WorldWideScience

Sample records for rajasthan phylogenetic relationship

  1. Sequence characterization of cotton leaf curl virus from Rajasthan: phylogenetic relationship with other members of geminiviruses and detection of recombination.

    Science.gov (United States)

    Kumar, A; Kumar, J; Khan, J A

    2010-04-01

    Diseased cotton plants showing typical leaf curl symptoms were collected from experimental plot of Agriculture Research Station-Sriganganagar, Rajasthan. Complete DNA-A component from samples taken from two areas were amplified through rolling circle amplification (RCA) using templiphi kit (GE Healthcare) and characterized. DNA-A of one isolate consists of 2751 nucleotides and second isolate of 2759 nucleotide. Both sequences comprised six ORF's. Genome organization of DNA-A of one isolate shows high sequence similarity with other characterized local begomovirus isolates of Rajasthan, while other isolate shows high sequence similarity with CLCuV reported from Pakistan. The maximum similarity of first isolate, CLCuV-SG01, shows highest sequence identity with Cotton leaf curl Abohar (Rajasthan) virus, and second isolate, CLCuV-SG02, shows highest sequence identity with cotton leaf curl virus from Pakistan. Both isolates showed 85% similarities with each other. The sequence data revealed probable infiltration of some strains of Cotton leaf curl virus from Pakistan to India, or co-existence of different isolates under similar geographical conditions. While CLCuV-SG01 shows highest nt sequence similarity with CLCuV Rajasthan (Abohar), nt identity of V1 ORF (encoding coat protein) of SG01 shows the highest nt identity (100%) with CLCuV Multan (Bhatinda) and Abohar virus while AC1 region also showed difference. Complete nucleotide sequence of SG01 shows only 86% similarity with CLCuV Multan virus. Similarity search revealed significant difference in AV1 and AC1 regions with respect to DNA-A suggesting an evolutionary history of recombination. Computer based analysis, recombination detection Program (RDP) supports the recombination hypothesis, indicated that recombination with other begomoviruses had taken place within V1 ORF and AC1 ORF of CLCuV-SG01 and AC1 ORF of CLCuV-SG02 and also in noncoding intergenic region (IR).

  2. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  3. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  4. Prospecting Organic production of spices in Rajasthan

    OpenAIRE

    Sharma, Arun K.

    2015-01-01

    Low rainfall and low atmospheric humidity favours spices production in Rajasthan, the largest state of India.Details on possibilities of organic production of spices in Rajasthan are described in the paper considering the future challenges of soil, climate,social and market environment.

  5. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  6. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  7. Interlinking feasibility of five river basins of Rajasthan in India

    OpenAIRE

    Vyas, Sunil Kumar; Sharma, Gunwant; Mathur, Y.P.; Chandwani, Vinay

    2016-01-01

    The increasing population and large scale growth with the development of modern science and technology has indicated very high stress on water sector in Rajasthan in India. Availability of water and uniformity of rainfall distribution is changing day by day due to shifting of monsoon in Rajasthan. The spatial and temporal variations in the rainfall in different river basins in Rajasthan are drastic due to which flood situation arises in the tributaries of Chambal river basin every year. Simul...

  8. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  9. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    phylogenetic relationships of the Branchiostoma lancelets from South (Xiamen) and North (Qingdao and Rizhao) China, and phylogenetic trees constructed also included the existing data from Japanese waters. The genetic distances of the lancelets between South and North China averaged 0.19, 0.21, and 0.17 based on ...

  10. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  11. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  12. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  13. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  14. Capturing Energy-Saving Opportunities: Improving Building Efficiency in Rajasthan through Energy Code Implementation

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Qing [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Yu, Sha [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Evans, Meredydd [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mathur, Jyotirmay [Malaviya National Institute of Technology, Jaipur (India); Vu, Linh D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2016-05-01

    India adopted the Energy Conservation Building Code (ECBC) in 2007. Rajasthan is the first state to make ECBC mandatory at the state level. In collaboration with Malaviya National Institute of Technology (MNIT) Jaipur, Pacific Northwest National Laboratory (PNNL) has been working with Rajasthan to facilitate the implementation of ECBC. This report summarizes milestones made in Rajasthan and PNNL's contribution in institutional set-ups, capacity building, compliance enforcement and pilot building construction.

  15. First record of Galeodes indicus Pocock, 1900 (Arachnida: Solifugae: Galeodidae from Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Ruquaeya Bano

    2016-03-01

    Full Text Available During a regular survey to collect soil arthropods in Lasiurus sindicus Henrard grassland by pitfall methods at Chandan Village near Jaisalmer City, Rajasthan, we found a dead specimen of Galeodes indicus in a sample.  Galeodes indicus (Pocock, 1900 has been reported from Madhya Pradesh, Maharashtra, Andhra Pradesh and Telangana but so far was unknown to Rajasthan, India.  In this communication, we report Galeodes indicus from Jaisalmer District, Rajasthan, India. 

  16. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  17. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  18. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  19. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees.

    Science.gov (United States)

    DeBlasio, Dan F; Wisecaver, Jennifer H

    2016-01-01

    We present the phylogeny analysis software SICLE (Sister Clade Extractor), an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  20. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dan F. DeBlasio

    2016-08-01

    Full Text Available We present the phylogeny analysis software SICLE (Sister Clade Extractor, an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  1. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  2. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  3. The Gypsum: White gold of Rajasthan, introduction, uses and future prospective

    Science.gov (United States)

    Sharma, Gayatri

    2013-06-01

    Rajasthan is mineral based state and Bikaner and its surrounding district have been gifted with Gypsum. Mt of Gypsum is available in these districts. Gypsum has multiple uses including basic raw material for POP industry, addition in cement and a natural fertilizer. This mineral has changes the economic scenario in the remote areas of Bikaner, Nagaur, Hanumangarh, Sanchore, Shriganganagar etc. Gypsum and selenite are mined about 3.0 million tons per year. There is huge demand from cement industry as Gypsum is added for improving setting time of cement. Gypsum is a natural fertilizer for alkaline land and it role is vital in state like India where alkaline land is major role. Its high use as fertilizer has potential to change millions of poor farmer families and improving in crop production. Cement Industry has started importing Gypsum from Thailand, Bankong, Pakistan, Iran etc. The mining of gypsum of purity of 70% CaSO4.2H2O is cooperative effort between the land owners and Rajasthan State Mines and Minerals Limited. Gypsum fulfills the demand of POP and Cement industry in Rajasthan and powder gypsum used in agriculture for recon dining of alkaline soil. This paper deals with multiple uses, availability, and future prospective of Gypsum, a white gold of Rajasthan.

  4. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... Inappropriate tree reconstruction methods would pose a problem only in the basal relationships rather than in terminal taxa; the paraphyly observed in this study applied mostly to terminal taxa. This study recovered sufficient phylogenetic characters to separate accessions of the same species, making.

  5. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  6. Interlinking feasibility of five river basins of Rajasthan in India

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Vyas

    2016-09-01

    Annual surplus water of about 1437 MCM in the river Chambal is going waste and ultimately reaches to sea after creating flood situations in various places in India including Rajasthan, while on the other hand 1077 MCM water is a requirement in the four other basins in Rajasthan i.e. Banas, Banganga, Gambhir and Parbati at 75% dependability. Interlinking and water transfer from Chambal to these four river basins is the prime solution for which 372 km link channel including 9 km tunnel of design capacity of 300 cumec with 64 m lift is required.

  7. Phylogenetic versus functional signals in the evolution of form-function relationships in terrestrial vision.

    Science.gov (United States)

    Motani, Ryosuke; Schmitz, Lars

    2011-08-01

    Phylogeny is deeply pertinent to evolutionary studies. Traits that perform a body function are expected to be strongly influenced by physical "requirements" of the function. We investigated if such traits exhibit phylogenetic signals, and, if so, how phylogenetic noises bias quantification of form-function relationships. A form-function system that is strongly influenced by physics, namely the relationship between eye morphology and visual optics in amniotes, was used. We quantified the correlation between form (i.e., eye morphology) and function (i.e., ocular optics) while varying the level of phylogenetic bias removal through adjusting Pagel's λ. Ocular soft-tissue dimensions exhibited the highest correlation with ocular optics when 1% of phylogenetic bias expected from Brownian motion was removed (i.e., λ= 0.01); the value for hard-tissue data were 8%. A small degree of phylogenetic bias therefore exists in morphology despite of the stringent functional constraints. We also devised a phylogenetically informed discriminant analysis and recorded the effects of phylogenetic bias on this method using the same data. Use of proper λ values during phylogenetic bias removal improved misidentification rates in resulting classifications when prior probabilities were assumed to be equal. Even a small degree of phylogenetic bias affected the classification resulting from phylogenetically informed discriminant analysis. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  8. How Do Age and Tooth Loss Affect Oral Health Impacts and Quality of Life?A Study Comparing Two State Samples of Gujarat and Rajasthan

    Directory of Open Access Journals (Sweden)

    A. Mathur

    2012-01-01

    Full Text Available Objective: Age and tooth loss are expected to have a complex relationship with oral health-related quality of life. So the purpose of this study was to explain the impact of age and tooth loss on oral health-related quality of life using the short form 14-item oral health impact profile (OHIP-14 among two population samples of Gujarat and Rajasthan.Materials and Methods: A cross-sectional questionnaire-based survey was conducted among 1441 subjects collected from two major cities of Gujarat and Rajasthan. Both questionnaire approaches using OHIP-14 scale and clinical examination were conducted in accordance with WHO criteria using type III procedure on the same day. Chi square test, ANOVA and stepwise multiple regression analysis were applied using SPSS software version 15.0.Results: With the increase of age, OHIP mean score in both states increased, but that among Rajasthan state was higher, depicting poor oral health. Whereas, in the remaining 23-27 number of teeth both states showed higher OHIP mean, however again the score was much higher among Rajasthan subjects showing worse oral hygiene. Hence, overall all mean OHIP score for Gujarat was lower indicating good oral health; whereas, that among Rajasthan was higher indicating poor oral health-related quality of life.Conclusion: Both age and tooth loss are associated with each other, but they have an independent effect on the oral health-related quality of life. Thus, all studied populations with complete natural dentition showed good oral health-related quality of life.

  9. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  10. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  11. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Nosocomial infection of CCHF among health care workers in Rajasthan, India.

    Science.gov (United States)

    Yadav, Pragya D; Patil, Deepak Y; Shete, Anita M; Kokate, Prasad; Goyal, Pulkit; Jadhav, Santosh; Sinha, Sanjeev; Zawar, Divya; Sharma, Surendra K; Kapil, Arti; Sharma, D K; Upadhyay, Kamlesh J; Mourya, Devendra T

    2016-11-03

    Ever since Crimean-Congo hemorrhagic fever [CCHF] discovered in India, several outbreaks of this disease have been recorded in Gujarat State, India. During the year 2011 to 2015 several districts of Gujarat and Rajasthan state (Sirohi) found to be affected with CCHF including the positivity among ticks and livestock. During these years many infected individuals succumbed to this disease; which subsequently led to nosocomial infections. Herein, we report CCHF cases recorded from Rajasthan state during January 2015. This has affected four individuals apparently associated with one suspected CCHF case admitted in a private hospital in Jodhpur, Rajasthan. A 30-year-old male was hospitalized in a private hospital in Jodhpur, Rajasthan State, who subsequently had developed thrombocytopenia and showed hemorrhagic manifestations and died in the hospital. Later on, four nursing staff from the same hospital also developed the similar symptoms (Index case and Case A, B, C). Index case succumbed to the disease in the hospital at Jodhpur followed by the death of the case A that was shifted to AIIMS hospital, Delhi due to clinical deterioration. Blood samples of the index case and Case A, B, C were referred to the National institute of Virology, Pune, India for CCHF diagnosis from the different hospitals in Rajasthan, Delhi and Gujarat. However, a sample of deceased suspected CCHF case was not referred. Subsequently, blood samples of 5 nursing staff and 37 contacts (Case D was one of them) from Pokhran area, Jaisalmer district were referred to NIV, Pune. It clearly indicated that nursing staff acquired a nosocomial infection while attending the suspected CCHF case in an Intensive Care Unit of a private hospital in Jodhpur. However, one case was confirmed from the Pokhran area where the suspected CCHF case was residing. This case might have got the infection from suspected CCHF case or through other routes. CCHF strain associated with these nosocomial infections shares the

  13. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  14. Real-time Extremely Heavy Rainfall Forecast and Warning over Rajasthan During the Monsoon Season (2016)

    Science.gov (United States)

    Srivastava, Kuldeep; Pradhan, D.

    2018-01-01

    Two events of extremely heavy rainfall occurred over Rajasthan during 7-9 August 2016 and 19-21 August 2016. Due to these events, flooding occurred over east Rajasthan and affected the normal life of people. A low-pressure area lying over northwest Madhya Pradesh on 7 August 2016 moved north-westward and lay near east Rajasthan and adjoining northwest Madhya Pradesh on 8 and 9 August 2016. Under the influence of this low-pressure system, Chittorgarh district and adjoining areas of Rajasthan received extremely heavy rainfall of 23 cm till 0300 UTC of 8 August 2016 and 34 cm on 0300 UTC of 9 August 2016. A deep depression lying over extreme south Uttar Pradesh and adjoining northeast Madhya Pradesh on 19 August 2016 moved westward and gradually weakened into a depression on 20 August 2016. It further weakened into a low-pressure area and lay over east Rajasthan on 21 and 22 August 2016. Under the influence of this deep depression, Jhalawar received 31 cm and Baran received 25 cm on 19 August. On 20 August 2016, extremely heavy rainfall (EHR) occurred over Banswara (23.5 cm), Pratapgarh (23.2 cm) and Chittorgarh (22.7 cm) districts. In this paper, the performance of the National Centers for Environmental Prediction (NCEP) global forecast system (GFS) model for real-time forecast and warning of heavy to very heavy/EHR that occurred over Rajasthan during 7-9 August 2016 and 19-21 August 2016 has been examined. The NCEP GFS forecast rainfall (Day 1, Day 2 and Day 3) was compared with the corresponding observed gridded rainfall. Based on the predictions given by the NCEP GFS model for heavy rainfall and with their application in real-time rainfall forecast and warnings issued by the Regional Weather Forecasting Center in New Delhi, it is concluded that the model has predicted the wind pattern and EHR event associated with the low-pressure system very accurately on day 1 and day 2 forecasts and with small errors in intensity and space for day 3.

  15. Production and quality control of concrete for the Rajasthan Atomic Power Station - [Part 2

    International Nuclear Information System (INIS)

    Singh Roy, P.K.; Sukhtankar, K.D.; Prasad, K.

    1975-01-01

    The following aspects of the production and quality control of concrete and concrete materials used in the construction of twin-reactor Rajasthan Atomic Power Station are discussed : (1) relationship between strength of cubes and cylinders made of concrete used for the prestressed dome (2) temperature control during pouring of concrete (3) thermal conductivity of heavy concrete (4) various types of grouting procedures used for different structures forming part of reactors (5) quality control of normal and heavy concrete and (6) leakage through form ties. Typical concrete mixes used for grouts are also given. (M.G.B.)

  16. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  17. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  18. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  19. Experience from the construction and operation of Tarapur and Rajasthan Nuclear Power Stations

    International Nuclear Information System (INIS)

    Shah, J.C.; Pardiwala, T.F.; Kothare, V.V.; Rao, M.H.P.; Nanjundeswaran, K.

    1977-01-01

    India's experience in construction and operation of nuclear power stations so far covers two BWR and four PHWR Units in three power stations. Two more PHWR units are at an early stage of construction. The twin unit Tarapur Station (2x210 MWe BWR) was built as a turnkey project which restricted participation of Indian engineers in design and construction considerably. The contrasting approach adopted for Rajasthan Station (2x220 MWe PHWR) involved Indian personnel and contractors fully in construction and commissioning, with Canadians providing supervisory assistance in Rajasthan I and essentially consultative help for Rajasthan II. Subsequent stations are wholly Indian efforts. Tarapur went into commercial operation in 1969, 60 months after breaking of ground. Construction was essentially uneventful, major problems faced being stress corrosion induced cracks in the reactor lining and complete change of steam generator tubes. In its seven years of operations, Tarapur has faced several problems mainly arising from rather early designs, indifferent fuel performance, constraints of twin-unit approach and operations in an inadequately developed grid system apart from those generally stemming from assimilation of an advanced technology in a developing country. The Station has undergone six refuellings during this period. Most of the problems have been overcome by design changes, system augmentations and experience and the Station operation since mid 1974 have generally been steady at around 90% of the rated capacity. Construction of Rajasthan I at a remote and isolated site proceeded relatively slowly. Local availability of skilled and semi-skilled manpower was poor, affecting construction. Inadequate roads impeded movements of overdimensioned components. Observing strict Quality Assurance standards required several major rectifications at site. Rajasthan I went on line in 1973 after overcoming major turbine bearing problems during commissioning. Since then, while

  20. Deformation of footwall rock of Phulad Shear Zone, Rajasthan ...

    Indian Academy of Sciences (India)

    Phulad Shear Zone (PSZ) of Delhi Fold Belt in Rajasthan is a northeasterly striking ductile shear zone with a well developed mylonitic foliation (035/70E) and a downdip stretching lineation. The deformation in the PSZ has developed in a transpressional regime with thrusting sense of movement. The northeastern unit, i.e. ...

  1. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  2. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  3. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  4. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  5. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  6. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  7. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  8. Antimicrobial Screening of Some Exotic Tree Species of Rajasthan Desert

    OpenAIRE

    B.B.S. Kapoor* and Shelja Pandita

    2013-01-01

    Antimicrobial screening of ethyl ether and alcoholic extracts of leaves of four selected exotic tree species growing inRajasthan Desert was carried out. Colophospermum mopane, Holoptelea integrifolia, Kigelia pinnata andPutranjiva roxburghii showed positive reactions against bacterial pathogens i.e. Staphylococcus aureus, Escherichiacoli and a fungal pathogen Candida albicans.

  9. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  10. Forest structure, diversity and soil properties in a dry tropical forest in Rajasthan, Western India

    Directory of Open Access Journals (Sweden)

    J. I. Nirmal Kumar

    2011-06-01

    Full Text Available Structure, species composition, and soil properties of a dry tropical forest in Rajasthan Western India, were examined by establishment of 25 plots. The forest was characterized by a relatively low canopy and a large number of small-diameter trees. Mean canopy height for this forest was 10 m and stands contained an average of 995 stems ha-1 (= 3.0 cm DBH; 52% of those stems were smaller than 10 cm DBH. The total basal area was 46.35 m2ha-1, of which Tectona grandis L. contributed 48%. The forest showed high species diversity of trees. 50 tree species (= 3.0 cm DBH from 29 families were identified in the 25 sampling plots. T. grandis (20.81% and Butea monosperma (9% were the dominant and subdominant species in terms of importance value. The mean tree species diversity indices for the plots were 1.08 for Shannon diversity index (H´, 0.71 for equitability index (J´ and 5.57 for species richness index (S´, all of which strongly declined with the increase of importance value of the dominant, T. grandis. Measures of soil nutrients indicated low fertility, extreme heterogeneity. Regression analysis showed that stem density and the dominant tree height were significantly correlated with soil pH. There was a significant positive relationship between species diversity index and soil available P, exchangeable K+, Ca2+ (all p values < 0.001 and a negative relationship with N, C, C:N and C:P ratio. The results suggest that soil properties are major factors influencing forest composition and structure within the dry tropical forest in Rajasthan.

