element analysis using proton induced X-ray emission technique (PIXE) with the proton beam from 5.5 MeV Van de Graaff accelerator at Trombay, is described. The experimental set up consisted of an indigeneously built 220 eV resolution Si(Li) x-ray spectrometer and target chamber having arrangements to mount upto twelve targets. In the present work, a variety of samples of biological nature, monazite mineral and some other samples were analyzed along with a standard multi-element sample. The sample preparation technique for different samples is also given in the report. For quantitative estimation of trace elements, a computer code developed earlier was used. The proton induced x-ray spectra of various samples and their computer fits are presented and quantitative results for some selected samples are also given. The minimum detection limits which were achieved with the present set up are also given. (auth.)
Microscopic model analyses of proton elastic scattering from diverse targets in the energy range 65 to 400 MeV

International Nuclear Information System (INIS)

Dortmans, P.J.; Amos, K.

1997-01-01

Two nucleon (NN) effective interactions based upon two-nucleon g matrices have been used in fully microscopic calculations of nonlocal proton-nucleus optical potentials for protons with energies between 65 and 400 MeV. Excellent predictions of the differential cross sections, analysing powers and spin rotations for scattering angles to 60 deg result. (authors)
Opacification of the C-flex 570C intraocular lens after sulcus fixation.

Science.gov (United States)

Daigle, Patrick; Carbonneau, Marjorie

2017-09-08

To report a case of diffuse intraocular lens (IOL) opacification in a patient who started complaining of blurred vision in his left eye over the course of three years after having phacoemulsification surgery combined with capsular bag fixation of a C-flex 570C IOL. The IOL had been repositioned in the ciliary sulcus following its subluxation. An IOL exchange was performed, and the explanted IOL was sent for histopathological analysis. Scanning electron microscopy identified multiple crystalline-like deposits on both sides of the IOL. The optic was more extensively involved than the haptics. Energy-dispersive X-ray spectroscopy confirmed the predominance of calcium within the deposits. The breakdown of the blood-aqueous barrier seems to be a key component of this calcification process. Ciliary sulcus fixation is not a suitable option for C-flex 570C IOLs.
7 CFR 220.17 - Prohibitions.

Science.gov (United States)

2010-01-01

..., curriculum, instructions, methods of instruction, and materials of instruction in any school as a condition... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.17 Prohibitions. (a) In carrying out the... limited to, laws relating to taxation, welfare, and public assistance programs. Expenditure of funds from...
Kerma factors for neutrons of 14 MeV to 60 MeV in elemental H, C, N and O

Energy Technology Data Exchange (ETDEWEB)

Behrooz, M.A.; Watt, D.E. (Dundee Univ. (UK). Dept. of Medical Biophysics)

1981-01-01

Total kerma factors, and partial kerma factors for production of specified charged H and He particles and heavier recoils, have been computed using basic theoretical and experimental nuclear data for neutrons at energies between 14 MeV and 60 MeV in the main tissue elements and in ICRU muscle tissue. All the more recent computations of total kerma factors, along with those determined from direct experimental measurements of partial kerma factors, now form a reasonably consistent set of data enabling average total kerma factors with coefficients of better than 3% for hydrogen, 16% for carbon, 23% for nitrogen and 9% for oxygen to be recommended for application to medical dosimetry and radiation protection. Total kerma factors for ICRU muscle tissue have a precision of better than 2.5% over the neutron energy range considered. Although there is adequate precision for total kerma factors for soft tissue, nevertheless analysis of the partial kerma factors indicates that caution must be exercised in use of the information for quality specification, e.g. in microdose spectra, and that more detailed basic reaction data is required for fast neutrons.
Gamma-ray emission spectra from spheres with 14 MeV neutron source

International Nuclear Information System (INIS)

Yamamoto, Junji; Kanaoka, Takeshi; Murata, Isao; Takahashi, Akito; Sumita, Kenji

1989-01-01

Energy spectra of neutron-induced gamma-rays emitted from spherical samples were measured using a 14 MeV neutron source. The samples in use were LiF, Teflon:(CF 2 ) n , Si, Cr, Mn, Co, Cu, Nb, Mo, W and Pb. A diameter of the sphere was either 40 or 60 cm. The gamma-ray energy in the emission spectra covered the range from 500 keV to 10 MeV. Measured spectra were compared with transport calculations using the nuclear data files of JENDL-3T and ENDF/B-IV. The agreements between the measurements and the JENDL-3T calculations were good in the emission spectra for the low energy gamma-rays from inelastic scattering. (author)
Effects of repulsive three-body force in 12C + 12C scattering at 100A MeV

Directory of Open Access Journals (Sweden)

W.W. Qu

2015-12-01

Full Text Available The angular distribution of 12C + 12C scattering at an incident energy of 100A MeV has been measured. The elastic and inelastic scatterings in 12C to the excitation energies of up to ∼45 MeV were measured simultaneously for the first time with the high-resolution Grand Raiden spectrometer at the Research Center for Nuclear Physics (RCNP. The angular distributions of the elastic scattering to the ground state (01+ and inelastic scattering to the 4.44 MeV (21+ excited state were precisely obtained in the angular range of 1.0°–7.5° with a step of 0.1°. Additionally, the angular distribution was obtained for the sum of the cross sections for excitation energies above the 4.44 MeV state up to 11 MeV, which includes the 7.65 MeV (02+, 9.64 MeV (31−, and 10.30 MeV (22+ states, in addition to probably the simultaneous excitation of the 4.44 MeV state in the projectile and the target nuclei. Those combined data provide a means to study the effects of channel coupling on the elastic cross section. The observed angular distributions are compared with theoretical calculations based on three double-folding models with complex G-matrix interactions, the CEG07b, MPa, and ESC models. The importance of three-body repulsive forces included in the CEG07b and MPa models will be discussed.
Measurements of the Fe-54 (n,p) Mn-54 Reaction Cross Section in the Neutron Energy Range 2.3-3.8 MeV

Energy Technology Data Exchange (ETDEWEB)

Lauber, A; Malmskog, S

1964-10-15

We have measured the {sup 54}Fe (n, p) {sup 54}Mn reaction cross section using a surface barrier detector to record the number of protons released in the reaction. The neutron flux was determined by means of a hydrogenous radiator, detecting the scattered protons with the solid state detector, and calculating the number of impinging neutrons from the well known n-p scattering cross section. The {sup 54}Fe (n, p) {sup 54}Mn reaction cross section is found to increase from 25 mb at 2.3 MeV to 208 mb at 3.5 MeV.
Correlations of light particles in the reaction 40Ar on 197Au at E/A=200 MeV

International Nuclear Information System (INIS)

Kunde, G.J.

1990-08-01

For the study of small-angle correlations of light particles an experiment at the SATURNE synchrotron with 40 Ar on 197 Au at an incident energy of E/A=200 MeV was performed. A hodoscope consisting of an 8x8 matrix of silicon-cesium iodide detectors was applied under a mean angle of 40 degrees. The evaluation of the coincident particle information was performed via correlation functions, which were determined for systems with Z ≤ = 3. For three different fragments emission temperatures were measured via the determination of population ratios for particle-unstable states. Furthermore by means of p-p correlations the reaction volume was studied. The results are: For 5 Li a mean emission temperature of 6.4 -1.0 1.1 MeV resulted, for 4 He a mean emission temperature of 5.4 -1.2 +1.8 MeV was found. The temperature of 2.3 -0.2 0.6 MeV determined for 8 Be is strongly influenced by feeding. For the states at 21.1 and 22.1 MeV in 4 He a dependence of the temperature on the kinetic sum energy of the coincident particles was found, a temperature growth with increasing sum energy of about 3 MeV over the measured range of the sum energies resulted. Via p-p correlations a source radius of 5.8 ± 0.3 fm was determined. The correction for protons from sequential decays leads to radii, which are about 1 fm smaller. The radii and radius ratios for different ranges of the sum energy of the protons were analyzed. The measured emission temperatures are about 1 MeV higher than the values for the same system at E/A = 60 MeV. The temperatures correspond in the model of the statistical multifragmentation to an excitation energy of about 2 GeV, while they follow in the model of the sequential fragment emission for an excitation energy of about 1 GeV. (orig.) [de
20 CFR 405.220 - Decision by the Federal reviewing official.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Decision by the Federal reviewing official. 405.220 Section 405.220 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW... Medical and Vocational Expert System before making a decision. At all times, the Federal reviewing...
Primary measuring of equipment factor of 222Rn/220Rn indoor

International Nuclear Information System (INIS)

Liu Yanyang; Liu Fudong; Wang Chunhong; Sheng Mingwei

2010-01-01

The activity concentration of 222 Rn, 220 Rn and their progenies of certain working places and dwellings in Baotou city were measured simultaneously. Based on these results, the equipment factor of 222 Rn is 0.35 for working places and 0.43 for dwellings, while equipment factor of 220 Rn measured at 20 cm distance from wall is 0.030 for both working places and dwellings. Preliminary results show that the temporal change of 220 Rn equilibrium equivalent concentration is same as 222 Rn which is high in midnight and low in afternoon,and significant difference between instant and accumulated measure result of 222 Rn, 220 Rn activity concentration is found, with the factor of 2.1 and 1.7. (authors)
Study on a charcoal-based monitor for Rn-220 in air

International Nuclear Information System (INIS)

Yu Yiqiao; Solomon, S.B.