  11. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  12. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  13. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  14. Bryozoans are returning home: recolonization of freshwater ecosystems inferred from phylogenetic relationships.

    Science.gov (United States)

    Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan

    2015-01-01

    Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.

  15. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  16. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  18. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  19. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  20. Estimates of Maternal Mortality Ratio and the associated medical causes in Orissa and Rajasthan States - A cross sectional study

    Directory of Open Access Journals (Sweden)

    Abha Rani Aggarwal

    2015-03-01

    Full Text Available Background: Maternal Mortality Ratio (MMR is an important indicator of reproductive health and its reduction remains a challenge in India. Aims &Objective: This study was conducted with the aim of estimating MMR in two states Orissa and Rajasthan having high MMR as well as to identify the associated medical causes of maternal mortality. Material Methods: This survey was conducted from October 2010-June 2012 on a sample of 13 Primary Health Centres (PHCs in Orissa and 15 PHCs in Rajasthan. These numbers have been derived after estimating the total number of live births using MMR and birth rate from Sample Registration System. 1997-2003.An adapted snowball technique was adopted wherein maternal deaths were captured by snowball technique and the numbers of live births were taken from the available records from the various health facilities in the study.  Results: The overall birth rate in Orissa was found to be 19 per 1000 population while in Rajasthan it was 24 per 1000 population. The study revealed that 17% additional maternal deaths could be captured by snowball technique as against the official record. The overall weighted estimate of MMR was 252 per one lakh live births (95% CI: 246-259 per 1,00,000 live births in Orissa and 209 per one lakh live births (95% CI: 207-211 per one lakh live births in Rajasthan. The main causes of maternal deaths were post-partum haemorrhage, anaemia and septicaemia. More than 25% maternal deaths could be attributed to indirect causes including suicide, accident and infectious diseases. Conclusion: There appears to be a positive trend towards reduction of maternal mortality in Orissa and Rajasthan. Greater care is essential to reduce medical as well as incidental causes of death during pregnancy.

  1. Estimates of Maternal Mortality Ratio and the associated medical causes in Orissa and Rajasthan States - A cross sectional study

    Directory of Open Access Journals (Sweden)

    Abha Rani Aggarwal

    2015-03-01

    Full Text Available Background: Maternal Mortality Ratio (MMR is an important indicator of reproductive health and its reduction remains a challenge in India. Aims &Objective: This study was conducted with the aim of estimating MMR in two states Orissa and Rajasthan having high MMR as well as to identify the associated medical causes of maternal mortality. Material Methods: This survey was conducted from October 2010-June 2012 on a sample of 13 Primary Health Centres (PHCs in Orissa and 15 PHCs in Rajasthan. These numbers have been derived after estimating the total number of live births using MMR and birth rate from Sample Registration System. 1997-2003.An adapted snowball technique was adopted wherein maternal deaths were captured by snowball technique and the numbers of live births were taken from the available records from the various health facilities in the study.  Results: The overall birth rate in Orissa was found to be 19 per 1000 population while in Rajasthan it was 24 per 1000 population. The study revealed that 17% additional maternal deaths could be captured by snowball technique as against the official record. The overall weighted estimate of MMR was 252 per one lakh live births (95% CI: 246-259 per 1,00,000 live births in Orissa and 209 per one lakh live births (95% CI: 207-211 per one lakh live births in Rajasthan. The main causes of maternal deaths were post-partum haemorrhage, anaemia and septicaemia. More than 25% maternal deaths could be attributed to indirect causes including suicide, accident and infectious diseases. Conclusion: There appears to be a positive trend towards reduction of maternal mortality in Orissa and Rajasthan. Greater care is essential to reduce medical as well as incidental causes of death during pregnancy.

  2. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  3. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  4. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  5. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  6. Spatial distribution of tritium in the Rawatbhata Rajasthan site environment

    International Nuclear Information System (INIS)

    GilI, Rajpal; Tiwari, S.N.; Gocher, A.K.; Ravi, P.M.; Tripathi, R.M.

    2014-01-01

    Tritium is one of the most environmentally mobile radionuclides and hence has high potential for migration into the different compartments of environment. Tritium from nuclear facilities at RAPS site is released into the environment through 93 m and 100 m high stack mainly as tritiated water (HTO). The released tritium undergoes dilution and dispersion and then follows the ecological pathway of water molecule. Environmental Survey Laboratory of Health Physics Division, Bhabha Atomic Research Centre (BARC), located at Rajasthan Atomic Power Station (RAPS) site is continuously monitoring the concentration of tritium in the environment to ensure the public safety. Atmospheric tritium activity during the period (2009-2013) was measured regularly around Rajasthan Atomic Power Station (RAPS). Data collected showed a large variation of H-3 concentration in air fluctuating in the range of 0.43 - 5.80 Bq.m -3 at site boundary of 1.6 km. This paper presents the result of analyses of tritium in atmospheric environment covering an area up to 20 km radius around RAPS site. Large number of air moisture samples were collected around the RAPS site, for estimating tritium in atmospheric environment to ascertain the atmospheric dispersion and computation of radiation dose to the public

  7. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  8. Geobotanical studies on uranium deposits of Udaipur, Rajasthan, India

    International Nuclear Information System (INIS)

    Aery, N.C.; Jain, G.S.

    1995-01-01

    Geobotanical studies were carried out on known uranium deposits of Udaisagar region in the district of Udaipur, Rajasthan. Releve method of Braun Blanquet was employed for community analysis. Though no species with an exclusive occurrence on uranium deposits was found, certain plant species registered higher constancy and fidelity on uranium rich soils in comparison to background soils. Obviously, these characteristic plant species have evolved tolerance to high uranium contents of the soils and might be neo-endemics. (author). 23 refs., 1 fig., 4 tabs

  9. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  10. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  11. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  12. Study On Harmful Effects Of Opium On Liver And Lungs In Chronic Opium Addicts Of Western Rajasthan

    Directory of Open Access Journals (Sweden)

    M Kamla

    2011-12-01

    Full Text Available Background: Today opium dependence is widely prevalent in certain states of India, especially Rajasthan, Punjab, Haryana, Madhya Pradesh (MP etc. In rural areas of western Rajasthan crude opium is consumed with a social acceptance by a notable proportion (8.0% of adult male population. Later on they become addicted to it.Objective: to observe the changes in some liver and lung function parameters in opium addicted subjects of Barmer city of Western Rajasthan.Methods: The present study was conducted in district hospital of Barmer, Rajasthan. Total fifty (50 adult male subjects with age ranged from 30 to 50 years were participated in this study. Among them 25 were opium addicted and were considered as study group (Group B and another 25 apparently healthy adult male of same age group were designated as control group (Group A. Opium addicts were consuming about 5–11 gm/day opium for >2 years. Then liver function tests were evaluated by estimating serum aspartate amino transferase (AST, alanine amino transferase (ALT, alkaline phosphatase and lung function tests by measuring FVC, FEV1 , FEV1/FVC% , PEF, FEF 25-75% of both the groups.Results: In this study AST, ALT and alkaline phosphatase levels were found significantly (p<.05 higher in group B as compared to those of group A. Again, FVC, FEV1, FEV1/ FVC were significantly (p<.05 lower in group B as compared to those of group A. PEF (L/sec and FEF 25-75% were also significantly (p<0.001 lower in group B as compared to those of group A.Conclusion: it is concluded that chronic long term use of opium, increases the risk of hepatic and pulmonary damage.

  13. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  14. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  15. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  16. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  17. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  18. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  19. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  20. Fission track dating and uranium estimation in pegmatitic minerals of Rajasthan state (India)

    Energy Technology Data Exchange (ETDEWEB)

    Singh, S; Virk, H S [Punjabi Univ., Patiala (India). Dept. of Physics

    1978-12-01

    Fission track geochronology of muscovite samples collected from some pegmatitic mines of Bhilwara and Ajmer districts of Rajasthan state (India) has been discussed. The ages obtained suggest the occurrence of Delhi Orogenic Cycle as the last major metamorphic activity in the region. The atomic fraction of uranium in muscovite samples is less than 1 p.p.b.

  1. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  2. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  3. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Land use and second-generation biofuel feedstocks: The unconsidered impacts of Jatropha biodiesel in Rajasthan, India

    International Nuclear Information System (INIS)

    Findlater, K.M.; Kandlikar, M.

    2011-01-01

    Governments around the world see biofuels as a common solution to the multiple policy challenges posed by energy insecurity, climate change and falling farmer incomes. The Indian government has enthusiastically adopted a second-generation feedstock - the oilseed-bearing shrub, Jatropha curcas - for an ambitious national biodiesel program. Studies estimating the production capacity and potential land use implications of this program have typically assumed that the 'waste land' slated for Jatropha production has no economic value and that no activities of note will be displaced by plantation development. Here we examine the specific local impacts of rapid Jatropha plantation development on rural livelihoods and land use in Rajasthan, India. We find that in Jhadol Tehsil, Jatropha is planted on both government and private land, and has typically displaced grazing and forage collection. For those at the socioeconomic margins, these unconsidered impacts counteract the very benefits that the biofuel programs aim to create. The Rajasthan case demonstrates that local land-use impacts need to be integrated into decision-making for national targets and global biofuel promotion efforts. - Highlights: → Hardy biofuel crops like Jatropha replace edible feedstocks that use arable land. → In Rajasthan, Jatropha displaces grazing and forage on both public and private land. → As Jatropha plantations mature, the loss of grass becomes more pronounced. → Unconsidered impacts negate the benefits that the biodiesel program aims to create. → Local land-use impacts need to be integrated into decision-making.

  5. Land use and second-generation biofuel feedstocks: The unconsidered impacts of Jatropha biodiesel in Rajasthan, India

    Energy Technology Data Exchange (ETDEWEB)

    Findlater, K.M. [Institute for Resources Environment and Sustainability, University of British Columbia, 429-2202 Main Mall, Vancouver, BC, V6T1Z4 (Canada); Kandlikar, M., E-mail: milind.k@ubc.ca [Liu Institute for Global Studies, University of British Columbia, 6476 NW Marine Drive, Vancouver, BC, V6T1Z2 (Canada)

    2011-06-15

    Governments around the world see biofuels as a common solution to the multiple policy challenges posed by energy insecurity, climate change and falling farmer incomes. The Indian government has enthusiastically adopted a second-generation feedstock - the oilseed-bearing shrub, Jatropha curcas - for an ambitious national biodiesel program. Studies estimating the production capacity and potential land use implications of this program have typically assumed that the 'waste land' slated for Jatropha production has no economic value and that no activities of note will be displaced by plantation development. Here we examine the specific local impacts of rapid Jatropha plantation development on rural livelihoods and land use in Rajasthan, India. We find that in Jhadol Tehsil, Jatropha is planted on both government and private land, and has typically displaced grazing and forage collection. For those at the socioeconomic margins, these unconsidered impacts counteract the very benefits that the biofuel programs aim to create. The Rajasthan case demonstrates that local land-use impacts need to be integrated into decision-making for national targets and global biofuel promotion efforts. - Highlights: > Hardy biofuel crops like Jatropha replace edible feedstocks that use arable land. > In Rajasthan, Jatropha displaces grazing and forage on both public and private land. > As Jatropha plantations mature, the loss of grass becomes more pronounced. > Unconsidered impacts negate the benefits that the biodiesel program aims to create. > Local land-use impacts need to be integrated into decision-making.

  6. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  7. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  8. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  9. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant-soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  10. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  11. Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

    Science.gov (United States)

    Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

    2012-01-01

    The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Species boundaries and phylogenetic relationships in the critically endangered Asian box turtle genus Cuora.

    Science.gov (United States)

    Spinks, Phillip Q; Thomson, Robert C; Zhang, YaPing; Che, Jing; Wu, Yonghua; Shaffer, H Bradley

    2012-06-01

    Turtles are currently the most endangered major clade of vertebrates on earth, and Asian box turtles (Cuora) are in catastrophic decline. Effective management of this diverse turtle clade has been hampered by human-mediated, and perhaps natural hybridization, resulting in discordance between mitochondrial and nuclear markers and confusion regarding species boundaries and phylogenetic relationships among hypothesized species of Cuora. Here, we present analyses of mitochondrial and nuclear DNA data for all 12 currently hypothesized species to resolve both species boundaries and phylogenetic relationships. Our 15-gene, 40-individual nuclear data set was frequently in conflict with our mitochondrial data set; based on its general concordance with published morphological analyses and the strength of 15 independent estimates of evolutionary history, we interpret the nuclear data as representing the most reliable estimate of species boundaries and phylogeny of Cuora. Our results strongly reiterate the necessity of using multiple nuclear markers for phylogeny and species delimitation in these animals, including any form of DNA "barcoding", and point to Cuora as an important case study where reliance on mitochondrial DNA can lead to incorrect species identification. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. IAEA Leads Operational Safety Mission to Rajasthan Atomic Power Station 3 and 4

    International Nuclear Information System (INIS)

    2012-01-01

    Full text: An international team of nuclear safety experts led by the International Atomic Energy Agency (IAEA) today completed a review of safety practices at Units 3 and 4 of the Rajasthan Atomic Power Station in Rawatbhata. The team noted a series of good practices and made recommendations and suggestions to reinforce safety practices. The IAEA assembled the Operational Safety Review Team (OSART) at the request of the Government of India. Led by the IAEA's Division of Nuclear Installation Safety, the team performed an in-depth operational safety review from 29 October to 14 November 2012. The team was comprised of experts from Canada, Belgium, Finland, Germany, Romania, Slovakia, Slovenia, Sweden and the IAEA. The team conducted an in-depth review of the aspects essential to the safe operation of the Power Plant. The conclusions of the review are based on the IAEA's Safety Standards and good international practices. The review covered the areas of Management, Organization and Administration; Training; Operations; Maintenance; Technical Support; Operating Experience; Radiation Protection; Chemistry; Emergency Planning and Preparedness; and Severe Accident Management. The OSART team identified a number of good practices of the plant. These will be shared in due course by the IAEA with the global nuclear industry for consideration. Examples include the following: - The Power Plant's safety culture cultivates a constructive work environment and a sense of accountability among the Power Plant personnel, and gives its staff the opportunity to expand skills and training; - The Power Plant's Public Awareness Programme provides educational opportunities to the local community about nuclear and radiation safety; - The Power Plant has a Management of Training and Authorization system for effective management of training activities; and - The Power Plant uses testing facilities and mockups to improve the quality of maintenance work and to reduce radiation doses. The OSART

  14. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  15. Pattern of invasion by Adhatoda vasica in savannas of Sariska Tiger Reserve, Rajasthan, Western India

    NARCIS (Netherlands)

    Bhatt, Priyanka; Rawat, G.S.; Sankar, K.; Tomlinson, K.W.; Langevelde, van F.

    2015-01-01

    As part of global experiments on Savanna vegetation, we examined the ecological characteristics of an important
    semiarid savanna in the Indian sub-continent i.e Sariska Tiger Reserve, Rajasthan, Western India during April 2009 to
    May 2011. 149 plots across five line transects were sampled

  16. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  17. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  18. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  19. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  20. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  1. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  2. Comparative analysis of DNA polymorphisms and phylogenetic relationships among Syzygium cumini Skeels based on phenotypic characters and RAPD technique.

    Science.gov (United States)

    Singh, Jitendra P; Singh, Ak; Bajpai, Anju; Ahmad, Iffat Zareen

    2014-01-01

    The Indian black berry (Syzygium cumini Skeels) has a great nutraceutical and medicinal properties. As in other fruit crops, the fruit characteristics are important attributes for differentiation were also determined for different accessions of S. cumini. The fruit weight, length, breadth, length: breadth ratio, pulp weight, pulp content, seed weight and pulp: seed ratio significantly varied in different accessions. Molecular characterization was carried out using PCR based RAPD technique. Out of 80 RAPD primers, only 18 primers produced stable polymorphisms that were used to examine the phylogenetic relationship. A sum of 207 loci were generated out of which 201 loci found polymorphic. The average genetic dissimilarity was 97 per cent among jamun accessions. The phylogenetic relationship was also determined by principal coordinates analysis (PCoA) that explained 46.95 per cent cumulative variance. The two-dimensional PCoA analysis showed grouping of the different accessions that were plotted into four sub-plots, representing clustering of accessions. The UPGMA (r = 0.967) and NJ (r = 0.987) dendrogram constructed based on the dissimilarity matrix revealed a good degree of fit with the cophenetic correlation value. The dendrogram grouped the accessions into three main clusters according to their eco-geographical regions which given useful insight into their phylogenetic relationships.

  3. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  4. Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca

    2017-04-01

    The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.

  5. Traditional knowledge on zootherapeutic uses by the Saharia tribe of Rajasthan, India

    OpenAIRE

    Jaroli DP; Mahawar Madan

    2007-01-01

    Abstract The present zootherapeutic study describes the traditional knowledge related to the use of different animals and animal-derived products as medicines by the Saharia tribe reside in the Shahabad and Kishanganj Panchayat Samiti's of Baran district of Rajasthan, India. A field survey was conducted from April to June 2006 by performing interview through structured questionnaire with 21 selected respondents, who provided information regarding use of animals and their products in folk medi...

  6. Baseline radiological monitoring at proposed uranium prospecting site at Rohil Sikar, Rajasthan

    International Nuclear Information System (INIS)

    Kumar, Rajesh; Jha, V.N.; Sahoo, N.K.; Jha, S.K.; Tripathi, R.M.

    2018-01-01

    Once economically viable grades of uranium deposits are proposed for mining and processing by the industry radiological baseline studies are required for future comparison during operational phases. The information collected during such studies serve as connecting feature between regulatory compliance and technical information. Present paper summarizes the results of baseline monitoring of atmospheric 222 Rn and gamma level in the area at prospecting mining, milling and waste disposal sites of Rohil Rajasthan

  7. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  8. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  9. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  10. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  11. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  12. Phylogenetic Structure of Foliar Spectral Traits in Tropical Forest Canopies

    Directory of Open Access Journals (Sweden)

    Kelly M. McManus

    2016-02-01

    Full Text Available The Spectranomics approach to tropical forest remote sensing has established a link between foliar reflectance spectra and the phylogenetic composition of tropical canopy tree communities vis-à-vis the taxonomic organization of biochemical trait variation. However, a direct relationship between phylogenetic affiliation and foliar reflectance spectra of species has not been established. We sought to develop this relationship by quantifying the extent to which underlying patterns of phylogenetic structure drive interspecific variation among foliar reflectance spectra within three Neotropical canopy tree communities with varying levels of soil fertility. We interpreted the resulting spectral patterns of phylogenetic signal in the context of foliar biochemical traits that may contribute to the spectral-phylogenetic link. We utilized a multi-model ensemble to elucidate trait-spectral relationships, and quantified phylogenetic signal for spectral wavelengths and traits using Pagel’s lambda statistic. Foliar reflectance spectra showed evidence of phylogenetic influence primarily within the visible and shortwave infrared spectral regions. These regions were also selected by the multi-model ensemble as those most important to the quantitative prediction of several foliar biochemical traits. Patterns of phylogenetic organization of spectra and traits varied across sites and with soil fertility, indicative of the complex interactions between the environmental and phylogenetic controls underlying patterns of biodiversity.