1993-01-01

Activated charcoal has been used in both passive monitors (Cohen, Pondy et al. 1987) and active monitors (Solomon and Gan, 1989) for the measurements of 222 Rn in air. Cooled, charcoal-impregnated filters, viewed in-situ by a solid state alpha detector, have been used for 220 Rn-in-breath studies. In general, γ ray counting of 220 Rn samples collected on activated charcoal has not been used. This paper describes the development and calibration of a charcoal based monitor designed to measure 220 Rn levels down to a lower limit of 10 Bq m -3 over sampling periods of 4 to 15 h. The activity of 212 Pb (10.6 h) produced from 220 Rn (55.6 s) collected in an activated charcoal-based sampler is 1/700 the total 220 Rn activity. A typical Hp-Ge detector has a MDL for a two-hours count of approximately 0.1 Bq of 212 Pb for the 239 keV γ-ray. For a MDL of 10 Bq·m -3 of 220 Rn in air, a volume of at least 7 m 3 must be sampled, assuming no breakthrough. The present charcoal-based 220 Rn monitor is designed to maximize the path length through the activated charcoal while sufficient cross-sectional area is retained to allow flow rates up to 0.03 m 3 ·kg -1 is packed into a specially designed aluminum container. The container is modeled on a Marinelli beaker to maximize the counting efficiency, while the sample flow through the chambers of the monitor is optimized to maintain radial symmetry. experiments demonstrated that 94% of 220 Rn was adsorbed by the charcoal in the monitor under a flow rate of 0.03 m 3 ·min -1 at 25 degree C and 85%. RH in 15 h. The monitor is designed to fit over a 70 mm diameter Hp-Ge detector. Preliminary measurements of 220 Rn in two buildings and a cave, using the active monitors and 'grabing' samples under a flow rate of 0.03 m 3 ·min -1 and a period of 4 h, indicated concentrations of between 18.6 and 142.0 Bq·m 3

29 CFR 570.35a - Work experience and career exploration program.

Science.gov (United States)

2010-07-01

... LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Employment of Minors Between 14 and 16 Years of Age (Child Labor Reg. 3) § 570.35a Work experience and career exploration... therefore is not deemed to be oppressive child labor. (b)(1) A school-supervised and school-administered...
29 CFR 570.109 - “Establishment situated in the United States”.

Science.gov (United States)

2010-07-01

... LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Coverage of... 29 Labor 3 2010-07-01 2010-07-01 false âEstablishment situated in the United Statesâ. 570.109...
Fluorescence lifetime studies of MeV erbium implanted silica glass

International Nuclear Information System (INIS)

Lidgard, A.; Polman, A.; Jacobsen, D.C.; Blonder, G.E.; Kistler, R.; Poate, J.M.; Becker, P.C.

1991-01-01

MeV erbium ion implantation into various SiO 2 glasses has been studied with the aim of incorporating the rare-earth dopant as an optically active ion in the silica network. The lifetime of the excited state ranges from 1.6 to 12.8 ms, depending on base material and implantation fluence. These results have positive implications for silica-based integrated optical technology. (Author)
Fluorescence lifetime studies of MeV erbium implanted silica glass

Energy Technology Data Exchange (ETDEWEB)

Lidgard, A.; Polman, A.; Jacobsen, D.C.; Blonder, G.E.; Kistler, R.; Poate, J.M.; Becker, P.C. (AT and T Bell Labs., Murray Hill, NJ (USA))

1991-05-23

MeV erbium ion implantation into various SiO{sub 2} glasses has been studied with the aim of incorporating the rare-earth dopant as an optically active ion in the silica network. The lifetime of the excited state ranges from 1.6 to 12.8 ms, depending on base material and implantation fluence. These results have positive implications for silica-based integrated optical technology. (Author).
Strong cytotoxic effect of the bradykinin antagonist BKM-570 in ovarian cancer cells--analysis of the molecular mechanisms of its antiproliferative action.

Science.gov (United States)

Jutras, Stephanie; Bachvarova, Magdalena; Keita, Mamadou; Bascands, Jean-Loup; Mes-Masson, Anne-Marie; Stewart, John M; Gera, Lajos; Bachvarov, Dimcho

2010-12-01

The standard chemotherapy for epithelial ovarian cancer (EOC) patients is currently a combination of taxane and platinum. However, most EOC patients still suffer relapses, and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly disease. Recently, the nonpeptide bradykinin (BK) antagonist 2,3,4,5,6-pentafluorocinnamoyl-(o-2,6-dichlorobenzyl)-l-tyrosine-N-(4-amino-2,2,6,6-tetramethyl-piperidyl) amide (BKM-570) was shown to cause impressive growth inhibition of lung and prostate tumors, displaying superior in vivo inhibitory effects than convential chemotherapeutic drugs. Here, we investigated BKM-570 cytotoxic effects in two EOC cell lines, derived from different EOC histopathologies: a clear cell carcinoma (TOV-21), and an endometrioid carcinoma (TOV-112). We showed that BKM-570 effectively inhibited the growth of ovarian cancer cells, as its cytotoxic effects were comparable to those of cisplatin, and were independent of the functional status of BK receptors. Moreover, BKM-570 synergized with cisplatin in inhibiting EOC cell growth. To better understand the molecular mechanisms of the antiproliferative action of this BK antagonist in EOC cells, we performed gene expression profiling in TOV-21 and TOV-112 cells following treatment with 10 μM BKM-570 for 24 h. BKM-570 displayed similar cytotoxic effects in the two cell lines analyzed, as genes with previously shown involvement in apoptosis/antiapoptosis and cell adhesion were proportionally upregulated and downregulated in both cell lines, whereas genes involved in basic cellular mechanisms, including cell growth and maintenance, metabolism, cell cycle control, inflammatory and immune response, signal transduction, protein biosynthesis, transcription regulation, and transport, were predominantly downregulated upon treatment. Our data are indicative of the therapeutic potential of BKM-570 and related compounds in EOC management. © 2010 The Authors
/sup 12/C(γ,n) cross section from 30 to 100 MeV

International Nuclear Information System (INIS)

Harty, P.D.; Thompson, M.N.; O'Keefe, G.J.

1988-01-01

This paper reports a measurement of the differential photoneutron cross section of /sup 12/C at 65 0 , between E/sub γ/ = 30 and 100 MeV. Tagged photons, monochromatic to within 2.6 MeV, were used, thus allowing the cross sections to a wide range of final states to be observed. The results are compared to the photoproton cross section of /sup 12/C, which was measured previously, under similar conditions. Comparisons are also made with calculations based on the quasi-deuteron model, and with calculations by Gari and Hebach, and Cavinato et al. These latter calculations incorporate two-body effects by the inclusion of meson exchange currents. The agreement between these calculations and the measured cross section is in contrast to predictions of a direct, single-nucleon knockout model of the reaction mechanism, indicating the importance of two-body effects in the photoreaction process for energies greater than 50 MeV
Measurement of thick target neutron yield from the reaction (p+181 Ta) with projectiles in the range of 6-20 MeV

Science.gov (United States)

Paul, Sabyasachi; Sahoo, G. S.; Tripathy, S. P.; Sharma, S. C.; Joshi, D. S.; Bandyopadhyay, T.

2018-02-01

181Ta is a commonly used backing material for many targets in nuclear reaction studies. When the target thickness is less than the range of bombarded projectiles, the interaction via Ta(p,n) reactions in the backing can be a significant source of background. In this study, the neutron spectral yields from the reaction of protons of different energies (between 6 to 20 MeV) with a thick Ta target were determined using CR-39 detectors. The results from this study can be used as a correction factor in such situations. The parameters of registered tracks in CR-39 were analysed using an in-house image analysing program autoTRAK_n and then to derive the associated dose values. The spectral yields obtained experimentally were compared with those obtained from the theoretical calculations. The neutron yield was found to increase with increase in projectile energy mainly due to the opening of reaction channels from (p, n) to (p, 3n).
Ion emission in solids bombarded with Aun+ (n = 1 - 9) clusters accelerated within the 0.15 - 1.25 MeV energy range

International Nuclear Information System (INIS)

Wehbe, Nimer

2006-06-01

This experimental work is devoted to the study of the ion emission in solids at the impact of gold clusters of energies within 0.15 to 1.25 MeV range. The physics of ion-solid collisions and the theoretical models of sputtering of solids under ion bombardment are presented in the first chapter. The chapter no. 2 deals with the description of the experimental setup. The study of a gold target allowed to evidence the role of the size and energy of the clusters in determining the emission intensity and the mass distribution of the ions. The 4. chapter gives results from the study of cesium iodide in which the intense emission of CsI clusters could be investigated quantitatively due to multiplicity measurements. Finally, the chapter no. 5 was devoted to the study of a biologic molecule, the phenylalanine, and of a pesticide molecule, chlorosulfuron. This work evidenced the importance of clusters for surface analyses by mass spectrometry
neutron multiplicity measurements on 220 l waste drums containing Pu in the range 0.1-1 g 240Pueff with the time interval analysis method

International Nuclear Information System (INIS)

Baeten, P.; Bruggeman, M.; Carchon, R.; De Boeck, W.

1998-01-01

Measurement results are presented for the assay of plutonium in 220 l waste drums containing Pu-masses in the range 0.1-1 g 240 Pu eff obtained with the time interval analysis (TIA) method. TIA is a neutron multiplicity method based on the concept of one- and two-dimensional Rossi-alpha distributions. The main source of measurement bias in neutron multiplicity measurements at low count-rates is the impredictable variation of the high-multiplicity neutron background of spallation neutrons induced by cosmic rays. The TIA-method was therefore equipped with a special background filter, which is designed and optimized to reduce the influence of these spallation neutrons by rejecting the high-multiplicity events. The measurement results, obtained with the background correction filter outlined in this paper, prove the repeatability and validity of the TIA-method and show that multiplicity counting with the TIA-technique is applicable for masses as low as 0.1 g 240 Pu eff even at a detection efficiency of 12%. (orig.)
Study of the process e+e- → K+K- in the center-of-mass energy range 1010-1060 MeV with the CMD-3 detector

Science.gov (United States)

Kozyrev, E. A.; Solodov, E. P.; Akhmetshin, R. R.; Amirkhanov, A. N.; Anisenkov, A. V.; Aulchenko, V. M.; Banzarov, V. S.; Bashtovoy, N. S.; Berkaev, D. E.; Bondar, A. E.; Bragin, A. V.; Eidelman, S. I.; Epifanov, D. A.; Epshteyn, L. B.; Erofeev, A. L.; Fedotovich, G. V.; Gayazov, S. E.; Grebenuk, A. A.; Gribanov, S. S.; Grigoriev, D. N.; Ignatov, F. V.; Ivanov, V. L.; Karpov, S. V.; Kasaev, A. S.; Kazanin, V. F.; Korobov, A. A.; Koop, I. A.; Kozyrev, A. N.; Krokovny, P. P.; Kuzmenko, A. E.; Kuzmin, A. S.; Logashenko, I. B.; Lukin, P. A.; Lysenko, A. P.; Mikhailov, K. Yu.; Okhapkin, V. S.; Perevedentsev, E. A.; Pestov, Yu. N.; Popov, A. S.; Razuvaev, G. P.; Rogovsky, Yu. A.; Ruban, A. A.; Ryskulov, N. M.; Ryzhenenkov, A. E.; Shebalin, V. E.; Shemyakin, D. N.; Shwartz, B. A.; Shwartz, D. B.; Sibidanov, A. L.; Shatunov, Yu. M.; Talyshev, A. A.; Vorobiov, A. I.; Yudin, Yu. V.

2018-04-01

The process e+e- →K+K- has been studied using 1.7 ×106 events from a data sample corresponding to an integrated luminosity of 5.7 pb-1 collected with the CMD-3 detector in the center-of-mass energy range 1010-1060 MeV. The cross section is measured with about 2% systematic uncertainty and is used to calculate the contribution to the anomalous magnetic moment of the muon aμK+K- = (19.33 ± 0.40) ×10-10, and to obtain the ϕ (1020) meson parameters. We consider the relationship between the e+e- →K+K- and e+e- → KS0 KL0 cross sections and compare it to the theoretical prediction.
An analytical expression for electron elastic scattering cross section from atoms and molecules in 1.0 keV to 1.0 MeV energy range

Energy Technology Data Exchange (ETDEWEB)

Yalcin, S. [Education Faculty, Kastamonu University, 37200 Kastamonu (Turkey)]. E-mail: yalcin@gazi.edu.tr; Gurler, O. [Physics Department, Faculty of Arts and Sciences, Uludag University, Gorukle Campus, 16059 Bursa (Turkey); Gultekin, A. [Physics Department, Faculty of Arts and Sciences, Uludag University, Gorukle Campus, 16059 Bursa (Turkey); Gundogdu, O. [School of Engineering, University of Surrey, Guildford, GU2 7XH (United Kingdom)]. E-mail: o.gundogdu@surrey.ac.uk

2006-07-31

In this Letter, an expression is presented to calculate elastic scattering cross sections for incident electrons as a function of both energy and atomic number in the energy range between 1 keV and 1 MeV for materials with effective atomic number between 3 and 18. The expression we present has a rather simple analytical form which gives accurate results that are in very good agreement with the results calculated by a relativistic partial-wave expansion method. Hence, this equation can be employed accurately and efficiently in a continuous manner, without the need to go through rather large look-up tables, thus making the whole process quick, efficient and removing possible computational errors that may arise from the efforts of interpolation.
An analytical expression for electron elastic scattering cross section from atoms and molecules in 1.0 keV to 1.0 MeV energy range

International Nuclear Information System (INIS)

Yalcin, S.; Gurler, O.; Gultekin, A.; Gundogdu, O.

2006-01-01

In this Letter, an expression is presented to calculate elastic scattering cross sections for incident electrons as a function of both energy and atomic number in the energy range between 1 keV and 1 MeV for materials with effective atomic number between 3 and 18. The expression we present has a rather simple analytical form which gives accurate results that are in very good agreement with the results calculated by a relativistic partial-wave expansion method. Hence, this equation can be employed accurately and efficiently in a continuous manner, without the need to go through rather large look-up tables, thus making the whole process quick, efficient and removing possible computational errors that may arise from the efforts of interpolation
Kidins220/ARMS as a functional mediator of multiple receptor signalling pathways.

Science.gov (United States)

Neubrand, Veronika E; Cesca, Fabrizia; Benfenati, Fabio; Schiavo, Giampietro

2012-04-15

An increasing body of evidence suggests that several membrane receptors--in addition to activating distinct signalling cascades--also engage in substantial crosstalk with each other, thereby adjusting their signalling outcome as a function of specific input information. However, little is known about the molecular mechanisms that control their coordination and integration of downstream signalling. A protein that is likely to have a role in this process is kinase-D-interacting substrate of 220 kDa [Kidins220, also known as ankyrin repeat-rich membrane spanning (ARMS), hereafter referred to as Kidins220/ARMS]. Kidins220/ARMS is a conserved membrane protein that is preferentially expressed in the nervous system and interacts with the microtubule and actin cytoskeleton. It interacts with neurotrophin, ephrin, vascular endothelial growth factor (VEGF) and glutamate receptors, and is a common downstream target of several trophic stimuli. Kidins220/ARMS is required for neuronal differentiation and survival, and its expression levels modulate synaptic plasticity. Kidins220/ARMS knockout mice show developmental defects mainly in the nervous and cardiovascular systems, suggesting a crucial role for this protein in modulating the cross talk between different signalling pathways. In this Commentary, we summarise existing knowledge regarding the physiological functions of Kidins220/ARMS, and highlight some interesting directions for future studies on the role of this protein in health and disease.
20 CFR 220.11 - Definitions as used in this subpart.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Definitions as used in this subpart. 220.11 Section 220.11 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT..., mobility, endurance and capacity to perform physically demanding tasks, such as standing, walking, lifting...
Neutron scattering on natural iron at incident energies between 9.4 and 15.2 MeV

International Nuclear Information System (INIS)

Schmidt, D.; Mannhart, W.; Klein, H.; Nolte, R.

1994-11-01

Neutrons were scattered on a sample of natural iron at 12 incident energies in the range between 9.4 MeV and 15.2 MeV. Differential cross sections of the elastic scattering (natural iron) and of the inelastic scattering to the first excited level of 56 Fe (Q=-0.847 MeV) were determined for angles between 12.5 deg and 160 deg with total uncertainties between of 3% and 10%. Legendre polynomial least-squares fits resulted in integrated cross sections with uncertainties of 2% (elastic data) and 7% (inelastic data). The cross sections obtained in this work were compared with data from the literature. Inelastic scattering cross sections were determined within the scope of a pseudolevel analysis up to excitation energies of nearly 5.5 MeV. At higher excitation energies the scattering spectrum is contaminated by scattered breakup neutrons from the D+d source used hampering an analysis of the data. (orig.) [de
A comparative study of 30MeV boron4+ and 60MeV oxygen8+ ion irradiated Si NPN BJTs

International Nuclear Information System (INIS)

Kumar, M. Vinay; Krishnaveni, S.; Yashoda, T.; Dinesh, C. M.; Krishnakumar, K. S.; Jayashree, B.; Ramani

2015-01-01

The impact of 30MeV boron 4+ and 60MeV oxygen 8+ ion irradiation on electrical characteristics of 2N3773 Si NPN Bipolar junction transistors (BJTs) is reported in the present study. The transistors were decapped and irradiated at room temperature. Gummel characteristics, DC current gain and Capacitance-voltage (C-V) characteristics were studied before and after irradiation at different fluences. DC current gain has decreased significantly in both boron and oxygen ion irradiation. Also the value of capacitance decreased 3-4 times with increase in fluence. Both 30MeV boron ion and 60MeV oxygen ion induced similar extent of degradation in electrical characteristics of the transistor
YAP(Ce) crystal characterization with proton beam up to 60 MeV

Energy Technology Data Exchange (ETDEWEB)

Randazzo, N. [Istituto Nazionale di Fisica Nucleare, Sezione di Catania (I), Via S. Sofia, 64-I-95123 Catania (Italy)], E-mail: nunzio.randazzo@ct.infn.it; Sipala, V.; Aiello, S. [Istituto Nazionale di Fisica Nucleare, Sezione di Catania (I), Via S. Sofia, 64-I-95123 Catania (Italy); Lo Presti, D. [Istituto Nazionale di Fisica Nucleare, Sezione di Catania (I), Via S. Sofia, 64-I-95123 Catania (Italy); Dipartimento di Fisica e Astronomia, Universita di Catania, Catania (Italy); Cirrone, G.A.P.; Cuttone, G.; Di Rosa, F. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali del Sud (Italy)

2008-02-21

A YAP(Ce) crystal was characterized with a proton beam up to 60 MeV. Tests were performed to investigate the possibility of using this detector as a proton calorimeter. The size of the crystal was chosen so that the proton energy is totally lost inside the medium. The authors propose to use the YAP(Ce) crystal in medical applications for proton therapy. In particular, in proton computed tomography (pCT) project it is necessary as a calorimeter in order to measure the proton residual energy after the phantom. Energy resolution, linearity, and light yield were measured in the Laboratori Nazionali del Sud with the CATANA proton beam [ (http://www.lns.infn.it/CATANA/CATANA)] and the results are shown in this paper. The crystal shows a good resolution (3% at 60 MeV proton beam) and it shows good linearity for different proton beam energies (1% at 30-60 MeV energy range). The crystal performances confirm that the YAP(Ce) crystal represents a good solution for these kinds of application.
YAP(Ce) crystal characterization with proton beam up to 60 MeV

International Nuclear Information System (INIS)

Randazzo, N.; Sipala, V.; Aiello, S.; Lo Presti, D.; Cirrone, G.A.P.; Cuttone, G.; Di Rosa, F.