  13. Assessment of Fluoride Level in Groundwater and Prevalence of Dental Fluorosis in Didwana Block of Nagaur District, Central Rajasthan, India

    Directory of Open Access Journals (Sweden)

    M Arif

    2013-10-01

    Full Text Available Background: In India, for the high concentration of fluoride in groundwater, people are at risk of dental fluorosis. The problem is common in various states of India. The condition in Rajasthan is worse where all districts have such a problem. Objective: To study the fluoride concentration in groundwater and prevalence of dental fluorosis in Didwana block of Nagaur district, Central Rajasthan, India. Methods: The fluoride concentration in water of 54 villages was measured electrochemically, using fluoride ion selective electrode. Dental fluorosis was assessed in 1136 people residing in study area by Dean's classification for dental fluorosis. Results: The fluoride concentration in groundwater in studied sites ranged from 0.5 to 8.5 mg/L. The concentration of fluoride was more than the maximum permissible limit set by WHO and Bureau of Indian Standards (1 mg/L in 48 groundwater sources. Of 1136 people studied, 788 (69.4%; 95% CI: 66.7%–72.1% had dental fluorosis—252 had mild and 74 had severe dental fluorosis. Conclusion: High level of fluoride in drinking water of Didwana block of Nagaur district, Central Rajasthan, India, causes dental fluorosis in most people in the region and is an important health problem that needs prompt attention.

  14. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Uranium and REE potential of the albitite-pyroxenite-microclinite belt of Rajasthan, India

    International Nuclear Information System (INIS)

    Singh, Govind; Sharma, D.K.; Yadav, O.P.; Jain, Rajan B.; Singh, Rajendra

    1998-01-01

    A number of radioactive albitite, pyroxenite and microclinite occurrences have been identified in north and central Rajasthan, along or in close proximity to major lineaments, from Dancholi - Mewara in the NE to Tal in the SW. With these new findings the total extent of Albitite belt of Rajasthan now stands at over 320 km. These occurrences have been evaluated on the basis of their U, Th and REE content to identify the potential areas for the second phase of uranium exploration programme. Further, based on the various characteristic features of radioactive host rocks, the Albitite Belt has been divided into five sectors. The U 3 O 8 content of albitites varies from 0.008 to 0.44% and of pyroxenites from 0.022 to 2.0% whereas ThO 2 varies from < 0.005 to 0.83% in albitites and <0.005 to 0.033% in pyroxenities. These albitites, microclinites and pyroxenites are also characterised by anomalous concentration of REEs. Uranium and REE bearing phases are represented by uraninite, brannerite, davidite, fergusonite, monazite, anatase, rutile, zircon, allanite and britholite. The data accrued so far suggest that U and REE potential of the Mewara-Maonda and Hurra Ki Dhani-Rohil sectors are very high and hence needs further detailed integrated exploration. (author)

  16. ["Long-branch Attraction" artifact in phylogenetic reconstruction].

    Science.gov (United States)

    Li, Yi-Wei; Yu, Li; Zhang, Ya-Ping

    2007-06-01

    Phylogenetic reconstruction among various organisms not only helps understand their evolutionary history but also reveal several fundamental evolutionary questions. Understanding of the evolutionary relationships among organisms establishes the foundation for the investigations of other biological disciplines. However, almost all the widely used phylogenetic methods have limitations which fail to eliminate systematic errors effectively, preventing the reconstruction of true organismal relationships. "Long-branch Attraction" (LBA) artifact is one of the most disturbing factors in phylogenetic reconstruction. In this review, the conception and analytic method as well as the avoidance strategy of LBA were summarized. In addition, several typical examples were provided. The approach to avoid and resolve LBA artifact has been discussed.

  17. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  18. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  19. Reproductive health and empowerment -- a Rajasthan perspective.

    Science.gov (United States)

    Pal, P; Joshi, V

    1996-01-01

    Reproductive health is one of the major issues of current feminist debates. The issue was brought to light because of population control policies which are being enforced through women's bodies and the spread of HIV/AIDS. In this context, women's organizations and activists are trying to focus upon the issue of reproductive health as part of the larger issue of the position of women in families, societies, and states. Policy makers and donor agencies are trying to address the problem as lack of awareness and knowledge of how to use contraceptives. The authors argue in this situation that it is important to study reproductive health relative to the status of women in society. This paper looks at the existing social construct of patriarchy and population control policies in relation to reproductive health. Women and self, the reproductive role of women, preference for male children, family planning decision making, family planning programs and reproductive health, and the Vikalp program in two districts of Rajasthan are discussed.

  20. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  1. Phylogenetic system and zoogeography of the Plecoptera.

    Science.gov (United States)

    Zwick, P

    2000-01-01

    Information about the phylogenetic relationships of Plecoptera is summarized. The few characters supporting monophyly of the order are outlined. Several characters of possible significance for the search for the closest relatives of the stoneflies are discussed, but the sister-group of the order remains unknown. Numerous characters supporting the presently recognized phylogenetic system of Plecoptera are presented, alternative classifications are discussed, and suggestions for future studies are made. Notes on zoogeography are appended. The order as such is old (Permian fossils), but phylogenetic relationships and global distribution patterns suggest that evolution of the extant suborders started with the breakup of Pangaea. There is evidence of extensive recent speciation in all parts of the world.

  2. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  3. Medicinal plant diversity of Sitamata wildlife sanctuary, Rajasthan, India.

    Science.gov (United States)

    Jain, Anita; Katewa, S S; Galav, P K; Sharma, Pallavi

    2005-11-14

    The present study has been carried out in Sitamata wildlife sanctuary of Chittorgarh and Udaipur district located in south-west region of Rajasthan. A field survey of the study area was carried out during 2002-2004 to document the medicinal utility of herbs occurring in this area. Two hundred fourty-three genera belonging to 76 families have been reported which are used by the tribals of about 50 villages around the sanctuary as means of primary health care to cure various ailments. The study revealed the new ethnobotanical uses of 24 plant species belonging to 20 genera. A list of plant species along with their local name, plant part/s used and mode of administration for effective control in different ailments of ethnomedicinal plants are given.

  4. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  5. PHYLOGENETIC RELATIONSHIPS AMONG VIETNAMESE COCOA ACCESSIONS USING A NON-CODING REGION OF THE CHLOROPLAST DNA

    OpenAIRE

    Lam Thi, Viet Ha; D.T., Khang; Everaert, Helena; T.N, Dung; P.H.D, Phuoc; H.T., Toan; Dewettinck, Koen; Messens, Kathy

    2017-01-01

    Cocoa (Theobroma cacao L.) cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes that are imported and cultivated in Vietnam based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected f...

  6. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  7. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  8. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  9. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  10. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  11. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  12. Assisting community management of groundwater: Irrigator attitudes in two watersheds in Rajasthan and Gujarat, India

    Science.gov (United States)

    Varua, M. E.; Ward, J.; Maheshwari, B.; Oza, S.; Purohit, R.; Hakimuddin; Chinnasamy, P.

    2016-06-01

    The absence of either state regulations or markets to coordinate the operation of individual wells has focussed attention on community level institutions as the primary loci for sustainable groundwater management in Rajasthan and Gujarat, India. The reported research relied on theoretical propositions that livelihood strategies, groundwater management and the propensity to cooperate are associated with the attitudinal orientations of well owners in the Meghraj and Dharta watersheds, located in Gujarat and Rajasthan respectively. The research tested the hypothesis that attitudes to groundwater management and farming practices, household income and trust levels of assisting agencies were not consistent across the watersheds, implying that a targeted approach, in contrast to default uniform programs, would assist communities craft rules to manage groundwater across multiple hydro-geological settings. Hierarchical cluster analysis of attitudes held by survey respondents revealed four statistically significant discrete clusters, supporting acceptance of the hypothesis. Further analyses revealed significant differences in farming practices, household wealth and willingness to adapt across the four groundwater management clusters. In conclusion, the need to account for attitudinal diversity is highlighted and a framework to guide the specific design of processes to assist communities craft coordinating instruments to sustainably manage local aquifers described.

  13. Economics of Garlic Production in Baran District of Rajasthan; Break Even Analysis

    OpenAIRE

    Meena, Lokesh Kumar; Sen, Chandra; Bairwa, Shoji lal; Arunjhajharia; Raghuwanshi, N. K.

    2013-01-01

    The study focuses on economic analysis of garlic production in the Baran District of Rajasthan. The study is carried out to determine break even analysis and constraints of garlic production in the study area. Break even analysis is carried out to arrive at that minimum level at which optimum conditions of cost and returns is equated that is no profit no loss point. In this study selected small, medium and large farmers will not be at loss even if their actual yield of garlic is decline by 56...

  14. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  16. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  17. Uranium exploration in albitised rocks of North Delhi Fold Belt in Rajasthan and Haryana, India

    International Nuclear Information System (INIS)

    Pandey, P.; Khandelwal, M.; Bhairam, C.; Parihar, P.

    2014-01-01

    Uranium deposits in Na-metasomatised granites and metasediments are reported from several places in the world. In India, uranium mineralization associated with soda metasomatic activity has been recognized at a number of places in North Delhi Fold Belt (NDFB) in Rajasthan and adjoining Haryana. Exploration activities for uranium in Khetri Sub Basin (KSB) of North Delhi Fold Belt (NDFB) in last six decades have resulted in locating number of uranium occurrences in the albitites and albitised metasediments at Sior, Siswali, Maonda, Hurra ki Dhani, Diara, Saladipura, Khandela, Rohil, Ghateshwar, Bichun, Sakhun, Ladera and Chota Udaipur in parts of Rajasthan and Dhancholi, Raghunathpura, Rambas and Gorir, in parts of Haryana. Incidentally, the occurrences fall along a NNE-SSW trending “Albitite line”, which comprises a 170 km long, structurally weak zone/lineament and axial trace of major folds in the KSB extending from Raghunathpura in Mahendragarh district of southern Haryana to Ladera-Sakun-Bichun in Rajasthan. Lithounits of KSB comprise lower Alwar Group consisting quartzite, amphibole quartzite, subordinate phyllite and schist and upper Ajabgarh Group consisting schist, phyllite, marble, quartzite and carbon phyllite. The post-Delhi magmatic activity in NDFB is represented by alkali granites, pegmatites, aplites and albitites. The rocks of Delhi supergroup have undergone low to medium grade metamorphism (amphibolite facies) and polyphase deformation. First two deformations with N-S to NNE-SSW axial plane are coaxial while the third phase have E-W axial plane. Prominent shear zones are developed along the N-S to NNE-SSW axial planes, characterized by intense silicification, brecciation and ferruginisation. The NE-SW trending disposition of albitised granites indicate that the metasomatic fluids originated during reactivation of the NE-SW trending Khetri lineament, caused pervasive albitisation of the preexisting rocks, the deformed lithounits providing conduits

  18. A status survey of common water-borne diseases in desert city Bikaner (NW Rajasthan, India).

    Science.gov (United States)

    Saxena, M M; Chhabra, Chetna

    2004-03-01

    Water is scarce and, in general, a low quality resource in desert areas and the Indian desert is no exception. With this in view, the present study was taken up to survey the status of common water-borne diseases epidemiological trends in the desert city Bikaner (NW Rajasthan). In the city, 15.5 per cent population and 44.5 per cent families were found to suffer from one or more common water-borne diseases including amoebiasis, diarrhoea, dysentery, jaundice and typhoid. No case of fluorosis was recorded. The highest incidence was that of diarrhoea (5.4 per cent population). The worst affected and safe zones in the city were identified and the trends of different diseases in different zones of the city are discussed. The highest incidence of diseases was noted during summer (58.8 per cent) followed by winter (34.1 per cent) and monsoon (7.0 per cent). Relationship of diseases with population attributes like age, education, economy and family size are also discussed. Attributes for contamination of drinking water have been tried to identify and safety measures suggested.

  19. Disentangling the phylogenetic and ecological components of spider phenotypic variation.

    Science.gov (United States)

    Gonçalves-Souza, Thiago; Diniz-Filho, José Alexandre Felizola; Romero, Gustavo Quevedo

    2014-01-01

    An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables) to the variation in spider body size and shape by comparing spiders at different scales: (i) between bromeliads and dicot plants (i.e., habitat scale) and (ii) among bromeliads with distinct architectural features (i.e., microhabitat scale). We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species) and ecological components (that express trait values independent of phylogenetic relationships). At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.

  20. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  1. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  2. A program to compute the soft Robinson-Foulds distance between phylogenetic networks.

    Science.gov (United States)

    Lu, Bingxin; Zhang, Louxin; Leong, Hon Wai

    2017-03-14

    Over the past two decades, phylogenetic networks have been studied to model reticulate evolutionary events. The relationships among phylogenetic networks, phylogenetic trees and clusters serve as the basis for reconstruction and comparison of phylogenetic networks. To understand these relationships, two problems are raised: the tree containment problem, which asks whether a phylogenetic tree is displayed in a phylogenetic network, and the cluster containment problem, which asks whether a cluster is represented at a node in a phylogenetic network. Both the problems are NP-complete. A fast exponential-time algorithm for the cluster containment problem on arbitrary networks is developed and implemented in C. The resulting program is further extended into a computer program for fast computation of the Soft Robinson-Foulds distance between phylogenetic networks. Two computer programs are developed for facilitating reconstruction and validation of phylogenetic network models in evolutionary and comparative genomics. Our simulation tests indicated that they are fast enough for use in practice. Additionally, the distribution of the Soft Robinson-Foulds distance between phylogenetic networks is demonstrated to be unlikely normal by our simulation data.

  3. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  4. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  5. Proterozoic rifting and major unconformities in Rajasthan, and their implications for uranium mineralisation

    International Nuclear Information System (INIS)

    Sinha-Roy, S.

    2004-01-01

    Evolution of the Precambrian terrain in Rajasthan has taken place via crustal consolidation of the basement at ca. 2.9 Ga, its cratonisation at ca. 2.5 Ga, through protracted tectonostratigraphic evolution of the Proterozoic cover sequences, following repeated rifting and Wilson cycles in the Aravalli and Delhi foldbelts. Consequently, the Proterozoic rift basins are characterised by growth faults and pull-aparts, and multitier volcanose dimentary sequences that contain a number of unconformities and stratigraphic breaks. The Archaean basement of the Mewar terrain that witnessed end-Archaean K-magmatism and ductile shearing, led to the creation of a possible uranium province, namely uranium enriched basement. This province acted as the source of remobilised uranium and its concentration at suitable multilevel structural and stratigraphic traps within the Proterozoic rift basins to give rise to unconformity-related syngenetic uranium mineralisation. Late Neoproterozoic to Pan-African tectonothermal reworking of the basement rocks produced fracture zones and caused Na-metasomatism giving rise to albitite-related uranium mineralisation. Based on an analysis of Proterozoic rift kinematics and lithofacies characteristics, five possible uranium-enriched stratigraphic horizons have been identified in the Aravalli and its equivalent sequences as well as in the North Delhi foldbelt sequences. From a regional synthesis, ten possible uranium metallogenic events, spanning ca. 2.5-0.5 Ga, are recognised in Rajasthan. These uranium events have predictive value for delineation of target areas for exploration. (author)

  6. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  7. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Biotech Unit

    2013-02-27

    Feb 27, 2013 ... Phylogenetic analysis of Chaetomium species. The evolutionary history was inferred using the maximum parsimony method. The bootstrap consensus tree inferred from. 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). The MP tree was obtained using.

  8. A Comparative Study of Job Satisfaction among Management Teachers of MBA Colleges in South Rajasthan

    Directory of Open Access Journals (Sweden)

    Anil K. Bhatt

    2015-03-01

    Full Text Available Management teaching is a noble profession, a continuous process and indicator of economic and social development. The management teachers are the pre-requisite of the success of management programmes, their role in society has been increasing with the rapid growth of trade and finance in the whole world. Society is continuously observing Management teachers while there are various concerns in their role and their satisfaction. Only satisfied and well-adjusted management teacher can think of the wellbeing of the future managers. The major source of satisfaction for the management teachers comes from their own institution, also known as hygiene factors. In the light of this background, the aim of this study is to analyze the job satisfaction level among the MBA teachers in selected management colleges of south Rajasthan. For this purpose, the Job related hygiene factors were identified and then the satisfactions of 220 management teachers were sought on various dimensions. The data were analysed by using multiple regression and ANOVA analysis with SPSS-19 software to identify the factors responsible for satisfaction. The analysis revealed that three factors Physical Teaching condition, Flexible working hours and Environment providing hint of Job Security revealed the job satisfaction in Management teachers of South Rajasthan.

  9. Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae).

    Science.gov (United States)

    Davis, Brian W; Li, Gang; Murphy, William J

    2010-07-01

    The pantherine lineage of cats diverged from the remainder of modern Felidae less than 11 million years ago and consists of the five big cats of the genus Panthera, the lion, tiger, jaguar, leopard, and snow leopard, as well as the closely related clouded leopard. A significant problem exists with respect to the precise phylogeny of these highly threatened great cats. Despite multiple publications on the subject, no two molecular studies have reconstructed Panthera with the same topology. These evolutionary relationships remain unresolved partially due to the recent and rapid radiation of pantherines in the Pliocene, individual speciation events occurring within less than 1 million years, and probable introgression between lineages following their divergence. We provide an alternative, highly supported interpretation of the evolutionary history of the pantherine lineage using novel and published DNA sequence data from the autosomes, both sex chromosomes and the mitochondrial genome. New sequences were generated for 39 single-copy regions of the felid Y chromosome, as well as four mitochondrial and four autosomal gene segments, totaling 28.7 kb. Phylogenetic analysis of these new data, combined with all published data in GenBank, highlighted the prevalence of phylogenetic disparities stemming either from the amplification of a mitochondrial to nuclear translocation event (numt), or errors in species identification. Our 47.6 kb combined dataset was analyzed as a supermatrix and with respect to individual partitions using maximum likelihood and Bayesian phylogenetic inference, in conjunction with Bayesian Estimation of Species Trees (BEST) which accounts for heterogeneous gene histories. Our results yield a robust consensus topology supporting the monophyly of lion and leopard, with jaguar sister to these species, as well as a sister species relationship of tiger and snow leopard. These results highlight new avenues for the study of speciation genomics and

  10. Phylogenetic community structure: temporal variation in fish assemblage

    OpenAIRE

    Santorelli, Sergio; Magnusson, William; Ferreira, Efrem; Caramaschi, Erica; Zuanon, Jansen; Amadio, Sidnéia

    2014-01-01

    Hypotheses about phylogenetic relationships among species allow inferences about the mechanisms that affect species coexistence. Nevertheless, most studies assume that phylogenetic patterns identified are stable over time. We used data on monthly samples of fish from a single lake over 10 years to show that the structure in phylogenetic assemblages varies over time and conclusions depend heavily on the time scale investigated. The data set was organized in guild structures and temporal scales...

  11. On the information content of discrete phylogenetic characters.

    Science.gov (United States)

    Bordewich, Magnus; Deutschmann, Ina Maria; Fischer, Mareike; Kasbohm, Elisa; Semple, Charles; Steel, Mike

    2017-12-16

    Phylogenetic inference aims to reconstruct the evolutionary relationships of different species based on genetic (or other) data. Discrete characters are a particular type of data, which contain information on how the species should be grouped together. However, it has long been known that some characters contain more information than others. For instance, a character that assigns the same state to each species groups all of them together and so provides no insight into the relationships of the species considered. At the other extreme, a character that assigns a different state to each species also conveys no phylogenetic signal. In this manuscript, we study a natural combinatorial measure of the information content of an individual character and analyse properties of characters that provide the maximum phylogenetic information, particularly, the number of states such a character uses and how the different states have to be distributed among the species or taxa of the phylogenetic tree.

  12. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  13. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  14. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  15. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  16. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  17. Impact of micronutrients sprinkle on weight and height of children aged 6-36 months in Tonk district of Rajasthan state

    Directory of Open Access Journals (Sweden)

    Vijay Jyoti

    2014-12-01

    Full Text Available Introduction: In India, multiple micronutrient deficiencies continue to be a major public health problem, especially for children below three years of age. It is a crucial period for the growth and development of children. There is lack of data from Rajasthan state on the effect of micronutrients supplementation on growth of children below three years of age. Aims & Objectives: To assess the impact of ICDS supplementary food with or without micronutrients sprinkles on weight and height of children aged 6-36 months in the Tonk district, Rajasthan state. Materials & Methods: The trial was conducted in the 15 Angan wadi centers, each from Tonk (rural and Malpura blocks of Tonk District in Rajasthan state. Children from both blocks were considered as experimental and control groups. Experimental (N=790 and Control groups (N=540 received ICDS supplementary food for six months with or without micronutrients sprinkles. Anthropometric measurements were taken using standard techniques. Results: At baseline, children with severe underweight, severe stunting and severe wasting in experimental group stood at 19.2%, 19.3%, 7.3%, respectively, which declined to 14.9%, 15.3% and 6.3%, after intervention. Significant difference was observed in the mean weights of post intervention children between experimental and control groups, whereas, there was no significant difference in mean heights. In experimental group, statistical significant difference was also noted in the mean weights and heights of children between pre and post intervention periods. Conclusion: Micronutrients sprinkles can be effective in reducing malnutrition amongst vulnerable population.

  18. Neglected health literacy undermining fluorosis control efforts: A pilot study among schoolchildren in an endemic village of rural Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Neeti Rustagi

    2017-01-01

    Full Text Available Background: Ingestion of excess fluoride can cause fluorosis which adversely affects teeth and bones. Fluorosis is a major public health problem in the state of Rajasthan with all its 32 districts having variable fluoride contamination, and many initiatives are currently implemented in this region to mitigate the fluorosis burden. Objective: The objective of this study was to assess fluorosis, its risk factors, and the awareness among school students and teachers in endemic villages of Jodhpur district, Rajasthan. Materials and Methods: A representative sample of 300 students of age 12–15 years were enrolled for cross-sectional study in selected villages. Data were collected regarding awareness, behavioral and preventive practices about fluorosis and clinical assessment and fluoride estimation in water and urine samples was done. Results: Dental fluorosis through Dean's index was observed in 24.5% of students. The awareness and practices for fluorosis prevention and its risk factors were poor among both students and teachers. Intake of piped water supply was reported by majority of students (95.8%. High fluoride concentration was found in 35 (81.3% out of 43 urine samples. Conclusion: Improvement in drinking water supply in the endemic village of Rajasthan has decreased the burden of fluorosis, but low level of awareness and prevailing dietary and behavioral practices still pose them at risk of high fluoride intake. This signifies the need to address nonconventional sources of fluoride intake (diet and toothpaste and early screening of disease by involving teachers and family physicians in fluoride mitigation efforts.

  19. Phylogenetic congruence between subtropical trees and their associated fungi

    NARCIS (Netherlands)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S.; Gilbert, Gregory S; Yu, Shixiao

    2016-01-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi

  20. Phylogenetic relationships of the glycoprotein gene of bovine ephemeral fever virus isolated from mainland China, Taiwan, Japan, Turkey, Israel and Australia

    Directory of Open Access Journals (Sweden)

    Zheng Fuying

    2012-11-01

    Full Text Available Abstract Background The glycoprotein (G gene sequences of bovine ephemeral fever virus (BEFV strains derived from mainland China have not been compared with those of the isolates from other countries or areas. Therefore, the G genes of four BEFV isolates obtained from mainland China were amplified and sequenced. A phylogenetic tree was constructed in order to compare and analyze the genetic relationships of the BEFV isolates derived from mainland China and different countries and areas. Results The complete BEFV G gene was successfully amplified and sequenced from four isolates that originated from mainland China. A total of fifty-one BEFV strains were analyzed based on the G gene sequence and were found to be highly conserved. A phylogenetic tree showed that the isolates were grouped into three distinct lineages depending on their source of origin. The antigenic sites of G1, G2 and G3 are conserved among the isolates, except for several substitutions in a few strains. Conclusions The phylogenetic relationships of the BEFV isolates that originated from mainland China, Taiwan, Japan, Turkey, Israel and Australia were closely related to their source of origin, while the antigenic sites G1, G2 and G3 are conserved among the BEFV isolates used in this work.

  1. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  2. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  3. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  4. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  5. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    Science.gov (United States)

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  6. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  7. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  8. Phylogenetic Paleoecology: Tree-Thinking and Ecology in Deep Time.

    Science.gov (United States)

    Lamsdell, James C; Congreve, Curtis R; Hopkins, Melanie J; Krug, Andrew Z; Patzkowsky, Mark E

    2017-06-01

    The new and emerging field of phylogenetic paleoecology leverages the evolutionary relationships among species to explain temporal and spatial changes in species diversity, abundance, and distribution in deep time. This field is poised for rapid progress as knowledge of the evolutionary relationships among fossil species continues to expand. In particular, this approach will lend new insights to many of the longstanding questions in evolutionary biology, such as: the relationships among character change, ecology, and evolutionary rates; the processes that determine the evolutionary relationships among species within communities and along environmental gradients; and the phylogenetic signal underlying ecological selectivity in background and mass extinctions and in major evolutionary radiations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Awareness of workplace hazards and preventive measures among sandstone mineworkers in Rajasthan, India: A cross-sectional study

    Directory of Open Access Journals (Sweden)

    Absar Ahmad

    2017-03-01

    Full Text Available Objective: The aim of this study was to assess awareness of workplace hazards and personal protective equipments (PPEs among mineworkers employed in a sandstone quarry in Rajasthan, India. Materials and Methods: A cross-sectional study of 218 miners was conducted in Karauli, Rajasthan, India. We used a standardized semi-structured questionnaire that was administered to each subject by face-to-face interviews. Descriptive statistics and Pearson chi-square test were used to show frequency distributions and associations between variables. Results: Almost all respondents were aware of at least one hazard in mining occupation (93.6%, but no of them was trained by a recent (within 1 year health and safety training course. However, mineworkers recognized only the risk of injury (74.3% and exposure to crystalline silica dust (40.4%. A high percentage of mineworkers were aware of PPEs (87.6%, but an only 16.5% of them used PPEs during their employment. The only PPEs mentioned by mineworkers was the dust protective mask. Occurrence of at least one occupational injury during work-life was associated with use of dust masks, while work-related diseases were associated with a low level of education, underweight (BMI < 18.5 kg/m2, and current smoking. Awareness of workplace hazards was associated with age less than 60, young age of starting work in mines (< 30 years, hours work per day (< 8 hr, and no availability of drinking water facility. Failure to use PPEs at work was statistically significant associated with belonging to scheduled castes or scheduled tribes, lower distance from home to workplace (1‒3 Km, hours work per day (< 8 hr, and no availability of safe drinking water. Discussion and Conclusion: In Rajasthan, India, there is a certain level of awareness about workplace hazards but usage of PPEs by sandstone mineworkers is very low. Policy makers should implement health and safety training programmes to promote use of PPEs among mine workers.

  10. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  11. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  13. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  14. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  15. ESTIMATION OF EXTRACELLULAR LIPOLYTIC ENZYME ACTIVITY BY THERMOPHILIC BACILLUS SP. ISOLATED FROM ARID AND SEMI-ARID REGION OF RAJASTHAN, INDIA

    Directory of Open Access Journals (Sweden)

    Deeksha Gaur

    2012-10-01

    Full Text Available Thermophilic organisms can be defined as, micro-organisms which are adapted to survive at high temperatures. The enzymes secreted by thermophilic bacteria are capable of catalyzing biochemical reactions at high temperatures. Thermophilic bacteria are able to produce thermostable lipolytic enzymes (capable of degradation of lipid at temperatures higher than mesophilic bacteria. Therefore, the isolation of thermophilic bacteria from natural sources and their identification are quite beneficial in terms of discovering thermostable lipase enzymes. Due to great temperature fluctuation in hot arid and semi-arid region of Rajasthan, this area could serve as a good source for new thermophilic lipase producing bacteria with novel industrially important properties. The main objective of this research is the isolation and estimation of industrially important thermophilic lipase enzyme produced by thermophilic bacteria, isolated from arid and semi-arid region of Rajasthan. For this research purpose soil samples were collected from Churu, Sikar and Jhunjunu regions of Rajasthan. Total 16 bacterial strains were isolated and among only 2 thermostable lipolytic enzyme producing bacteria were charcterized. The thermostable lipolytic enzyme was estimated by qualitative and quantitative experiments. The isolates were identified as Bacillus sp. by microscopic, biochemical and molecular characterization. The optimum enzyme activity was observed at pH 8, temperature 60°C and 6% salt concentrations at 24 hrs time duration. Lipolytic enzyme find useful in a variety of biotechnological fields such as food and dairy (cheese ripening, flavour development, detergent, pharmaceutical (naproxen, ibuprofen, agrochemical (insecticide, pesticide and oleochemical (fat and oil hydrolysis, biosurfactant synthesis industries. Lipolytic enzyme can be further used in many newer areas where they can serve as potential biocatalysts.

  16. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  17. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  18. Evolution of the brain and phylogenetic development of Mrican ...

    African Journals Online (AJOL)

    Evolution of the brain and phylogenetic development of Mrican Bovidae. Henriette Oboussier. Zoological Institute and Museum, University of Hamburg. Evidence drawn from the study of 270 brains of 54 species and subspecies of African Bovidae makes it possible to base phylogenetic relationships on the similarities in the ...

  19. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  20. Biogeographic links between southern Atlantic Forest and western South America: Rediscovery, re-description, and phylogenetic relationships of two rare montane anole lizards from Brazil.

    Science.gov (United States)

    Prates, Ivan; Melo-Sampaio, Paulo Roberto; Drummond, Leandro de Oliveira; Teixeira, Mauro; Rodrigues, Miguel Trefaut; Carnaval, Ana Carolina

    2017-08-01

    Data on species ranges and phylogenetic relationships are key in historical biogeographical inference. In South America, our understanding of the evolutionary processes that underlie biodiversity patterns varies greatly across regions. Little is known, for instance, about the drivers of high endemism in the southern montane region of the Atlantic Rainforest. In this region, former biogeographic connections with other South American ecosystems have been invoked to explain the phylogenetic affinities of a number of endemic taxa. This may also be the case of the montane anole lizards Anolis nasofrontalis and A. pseudotigrinus, known from few specimens collected more than 40years ago. We combine new genetic data with published sequences of species in the Dactyloa clade of Anolis to investigate the phylogenetic relationships of A. nasofrontalis and A. pseudotigrinus, as well as estimate divergence times from their closest relatives. Based on newly sampled and previously overlooked specimens, we provide a taxonomic re-description of those two taxa. Our phylogenetic analysis recovered six main clades within Dactyloa, five of which were previously referred to as species series (aequatorialis, heterodermus, latifrons, punctatus, roquet). A sixth clade clustered A. nasofrontalis and A. pseudotigrinus with A. dissimilis from western Amazonia, A. calimae from the Andes, A. neblininus from the Guiana Shield, and two undescribed Andean taxa. We therefore define a sixth species series within Dactyloa: the neblininus series. Close phylogenetic relationships between highly disjunct, narrowly-distributed anoles suggest that patches of suitable habitat connected the southern Atlantic Forest to western South America during the Miocene, in agreement with the age of former connections between the central Andes and the Brazilian Shield as a result of Andean orogeny. The data also support the view of recurrent evolution (or loss) of a twig anole-like phenotype in mainland anoles, in

  1. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  2. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  3. Thermo Gravimetric and Differential Thermal Analysis of Clay of Western Rajasthan (india)

    Science.gov (United States)

    Shekhawat, M. S.

    The paper presents the study of thermo gravimetric and differential thermal analysis of blended clay. Western part of Rajasthan (India) is rich resource of Ball clays and it is mainly used by porcelain, sanitary ware, and tile industry. The quality and grade of clay available in the region vary from one deposit to other. To upgrade the fired colour and strength properties, different variety of clays may be blended together. The paper compares the results of thermal analysis one of blended clay B2 with reference clay of Ukraine which is imported by industries owners. The result revealed that the blended clay is having mineral kaolinite while the Ukrainian clay is Halloysite.

  4. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  5. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  6. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  7. Quartet-net: a quartet-based method to reconstruct phylogenetic networks.

    Science.gov (United States)

    Yang, Jialiang; Grünewald, Stefan; Wan, Xiu-Feng

    2013-05-01

    Phylogenetic networks can model reticulate evolutionary events such as hybridization, recombination, and horizontal gene transfer. However, reconstructing such networks is not trivial. Popular character-based methods are computationally inefficient, whereas distance-based methods cannot guarantee reconstruction accuracy because pairwise genetic distances only reflect partial information about a reticulate phylogeny. To balance accuracy and computational efficiency, here we introduce a quartet-based method to construct a phylogenetic network from a multiple sequence alignment. Unlike distances that only reflect the relationship between a pair of taxa, quartets contain information on the relationships among four taxa; these quartets provide adequate capacity to infer a more accurate phylogenetic network. In applications to simulated and biological data sets, we demonstrate that this novel method is robust and effective in reconstructing reticulate evolutionary events and it has the potential to infer more accurate phylogenetic distances than other conventional phylogenetic network construction methods such as Neighbor-Joining, Neighbor-Net, and Split Decomposition. This method can be used in constructing phylogenetic networks from simple evolutionary events involving a few reticulate events to complex evolutionary histories involving a large number of reticulate events. A software called "Quartet-Net" is implemented and available at http://sysbio.cvm.msstate.edu/QuartetNet/.

  8. Performance of on-power fuelling equipment at Rajasthan Atomic Power Station

    International Nuclear Information System (INIS)

    Jayabarathan, S.; Gopalakrishnan, S.

    1977-01-01

    Natural uranium reactors on account of their intrinsically low reactivity need frequent refuelling. The Rajasthan Atomic Power Station based on natural uranium reactors has, therefore, been provided with on-power fuel handling system which was installed in 1972. Its performance has met the design intent and operational objectives which are enumerated. However, continuous fuelling 7 to 10 days has not been possible because frequent maintenance of refuelling system is needed on account of certain deficiencies major of which is the heavy water leakage. For better performance, installation of a programmable logic controller is suggested. Mention has also been made of inadequate number of skilled man-power required for maintenance which leads to quick depletion of man-rem of all the available personnel trained for maintenance work. (M.G.B.)

  9. Assessment of tritium dose around Rajasthan Atomic Power Station (1989-1997)

    International Nuclear Information System (INIS)

    Verma, P.C.; Vijaykumar, B.; George, Thomas; Sankhla, Rajesh; Roy, Alpana; Vyas, P.V.; Gurg, R.P.

    1999-01-01

    Tritium monitoring in the atmospheric and aquatic environment forms an integral part of the environmental radiological measurements conducted around PHWR type Nuclear Power Plant sites as tritium is one of the predominantly produced radionuclides in such systems. This paper presents the tritium concentration levels in the atmospheric and aquatic environs of Rajasthan Atomic Power Station (RAPS) during 1989-1997. The committed effective doses due to tritium are computed on annual basis for different radial zones around RAPS. It is observed that the maximum dose due to tritium at 1.6 km post fence has been less than 1% of the dose limit (1 mSv) set by regulatory body for the members of the public and beyond 5 km distance it is only 0.4% of the limit. (author)

  10. Factors Influencing Institutional-Based Pediatric Rehabilitation Services among Caregivers of Children with Developmental Delay in Southwestern Rajasthan

    OpenAIRE

    Mishra, Kriti; Siddharth, V.

    2018-01-01

    Context: A limited number of caregivers of children with developmental delay access rehabilitation facilities in India. The study explored utilization of rehabilitation services at a tertiary care setup in southwestern Rajasthan and various factors influencing it. Aims: The aim of this study is to explore rehabilitation service utilization among children with developmental delay at a tertiary care setup and to ascertain factors that influence this pattern. Settings: This study was conducted a...

  11. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  12. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  13. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  14. Forest structure, diversity and soil properties in a dry tropical forest in Rajasthan, Western India

    OpenAIRE

    J. I. Nirmal Kumar,; Kanti Patel,; Rohit Bhoi Kumar

    2011-01-01

    Structure, species composition, and soil properties of a dry tropical forest in Rajasthan Western India, were examined by establishment of 25 plots. The forest was characterized by a relatively low canopy and a large number of small-diameter trees. Mean canopy height for this forest was 10 m and stands contained an average of 995 stems ha-1 (≥ 3.0 cm DBH); 52% of those stems were smaller than 10 cm DBH. The total basal area was 46.35 m2ha-1, of which Tectona grandis L. contributed 48%. The fo...

  15. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  16. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Inequities in coverage of preventive child health interventions: the rural drinking water supply program and the universal immunization program in Rajasthan, India.

    Science.gov (United States)

    Mohan, Pavitra

    2005-02-01

    I assessed whether the Rural Drinking Water Supply Program (RDWSP) and the Universal Immunization Program (UIP) have achieved equitable coverage in Rajasthan, India, and explored program characteristics that affect equitable coverage of preventive health interventions. A total of 2460 children presenting at 12 primary health facilities in one district of Rajasthan were enrolled and classified into economic quartiles based on possession of assets. Immunization coverage and prime source of drinking water were compared across quartiles. A higher access to piped water by wealthier families (P< .001) was compensated by higher access to hand pumps by poorer families (P<.001), resulting in equal access to a safe source (P=.9). Immunization coverage was inequitable, favoring the wealthier children (P<.001). The RDWSP has achieved equitable coverage, while UIP coverage remains highly inequitable. Programs can make coverage more equitable by formulating explicit objectives to ensure physical access to all, promoting the intervention's demand by the poor, and enhancing the support and monitoring of frontline workers who deliver these interventions.

  18. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  19. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  20. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  1. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  2. Predicting rates of interspecific interaction from phylogenetic trees.