2008-01-01

A YAP(Ce) crystal was characterized with a proton beam up to 60 MeV. Tests were performed to investigate the possibility of using this detector as a proton calorimeter. The size of the crystal was chosen so that the proton energy is totally lost inside the medium. The authors propose to use the YAP(Ce) crystal in medical applications for proton therapy. In particular, in proton computed tomography (pCT) project it is necessary as a calorimeter in order to measure the proton residual energy after the phantom. Energy resolution, linearity, and light yield were measured in the Laboratori Nazionali del Sud with the CATANA proton beam [ (http://www.lns.infn.it/CATANA/CATANA)] and the results are shown in this paper. The crystal shows a good resolution (3% at 60 MeV proton beam) and it shows good linearity for different proton beam energies (1% at 30-60 MeV energy range). The crystal performances confirm that the YAP(Ce) crystal represents a good solution for these kinds of application
YAP(Ce) crystal characterization with proton beam up to 60 MeV

Science.gov (United States)

Randazzo, N.; Sipala, V.; Aiello, S.; Lo Presti, D.; Cirrone, G. A. P.; Cuttone, G.; Di Rosa, F.

2008-02-01

A YAP(Ce) crystal was characterized with a proton beam up to 60 MeV. Tests were performed to investigate the possibility of using this detector as a proton calorimeter. The size of the crystal was chosen so that the proton energy is totally lost inside the medium. The authors propose to use the YAP(Ce) crystal in medical applications for proton therapy. In particular, in proton computed tomography (pCT) project it is necessary as a calorimeter in order to measure the proton residual energy after the phantom. Energy resolution, linearity, and light yield were measured in the Laboratori Nazionali del Sud with the CATANA proton beam [ http://www.lns.infn.it/CATANA/CATANA] and the results are shown in this paper. The crystal shows a good resolution (3% at 60 MeV proton beam) and it shows good linearity for different proton beam energies (1% at 30-60 MeV energy range). The crystal performances confirm that the YAP(Ce) crystal represents a good solution for these kinds of application.
2 CFR 220.15 - Policy.

Science.gov (United States)

2010-01-01

... Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST PRINCIPLES FOR EDUCATIONAL INSTITUTIONS (OMB CIRCULAR A-21) § 220.15 Policy. The principles in this part are designed to provide that the... accounting principles, except where restricted or prohibited by law. Agencies are not expected to place...

207,208Pb(n,xnγ) reactions for neutron energies from 3 to 200 MeV

International Nuclear Information System (INIS)

Vonach, H.; Pavlik, A.; Chadwick, M.B.; Haight, R.C.; Nelson, R.O.; Wender, S.A.; Young, P.G.

1994-01-01

High-resolution γ-ray spectra from the interaction of neutrons in the energy range from 3 to 200 MeV with 207,208 Pb were measured with the white neutron source at the weapons neutron research (WNR) facility at Los Alamos National Laboratory. From these data, excitation functions for prominent γ transitions in 200,202,204,206,207,208 Pb were derived from threshold to 200 MeV incident neutron energy. These γ-production cross sections reflect the excitation cross sections for the respective residual nuclei. The results are compared with the predictions of nuclear reaction calculations based on the exciton model for precompound emission, the Hauser-Feshbach theory for compound nucleus decay, and coupled channels calculations to account for direct excitation of collective levels. Good agreement was obtained over the entire energy range covered in the experiment with reasonable model parameters. The results of this work clearly demonstrate that multiple preequilibrium emission has to be taken into account above about 40 MeV, and that the level density model of Ignatyuk, which accounts for the gradual disappearance of shell effects with increasing excitation energy, should be used instead of the Gilbert-Cameron and backshifted Fermi-gas models if excitation energies exceed about 30 MeV. No indication for a reduction of the nuclear moment of inertia below the rigid body value was found
49 CFR 220.49 - Radio communication used in shoving, backing or pushing movements.

Science.gov (United States)

2010-10-01

... pushing movements. 220.49 Section 220.49 Transportation Other Regulations Relating to Transportation... Wireless Communication Procedures § 220.49 Radio communication used in shoving, backing or pushing movements. When radio communication is used in connection with the shoving, backing or pushing of a train...
33 CFR 334.570 - Banana River near Orsino, Fla.; restricted area.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Banana River near Orsino, Fla... THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.570 Banana River near Orsino, Fla.; restricted area. (a) The area. That part of Banana River N of the NASA Banana River...
Conversion efficiency of lead for 30-200 MeV photons

International Nuclear Information System (INIS)

Darriulat, P.; Gygi, E.; Holder, M.; McDonald, K.T.; Pugh, H.G.; Schneider, F.; Tittel, K.

1975-01-01

The conversion efficiency of lead has been measured as a function of thickness for 44 MeV, 94 MeV and 177 MeV photons, and as a function of energy between 29 MeV and 177 Mev for thickness of one and two radiation lengths. Some additional information on multiplicity of secondary tracks and on their angular distribution was obtained using a small streamer chamber. The results obtained confirm the shower calculations of Messel and Crawford. (Auth.)
20 CFR 220.130 - Work experience as a vocational factor.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work experience as a vocational factor. 220.130 Section 220.130 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD... amount of walking, standing, sitting, lifting and carrying the claimant did during the work day, as well...
Radiochemical study of 45Sc(n,p)45Ca and 89Y(n,p)89Sr reactions in the neutron energy range of 13.9 to 14.7 MeV

International Nuclear Information System (INIS)

Molla, N.I.; Basunia, S.; Miah, M.R.; Hossain, S.M.; Rahman, M.M.; Spellerberg, S.; Qaim, S.M.

1998-01-01

Cross sections for 45 Sc(n,p) 45 Ca and 89 Y(n,p) 89 Sr reactions were measured using the activation technique. Monoenergetic neutrons in the energy range of 13.9 to 14.7 MeV were produced using a D-T neutron generator. The purely β - emitting products 45 Ca and 89 Sr were separated radiochemically; their radioactivity was assayed via low-level β - counting. The measured data complement the available published experimental information, and agree with the results of statistical model calculations. (orig.)
Identification and imaging of modern paints using Secondary Ion Mass Spectrometry with MeV ions

DEFF Research Database (Denmark)

Bogdanović Radović, Iva; Siketić, Zdravko; Jembrih-Simbürger, Dubravka

2017-01-01

Secondary Ion Mass Spectrometry using MeV ion excitation was applied to analyse modern paint materials containing synthetic organic pigments and binders. It was demonstrated that synthetic organic pigments and binder components with molecular masses in the m/z range from 1 to 1200 could be identi......Secondary Ion Mass Spectrometry using MeV ion excitation was applied to analyse modern paint materials containing synthetic organic pigments and binders. It was demonstrated that synthetic organic pigments and binder components with molecular masses in the m/z range from 1 to 1200 could...... be identified in different paint samples with a high efficiency and in a single measurement. Different ways of mounting of mostly insulating paint samples were tested prior to the analysis in order to achieve the highest possible yield of pigment main molecular ions. As Time-of-Flight mass spectrometer for Me......V Secondary Ion Mass Spectrometry is attached to the heavy ion microprobe, molecular imaging on cross-sections of small paint fragments was performed using focused ions. Due to the fact that molecules are extracted from the uppermost layer of the sample and to avoid surface contamination, the paint samples...
The prediction of Neutron Elastic Scattering from Tritium for E(n) = 6-14 MeV

International Nuclear Information System (INIS)

Anderson, J.D.; Dietrich, F.S.; Luu, T.; McNabb, D.P.; Navratil, P.; Quaglioni, S.

2010-01-01

In a recent report Navratil et al. evaluated the angle-integrated cross section and the angular distribution for 14-MeV n+T elastic scattering by inferring these cross sections from accurately measured p+3He angular distributions. This evaluation used a combination of two theoretical treatments, based on the no-core shell model and resonating-group method (NCSM/RGM) and on the R-matrix formalism, to connect the two charge-symmetric reactions n+T and p+ 3 He. In this report we extend this treatment to cover the neutron incident energy range 6-14 MeV. To do this, we evaluate angle-dependent correction factors for the NCSM/RGM calculations so that they agree with the p+ 3 He data near 6 MeV, and using the results found earlier near 14 MeV we interpolate these correction factors to obtain correction factors throughout the 6-14 MeV energy range. The agreement between the corrected NCSM/RGM and R-Matrix values for the integral elastic cross sections is excellent (±1%), and these are in very good agreement with total cross section experiments. This result can be attributed to the nearly constant correction factors at forward angles, and to the evidently satisfactory physics content of the two calculations. The difference in angular shape, obtained by comparing values of the scattering probability distribution P(μ) vs. μ(the cosine of the c.m. scattering angle), is about ±4% and appears to be related to differences in the two theoretical calculations. Averaging the calculations yields P(μ) values with errors of ±2 1/2 % or less. These averaged values, along with the corresponding quantities for the differential cross sections, will form the basis of a new evaluation of n+T elastic scattering. Computer files of the results discussed in this report will be supplied upon request.
The prediction of Neutron Elastic Scattering from Tritium for E(n) = 6-14 MeV

Energy Technology Data Exchange (ETDEWEB)

Anderson, J D; Dietrich, F S; Luu, T; McNabb, D P; Navratil, P; Quaglioni, S

2010-06-14

In a recent report Navratil et al. evaluated the angle-integrated cross section and the angular distribution for 14-MeV n+T elastic scattering by inferring these cross sections from accurately measured p+3He angular distributions. This evaluation used a combination of two theoretical treatments, based on the no-core shell model and resonating-group method (NCSM/RGM) and on the R-matrix formalism, to connect the two charge-symmetric reactions n+T and p+{sup 3}He. In this report we extend this treatment to cover the neutron incident energy range 6-14 MeV. To do this, we evaluate angle-dependent correction factors for the NCSM/RGM calculations so that they agree with the p+{sup 3}He data near 6 MeV, and using the results found earlier near 14 MeV we interpolate these correction factors to obtain correction factors throughout the 6-14 MeV energy range. The agreement between the corrected NCSM/RGM and R-Matrix values for the integral elastic cross sections is excellent ({+-}1%), and these are in very good agreement with total cross section experiments. This result can be attributed to the nearly constant correction factors at forward angles, and to the evidently satisfactory physics content of the two calculations. The difference in angular shape, obtained by comparing values of the scattering probability distribution P({mu}) vs. {mu}(the cosine of the c.m. scattering angle), is about {+-}4% and appears to be related to differences in the two theoretical calculations. Averaging the calculations yields P({mu}) values with errors of {+-}2 1/2 % or less. These averaged values, along with the corresponding quantities for the differential cross sections, will form the basis of a new evaluation of n+T elastic scattering. Computer files of the results discussed in this report will be supplied upon request.
Neutron spectrum at 900 from 800 MeV (p,n) reactions on a Ta target

International Nuclear Information System (INIS)

Howe, S.D.; Lisowski, P.W.; King, N.S.P.; Russell, G.J.; Donnert, H.J.