    Science.gov (United States)

    Nuismer, Scott L; Harmon, Luke J

    2015-01-01

    Integrating phylogenetic information can potentially improve our ability to explain species' traits, patterns of community assembly, the network structure of communities, and ecosystem function. In this study, we use mathematical models to explore the ecological and evolutionary factors that modulate the explanatory power of phylogenetic information for communities of species that interact within a single trophic level. We find that phylogenetic relationships among species can influence trait evolution and rates of interaction among species, but only under particular models of species interaction. For example, when interactions within communities are mediated by a mechanism of phenotype matching, phylogenetic trees make specific predictions about trait evolution and rates of interaction. In contrast, if interactions within a community depend on a mechanism of phenotype differences, phylogenetic information has little, if any, predictive power for trait evolution and interaction rate. Together, these results make clear and testable predictions for when and how evolutionary history is expected to influence contemporary rates of species interaction. © 2014 John Wiley & Sons Ltd/CNRS.

  3. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  4. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  5. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  6. PREVALENCE OF ANEMIA AND ITS SOCIO - DEMOGRAPHIC DETERMINANTS IN PREGNANT WOMEN AT A TERTIARY CARE HOSPITAL IN JAIPUR, RAJASTHAN

    OpenAIRE

    Prabhjot Singh; Swati; Rajat; Urvahi; Karnika; Isha; Navsangeet; Arihant

    2015-01-01

    AIM: Prevalence of anemia and its socio - demographic determinants in pregnant women at a tertiary care hospital in Jaipur, Rajasthan . MATERIALS AND METHODS: All the pregnant women aged 25 to 35 years , registered at antenatal clinic at Department of Obstetrics an d Gynaecology , Mahatma Gandhi Medical College , Jaipur were included. A predesigned and pre tested questionnaire was used to elicit the information. Various possible causes of anaemi...

  7. Evolutionary history determines how plant productivity responds to phylogenetic diversity and species richness

    Directory of Open Access Journals (Sweden)

    Mark A. Genung

    2014-03-01

    Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.

  8. Efficient parsimony-based methods for phylogenetic network reconstruction.

    Science.gov (United States)

    Jin, Guohua; Nakhleh, Luay; Snir, Sagi; Tuller, Tamir

    2007-01-15

    Phylogenies--the evolutionary histories of groups of organisms-play a major role in representing relationships among biological entities. Although many biological processes can be effectively modeled as tree-like relationships, others, such as hybrid speciation and horizontal gene transfer (HGT), result in networks, rather than trees, of relationships. Hybrid speciation is a significant evolutionary mechanism in plants, fish and other groups of species. HGT plays a major role in bacterial genome diversification and is a significant mechanism by which bacteria develop resistance to antibiotics. Maximum parsimony is one of the most commonly used criteria for phylogenetic tree inference. Roughly speaking, inference based on this criterion seeks the tree that minimizes the amount of evolution. In 1990, Jotun Hein proposed using this criterion for inferring the evolution of sequences subject to recombination. Preliminary results on small synthetic datasets. Nakhleh et al. (2005) demonstrated the criterion's application to phylogenetic network reconstruction in general and HGT detection in particular. However, the naive algorithms used by the authors are inapplicable to large datasets due to their demanding computational requirements. Further, no rigorous theoretical analysis of computing the criterion was given, nor was it tested on biological data. In the present work we prove that the problem of scoring the parsimony of a phylogenetic network is NP-hard and provide an improved fixed parameter tractable algorithm for it. Further, we devise efficient heuristics for parsimony-based reconstruction of phylogenetic networks. We test our methods on both synthetic and biological data (rbcL gene in bacteria) and obtain very promising results.

  9. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  10. Antenatal care among currently married women in Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Alok Chauhan

    2012-10-01

    Full Text Available Objective: To assess the utilization of antenatal care (ANC services among currently married women in Rajasthan. Methods: The data have been extracted from District Level Household and Facility Survey (DLHS-3 which was conducted during 2007-2008, all over India. A total of 12 458 currently married women in the age group of 15-49 were taken as the sample for the study. Cross tabulation and binary logistic regression method were applied to determine the factors influencing ANC. Results: Out of 12 458 respondents, 43.4 percent women not received even a single ANC during their pregnancy period. 45.1 percent of the women not received tetanus toxoid injection and 13.0 percent of the women not received Iron folic acid tablets during their pregnancy period. Only 6.6 percent of women fulfilled the minimum recommendation with regard ANC services. Conclusions: The study points to the avenues through which policy makers can formulate and implement policies on a realistic basis by identifying critical variables and target groups for effective utilisation of ANC.

  11. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Comparative assessment of Oral Hygiene and Periodontal status among children who have Poliomyelitis at Udaipur city, Rajasthan, India

    OpenAIRE

    Tak, Mridula; Nagarajappa, Ramesh; Sharda, Archana; Asawa, Kailash; Tak, Aniruddh; Jalihal, Sagar

    2012-01-01

    Objective: To assess and compare the oral hygiene and periodontal status among children with Poliomyelitis having upper limb disability, lower limb disability and both upper and lower disability at Udaipur city, Rajasthan, India. Study design: Total sample comprised of 344 Poliomyelitis children (upper limb disability: 33.4%; lower limb disability: 33.7%; both upper and lower limb disability: 32.9%) in the age group of 12-15 years. Clinical examination included recording Simplified Oral Hygie...

  13. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  14. On the Quirks of Maximum Parsimony and Likelihood on Phylogenetic Networks

    OpenAIRE

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2015-01-01

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogene...

  15. Phylogenetic relationships of cone snails endemic to Cabo Verde based on mitochondrial genomes.

    Science.gov (United States)

    Abalde, Samuel; Tenorio, Manuel J; Afonso, Carlos M L; Uribe, Juan E; Echeverry, Ana M; Zardoya, Rafael

    2017-11-25

    Due to their great species and ecological diversity as well as their capacity to produce hundreds of different toxins, cone snails are of interest to evolutionary biologists, pharmacologists and amateur naturalists alike. Taxonomic identification of cone snails still relies mostly on the shape, color, and banding patterns of the shell. However, these phenotypic traits are prone to homoplasy. Therefore, the consistent use of genetic data for species delimitation and phylogenetic inference in this apparently hyperdiverse group is largely wanting. Here, we reconstruct the phylogeny of the cones endemic to Cabo Verde archipelago, a well-known radiation of the group, using mitochondrial (mt) genomes. The reconstructed phylogeny grouped the analyzed species into two main clades, one including Kalloconus from West Africa sister to Trovaoconus from Cabo Verde and the other with a paraphyletic Lautoconus due to the sister group relationship of Africonus from Cabo Verde and Lautoconus ventricosus from Mediterranean Sea and neighboring Atlantic Ocean to the exclusion of Lautoconus endemic to Senegal (plus Lautoconus guanche from Mauritania, Morocco, and Canary Islands). Within Trovaoconus, up to three main lineages could be distinguished. The clade of Africonus included four main lineages (named I to IV), each further subdivided into two monophyletic groups. The reconstructed phylogeny allowed inferring the evolution of the radula in the studied lineages as well as biogeographic patterns. The number of cone species endemic to Cabo Verde was revised under the light of sequence divergence data and the inferred phylogenetic relationships. The sequence divergence between continental members of the genus Kalloconus and island endemics ascribed to the genus Trovaoconus is low, prompting for synonymization of the latter. The genus Lautoconus is paraphyletic. Lautoconus ventricosus is the closest living sister group of genus Africonus. Diversification of Africonus was in allopatry

  16. Scrub typhus in rural Rajasthan and a review of other Indian studies.

    Science.gov (United States)

    Masand, Rupesh; Yadav, Ritesh; Purohit, Alok; Tomar, Balvir Singh

    2016-05-01

    Scrub typhus is an acute febrile illness which has been reported from various parts of India with Rajasthan recently joining the list of affected states. To report a series of paediatric scrub typhus cases from rural Rajasthan. Retrospective review of children with scrub typhus admitted to the wards and paediatric intensive care unit (PICU) of a tertiary-care hospital. The study was undertaken over an 8-month period from May to December 2013. All patients with a clinical presentation and/or serological confirmation of scrub typhus who tested negative for malaria, enteric fever, dengue, leptospirosis and urinary tract infection (UTI) were included. A range of investigations were undertaken including IgM-ELISA for scrub typhus, followed by appropriate medical management. Thirty patients satisfied the inclusion criteria. The mean (SD, range) age of the patients was 8·56 (3·43, 3-16) years. The most common clinical features were fever (n = 30, 100%), headache (n = 20, 66%), myalgia (n = 15, 50%), hepatosplenomegaly (n = 18, 60%) and pallor (n = 5, 16%). Typical features such as eschar and rash were observed in only one (3·3%) and three (10%) patients, respectively; none had generalised lymphadenopathy or conjunctival congestion. IgM-ELISA for scrub typhus was positive in 28 patients (93·3%) and 27 responded to doxycycline within 24-72 hours. One of the three patients who required PICU support responded to intravenous chloramphenicol and, of the other two (6·6%), one died of acute respiratory distress syndrome and the other owing to acute renal failure. A high index of suspicion is essential for early diagnosis and prevention of complications in scrub typhus together with prompt referral from rural areas to a higher centre. Awareness of the disease manifestations may further help to prevent excessive investigations in patients presenting with non-specific febrile illness and reduce the economic burden to the family and society in resource

  17. Folding and unfolding phylogenetic trees and networks.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang

    2016-12-01

    Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.

  18. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  19. Unusual nocturnal feeding by Brown Rock-chat Cercomela fusca (Passeriformes: Muscicapidae in Bikaner, Rajasthan, India

    Directory of Open Access Journals (Sweden)

    P. Singh

    2009-04-01

    Full Text Available Brown Rock-chat is a diurnal insectivorous bird commonly associated with human habitations. I report here nocturnal foraging of the species in and around Bikaner in Rajasthan. The birds showed a marked bimodal activity during their nocturnal foraging which peaked in early morning and late evening hours. Bright sodium-vapour lights that attracted a horde of insects during monsoons offered ideal foraging opportunities for the birds. This behavior is explained here as an adaptation to maximize their food intake during the period when the birds breed and their nutritional requirements are naturally high.

  20. Seroprevalence of Hepatitis B surface antigen, antibodies to the Hepatitis C virus, and human immunodeficiency virus in a hospital-based population in Jaipur, Rajasthan

    Directory of Open Access Journals (Sweden)

    Sood Smita

    2010-01-01

    Full Text Available Background: Hepatitis B, hepatitis C, and HIV infections are a serious global and public health problem. To assess the magnitude and dynamics of disease transmission and for its prevention and control, the study of its seroprevalence is important. A private hospital catering to the needs of a large population represents an important center for serological surveys. Available data, at Rajasthan state level, on the seroprevalence of these bloodborne pathogens is also very limited. Objective: A study was undertaken to estimate the seroprevalence of hepatitis B surface antigen (HBsAg and antibodies to hepatitis C (anti-HCV Ab and human immunodeficiency virus (anti-HIV Ab in both the sexes and different age groups in a hospital-based population in Jaipur, Rajasthan. Materials and Methods: Serum samples collected over a period of 14 months from patients attending OPDs and admitted to various IPDs of Fortis Escorts Hospital, Jaipur, were subjected within the hospital-based lab for the detection of HBsAg and anti-HCV Ab and anti-HIV Ab using rapid card tests. This was followed by further confirmation of all reactive samples by a microparticle enzyme immunoassay (Abbott AxSYM at Super Religare Laboratories (formerly SRL Ranbaxy Reference Lab, Mumbai. Results: The seroprevalence of HBsAg was found to be 0.87%, of anti-HCV Ab as 0.28%, and of anti-HIV Ab as 0.35%. Conclusion: The study throws light on the magnitude of viral transmission in the community in the state of Rajasthan and provides a reference for future studies.

  1. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  2. Fluoride, boron and nitrate toxicity in ground water of northwest Rajasthan, India.

    Science.gov (United States)

    Chaudhary, Veena; Kumar, Mukesh; Sharma, Mukesh; Yadav, B S

    2010-02-01

    The study was carried out to access the fluoride, boron, and nitrate concentrations in ground water samples of different villages in Indira Gandhi, Bhakra, and Gang canal catchment area of northwest Rajasthan, India. Rural population, in the study site, is using groundwater for drinking and irrigation purposes, without any quality test of water. All water samples (including canal water) were contaminated with fluoride. Fluoride, boron, and nitrate were observed in the ranges of 0.50-8.50, 0.0-7.73, and 0.0-278.68 mg/l, respectively. Most of the water samples were in the categories of fluoride 1.50 mg/l, of boron 2.0-4.0 mg/l, and of nitrate availability of these compounds in groundwater was due to natural reasons and by the use of chemical fertilizers.

  3. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  4. Efficient FPT Algorithms for (Strict) Compatibility of Unrooted Phylogenetic Trees.

    Science.gov (United States)

    Baste, Julien; Paul, Christophe; Sau, Ignasi; Scornavacca, Celine

    2017-04-01

    In phylogenetics, a central problem is to infer the evolutionary relationships between a set of species X; these relationships are often depicted via a phylogenetic tree-a tree having its leaves labeled bijectively by elements of X and without degree-2 nodes-called the "species tree." One common approach for reconstructing a species tree consists in first constructing several phylogenetic trees from primary data (e.g., DNA sequences originating from some species in X), and then constructing a single phylogenetic tree maximizing the "concordance" with the input trees. The obtained tree is our estimation of the species tree and, when the input trees are defined on overlapping-but not identical-sets of labels, is called "supertree." In this paper, we focus on two problems that are central when combining phylogenetic trees into a supertree: the compatibility and the strict compatibility problems for unrooted phylogenetic trees. These problems are strongly related, respectively, to the notions of "containing as a minor" and "containing as a topological minor" in the graph community. Both problems are known to be fixed parameter tractable in the number of input trees k, by using their expressibility in monadic second-order logic and a reduction to graphs of bounded treewidth. Motivated by the fact that the dependency on k of these algorithms is prohibitively large, we give the first explicit dynamic programming algorithms for solving these problems, both running in time [Formula: see text], where n is the total size of the input.

  5. Uranium in ancient slag from Rajasthan

    International Nuclear Information System (INIS)

    Pradeepkumar, T.B.; Fahmi, Sohail; Sharma, S.K.

    2008-01-01

    Anomalous radioactivity was recorded in two ancient slag dumps spread on the surface near Bansda (24 deg 35'N lat., 70 deg 09'E long.) and Dhavadiya (24 deg 30'N lat., 70 deg 05'E long.) villages, Udaipur District, Rajasthan. The slag, with a range of high to low radioactivity levels, is the remnant of ancient smelting in the area, probably for copper. Six samples showing low radioactivity in Bansda contain an average of 0.030% U 3 O 8 , while five moderately radioactive samples analysed contain 0.225% U 3 O 8 and four highly radioactive samples analysed contain 1.15% U 3 O 8 . The 15 samples contain on an average 0.627% copper, 719 ppm zinc, 329 ppm cobalt and 133 ppm vanadium. Fifteen samples from Dhavadiya slag assayed on an average contain 0.040% U 3 O 8 , 0.297% Cu, 292 ppm Zn and 250 ppm Co. The extent of crystallization seen in the slag is intriguing because an over-cooled melt generally forms glass. The high rate of crystal formation may be attributed to high amounts of volatiles, particularly CO 2 and SO 4 , released during the breakdown of limestone (added as flux during smelting) and sulphide minerals in the ore. The high order of radioactivity recorded in the slags of Bansda and Dhavadiya points to the presence of ore-grade uranium concentration associated with sulphide mineralization in the vicinity of the basement Banded Gneissic Complex, intrusive granites and the cover sequence of the Bhinder basin. (author)

  6. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  7. Socio-economic effect on socially-deprived communities of developing drinking water quality problems in arid and semi-arid area of central Rajasthan

    Directory of Open Access Journals (Sweden)

    I. Husain

    2014-09-01

    Full Text Available Rajasthan is well known for its Great Thar desert. Central Rajasthan has an arid to semi-arid environment. The area faces either scarcity of water or poor quality of drinking water. In some areas water is transported 2 km or more, which uses time, energy and money. Rich people have their own sources, which is restricted for use by others. Such conditions are affecting socially-deprived communities, both socially and economically. Groundwater is a major source of drinking water due to the unavailability of surface water. There is a lack of groundwater quality knowledge in the community and the data available is hard to understand by consumers. The CCME Water Quality Index is a tool to simplify the water quality report by rating the water on quality standards. It provides meaningful summaries of overall water quality and trends, which is accessible to non-technical lay people. In the present study the objective is to examine the groundwater quality of six districts (Ajmer, Bhilwara, Pali, Rajasamand, Nagaur and Jodhpur, centrally located in Rajasthan, with arid and semi-arid conditions. CCME WQI is also evaluated to produce quality data in a form to be understood by the community. A total of 4369 groundwater sources in 1680 villages from six districts (76 546 km2 were collected and examined. Results are outlined in the Bureau of Indian Standards (BIS: 10500, 2012 and 2952 sources are unsafe for drinking. According to CCME WQI groundwater of 93 villages is poor, 343 villages are marginal, and 369 villages are fair in quality. Toxicological studies of unsafe drinking water and their remedial measures are also discussed. A tentative correlation between prevailing water-borne diseases and quality parameter has also been shown

  8. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Science.gov (United States)

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more

  9. Phylogenetic comparative methods complement discriminant function analysis in ecomorphology.

    Science.gov (United States)

    Barr, W Andrew; Scott, Robert S

    2014-04-01

    In ecomorphology, Discriminant Function Analysis (DFA) has been used as evidence for the presence of functional links between morphometric variables and ecological categories. Here we conduct simulations of characters containing phylogenetic signal to explore the performance of DFA under a variety of conditions. Characters were simulated using a phylogeny of extant antelope species from known habitats. Characters were modeled with no biomechanical relationship to the habitat category; the only sources of variation were body mass, phylogenetic signal, or random "noise." DFA on the discriminability of habitat categories was performed using subsets of the simulated characters, and Phylogenetic Generalized Least Squares (PGLS) was performed for each character. Analyses were repeated with randomized habitat assignments. When simulated characters lacked phylogenetic signal and/or habitat assignments were random, ecomorphology. Copyright © 2013 Wiley Periodicals, Inc.

  10. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  11. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

    1995-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

  12. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  13. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Science.gov (United States)

    Li, Xinnian; Duke, Norman C; Yang, Yuchen; Huang, Lishi; Zhu, Yuxiang; Zhang, Zhang; Zhou, Renchao; Zhong, Cairong; Huang, Yelin; Shi, Suhua

    2016-01-01

    Avicennia L. (Avicenniaceae), one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP) lineage and an Indo-West Pacific (IWP) lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1) A. rumphiana and A. alba, (2) A. officinalis and A. integra, and (3) the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago) and may have been driven largely by the fluctuating sea levels since that time.

  14. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Directory of Open Access Journals (Sweden)

    Xinnian Li

    Full Text Available Avicennia L. (Avicenniaceae, one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP lineage and an Indo-West Pacific (IWP lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1 A. rumphiana and A. alba, (2 A. officinalis and A. integra, and (3 the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago and may have been driven largely by the fluctuating sea levels since that time.

  15. Phylogenetic representativeness: a new method for evaluating taxon sampling in evolutionary studies

    Directory of Open Access Journals (Sweden)

    Passamonti Marco

    2010-04-01

    Full Text Available Abstract Background Taxon sampling is a major concern in phylogenetic studies. Incomplete, biased, or improper taxon sampling can lead to misleading results in reconstructing evolutionary relationships. Several theoretical methods are available to optimize taxon choice in phylogenetic analyses. However, most involve some knowledge about the genetic relationships of the group of interest (i.e., the ingroup, or even a well-established phylogeny itself; these data are not always available in general phylogenetic applications. Results We propose a new method to assess taxon sampling developing Clarke and Warwick statistics. This method aims to measure the "phylogenetic representativeness" of a given sample or set of samples and it is based entirely on the pre-existing available taxonomy of the ingroup, which is commonly known to investigators. Moreover, our method also accounts for instability and discordance in taxonomies. A Python-based script suite, called PhyRe, has been developed to implement all analyses we describe in this paper. Conclusions We show that this method is sensitive and allows direct discrimination between representative and unrepresentative samples. It is also informative about the addition of taxa to improve taxonomic coverage of the ingroup. Provided that the investigators' expertise is mandatory in this field, phylogenetic representativeness makes up an objective touchstone in planning phylogenetic studies.

  16. Awareness and Attitude of Physicians in Academia towards Human Stem Cell Research (HSCR) and Related Policies in Rajasthan, India

    OpenAIRE

    Nitin K Joshi; Latika Nath; Vibha Joshi; Anil Purohit

    2015-01-01

    Introduction: In India, several science agencies are promoting Stem Cell Research (SCR). There is paucity of studies which document the perception of doctors about SCR, especially physicians in academia. This study was carried out to assess perception of physicians in academia towards Human Stem Cell Research (HSCR) and related policies in India. Methods: We interviewed 200 doctors from three different government medical colleges of Rajasthan. A semi-structured questionnaire was used to disce...

  17. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Dental caries and treatment needs of children (6-10 years in rural Udaipur, Rajasthan

    Directory of Open Access Journals (Sweden)

    Dhar Vineet

    2009-01-01

    Full Text Available Objective : This study was done to examine caries prevalence and corresponding treatment needs in school children of rural areas of Udaipur, Rajasthan. Materials and Methods : A total of 750 children of rural areas in the age group of 6-10 years were examined, using WHO index, to record the prevalence of dental caries and treatment needs. The results were subjected to statistical analysis using chi square test. Results : Dental caries was found in 63.20% children, and 85.07% children needed dental treatment. The highest need was of one surface filling (85.73% followed by sealant (51.20%. Conclusion : Dental caries showed to be a significant health issue in the rural population requiring immediate attention.

  19. Gastrointestinal parasitic infection in diverse species of domestic ruminants inhabiting tribal rural areas of southern Rajasthan, India.

    Science.gov (United States)

    Choubisa, S L; Jaroli, V J

    2013-10-01

    A total of 415 adult domesticated ruminants, 130 cattle (Bos taurus), 108 buffaloes (Bubalus bubalis), 94 goats (Capra hircus) and 83 sheep (Ovis aries) inhabiting tribal rural areas of southern Rajasthan, India were investigated for evidence of gastrointestinal protozoan and helminthic infections. In southern Rajasthan humid ecosystem is predominant and has number of perennial freshwater bodies. Fresh faecal samples of these animals were examined microscopically by direct wet smear with saline and 1 % Lugol's iodine and formalin ether concentration. Of these 296 (71.32 %) were found to be infected with different species of gastrointestinal parasites. The highest (93.84 %) prevalence of these parasitic infections was found in cattle followed by goats (82.97 %), sheep (55.42 %) and buffaloes (46.29 %). Except cattle no other ruminants revealed protozoan infection. A total 8 species of gastrointestinal parasites were encountered. Among these parasites Fasciola hepatica was the commonest (15.18 %) followed by Haemonchus contortus (11.32 %), Ancylostoma duodenale (10.36 %), Trichuris trichiura (9.15 %), Amphistome species (7.95 %), Moniezia expansa (6.98 %), Strongyloides stercoralis (4.57 %) and Balantidium coli (3.37 %). The prevalence rate of these parasitic infections also varied seasonally. The highest prevalence rate was found in rainy season (84.21 %) followed by winter (73.9 %) and summer (52.8 %). The possible causes for variation in prevalence of parasitic infections are also discussed.

  20. Oral health knowledge, attitude and practices of children and adolescents of orphanages in jodhpur city rajasthan, India.

    Science.gov (United States)

    Hans, Rinki; Thomas, Susan; Dagli, Rushabh; Bhateja, Geetika Arora; Sharma, Akanksha; Singh, Amarpreet

    2014-10-01

    This study had twin objectives of assessing the oral health knowledge, attitude and practices and to assess the dental caries status and treatment needs among the orphan children of orphanages of Jodhpur city, Rajasthan, India. This cross- sectional study was carried out on 100 children to assess the oral health knowledge, attitude and practices of children and adolescents of orphanages in Jodhpur city, Rajasthan, India. The data was collected on a pre-tested questionnaire which included 20 closed ended multiple-choice questions on perceived oral health status, knowledge of oral health and attitude, oral health practices, dietary habits and behaviour towards dental treatment. On completion of the questionnaire, each child underwent an oral examination and Dentition status and treatment needs index (WHO Oral Health Surveys- 1997) was recorded for each subject. Almost 93% of the children felt the necessity of maintaining oral hygiene. There were 69% of the children who believed that it was necessary to brush teeth after every meal, 51% children believed that regular tooth-brushing prevents all tooth problems and 93% children knew that tobacco is carcinogenic in nature. Also, it was found that 77% of the children believed that regular dental visits help in maintaining oral hygiene. Many of them had acquired knowledge on oral health. More than half of the study subjects were aware of the importance of keeping good oral hygiene, regular dental visits and harmful effects of tobacco.

  1. Techno-economic felling cycles for selected energy plantation species in the arid areas of western Rajasthan

    Energy Technology Data Exchange (ETDEWEB)

    Kalla, J.C.; Gyan, C.; Vyas, D.L.; Gehlot, N.S.

    1978-01-01

    Analysis of data collected from research plots at Pali, Rajasthan, predicted that the maximum fuel yields per tree would be reached at rotations of 50 years for (a) Azadirachta indica (51 kg), 25 years for (b) Acacia tortilis (39 kg), 14 years for (c) Albizzia (Abizia) lebbek (15 kg) and 13 years for (d) Acacia nilotica (6 kg). The best economic rotations would be 23 years for (a) yielding 24 kg/tree, 8 years for (b) yielding 20 kg/tree and 11 years for (c) yielding 6 kg/tree. Harvesting (d) for fuel would not be economic.

  2. Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

    Science.gov (United States)

    Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  3. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  4. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  5. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  6. Phylogenetic signal dissection identifies the root of starfishes.

    Directory of Open Access Journals (Sweden)

    Roberto Feuda

    Full Text Available Relationships within the class Asteroidea have remained controversial for almost 100 years and, despite many attempts to resolve this problem using molecular data, no consensus has yet emerged. Using two nuclear genes and a taxon sampling covering the major asteroid clades we show that non-phylogenetic signal created by three factors--Long Branch Attraction, compositional heterogeneity and the use of poorly fitting models of evolution--have confounded accurate estimation of phylogenetic relationships. To overcome the effect of this non-phylogenetic signal we analyse the data using non-homogeneous models, site stripping and the creation of subpartitions aimed to reduce or amplify the systematic error, and calculate Bayes Factor support for a selection of previously suggested topological arrangements of asteroid orders. We show that most of the previous alternative hypotheses are not supported in the most reliable data partitions, including the previously suggested placement of either Forcipulatida or Paxillosida as sister group to the other major branches. The best-supported solution places Velatida as the sister group to other asteroids, and the implications of this finding for the morphological evolution of asteroids are presented.

  7. The tribal girl child in Rajasthan.

    Science.gov (United States)

    Bhanti, R

    1995-01-01

    This article describes the status of the girl child among tribes in India. Tribes have son preference but do not discriminate against girls by female infanticide or sex determination tests. Girls do not inherit land, but they are not abused, hated, or subjected to rigid social norms. Girls are not veiled and are free to participate in dancing and other recreational programs. There is no dowry on marriage. The father of the bridegroom pays a brideprice to the father of the girl. Widowed or divorced women are free to marry again. Daughters care for young children, perform housework, and work in the field with their brothers. In the tribal village of Choti Underi girls were not discriminated against in health and nutrition, but there was a gender gap in education. Both girls and boys were equally exposed to infection and undernourishment. Tribals experience high rates of infant and child mortality due to poverty and its related malnutrition. Child labor among tribals is a way of life for meeting the basic needs of the total household. A recent report on tribals in Rajasthan reveals that 15-20% of child labor involved work in mines that were dangerous to children's health. Girl children had no security provisions or minimum wages. Tribal children were exploited by human service agencies. Child laborers were raped. Government programs in tribal areas should focus on improving living conditions for children in general. Special programs for girls are needed for providing security in the workplace and increasing female educational levels. More information is needed on the work burden of tribal girls that may include wage employment as well as housework.

  8. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  9. Molecular phylogenetic reconstruction of the endemic Asian salamander family Hynobiidae (Amphibia, Caudata).

    Science.gov (United States)

    Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J

    2013-01-01

    The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger

  10. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  11. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    Science.gov (United States)

    Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188

  12. Polytomy identification in microbial phylogenetic reconstruction

    Directory of Open Access Journals (Sweden)

    Lin Guan

    2011-12-01

    Full Text Available Abstract Background A phylogenetic tree, showing ancestral relations among organisms, is commonly represented as a rooted tree with sets of bifurcating branches (dichotomies for simplicity, although polytomies (multifurcating branches may reflect more accurate evolutionary relationships. To represent the true evolutionary relationships, it is important to systematically identify the polytomies from a bifurcating tree and generate a taxonomy-compatible multifurcating tree. For this purpose we propose a novel approach, "PolyPhy", which would classify a set of bifurcating branches of a phylogenetic tree into a set of branches with dichotomies and polytomies by considering genome distances among genomes and tree topological properties. Results PolyPhy employs a machine learning technique, BLR (Bayesian logistic regression classifier, to identify possible bifurcating subtrees as polytomies from the trees resulted from ComPhy. Other than considering genome-scale distances between all pairs of species, PolyPhy also takes into account different properties of tree topology between dichotomy and polytomy, such as long-branch retraction and short-branch contraction, and quantifies these properties into comparable rates among different sub-branches. We extract three tree topological features, 'LR' (Leaf rate, 'IntraR' (Intra-subset branch rate and 'InterR' (Inter-subset branch rate, all of which are calculated from bifurcating tree branch sets for classification. We have achieved F-measure (balanced measure between precision and recall of 81% with about 0.9 area under the curve (AUC of ROC. Conclusions PolyPhy is a fast and robust method to identify polytomies from phylogenetic trees based on genome-wide inference of evolutionary relationships among genomes. The software package and test data can be downloaded from http://digbio.missouri.edu/ComPhy/phyloTreeBiNonBi-1.0.zip.

  13. Phylogenetic relationships of leopard frogs (Rana pipiens complex) from an isolated coastal mountain range in southern Sonora, Mexico.

    Science.gov (United States)

    Pfeiler, E; Markow, T A

    2008-10-01

    Mitochondrial DNA sequence data from the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico, together with GenBank sequences, were used to infer taxonomic identity and provide phylogenetic hypotheses for relationships with other members of the Rana pipiens complex. We show that frogs from the Sierra El Aguaje belong to the Rana berlandieri subgroup, or Scurrilirana clade, of the R. pipiens group, and are most closely related to Rana magnaocularis from Nayarit, Mexico. We also provide further evidence that Rana magnaocularis and R. yavapaiensis are close relatives.

  14. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  15. Phylogenetic affinity of tree shrews to Glires is attributed to fast evolution rate.

    Science.gov (United States)

    Lin, Jiannan; Chen, Guangfeng; Gu, Liang; Shen, Yuefeng; Zheng, Meizhu; Zheng, Weisheng; Hu, Xinjie; Zhang, Xiaobai; Qiu, Yu; Liu, Xiaoqing; Jiang, Cizhong

    2014-02-01

    Previous phylogenetic analyses have led to incongruent evolutionary relationships between tree shrews and other suborders of Euarchontoglires. What caused the incongruence remains elusive. In this study, we identified 6845 orthologous genes between seventeen placental mammals. Tree shrews and Primates were monophyletic in the phylogenetic trees derived from the first or/and second codon positions whereas tree shrews and Glires formed a monophyly in the trees derived from the third or all codon positions. The same topology was obtained in the phylogeny inference using the slowly and fast evolving genes, respectively. This incongruence was likely attributed to the fast substitution rate in tree shrews and Glires. Notably, sequence GC content only was not informative to resolve the controversial phylogenetic relationships between tree shrews, Glires, and Primates. Finally, estimation in the confidence of the tree selection strongly supported the phylogenetic affiliation of tree shrews to Primates as a monophyly. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Inferring phylogenetic trees from the knowledge of rare evolutionary events.

    Science.gov (United States)

    Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F

    2018-06-01

    Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.

  17. Linear programming model to construct phylogenetic network for 16S rRNA sequences of photosynthetic organisms and influenza viruses.

    Science.gov (United States)

    Mathur, Rinku; Adlakha, Neeru

    2014-06-01

    Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.

  18. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  19. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  20. Some limitations of public sequence data for phylogenetic inference (in plants).

    Science.gov (United States)

    Hinchliff, Cody E; Smith, Stephen Andrew

    2014-01-01

    The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing

  1. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  2. An evaluation of phylogenetic informativeness profiles and the molecular phylogeny of diplazontinae (Hymenoptera, Ichneumonidae).

    Science.gov (United States)

    Klopfstein, Seraina; Kropf, Christian; Quicke, Donald L J

    2010-03-01

    How to quantify the phylogenetic information content of a data set is a longstanding question in phylogenetics, influencing both the assessment of data quality in completed studies and the planning of future phylogenetic projects. Recently, a method has been developed that profiles the phylogenetic informativeness (PI) of a data set through time by linking its site-specific rates of change to its power to resolve relationships at different timescales. Here, we evaluate the performance of this method in the case of 2 standard genetic markers for phylogenetic reconstruction, 28S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) mitochondrial DNA, with maximum parsimony, maximum likelihood, and Bayesian analyses of relationships within a group of parasitoid wasps (Hymenoptera: Ichneumonidae, Diplazontinae). Retrieving PI profiles of the 2 genes from our own and from 3 additional data sets, we find that the method repeatedly overestimates the performance of the more quickly evolving CO1 compared with 28S. We explore possible reasons for this bias, including phylogenetic uncertainty, violation of the molecular clock assumption, model misspecification, and nonstationary nucleotide composition. As none of these provides a sufficient explanation of the observed discrepancy, we use simulated data sets, based on an idealized setting, to show that the optimum evolutionary rate decreases with increasing number of taxa. We suggest that this relationship could explain why the formula derived from the 4-taxon case overrates the performance of higher versus lower rates of evolution in our case and that caution should be taken when the method is applied to data sets including more than 4 taxa.

  3. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  4. On the quirks of maximum parsimony and likelihood on phylogenetic networks.

    Science.gov (United States)

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2017-03-21

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogenetic networks, which can display such events, are becoming of more and more interest in phylogenetic research. It is therefore necessary to extend concepts like maximum parsimony from phylogenetic trees to networks. Several suggestions for possible extensions can be found in recent literature, for instance the softwired and the hardwired parsimony concepts. In this paper, we analyze the so-called big parsimony problem under these two concepts, i.e. we investigate maximum parsimonious networks and analyze their properties. In particular, we show that finding a softwired maximum parsimony network is possible in polynomial time. We also show that the set of maximum parsimony networks for the hardwired definition always contains at least one phylogenetic tree. Lastly, we investigate some parallels of parsimony to different likelihood concepts on phylogenetic networks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  6. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  7. Phylogenetic Analyses of Armillaria Reveal at Least 15 Phylogenetic Lineages in China, Seven of Which Are Associated with Cultivated Gastrodia elata.

    Directory of Open Access Journals (Sweden)

    Ting Guo

    Full Text Available Fungal species of Armillaria, which can act as plant pathogens and/or symbionts of the Chinese traditional medicinal herb Gastrodia elata ("Tianma", are ecologically and economically important and have consequently attracted the attention of mycologists. However, their taxonomy has been highly dependent on morphological characterization and mating tests. In this study, we phylogenetically analyzed Chinese Armillaria samples using the sequences of the internal transcribed spacer region, translation elongation factor-1 alpha gene and beta-tubulin gene. Our data revealed at least 15 phylogenetic lineages of Armillaria from China, of which seven were newly discovered and two were recorded from China for the first time. Fourteen Chinese biological species of Armillaria, which were previously defined based on mating tests, could be assigned to the 15 phylogenetic lineages identified herein. Seven of the 15 phylogenetic lineages were found to be disjunctively distributed in different continents of the Northern Hemisphere, while eight were revealed to be endemic to certain continents. In addition, we found that seven phylogenetic lineages of Armillaria were used for the cultivation of Tianma, only two of which had been recorded to be associated with Tianma previously. We also illustrated that G. elata f. glauca ("Brown Tianma" and G. elata f. elata ("Red Tianma", two cultivars of Tianma grown in different regions of China, form symbiotic relationships with different phylogenetic lineages of Armillaria. These findings should aid the development of Tianma cultivation in China.

  8. Case study of fly ash brick manufacturing units at Kota in Rajasthan

    Science.gov (United States)

    Sharma, Y.; Saxena, B. K.; Rao, K. V. S.

    2018-03-01

    Kota Super Thermal Power Station of 1240 MW is located at Kota in Rajasthan, India. The quantity of fly ash generated by it is about 1.64 to 2.03 million tonnes per year. This fly ash is being utilized for making bricks, tiles, portland pozzolana cement, construction of highways, and other purposes. 1.79 million tonnes of fly ash was utilized for different applications in one year duration from April 01st, 2015 to March 31st, 2016. Out of this total utilization, 0.6439 million tonnes (36.06 %) of fly ash was used for making bricks, blocks, and tiles. In this paper, a case study of two fly ash brick manufacturing units using fly ash produced from Kota Super Thermal Power Station is described. These units produce about 15,000 and 20,000 bricks respectively by employing 10 and 16 workers each and are making a profit of about Rs. 6,000 and Rs. 8,000 per day in one shift.

  9. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  10. Forecasting incidence of dengue in Rajasthan, using time series analyses.

    Science.gov (United States)

    Bhatnagar, Sunil; Lal, Vivek; Gupta, Shiv D; Gupta, Om P

    2012-01-01

    To develop a prediction model for dengue fever/dengue haemorrhagic fever (DF/DHF) using time series data over the past decade in Rajasthan and to forecast monthly DF/DHF incidence for 2011. Seasonal autoregressive integrated moving average (SARIMA) model was used for statistical modeling. During January 2001 to December 2010, the reported DF/DHF cases showed a cyclical pattern with seasonal variation. SARIMA (0,0,1) (0,1,1) 12 model had the lowest normalized Bayesian information criteria (BIC) of 9.426 and mean absolute percentage error (MAPE) of 263.361 and appeared to be the best model. The proportion of variance explained by the model was 54.3%. Adequacy of the model was established through Ljung-Box test (Q statistic 4.910 and P-value 0.996), which showed no significant correlation between residuals at different lag times. The forecast for the year 2011 showed a seasonal peak in the month of October with an estimated 546 cases. Application of SARIMA model may be useful for forecast of cases and impending outbreaks of DF/DHF and other infectious diseases, which exhibit seasonal pattern.