1979-01-01

The neutron time-of-flight spectrum produced by a thick tantalum target bombarded by 800-MeV protons was measured at an angle of 90 0 . The data were taken at the Weapons Neutron Research facility by use of a cylindrical Ta target with a radius of 1.27 cm and a length of 15 cm. An NE-213 liquid scintillator was used to detect the neutrons over an energy range of 0.5 to 350 MeV. The neutron yield is presented and compared to a intranuclear-cascade/evaporation model prediction. 3 figures
Measurements of the 169Tm(n,2n)168Tm cross section between 9.0 and 17.5 MeV

Science.gov (United States)

Soter, J.; Bhike, Megha; Krishichayan, Fnu; Finch, S. W.; Tornow, W.

2016-09-01

Measurements of the 169Tm(n,2n)168Tm cross section have been performed in 0.5 MeV intervals for neutron energies ranging from 9.0 MeV to 17.5 MeV in order to resolve discrepancies in the current literature data. The neutron activation technique was used with 90Zr and 197Au as monitor foils. After irradiation, de-excitation gamma rays were recorded off-line with High-Purity Germanium (HPGE) detectors in TUNL's Low-Background Counting Facility. In addition, data for the 169Tm(n,3n)167Tm reaction have also been obtained from 15.5 MeV to 17.5 MeV. The results of these measurements provide the basis for investigating properties of the interial confinement fusion plasma in deuterium-tritium (DT) capsules at the National Ignition Facility located at Lawrence Livermore National Laboratory.
Numerical simulation on range of high-energy electron moving in accelerator target

International Nuclear Information System (INIS)

Shao Wencheng; Sun Punan; Dai Wenjiang

2008-01-01

In order to determine the range of high-energy electron moving in accelerator target, the range of electron with the energy range of 1 to 100 MeV moving in common target material of accelerator was calculated by Monte-Carlo method. Comparison between the calculated result and the published data were performed. The results of Monte-Carlo calculation are in good agreement with the published data. Empirical formulas were obtained for the range of high-energy electron with the energy range of 1 to 100 MeV in common target material by curve fitting, offering a series of referenced data for the design of targets in electron accelerator. (authors)
42 CFR 412.220 - Special treatment of certain hospitals located in Puerto Rico.

Science.gov (United States)

2010-10-01

... Puerto Rico. 412.220 Section 412.220 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT... SERVICES Prospective Payment System for Inpatient Operating Costs for Hospitals Located in Puerto Rico § 412.220 Special treatment of certain hospitals located in Puerto Rico. Subpart G of this part sets...
46 CFR 185.220 - Records of a voyage resulting in a marine casualty.

Science.gov (United States)

2010-10-01

....220 Section 185.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) OPERATIONS Marine Casualties and Voyage Records § 185.220 Records of a... officer, or person responsible for the custody thereof, shall make these records available upon request...
46 CFR 122.220 - Records of a voyage resulting in a marine casualty.

Science.gov (United States)

2010-10-01

....220 Section 122.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER... OPERATIONS Marine Casualties and Voyage Records § 122.220 Records of a voyage resulting in a marine casualty... custody thereof, shall make these records available upon request, to a duly authorized investigating...
24 CFR 570.209 - Guidelines for evaluating and selecting economic development projects.

Science.gov (United States)

2010-04-01

..., where the recreational benefit to users or members clearly outweighs employment or other benefits to low... DEVELOPMENT BLOCK GRANTS Eligible Activities § 570.209 Guidelines for evaluating and selecting economic... activities to be carried out for economic development purposes. Specifically, these guidelines are applicable...
Range energy for heavy ions in CR-39

International Nuclear Information System (INIS)

Gil, L.R.; Marques, A.

1987-01-01

Range-energy relations in CR-39, for ions from He to Ar, are obtained after their effective nuclear charge. Comparison with earlier calculations and numerical results in the energy range 0,1 to 200 Mev/ Nucleon are also given. (M.W.O.)
Simultaneous quantification of MTC-220 and its metabolites in beagle dog plasma by liquid chromatography-tandem mass spectrometry.

Science.gov (United States)

Liu, Xin; Zhao, Manman; Mi, Jiaqi; Liu, Zhihao; Hu, Jinping; Sheng, Li; Wang, Baolian; Li, Dan; Yang, Shuang; Li, Yan

2014-10-01

A sensitive LC-ESI-MS/MS method for simultaneous determination of MTC-220 and its metabolites (paclitaxel and MDA-linker) in dog plasma has been developed and validated. After addition of docetaxel (internal standard), plasma samples containing MTC-220, paclitaxel and MDA-linker were prepared based on a simple protein precipitation by adding two volumes of acetonitrile. The separation was performed on a ZorbaxSB-C18 column (3.5μm, 2.1mm×100mm) at a flow rate of 0.2ml/min, using acetonitrile/water containing 0.1% formic acid (v/v) as mobile phase. The detection was performed on a triple quadrupole tandem mass spectrometer equipped with electrospray ionization (ESI) by selected reaction monitoring (SRM). The MS/MS ion transit ions monitored were 1444.4→623.8 for MTC-220, 876.4→307.9 for paclitaxel, 631.2→531.2 for MDA-linker and 830.2→549.1 for the internal standard. Linear detection responses were obtained for MTC-220, paclitaxel and MDA-linker ranging from 10 to 5000, 5 to 2500 and 5 to 500ng/ml, respectively. The lower limits of quantitation (LLOQs) for MTC-220, paclitaxel and MDA-linker were 10, 5 and 5ng/ml, respectively. The intra-day and inter-day precisions (RSD, %) of the three analytes do not exceed 10.9% except for LLOQs (≤17.50), and the accuracy (RE, %) were within ±17.5% for LLOQs and ±12.6% for the others. The average recoveries of three compounds were greater than 85.0%. The analytes were proved to be stable during all sample storage, preparation and analytic procedures. The validated method was successfully applied to pharmacokinetic studies of MTC-220 and its metabolites in beagle dogs after intravenous infusion of MTC-220 at 2.5mg/kg. Copyright © 2014 Elsevier B.V. All rights reserved.
Elastic scattering of 7Li projectiles in the energy range of 20 to 34 MeV

International Nuclear Information System (INIS)

Khallaf, S.A.E.

1983-01-01

As far as it is known, the Watanabe folding model has not been used to analyse the elastic scattering of 7 Li projectiles. The main purpose of the present work is to calculate the differential cross sections for 7 Li elastic scattering von 90 Zr, 48 , 40 Ca, 16 O and 12 C at incident energies of 20 to 34 MeV using the Watanabe folding model and to study the applicability of this model for 7 Li elastic scattering. The potentials of 7 Li ions are revealed by Taylor expansions of alpha and triton cluster potentials. The resulting differential cross sections are compared with the predicted cross sections using phenomenological potentials of 7 Li ions. (orig./WL)
Neutron cross section evaluations of europium isotopes in 1 keV - 30 MeV energy range. Format - validation - comparison; Evaluation de sections efficaces pour des neutrons incidents sur des isotopes d'europium aux energies 1 keV - 30 MeV. Format - validation - comparaison

Energy Technology Data Exchange (ETDEWEB)

Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee

2004-07-01

This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)

Evaluation of neutron cross sections to 40 MeV for 5456Fe

International Nuclear Information System (INIS)

Arthur, E.D.; Young, P.G.

1980-01-01

Cross sections for neutron-induced reactions on 54 56 Fe were calculated by employing several nuclear models: optical, Hauser-Feshbach, preequilibrium and DWBA - in the energy range between 3 and 40 MeV. As a prelude to the calculations, the necessary input parameters were determined or verified through analysis of a large body of experimental data for both neutron- and proton-induced reactions in this mass and energy region. This technique also led to cross sections in which the simultaneous influence of available data types added to their consistency and reliability. Calculated cross sections as well as neutron and gamma-ray emission spectra were incorporated into an ENDF evaluation suitable for use to 40 MeV. 12 figures, 1 table
75 FR 36471 - Seventh Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-06-25

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Committee 220: Automatic Flight Guidance and [[Page 36472
20 CFR 220.184 - If the annuitant becomes disabled by another impairment(s).

Science.gov (United States)

2010-04-01

... impairment(s). 220.184 Section 220.184 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE... Activity or Medical Improvement § 220.184 If the annuitant becomes disabled by another impairment(s). If a new severe impairment(s) begins in or before the month in which the last impairment(s) ends, the Board...
Phase-shift-analysis approach to elastic neutron scattering from 12C between 9 and 12 MeV

International Nuclear Information System (INIS)

Tornow, W.