  11. Phylogenetic inference in Rafflesiales: the influence of rate heterogeneity and horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Vidal-Russell Romina

    2004-10-01

    Full Text Available Abstract Background The phylogenetic relationships among the holoparasites of Rafflesiales have remained enigmatic for over a century. Recent molecular phylogenetic studies using the mitochondrial matR gene placed Rafflesia, Rhizanthes and Sapria (Rafflesiaceae s. str. in the angiosperm order Malpighiales and Mitrastema (Mitrastemonaceae in Ericales. These phylogenetic studies did not, however, sample two additional groups traditionally classified within Rafflesiales (Apodantheaceae and Cytinaceae. Here we provide molecular phylogenetic evidence using DNA sequence data from mitochondrial and nuclear genes for representatives of all genera in Rafflesiales. Results Our analyses indicate that the phylogenetic affinities of the large-flowered clade and Mitrastema, ascertained using mitochondrial matR, are congruent with results from nuclear SSU rDNA when these data are analyzed using maximum likelihood and Bayesian methods. The relationship of Cytinaceae to Malvales was recovered in all analyses. Relationships between Apodanthaceae and photosynthetic angiosperms varied depending upon the data partition: Malvales (3-gene, Cucurbitales (matR or Fabales (atp1. The latter incongruencies suggest that horizontal gene transfer (HGT may be affecting the mitochondrial gene topologies. The lack of association between Mitrastema and Ericales using atp1 is suggestive of HGT, but greater sampling within eudicots is needed to test this hypothesis further. Conclusions Rafflesiales are not monophyletic but composed of three or four independent lineages (families: Rafflesiaceae, Mitrastemonaceae, Apodanthaceae and Cytinaceae. Long-branch attraction appears to be misleading parsimony analyses of nuclear small-subunit rDNA data, but model-based methods (maximum likelihood and Bayesian analyses recover a topology that is congruent with the mitochondrial matR gene tree, thus providing compelling evidence for organismal relationships. Horizontal gene transfer appears to

  12. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  13. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  14. A guide to phylogenetic metrics for conservation, community ecology and macroecology

    Science.gov (United States)

    Cadotte, Marc W.; Carvalho, Silvia B.; Davies, T. Jonathan; Ferrier, Simon; Fritz, Susanne A.; Grenyer, Rich; Helmus, Matthew R.; Jin, Lanna S.; Mooers, Arne O.; Pavoine, Sandrine; Purschke, Oliver; Redding, David W.; Rosauer, Dan F.; Winter, Marten; Mazel, Florent

    2016-01-01

    ABSTRACT The use of phylogenies in ecology is increasingly common and has broadened our understanding of biological diversity. Ecological sub‐disciplines, particularly conservation, community ecology and macroecology, all recognize the value of evolutionary relationships but the resulting development of phylogenetic approaches has led to a proliferation of phylogenetic diversity metrics. The use of many metrics across the sub‐disciplines hampers potential meta‐analyses, syntheses, and generalizations of existing results. Further, there is no guide for selecting the appropriate metric for a given question, and different metrics are frequently used to address similar questions. To improve the choice, application, and interpretation of phylo‐diversity metrics, we organize existing metrics by expanding on a unifying framework for phylogenetic information. Generally, questions about phylogenetic relationships within or between assemblages tend to ask three types of question: how much; how different; or how regular? We show that these questions reflect three dimensions of a phylogenetic tree: richness, divergence, and regularity. We classify 70 existing phylo‐diversity metrics based on their mathematical form within these three dimensions and identify ‘anchor’ representatives: for α‐diversity metrics these are PD (Faith's phylogenetic diversity), MPD (mean pairwise distance), and VPD (variation of pairwise distances). By analysing mathematical formulae and using simulations, we use this framework to identify metrics that mix dimensions, and we provide a guide to choosing and using the most appropriate metrics. We show that metric choice requires connecting the research question with the correct dimension of the framework and that there are logical approaches to selecting and interpreting metrics. The guide outlined herein will help researchers navigate the current jungle of indices. PMID:26785932

  15. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  16. Vertebrate hosts and phylogenetic relationships of amphibian trypanosomes from a potential invertebrate vector, Culex territans Walker (Diptera: Culicidae).

    Science.gov (United States)

    Bartlett-Healy, Kristen; Crans, Wayne; Gaugler, Randy

    2009-04-01

    The blood meals of field-collected female Culex territans (Diptera: Culicidae) were concurrently assayed for the presence of trypanosomes and for vertebrate host identification. We amplified vertebrate DNA in 42 of 119 females and made positive identification to the host species level in 29 of those samples. Of the 119 field-collected Cx. territans females, 24 were infected with trypanosomes. Phylogenetic analysis placed the trypanosomes in the amphibian portion of the aquatic clade of the Trypanosomatidae. These trypanosomes were isolated from Cx. territans females that had fed on the frog species Rana clamitans, R. catesbeiana, R. virgatipes, and Rana spp. Results support a potential new lineage of dipteran-transmitted amphibian trypanosomes may occur within the aquatic clade. The frequency in which female Cx. territans acquire trypanosomes, through diverse feeding habits, indicates a new relationship between amphibian trypanosomes and mosquitoes that has not been examined previously. Combining Trypanosoma species, invertebrate, and vertebrate hosts to existing phylogenies can elucidate trypanosome and host relationships.

  17. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  18. Phylogenetic relationships among zooxanthellae (Symbiodinium) associated to excavating sponges (Cliona spp.) reveal an unexpected lineage in the Caribbean.

    Science.gov (United States)

    Granados, C; Camargo, C; Zea, S; Sánchez, J A

    2008-11-01

    Phylogenetic relationships of symbiotic dinoflagellate lineages, distributed in all tropical and subtropical seas, suggest strategies for long distance dispersal but at the same time strong host specialization. Zooxanthellae (Symbiodinium: Dinophyta), which are associated to diverse shallow-water cnidarians, also engage in symbioses with some sponge species of the genus Cliona. In the Caribbean, zooxanthellae-bearing Cliona has recently become abundant due to global warming, overfishing, and algae abundance. Using molecular techniques, the symbionts from five excavating species (Clionacaribbaea, C. tenuis, C. varians, C. aprica and C. laticavicola) from the southern and southwestern Caribbean were surveyed. Several DNA sequence regions were used in order to confirm zooxanthellae identity; 18S rDNA, domain V of chloroplast large subunit (cp23S), internal transcribed spacer 2 (ITS2), and ITS2 secondary structure. Sequence analyses corroborated the presence of three zooxanthellae clades: A, B, and G. Presence of clades A and B in common boring sponges of the Caribbean fit with the general pattern of the province. The discovery of clade G for the first time in any organism of the Atlantic Ocean leads us to consider this unusual finding as a phylogenetic relict through common ancestors of sponge clades or an invasion of the sponge from the Indo-Pacific.

  19. Enumerating all maximal frequent subtrees in collections of phylogenetic trees.

    Science.gov (United States)

    Deepak, Akshay; Fernández-Baca, David

    2014-01-01

    A common problem in phylogenetic analysis is to identify frequent patterns in a collection of phylogenetic trees. The goal is, roughly, to find a subset of the species (taxa) on which all or some significant subset of the trees agree. One popular method to do so is through maximum agreement subtrees (MASTs). MASTs are also used, among other things, as a metric for comparing phylogenetic trees, computing congruence indices and to identify horizontal gene transfer events. We give algorithms and experimental results for two approaches to identify common patterns in a collection of phylogenetic trees, one based on agreement subtrees, called maximal agreement subtrees, the other on frequent subtrees, called maximal frequent subtrees. These approaches can return subtrees on larger sets of taxa than MASTs, and can reveal new common phylogenetic relationships not present in either MASTs or the majority rule tree (a popular consensus method). Our current implementation is available on the web at https://code.google.com/p/mfst-miner/. Our computational results confirm that maximal agreement subtrees and all maximal frequent subtrees can reveal a more complete phylogenetic picture of the common patterns in collections of phylogenetic trees than maximum agreement subtrees; they are also often more resolved than the majority rule tree. Further, our experiments show that enumerating maximal frequent subtrees is considerably more practical than enumerating ordinary (not necessarily maximal) frequent subtrees.

  20. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  1. Phylogenetic and biogeographic analysis of sphaerexochine trilobites.

    Directory of Open Access Journals (Sweden)

    Curtis R Congreve

    Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and

  2. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    Science.gov (United States)

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  3. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  4. Towards an integrated phylogenetic classification of the Tremellomycetes.

    Science.gov (United States)

    Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y

    2015-06-01

    Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.

  5. Comparative analyses of the complete mitochondrial genomes of Dosinia clams and their phylogenetic position within Veneridae.

    Science.gov (United States)

    Lv, Changda; Li, Qi; Kong, Lingfeng

    2018-01-01

    Mitochondrial genomes have proved to be a powerful tool in resolving phylogenetic relationship. In order to understand the mitogenome characteristics and phylogenetic position of the genus Dosinia, we sequenced the complete mitochondrial genomes of Dosinia altior and Dosinia troscheli (Bivalvia: Veneridae), compared them with that of Dosinia japonica and established a phylogenetic tree for Veneridae. The mitogenomes of D. altior (17,536 bp) and D. troscheli (17,229 bp) are the two smallest in Veneridae, which include 13 protein-coding genes, 2 ribosomal RNA genes, 22 tRNA genes, and non-coding regions. The mitogenomes of the Dosinia species are similar in size, gene content, AT content, AT- and GC- skews, and gene arrangement. The phylogenetic relationships of family Veneridae were established based on 12 concatenated protein-coding genes using maximum likelihood and Bayesian analyses, which supported that Dosininae and Meretricinae have a closer relationship, with Tapetinae being the sister taxon. The information obtained in this study will contribute to further understanding of the molecular features of bivalve mitogenomes and the evolutionary history of the genus Dosinia.

  6. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  7. Suitability of cuticular pores and sensilla for harpacticoid copepod species delineation and phylogenetic reconstruction.

    Science.gov (United States)

    Karanovic, Tomislav; Kim, Kichoon

    2014-11-01

    Cuticular organs have not been described systematically in harpacticoids until recently, and they haven ever been used as characters for reconstructing phylogenetic relationships in any crustacean group. We survey cuticular pores and sensilla on somites in ten Miraciidae species, belonging to six genera, from Korea, Australia, and Russia. Nine species belong to the subfamily Stenheliinae, while the outgroup belongs to the subfamily Diosaccinae. We aim to compare phylogenetic trees reconstructed for these harpactioids based on: 1) cuticular organs (with 76 characters scored, 71% of them phylogenetically informative); 2) traditionally used macro-morphological characters (66 scored, 77% of them informative);and 3) mtCOI DNA data. All analyses suggest that cuticular organs are useful characters for harpacticoid species delineation, although not as sensitive as some fast-evolving molecular markers. Reconstructed cladograms based on all three datasets show very high bootstrap values for clades representing distinct genera, suggesting that cuticular organs are suitable characters for studying phylogenetic relationships. Bootstrap values for the more basal nodes differ among the different cladograms,as do the sister-group relationships they suggest, indicating that cuticular organs probably have different evolutionary constraints from macro-morphological characters. Cuticular organs could be quite useful in the study of old museum specimens and fossil crustaceans.

  8. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Directory of Open Access Journals (Sweden)

    David Lee Erickson

    2014-11-01

    Full Text Available Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1,347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK and psbA-trnH and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance metrics that are commonly used to infer assembly processes were estimated for each plot (Phylogenetic Distance [PD], Mean Phylogenetic Distance [MPD], and Mean Nearest Taxon Distance [MNTD]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for

  9. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  10. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  11. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  12. Phylogenetic relationships of Acheilognathidae (Cypriniformes: Cyprinoidea) as revealed from evidence of both nuclear and mitochondrial gene sequence variation: evidence for necessary taxonomic revision in the family and the identification of cryptic species.

    Science.gov (United States)

    Chang, Chia-Hao; Li, Fan; Shao, Kwang-Tsao; Lin, Yeong-Shin; Morosawa, Takahiro; Kim, Sungmin; Koo, Hyeyoung; Kim, Won; Lee, Jae-Seong; He, Shunping; Smith, Carl; Reichard, Martin; Miya, Masaki; Sado, Tetsuya; Uehara, Kazuhiko; Lavoué, Sébastien; Chen, Wei-Jen; Mayden, Richard L

    2014-12-01

    Bitterlings are relatively small cypriniform species and extremely interesting evolutionarily due to their unusual reproductive behaviors and their coevolutionary relationships with freshwater mussels. As a group, they have attracted a great deal of attention in biological studies. Understanding the origin and evolution of their mating system demands a well-corroborated hypothesis of their evolutionary relationships. In this study, we provide the most comprehensive phylogenetic reconstruction of species relationships of the group based on partitioned maximum likelihood and Bayesian methods using DNA sequence variation of nuclear and mitochondrial genes on 41 species, several subspecies and three undescribed species. Our findings support the monophyly of the Acheilognathidae. Two of the three currently recognized genera are not monophyletic and the family can be subdivided into six clades. These clades are further regarded as genera based on both their phylogenetic relationships and a reappraisal of morphological characters. We present a revised classification for the Acheilognathidae with five genera/lineages: Rhodeus, Acheilognathus (new constitution), Tanakia (new constitution), Paratanakia gen. nov., and Pseudorhodeus gen. nov. and an unnamed clade containing five species currently referred to as "Acheilognathus". Gene trees of several bitterling species indicate that the taxa are not monophyletic. This result highlights a potentially dramatic underestimation of species diversity in this family. Using our new phylogenetic framework, we discuss the evolution of the Acheilognathidae relative to classification, taxonomy and biogeography. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Enumerating all maximal frequent subtrees in collections of phylogenetic trees

    Science.gov (United States)

    2014-01-01

    Background A common problem in phylogenetic analysis is to identify frequent patterns in a collection of phylogenetic trees. The goal is, roughly, to find a subset of the species (taxa) on which all or some significant subset of the trees agree. One popular method to do so is through maximum agreement subtrees (MASTs). MASTs are also used, among other things, as a metric for comparing phylogenetic trees, computing congruence indices and to identify horizontal gene transfer events. Results We give algorithms and experimental results for two approaches to identify common patterns in a collection of phylogenetic trees, one based on agreement subtrees, called maximal agreement subtrees, the other on frequent subtrees, called maximal frequent subtrees. These approaches can return subtrees on larger sets of taxa than MASTs, and can reveal new common phylogenetic relationships not present in either MASTs or the majority rule tree (a popular consensus method). Our current implementation is available on the web at https://code.google.com/p/mfst-miner/. Conclusions Our computational results confirm that maximal agreement subtrees and all maximal frequent subtrees can reveal a more complete phylogenetic picture of the common patterns in collections of phylogenetic trees than maximum agreement subtrees; they are also often more resolved than the majority rule tree. Further, our experiments show that enumerating maximal frequent subtrees is considerably more practical than enumerating ordinary (not necessarily maximal) frequent subtrees. PMID:25061474

  14. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  15. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  16. Phylogeny and phylogenetic classification of the antbirds, ovenbirds, woodcreepers, and allies (Aves: Passeriformes: Infraorder Furnariides)

    Science.gov (United States)

    Moyle, R.G.; Chesser, R.T.; Brumfield, R.T.; Tello, J.G.; Marchese, D.J.; Cracraft, J.

    2009-01-01

    The infraorder Furnariides is a diverse group of suboscine passerine birds comprising a substantial component of the Neotropical avifauna. The included species encompass a broad array of morphologies and behaviours, making them appealing for evolutionary studies, but the size of the group (ca. 600 species) has limited well-sampled higher-level phylogenetic studies. Using DNA sequence data from the nuclear RAG-1 and RAG-2 exons, we undertook a phylogenetic analysis of the Furnariides sampling 124 (more than 88%) of the genera. Basal relationships among family-level taxa differed depending on phylogenetic method, but all topologies had little nodal support, mirroring the results from earlier studies in which discerning relationships at the base of the radiation was also difficult. In contrast, branch support for family-rank taxa and for many relationships within those clades was generally high. Our results support the Melanopareidae and Grallariidae as distinct from the Rhinocryptidae and Formicariidae, respectively. Within the Furnariides our data contradict some recent phylogenetic hypotheses and suggest that further study is needed to resolve these discrepancies. Of the few genera represented by multiple species, several were not monophyletic, indicating that additional systematic work remains within furnariine families and must include dense taxon sampling. We use this study as a basis for proposing a new phylogenetic classification for the group and in the process erect new family-group names for clades having high branch support across methods. ?? 2009 The Willi Hennig Society.

  17. Phylogenetic Analysis of the Bee Tribe Anthidiini | Combey | Journal ...

    African Journals Online (AJOL)

    The phylogenetic relationships among members of long tongue bee tribe Anthidiini (Megachilidae: Megachilinae) were investigated at the Department of Entomology and Wildlife, University of Cape Coast (Ghana) and the Agricultural Research Council, Pretoria (South Af-rica) from July, 2006 to May, 2007. Ten museums ...

  18. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  19. Phylogenetic relationship and Fourier-transform infrared spectroscopy-derived lipid determinants of lifespan parameters in the Saccharomyces cerevisiae yeast.

    Science.gov (United States)

    Molon, Mateusz; Zebrowski, Jacek

    2017-06-01

    Yeast ageing has been gaining much attention in gerontology research, yet the process itself is still not entirely clear. One of the constraints related to the use of the Saccharomyces cerevisiae yeast in studies is the ambiguity of the results concerning ageing determinants for different genetic backgrounds. In this paper, we compare reproductive potentials and lifespans of seven widely used haploid laboratory strains differing in daughter cells production capabilities and highlight the importance of choosing an appropriate genotype for the studies on ageing. Moreover, we show here links between post-reproductive lifespan and lipid metabolism, as well as between reproductive potential, reproductive lifespan and phylogenetic relationship. Using FTIR spectroscopy that generated a biochemical fingerprint of cells, coupled with chemometrics, we found that the band of carbonyl (C = O) stretching vibration discriminates the strains according to post-reproductive lifespan. The results indicated that prolonged post-reproductive lifespan was associated with relatively lower amount of fatty acids esterified to phospholipids compared to a free acid pool, thus implying phospholipid metabolism for the post-reproductive lifespan of yeast. In addition, phylogenetic analysis showed a correlation between nucleotide similarity and the reproductive potential or reproductive lifespan, but not to the longevity expressed in time units. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  1. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Science.gov (United States)

    Erickson, David L.; Jones, Frank A.; Swenson, Nathan G.; Pei, Nancai; Bourg, Norman A.; Chen, Wenna; Davies, Stuart J.; Ge, Xue-jun; Hao, Zhanqing; Howe, Robert W.; Huang, Chun-Lin; Larson, Andrew J.; Lum, Shawn K. Y.; Lutz, James A.; Ma, Keping; Meegaskumbura, Madhava; Mi, Xiangcheng; Parker, John D.; Fang-Sun, I.; Wright, S. Joseph; Wolf, Amy T.; Ye, W.; Xing, Dingliang; Zimmerman, Jess K.; Kress, W. John

    2014-01-01

    Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK, and psbA-trnH) and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance (PD) metrics that are commonly used to infer assembly processes were estimated for each plot [PD, Mean Phylogenetic Distance (MPD), and Mean Nearest Taxon Distance (MNTD)]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for individual plots, estimates of

  2. SILVA tree viewer: interactive web browsing of the SILVA phylogenetic guide trees

    OpenAIRE

    Beccati, Alan; Gerken, Jan; Quast, Christian; Yilmaz, Pelin; Glöckner, Frank Oliver

    2017-01-01

    Background Phylogenetic trees are an important tool to study the evolutionary relationships among organisms. The huge amount of available taxa poses difficulties in their interactive visualization. This hampers the interaction with the users to provide feedback for the further improvement of the taxonomic framework. Results The SILVA Tree Viewer is a web application designed for visualizing large phylogenetic trees without requiring the download of any software tool or data files. The SILVA T...