1985-01-01

The excitation energy, spin and parity of levels in 13 C have been determined for excitation energies between 13 and 16 MeV via a phase-shift analysis of the measured total cross section, elastic differential cross section and analysing power for n + 12 C in the neutron energy range from 8.9 to 12.0 MeV. New analysing power measurements are reported for this energy range. The present and previous experimental data are well described by the phase shifts obtained. The non-elastic cross section for n + 12 C predicted from the phase shifts is in good agreement with the ENDF/B-V evaluation. The need for further experimental data is pointed out. (author)
Reduction in 14 MeV neutron generation rate by ICRF injection in D-3He burning plasmas

International Nuclear Information System (INIS)

Matsuura, Hideaki; Nakao, Yasuyuki

2004-01-01

The triton distribution function during ion cyclotron range of frequency (ICRF) waves injection in D- 3 He plasmas is examined by solving the 2-dimensional Fokker-Planck equation. Triton distribution function originally has a non-Maxwellian (tail) component around 1.01 MeV birth energy range due to D(d,p)T fusion reaction. Owing to the extension of the original tail by ICRF injection, the high-energy resonance tritons further increase, and the velocity-averaged T(d,n) 4 He fusion reaction rate coefficient, i.e. 14 MeV neutron generation rate, decreases from the values when triton is assumed to be Maxwellian. It is shown that when tritons absorb ∼1/200 of the fusion power from the waves in typical D- 3 He plasma, i.e. T=80 keV, n D =2x10 20 m -3 , τ E0 =3 sec and B=6T, the 14 MeV neutron generation rate is reduced by about ∼20% from the values for Maxwellian plasmas. (author)
Measurements of 14 MeV neutron multiplication in spherical beryllium shells

International Nuclear Information System (INIS)

Moellendorff, U. von; Alevra, A.V.; Giese, H.; Kappler, F.; Klein, H.; Klein, H.; Tayama, R.

1995-01-01

New results of spherical-shell transmission measurements with 14MeV neutrons on pure beryllium shells up to 17cm thick are reported. The total leakage neutron multiplications were measured using a Bonner sphere system. Independently, the leakage neutron spectra were measured over the entire energy range, 15MeV to thermal energies, by proton-recoil and time-of-flight methods. The total leakage multiplications are in excellent agreement with three-dimensional Monte Carlo calculations using beryllium nuclear data based on the Young and Stewart evaluation. The leakage in the evaporation energy window confirms the Be(n,2n) cross-section of the Young and Stewart evaluation rather than that used in the ENDF/B-VI library. At energies below 1keV, a surplus of leakage neutrons over the calculation is found for smaller beryllium thicknesses. (orig.)
Dispersive optical-model and coupled-channels descriptions of neutron scattering from 27Al and 59Co up to 80 MeV

International Nuclear Information System (INIS)

Nagadi, M.M.; Howell, C.R.; Tornow, W.; Weisel, G.J.; Al-Ohali, M.A.; Braun, R.T.; Setze, H.R.; Chen Zemin; Walter, R.L.; Delaroche, J.P.; Romain, P.

2003-01-01

Differential cross sections σ(θ) and analyzing powers A y (θ) have been measured for neutron scattering from 27 Al and 59 Co at 15 MeV at the Triangle Universities Nuclear Laboratory using standard time-of-flight techniques. In addition, σ(θ) was measured for 59 Co at 10, 12, 14, 17, and 19 MeV . Two large databases covering the energy range from 0.1 to 80 MeV were formed for these nuclei from this new data and previously published data, including that for the total cross section σ T . These sets of data were analyzed using spherical dispersive optical-model (DOM) potentials, as well as coupled-channels model (CCM) potentials. The 59 Co DOM gives good agreement with the σ(θ) data, except in the region of the first minimum. It also gives a reasonable description of our A y (θ) measurement. The 27 Al DOM gives good agreement with the data, except for σ(θ) at backward angles below 9.4 MeV and for σ T , for which there is up to 5% disagreement in the 10-50 MeV range. Compared to the DOM, the 59 Co CCM calculations give improved agreement with the σ(θ) data, especially at the first minimum. The σ T calculations agree with the data to within about 3% above 1.0 MeV . The three-level CCM calculations for 27 Al give excellent agreement with the entire database
Excitation function of ''7''4Ge(n, α)''7''1''mZn reaction in the energy range 13.82-14.70 MeV

International Nuclear Information System (INIS)

Halim, M.A.; Hafiz, M.A.; Naher, K.; Miah, R.U.; Ullah, M.R.

2003-01-01

The excitation function of the reaction ''7''4Ge(n, α)''7''1''mZn is measured by activation technique using high resolution HPGe detector gamma ray spectroscopy. Monoenergetic neutrons are produced via D-T reaction at J-25 neutron generator facility of the Institute of Nuclear Science and Technology, AERE, Bangladesh. The neutron flux measurement was done at different energy position in the range 13.82-14.70 MeV using the monitor reaction ''2''7Al(n, α)''2''4Na. The measured cross section values along with the literature data are plotted as a function of neutron energy to get the excitation function of the reaction. A theoretical calculation is also performed to produce the excitation function of the investigated reaction using statistical code SINCROS-II. The measured data are to be found to be in good agreement with the literature data and the theoretical cross section values. (author)
75 FR 59326 - Eighth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-09-27

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include: Welcome...
Measurements and amplitude analysis of small angle pp polarization between 398 and 572 MeV

International Nuclear Information System (INIS)

Aebischer, D.; Favier, B.; Greeniaus, L.G.; Hess, R.; Junod, A.; Lechanoine, C.; Nikles, J.C.; Rapin, D.; Werren, D.W.

1976-01-01

The analyzing power of pp scattering in the cm angular range 4 to 22 0 at 398 to 572 MeV. The analyzing power was determined from the asymmetry in the azimuthal angle distributions of the scattered protons
Experimental evaluation of the response of micro-channel plate detector to ions with 10s of MeV energies

Science.gov (United States)

Jeong, Tae Won; Singh, P. K.; Scullion, C.; Ahmed, H.; Kakolee, K. F.; Hadjisolomou, P.; Alejo, A.; Kar, S.; Borghesi, M.; Ter-Avetisyan, S.

2016-08-01

The absolute calibration of a microchannel plate (MCP) assembly using a Thomson spectrometer for laser-driven ion beams is described. In order to obtain the response of the whole detection system to the particles' impact, a slotted solid state nuclear track detector (CR-39) was installed in front of the MCP to record the ions simultaneously on both detectors. The response of the MCP (counts/particles) was measured for 5-58 MeV carbon ions and for protons in the energy range 2-17.3 MeV. The response of the MCP detector is non-trivial when the stopping range of particles becomes larger than the thickness of the detector. Protons with energies E ≳ 10 MeV are energetic enough that they can pass through the MCP detector. Quantitative analysis of the pits formed in CR-39 and the signal generated in the MCP allowed to determine the MCP response to particles in this energy range. Moreover, a theoretical model allows to predict the response of MCP at even higher proton energies. This suggests that in this regime the MCP response is a slowly decreasing function of energy, consistently with the decrease of the deposited energy. These calibration data will enable particle spectra to be obtained in absolute terms over a broad energy range.
24 CFR 180.220 - Separation of functions.

Science.gov (United States)

2010-04-01

... AND BUSINESS OPPORTUNITY CONSOLIDATED HUD HEARING PROCEDURES FOR CIVIL RIGHTS MATTERS Administrative Law Judge § 180.220 Separation of functions. No officer, employee, or agent of the Federal Government...
Industrial and medicine accelerators and prospects of their development in the 11 five year plan

International Nuclear Information System (INIS)

Vakhrushin, Yu.P.; Glukhikh, V.A.; Svin'in, M.P.

1981-01-01

The data on development and introduction of accelerators into industry and medicine, improvement of their technical-and-econmic factors are presented. A parametric series of high-voltage electron accelerators which includes seven models covering the 0.15-4 MeV energy range, is developed. A common series of linear resonance accelerators for non-destructive testing, radio-therapy, activation analysis and radiation technology cover the 3-40 MeV electron energy range. The series includes 12 modifications of accelerators made of unified modules. A linear induction accelerator with up to 200 kW average beam power for using in an installation for liquid waste decontamination is under development. A parametric series of cyclotrons for industry and medicine using electron beams at 6-220 MeV energy and up to 200 μmA current is developed [ru
The thick-target 9Be(d,n) neutron spectra for deuteron energies between 2.6 and 7.0-MeV

International Nuclear Information System (INIS)

Meadows, J.W.

1991-11-01

The measurement of the zero deg. neutron spectra and yields from deuterons incident on thick beryllium metal targets is described. 235 U and 238 U fission ion chambers were used as neutron detectors to span the neutron energy range above 0.05-MeV with a time resolution of ≤ 3 nanosec. Measurements were made for incident deuteron energies from 2.6 to 7.0-MeV, at 0.4-MeV intervals, using time-of-flight techniques with flight paths of 2.7 and 6.8 meters. The results are presented in graphical form and in tables
76 FR 22163 - Tenth Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-04-20

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control. SUMMARY: The FAA is... hereby given for a Special Committee 220, Automatic Flight Guidance and Control. Agenda Tuesday May 10...
75 FR 15770 - Sixth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-03-30

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... hereby given for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will...
75 FR 80886 - Ninth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-12-23

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include...
High energy proton simulation of 14-MeV neutron damage in Al2O3

International Nuclear Information System (INIS)

Muir, D.W.; Bunch, J.M.

1975-01-01

High-energy protons are a potentially useful tool for simulating the radiation damage produced by 14-MeV neutrons in CTR materials. A comparison is given of calculations and measurements of the relative damage effectiveness of these two types of radiation in single-crystal Al 2 O 3 . The experiments make use of the prominent absorption band at 206 nm as an index to lattice damage, on the assumption that peak absorption is proportional to the concentration of lattice vacancies. The induced absorption is measured for incident proton energies ranging from 5 to 15 MeV and for 14-MeV neutrons. Recoil-energy spectra are calculated for elastic and inelastic scattering using published angular distributions. Recoil-energy spectra also are calculated for the secondary alpha particles and 12 C nuclei produced by (p,p'α) reactions on 16 O. The recoil spectra are converted to damage-energy spectra and then integrated to yield the damage-energy cross section at each proton energy and for 14 MeV neutrons. A comparison of the calculations with experimental results suggests that damage energy, at least at high energies, is a reasonable criterion for estimating this type of radiation damage. (auth)
Evaluated Nuclear Data Library for Transport Calculations at Energies up to 150 MeV

International Nuclear Information System (INIS)

Korovin, Yu.A.; Konobeyev, A.Yu.; Pilnov, G.B.; Stankovskiy, A.Yu.

2005-01-01

A new evaluated nuclear data library has been created. The library consists of two sub-libraries for neutron and proton incident particles. The first version of neutron sub-library has been completed and described in the present paper. The library contains nuclear data for transport, heating, and shielding applications for 242 nuclides ranging in atomic number from 8 to 82 in the energy region of primary neutrons from 10-5 eV to 150 MeV. Data below 20 MeV are taken mainly from ENDF/B-VI (Revision 8) and for some nuclides, from the JENDL-3.3 and JEFF-3.0 libraries. The evaluation of emitted particle energy and angular distributions at the energies above 20 MeV was performed with the help of the ALICE/ASH code and the analysis of available experimental data. The total cross sections, elastic cross sections, and elastic scattering angular distributions were calculated with the help of the coupled channel model. The results of the calculation were adjusted to the data from ENDF/B-VI, JENDL-3.3m or JEFF-3.0 at the neutron energy equal to 20 MeV. The library is written in ENDF/B-VI format using the MF=3/MT=5 and MF=6/MT=5 representations
75 FR 3959 - Fifth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-01-25

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is issuing this notice to advise the public of a meeting of RTCA Special Committee 220: Automatic Flight...

Measurements of double differential charged particle emission cross sections and development of a wide range charged particles spectrometer for ten`s MeV neutrons

Energy Technology Data Exchange (ETDEWEB)

Nauchi, Yasushi; Baba, Mamoru; Kiyosumi, Takehide [Tohoku Univ., Sendai (Japan). Faculty of Engineering] [and others

1997-03-01

We measured (n,xp), (n,xd) cross sections of C and Al for En=64.3 MeV neutrons at the {sup 7}Li(p,n) neutron sources facility at TIARA (Takasaki Establishment, JAERI) by using a conventional SSD-NaI telescope placed in the air. They show characteristic energy and angular dependence in high energy regions. In order to extend the measurements to low energy protons and {alpha} particles, a new spectrometer consisting of low pressure gas counters and BaF{sub 2} scintillators is now under development. A low threshold for low energy {alpha} particles will be achieved by using the gas counters. The particle identification over a wide energy range will be achieved by combining the {Delta}E-E method for low energy particles with the pulse shape discrimination (PSD) method of BaF{sub 2} for high energy particles. (author)
7 CFR 220.7 - Requirements for participation.

Science.gov (United States)

2010-01-01

... items such a grade, purchase units, style, condition, weight, ingredients, formulations, and delivery... citations affecting § 220.7, see the List of CFR Sections Affected, which appears in the Finding Aids...
A preliminary investigation of 222Rn and 220Rn levels in non-uranium mines in China

International Nuclear Information System (INIS)

Shang Bing; Cui Hongxing; Wu Yunyun; Zhang Qingzhao; Su Xu

2008-01-01

Objective: To measure levels of 222 Rn and 220 Rn in typical non-uranium mines, China, and to estimate dose from the occupational radon exposure in the miners. Methods: Using typical sampling scheme, 44 mines were selected in 12 provinces, which can be classified into 4 categories and 17 types of mines. The radon-thoron discriminative detectors were used to measure 222 Rn and 220 Rn concentrations in mines. Result: The concentration of 222 Rn or 220 Rn was log-normally distributed. The arithmetic mean (AM) concentration and geometric mean (GM) concentration of 222 Rn and 220 Rn in 25 metal mines (n=147) were estimated to be (1211 ±2359) Bq/m 3 (AM) and (311 ± 5.5) Bq/m 3 (GM), and (269 ±700) Bq/m 3 (AM) and (71 ± 4.4)Bq/m 3 (GM), respectively. The mean concentrations of 222 Rn and 220 Rn in 18 non-metal mines (n=118) were (98 ± 207) Bq/m 3 (AM) and(55 ± 2.5) Bq/m 3 (GM), and (60 ± 76) Bq/m 3 (AM) and (38 ± 2.4) Bq/m 3 (GM) respectively. In total, we measured 222 Rn concentration in 44 underground mines, 6 of them, accounted for 15%, with the mean radon concentration exceeding 1000 Bqm -3 (limit of workplace in China). Approximately 7% of radon concentration in mines measured were higher than 3700 Bq/m 3 (current limit in uranium mine in China), some points even exceeded 10 000 Bq/m 3 . Based on this typical measurements, the equilibrium factor for 222 Rn was estimated to be 0.33 ± 0.15 in underground mines and 0.47 ±0.18 in nearby houses. Equilibrium factor for 220 Rn ranged from 0.001 to 0.032. Using the data obtained in this typical survey, the average annual effective dose of underground miners exposed to radon and thoron was estimated to be 8.15 mSv/a. Conclusions: High levels of 222 Rn exists in metal mines, such as copper, tin, lead and zinc, gold, and aluminum mines among others. More study and administrative measures are needed to address the radiation protection of workers occupationally exposed to high radon in mines. (authors)
24 CFR 570.614 - Architectural Barriers Act and the Americans with Disabilities Act.

Science.gov (United States)

2010-04-01

... with disabilities. Further, the ADA requires the removal of architectural barriers and communication... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Architectural Barriers Act and the... GRANTS Other Program Requirements § 570.614 Architectural Barriers Act and the Americans with...
Phase-shift-analysis approach to elastic neutron scattering from /sup 12/C between 9 and 12 MeV

Energy Technology Data Exchange (ETDEWEB)

Tornow, W. (Tuebingen Univ. (Germany, F.R.). Physikalisches Inst.); Walter, R.L.; Byrd, R.C. (Duke Univ., Durham, NC (USA). Dept. of Physics; Triangle Universities Nuclear Lab., Durham, NC (USA))

1985-03-01

The excitation energy, spin and parity of levels in /sup 13/C have been determined for excitation energies between 13 and 16 MeV via a phase-shift analysis of the measured total cross section, elastic differential cross section and analysing power for n + /sup 12/C in the neutron energy range from 8.9 to 12.0 MeV. New analysing power measurements are reported for this energy range. The present and previous experimental data are well described by the phase shifts obtained. The non-elastic cross section for n + /sup 12/C predicted from the phase shifts is in good agreement with the ENDF/B-V evaluation. The need for further experimental data is pointed out.
Measurements of hydrogen and helium isotopes emission spectra from neutrons induced reaction at ten's of MeV

International Nuclear Information System (INIS)

Nauchi, Yasushi; Baba, Mamoru; Hirasawa, Yoshitaka

1999-01-01

We have developed a wide dynamic range spectrometer for the measurements of (n, xZ) double differential cross sections (DDXs) for ten's of MeV neutrons at TIARA. The spectrometer consists of a 40-cm diameter vacuum reaction chamber and three counter telescopes. Each telescope consists of a gas proportional counter, an SSD and a BaF 2 scintillator. By using the spectrometer, we achieved simultaneous measurements from ∼MeV α particles to 75 MeV protons with an acceptable counting rate. (author)
Laser driven single shock compression of fluid deuterium from 45 to 220 GPa

Energy Technology Data Exchange (ETDEWEB)

Hicks, D; Boehly, T; Celliers, P; Eggert, J; Moon, S; Meyerhofer, D; Collins, G

2008-03-23

The compression {eta} of liquid deuterium between 45 and 220 GPa under laser-driven shock loading has been measured using impedance matching to an aluminum (Al) standard. An Al impedance match model derived from a best fit to absolute Hugoniot data has been used to quantify and minimize the systematic errors caused by uncertainties in the high-pressure Al equation of state. In deuterium below 100 GPa results show that {eta} {approx_equal} 4.2, in agreement with previous impedance match data from magnetically-driven flyer and convergent-explosive shock wave experiments; between 100 and 220 GPa {eta} reaches a maximum of {approx}5.0, less than the 6-fold compression observed on the earliest laser-shock experiments but greater than expected from simple extrapolations of lower pressure data. Previous laser-driven double-shock results are found to be in good agreement with these single-shock measurements over the entire range under study. Both sets of laser-shock data indicate that deuterium undergoes an abrupt increase in compression at around 110 GPa.
Development and application of a detector for absolute measurement of neutron fluence rate in MeV region

International Nuclear Information System (INIS)

Silva Dias, M. da.

1988-01-01

The development and performance of the DTS (Dual Thin Scintillator) for the absolute measurement of the neutron fluence rate between 1 and 15 MeV is decribed. The DTS detector consists of a pair of organic scintillators in a dual configuration, where the incident produces a proton-recoil which is detected in a 2Π geometry therefore avoiding the effect of the escape of protons. Thin scintillators are used resulting in small multiple scattering corrections. The theoretical caluclations of detector efficiency and proton-recoil spectrum were performed by means of a Monte Carlos code - CARLO DTS. The calculated efficiency was compared to the experimental one at two neutron energies namely 2.446 MeV and 14.04 MeV applying the Time Correlated Associated Particle technique. The theoretical and experimental efficiencies agreed within the experimental uncertainties of 1.44% and 0.77%, respectively. The performance of the DTS has been verified in an absolute 235 U(n,f) cross section measurement between 1 and 6 MeV neutron energy. The cross section results were compared to those obtained replacing the DTS detector by the NBS (National Bureau of Standards, USA) Black Neutron Detector. The agreement was excellent in the overlapping energy interval of the two experiments (between 1 and 3 MeV), within the estimated uncertainly in the range of 1,0 to 1,7%. The agreement with the most recent evaluation from the ENDF/B-VI was excellent in almost all the energy range between 1 and 6 MeV. The 235 U(n,f) cross section, average over the 252 Cf fission neutron spectrum has been evaluated. The result including the cross section values of the present work was 1220 mb, in excellent agreement with the average value among the most recent measurements, 1227 +- 12 mb, and with the value 1213 mb, using the ENDF/B-VI data. (author) [pt
Thoron (220Rn) in the indoor environment and work places

Science.gov (United States)

Ramachandran, T. V.; Sahoo, B. K.

2009-08-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222Rn and its progeny, there was a great upsurge of interest in the measurement of 222Rn in the environment. Subsequently, considerable data is being generated on the levels of 222Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220Rn in indoors and workplace environment is scaree due to the genral perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon (222Rn), and thoron (220Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222Rn, 220Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232Th is being handled is being summarized. Methods of measurement and
Thoron (220Rn) in the indoor environment and work places

International Nuclear Information System (INIS)

Ramchandran, T.V.; Sahoo, B.K.

2009-01-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scaree due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220 Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220 Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232 Th is being handled is being summarized. Methods of
Thoron (220Rn) in the indoor atmospheric environment

International Nuclear Information System (INIS)

Ramachandran, T.V.

2006-01-01

Naturally occurring background radiation is a topic, which has evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Many locations around the world have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It has been estimated that inhalation of 222 Rn, 2 20 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. In the Indian context, in an earlier national survey, the external gamma radiation dose rates have been more or less well mapped using thermo luminescent dosimeters covering more than 214 locations, which has yielded a national average of 775 mGy/y. Of this, nearly 48.7% contribution of the dose rate is from 40 K and the rest from the uranium (33.6%) and thorium (17.7%) series. A good database pertaining to the country wide levels of uranium, thorium and potassium in geological materials also exists. Thus, there exists a good database on the total external gamma radiation level across the country. Since the contribution from inhalation of 222 Rn, 220 Rn and their short lived progenies contributes more than 54% of the total background radiation dose, it was necessary to supplement the external component with inhalation component. This component is not adequately estimated for the country so far on national level. With this in mind, a national survey has been executed by this center involving a large number of universities and other allied research institutions from different parts of the country for the estimation of inhalation component of the dose
36 CFR 220.4 - General requirements.

Science.gov (United States)

2010-07-01

... natural and physical environment and the relationship of people with that environment (see 40 CFR 1508.14... for environmental assessments, findings of no significant impact and categorical exclusions (FSM 1950... ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.4 General requirements. (a) Proposed actions subject to the...
Study of the response of a silicon detector irradiated with 1 MeV neutrons; Etude de la reponse d`un detecteur Si irradie par des neutrons de 1 MeV

Energy Technology Data Exchange (ETDEWEB)

Roy, P [Montreal Univ., PQ (Canada). Lab. de Physique Nucleaire

1994-12-31

The author studied the response of an n-type silicon detector irradiated with 1 MeV neutrons at fluences ranging from 0.26x10{sup 13} to 11.19x10{sup 13} neutrons/cm{sup 2}. The response of the irradiated detector to {sup 241}Am alpha particles was measured. 13 refs., 7 figs.
Photospallation reactions of 133Cs and 139La by 100 MeV- and 200 MeV bremsstrahlungs

International Nuclear Information System (INIS)

Sakamoto, K.; Toramoto, H.; Hamajima, Y.; Okada, K.; Dohniwa, M.

1984-01-01

Spallation yields relative to the 196 Au yield from 197 Au(γ,n) of 26 to 46 nuclides of Sb, Te, I, Xe, Cs and/or Ba and La from 133 Cs and 139 La targets irradiated with bremsstrahlungs of end energies of 100 MeV and 200 MeV were radiochemically determined. The isomeric yield ratios for 132 La and 131 Ba from the ( 139 La + 100 MeV-γ), 132 La, 131 Ba, 121 Te and 119 Te from the ( 139 La + 200 MeV-γ, and 120 I, 121 Te and 119 Te from the ( 133 Cs +- 200 MeV-γ) were also determined. The isotopic yields from the (γ,yn) reactions decrease exponentially with increase of y up to 5, and show no dependence on energy and targets studied, indicating that the reactions of a few neutron emissions occur at energies lower than 100 MeV. When the product yields from the (γ,xpyn) reactions were plotted against (x + y) for each x (isotopic distribution), a regular variation of the Gaussian distributions, typical of nuclear spallation, was observed. Isobaric mass distributions and charge dispersions were deduced to extract characteristic features of these reactions. The isobaric distributions due only to photons of 100 MeV to 200 MeV, which were obtained by subtracting the 100 MeV-yields from the 200 MeV-yields, are very close to a symmetric one peaking at about 8 amu from the target masses. Nuclear charges are also dispersed symmetrically, with most probable N/Zsub(p) of about 1.3 replaced by about 1 amu to the neutron-deficient side from the beta stability valley in all the cases studied. Parameters included in Rudstam's semi-empirical formula were examined by comparing with the observed yield curves. The P values of 0.45 and 0.65, chosen for a better fit to the 200 MeV data on 133 Cs and 139 La, respectively, were larger than the predictions reported in the literature. The magic number effects of 139 La may explain the target-differences in mass distributions. (orig.)
22 CFR 1508.220 - Are any procurement contracts included as covered transactions?

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Are any procurement contracts included as covered transactions? 1508.220 Section 1508.220 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION.... (3) The contract is for federally-required audit services. ...
Measurement of the 0.511 MeV #betta# ray line from the galactic center

International Nuclear Information System (INIS)

Jardim, J.O.D.; Benson, J.L.; Jardim, M.V.A.; Martin, I.M.

1981-02-01

The detection of the 0.511 MeV electron-positron annihilation line coming from the Galactic Center can provide the means to estimate the rate of positron production and to test some theoretical sources of positrons. The result of the measurements of the 0.511 MeV line flux made in a gamma-ray experiment on board a stratospheric balloon is presented. Thedetector field of view looked at the galactic longitude range-31 0 0 . The observed flux is (6.70 + - 0.85)x10 - 3 photons cm - 2 s - 1 , which is in good agreement with the expected flux when assuming that the Galactic Center is a line source emitting uniformly. (Author) [pt
Dynamic interaction of p220NPAT and CBP/p300 promotes S-phase entry

International Nuclear Information System (INIS)

Wang, Aiyan; Ikura, Tsuyoshi; Eto, Kazuhiro; Ota, Masato S.

2004-01-01

Cajal bodies contain cyclin E/cdk2 and the substrate p220 NPAT to regulate the transcription of histones, which is essential for cell proliferation, however, recent mouse knockout studies indicate that cyclin E and cdk2 are dispensable for these events. Because the CBP/p300 histone acetyltransferase are also known to be involved in cell proliferation, we examined the molecular and functional interactions of p220 NPAT with the CBP/p300 at the G1/S boundary as cell cycle regulators. The subnuclear localization of p220 NPAT and CBP/p300 proteins showed that their foci partially overlapped in a cell cycle dependent manner. Overexpression of p220 NPAT and CBP/p300 cooperatively enhanced G1/S transition and DNA synthesis even without cdk2 phosphorylation site. Finally, molecular alignment analysis indicated that p220 NPAT contains several potential substrate sites for CBP/p300. Overall, our findings demonstrate that p220 NPAT and CBP/p300 form a transient complex at the G1/S boundary to play cooperative roles to promote the S-phase entry
Fusion with projectiles form carbon to argon at energies between 20A and 60A MeV

International Nuclear Information System (INIS)

Galin, J.

1986-03-01

A review of the linear momentum transfer is made, considering essentially heavy targets and two important parameters in the entrance channel: the projectile energy and its mass. Over a broad mass range, and for energies up to 30A MeV, the momentum transfer scales with the mass of the projectile. At 30A MeV, the most probable value of projectile momentum transferred to the fused system is 80%, and this represents roughly 180 MEV/c per projectile nucleon. At higher bombarding energies, the momentum distribution in the fused systems, as observed from binary fission events, seems to depend on the mass of the projectile. Further studies are still needed to understand this behaviour. Finally, the decay of highly excited (E* approximately 500-800 MeV) fused systems, with masses close to 270 amu, is studied from the characteristics of both fusion fragments and light charged particles. It is shown that thermal equilibrium is reached before fission, even for such high energy deposition. However, the decay sequence is sensitive to dynamical effects and does not depend only on available phase space
Tests of health physics detectors and dosimeters to 6 and 9 MeV gamma-radiation

International Nuclear Information System (INIS)

1982-04-01

The CEA health physicists working group on standardization and testing of detectors for the measurements of external exposure has set up and calibrated a capture #betta# beam. 6 and 9 MeV energies were obtained by means of Ti and Ni targets. These beams made it possible to determine the response of a number of detectors and dosimeters used in health physics to these energy ranges. Most generally, these tests showed that at 6 or 9 MeV the responses of instruments calibrated with 60 Co #betta#-rays could vary as much as a factor 2 when compared to the maximun of the absorbed dose in a human body [fr
GXRD study of 100 MeV Fe9+ ion irradiated indium phosphide

International Nuclear Information System (INIS)

Dubey, R.L.; Dubey, S.K.; Kachhap, N.K.; Kanjilal, D.

2014-01-01

Swift heavy ions with MeV to GeV kinetic energy offer unique possibilities of modifying material properties. Each projectile passing through the target material causes loss of its energy by ion-electrons and ion-atoms interaction with the target material. The consequence of formal one is to change in surface properties and latter to produces damage deep in the target material near the projected range of projectile. In the present work, indium phosphide samples were irradiated at 100 MeV 56 Fe 9+ ions with different fluences varying from 1x10 12 to 1x10 14 ions cm -2 using the 15UD Pelletron facilities at Inter University Accelerator Centre (IUAC), New Delhi. Grazing angle X-ray diffraction technique was used to investigate the structural properties of irradiated indium phosphide at different depths. The GXRD spectra of non-irradiated and irradiated samples were recorded at different grazing angle i.e 1°, 2°, 3°, 4° and 5° to get the structural information over the projected range. The detailed result will be presented and discussed in the conference. (author)

Some links on this page may take you to non-federal websites. Their policies may differ from this site.