  3. One tree to link them all: a phylogenetic dataset for the European tetrapoda.

    Science.gov (United States)

    Roquet, Cristina; Lavergne, Sébastien; Thuiller, Wilfried

    2014-08-08

    Since the ever-increasing availability of phylogenetic informative data, the last decade has seen an upsurge of ecological studies incorporating information on evolutionary relationships among species. However, detailed species-level phylogenies are still lacking for many large groups and regions, which are necessary for comprehensive large-scale eco-phylogenetic analyses. Here, we provide a dataset of 100 dated phylogenetic trees for all European tetrapods based on a mixture of supermatrix and supertree approaches. Phylogenetic inference was performed separately for each of the main Tetrapoda groups of Europe except mammals (i.e. amphibians, birds, squamates and turtles) by means of maximum likelihood (ML) analyses of supermatrix applying a tree constraint at the family (amphibians and squamates) or order (birds and turtles) levels based on consensus knowledge. For each group, we inferred 100 ML trees to be able to provide a phylogenetic dataset that accounts for phylogenetic uncertainty, and assessed node support with bootstrap analyses. Each tree was dated using penalized-likelihood and fossil calibration. The trees obtained were well-supported by existing knowledge and previous phylogenetic studies. For mammals, we modified the most complete supertree dataset available on the literature to include a recent update of the Carnivora clade. As a final step, we merged the phylogenetic trees of all groups to obtain a set of 100 phylogenetic trees for all European Tetrapoda species for which data was available (91%). We provide this phylogenetic dataset (100 chronograms) for the purpose of comparative analyses, macro-ecological or community ecology studies aiming to incorporate phylogenetic information while accounting for phylogenetic uncertainty.

  4. Phylogenetic paleobiogeography of Late Ordovician Laurentian brachiopods

    Directory of Open Access Journals (Sweden)

    Jennifer E. Bauer

    2014-12-01

    Full Text Available Phylogenetic biogeographic analysis of four brachiopod genera was used to uncover large-scale geologic drivers of Late Ordovician biogeographic differentiation in Laurentia. Previously generated phylogenetic hypotheses were converted into area cladograms, ancestral geographic ranges were optimized and speciation events characterized as via dispersal or vicariance, when possible. Area relationships were reconstructed using Lieberman-modified Brooks Parsimony Analysis. The resulting area cladograms indicate tectonic and oceanographic changes were the primary geologic drivers of biogeographic patterns within the focal taxa. The Taconic tectophase contributed to the separation of the Appalachian and Central basins as well as the two midcontinent basins, whereas sea level rise following the Boda Event promoted interbasinal dispersal. Three migration pathways into the Cincinnati Basin were recognized, which supports the multiple pathway hypothesis for the Richmondian Invasion.

  5. Traditional knowledge on zootherapeutic uses by the Saharia tribe of Rajasthan, India.

    Science.gov (United States)

    Mahawar, Madan Mohan; Jaroli, D P

    2007-06-05

    The present zootherapeutic study describes the traditional knowledge related to the use of different animals and animal-derived products as medicines by the Saharia tribe reside in the Shahabad and Kishanganj Panchayat Samiti's of Baran district of Rajasthan, India. A field survey was conducted from April to June 2006 by performing interview through structured questionnaire with 21 selected respondents, who provided information regarding use of animals and their products in folk medicine. A total of 15 animal species were recorded and they are used for different ethnomedical purposes, including cough, asthma, tuberculosis, paralysis, earache, herpes, weakness, muscular pain etc. The zootherapeutic knowledge was mostly based on domestic animals, but some protected species like the peacock (Pavo cristatus,), hard shelled turtle (Kachuga tentoria), sambhar (Cervus unicolor) were also mentioned as medicinal resources. We would suggest that this kind of neglected traditional knowledge should be included into the strategies of conservation and management of faunistic resources. Further studies are required for experimental validation to confirm the presence of bioactive compounds in these traditional remedies and also to emphasize more sustainable use of these resources.

  6. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  7. Morphometric relationship, phylogenetic correlation, and character evolution in the species-rich genus Aphis (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim

    2010-07-01

    Full Text Available The species-rich genus Aphis consists of more than 500 species, many of them host-specific on a wide range of plants, yet very similar in general appearance due to convergence toward particular morphological types. Most species have been historically clustered into four main phenotypic groups (gossypii, craccivora, fabae, and spiraecola groups. To confirm the morphological hypotheses between these groups and to examine the characteristics that determine them, multivariate morphometric analyses were performed using 28 characters measured/counted from 40 species. To infer whether the morphological relationships are correlated with the genetic relationships, we compared the morphometric dataset with a phylogeny reconstructed from the combined dataset of three mtDNA and one nuclear DNA regions.Based on a comparison of morphological and molecular datasets, we confirmed morphological reduction or regression in the gossypii group unlike in related groups. Most morphological characteristics of the gossypii group were less variable than for the other groups. Due to these, the gossypii group could be morphologically well separated from the craccivora, fabae, and spiraecola groups. In addition, the correlation of the rates of evolution between morphological and DNA datasets was highly significant in their diversification.The morphological separation between the gossypii group and the other species-groups are congruent with their phylogenetic relationships. Analysis of trait evolution revealed that the morphological traits found to be significant based on the morphometric analyses were confidently correlated with the phylogeny. The dominant patterns of trait evolution resulting in increased rates of short branches and temporally later evolution are likely suitable for the modality of Aphis speciation because they have adapted species-specifically, rapidly, and more recently on many different host plants.

  8. Phylogenetic congruence between subtropical trees and their associated fungi.

    Science.gov (United States)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S; Gilbert, Gregory S; Yu, Shixiao

    2016-12-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi in has rarely been investigated. Using next-generation high-throughput DNA sequencing techniques, we analyzed fungal taxa associated with diseased leaves, rotten seeds, and infected seedlings of subtropical trees. We compared the topologies of the phylogenetic trees of the soil and foliar fungi based on the internal transcribed spacer (ITS) region with the phylogeny of host tree species based on matK , rbcL , atpB, and 5.8S genes. We identified 37 foliar and 103 soil pathogenic fungi belonging to the Ascomycota and Basidiomycota phyla and detected significantly nonrandom host-fungus combinations, which clustered on both the fungus phylogeny and the host phylogeny. The explicit evidence of congruent phylogenies between tree hosts and their potential fungal pathogens suggests either diffuse coevolution among the plant-fungal interaction networks or that the distribution of fungal species tracked spatially associated hosts with phylogenetically conserved traits and habitat preferences. Phylogenetic conservatism in plant-fungal interactions within a local community promotes host and parasite specificity, which is integral to the important role of fungi in promoting species coexistence and maintaining biodiversity of forest communities.

  9. Phylogenetic constrains on mycorrhizal specificity in eight Dendrobium (Orchidaceae) species.

    Science.gov (United States)

    Xing, Xiaoke; Ma, Xueting; Men, Jinxin; Chen, Yanhong; Guo, Shunxing

    2017-05-01

    Plant phylogeny constrains orchid mycorrhizal (OrM) fungal community composition in some orchids. Here, we investigated the structures of the OrM fungal communities of eight Dendrobium species in one niche to determine whether similarities in the OrM fungal communities correlated with the phylogeny of the host plants and whether the Dendrobium-OrM fungal interactions are phylogenetically conserved. A phylogeny based on DNA data was constructed for the eight coexisting Dendrobium species, and the OrM fungal communities were characterized by their roots. There were 31 different fungal lineages associated with the eight Dendrobium species. In total, 82.98% of the identified associations belonging to Tulasnellaceae, and a smaller proportion involved members of the unknown Basidiomycota (9.67%). Community analyses revealed that phylogenetically related Dendrobium tended to interact with a similar set of Tulasnellaceae fungi. The interactions between Dendrobium and Tulasnellaceae fungi were significantly influenced by the phylogenetic relationships among the Dendrobium species. Our results provide evidence that the mycorrhizal specificity in the eight coexisting Dendrobium species was phylogenetically conserved.

  10. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  11. Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

    Science.gov (United States)

    Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

    2005-11-01

    Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

  12. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  13. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  14. Phylogenetic relationships in the genus Leonardoxa (Leguminosae: Caesalpinioideae) inferred from chloroplast trnL intron and trnL-trnF intergenic spacer sequences.

    Science.gov (United States)

    Brouat, Carine; Gielly, Ludovic; McKey, Doyle

    2001-01-01

    The African genus LEONARDOXA: (Leguminosae: Caesalpinioideae) comprises two Congolean species and a group of four mostly allopatric subspecies principally located in Cameroon and clustered together in the L. africana complex. LEONARDOXA: provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms, as it exhibits various grades of ant-plant interactions from diffuse to obligate and symbiotic associations. We present in this paper the first molecular phylogenetic study of this genus. We sequenced both the chloroplast DNA trnL intron (677 aligned base pairs [bp]) and trnL-trnF intergene spacer (598 aligned bp). Inferred phylogenetic relationships suggested first that the genus is paraphyletic. The L. africana complex is clearly separated from the two Congolean species, and the integrity of the genus is thus in question. In the L. africana complex, our data showed a lack of congruence between clades suggested by morphological and chloroplast characters. This, and the low level of molecular divergence found between subspecies, suggests gene flow and introgressive events in the L. africana complex.

  15. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  16. The Independent Evolution Method Is Not a Viable Phylogenetic Comparative Method.

    Directory of Open Access Journals (Sweden)

    Randi H Griffin

    Full Text Available Phylogenetic comparative methods (PCMs use data on species traits and phylogenetic relationships to shed light on evolutionary questions. Recently, Smaers and Vinicius suggested a new PCM, Independent Evolution (IE, which purportedly employs a novel model of evolution based on Felsenstein's Adaptive Peak Model. The authors found that IE improves upon previous PCMs by producing more accurate estimates of ancestral states, as well as separate estimates of evolutionary rates for each branch of a phylogenetic tree. Here, we document substantial theoretical and computational issues with IE. When data are simulated under a simple Brownian motion model of evolution, IE produces severely biased estimates of ancestral states and changes along individual branches. We show that these branch-specific changes are essentially ancestor-descendant or "directional" contrasts, and draw parallels between IE and previous PCMs such as "minimum evolution". Additionally, while comparisons of branch-specific changes between variables have been interpreted as reflecting the relative strength of selection on those traits, we demonstrate through simulations that regressing IE estimated branch-specific changes against one another gives a biased estimate of the scaling relationship between these variables, and provides no advantages or insights beyond established PCMs such as phylogenetically independent contrasts. In light of our findings, we discuss the results of previous papers that employed IE. We conclude that Independent Evolution is not a viable PCM, and should not be used in comparative analyses.

  17. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  19. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  20. Patterns of forest phylogenetic community structure across the United States and their possible forest health implications

    Science.gov (United States)

    Kevin M. Potter; Frank H. Koch

    2014-01-01

    The analysis of phylogenetic relationships among co-occurring tree species offers insights into the ecological organization of forest communities from an evolutionary perspective and, when employed regionally across thousands of plots, can assist in forest health assessment. Phylogenetic clustering of species, when species are more closely related than expected by...

  1. Dental caries experience and treatment needs of green marble mine laborers in Udaipur district, Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Duraiswamy Prabu

    2008-01-01

    Full Text Available Background and Objectives: The study was undertaken at Kesariyaji, located in Udaipur district of Rajasthan. There are about 3 million workers who marble mine at Rajasthan. Living conditions of these workers are substandard and most of them are immigrant workers living in tiny shacks. Majority of them belong to lower socioeconomic status with poor educational background. The present study was carried out to estimate dental caries prevalence and treatment needs of laborers working in the green marble mines of Udaipur district. Basic Research Design: The data was collected using the methods and standards recommended by the WHO. Dentition status and treatment needs along with decayed, missing, and filled teeth (DMFT index, and decayed, missing, and filled surfaces score were recorded. Standard error of mean was calculated for all the mean values of treatment needs. There were three examiners, who were trained before the survey for inter-examiner variability, and the reliability was tested by means of weighted kappa statistics, which was 90%. Participants: The study population comprised 513 men in four age groups of 18-25, 26-34, 35-44, and 45-54 years, respectively. Results: The mean DMFT for all age groups was 3.13 with highest mean of 4.0 for the age group of 45-54 years. Mean decayed teeth were 2.60, 3.33, 1.46, and 1.5 for the age groups 15-24, 25-34, 35-44, and 45-54 years, respectively. Filled component was nil for all age groups. Most of the subjects required one surface filling with a very less proportion needing pulp care. Conclusions: The missing component constituted the major part of DMFT index in the 45-54 years age group and the absence of filled component in the whole study population implies that the treatment needs of the study population are unmet. Thus, intervention in the form of oral health promotion and curative services are the need of the hour.

  2. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  3. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

  4. Phylogenetic relationships and generic delimitation in Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA sequence data

    DEFF Research Database (Denmark)

    Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats

    2009-01-01

    Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...

  5. Phylogenetic Relationships of Cucullanidae (Nematoda), with Observations on Seuratoidea and the Monophyly of Cucullanus, Dichelyne and Truttaedacnitis.

    Science.gov (United States)

    Choudhury, Anindo; Nadler, Steven A

    2016-02-01

    The phylogenetic relationships of Cucullanidae were explored using near-complete sequences of the 18S rDNA (rRNA gene). Sequences (1,750-1,760 bp) were obtained from 7 species of Cucullanidae belonging to 3 genera, Cucullanus (2 spp.), Dichelyne (2 spp.), Truttaedacnitis (3 spp.), and 1 species of Quimperiidae ( Paraseuratum sp.). These sequences were aligned with those of 128 other nematode species available in GenBank, including 3 other cucullanids (Dichelyne mexicanus, Cucullanus robustus, and Cucullanus baylisi) and 2 non-cucullanid seuratoids (Paraquimperia africana, and Linstowinema sp.). Bayesian (BPP) and maximum likelihood (ML) analyses of 2 different datasets strongly supported a monophyletic Cucullanidae. Bayesian analysis placed this family as the sister group to a clade containing species of Diplogasterida, Strongylida, Rhabditida, and Tylenchida with very strong support. Neither BPP nor ML analyses recovered a close relationship of Cucullanidae to Ascaridida. None of the 3 non-cucullanid seuratoid species were sister to Cucullanidae, nor did they form a monophyletic group of their own, which questions the monophyly of Seuratoidea and the relationships among species within this superfamily. The 3 genera of cucullanids were also not monophyletic, although morphologically similar species such as the 2 species of Cucullanus from Neotropical catfishes and 2 species of Dichelyne from Nearctic ictalurid catfishes were sister taxa with strong support. The results were ambiguous with respect to the relationship of 2 Truttaedacnitis spp. in Nearctic freshwater fishes but do not support Truttaedacnitis heterodonti, a parasite of heterodontid sharks, as belonging to this genus. The study shows that all aspects of the conventional classification of Seuratoidea and its taxa should be scrutinized by even more extensive sampling across hosts and habitats.

  6. Karyotypic evolution and phylogenetic relationships in the order Chiroptera as revealed by G-banding comparison and chromosome painting.

    Science.gov (United States)

    Ao, Lei; Mao, Xiuguang; Nie, Wenhui; Gu, Xiaoming; Feng, Qing; Wang, Jinhuan; Su, Weiting; Wang, Yingxiang; Volleth, Marianne; Yang, Fengtang

    2007-01-01

    Bats are a unique but enigmatic group of mammals and have a world-wide distribution. The phylogenetic relationships of extant bats are far from being resolved. Here, we investigated the karyotypic relationships of representative species from four families of the order Chiroptera by comparative chromosome painting and banding. A complete set of painting probes derived from flow-sorted chromosomes of Myotis myotis (family Vespertilionidae) were hybridized onto metaphases of Cynopterus sphinx (2n = 34, family Pteropodidae), Rhinolophus sinicus (2n=36, family Rhinolophidae) and Aselliscus stoliczkanus (2n=30, family Hipposideridae) and delimited 27, 30 and 25 conserved chromosomal segments in the three genomes, respectively. The results substantiate that Robertsonian translocation is the main mode of chromosome evolution in the order Chiroptera, with extensive conservation of whole chromosomal arms. The use of M. myotis (2n=44) probes has enabled the integration of C. sphinx, R. sinicus and A. stoliczkanus chromosomes into the previously established comparative maps between human and Eonycteris spelaea (2n=36), Rhinolophus mehelyi (2n=58), Hipposideros larvatus (2n=32), and M. myotis. Our results provide the first cytogenetic signature rearrangement that supports the grouping of Pteropodidae and Rhinolophoidea in a common clade (i.e. Pteropodiformes or Yinpterochiroptera) and thus improve our understanding on the karyotypic relationships and genome phylogeny of these bat species.

  7. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  8. Studying the evolutionary relationships and phylogenetic trees of 21 groups of tRNA sequences based on complex networks.

    Science.gov (United States)

    Wei, Fangping; Chen, Bowen

    2012-03-01

    To find out the evolutionary relationships among different tRNA sequences of 21 amino acids, 22 networks are constructed. One is constructed from whole tRNAs, and the other 21 networks are constructed from the tRNAs which carry the same amino acids. A new method is proposed such that the alignment scores of any two amino acids groups are determined by the average degree and the average clustering coefficient of their networks. The anticodon feature of isolated tRNA and the phylogenetic trees of 21 group networks are discussed. We find that some isolated tRNA sequences in 21 networks still connect with other tRNAs outside their group, which reflects the fact that those tRNAs might evolve by intercrossing among these 21 groups. We also find that most anticodons among the same cluster are only one base different in the same sites when S ≥ 70, and they stay in the same rank in the ladder of evolutionary relationships. Those observations seem to agree on that some tRNAs might mutate from the same ancestor sequences based on point mutation mechanisms.

  9. Drainage Characteristics of Tectonically Active Areas: An Example from Rajasthan, India

    Directory of Open Access Journals (Sweden)

    SWATI JAIN

    2010-06-01

    Full Text Available The morphotectonic studies help in deciphering the role of tectonics and neotectonics in morphological evolution of drainage basins. On the basis of remote sensing technique, the relationship between morphology and tectonics have been investigated in Bundi-Indergarh sector of southeast Rajasthan. The area selected for present study is drained by Mej river and its tributaries and occupies the southeastern part of the Aravalli Mountain Range (AMR. The course of Mej river is mostly controlled by the Great Boundary Thrust (GBT and associated tectonic elements. GBT separates the folded, faulted and metamorphosed older rocks of the AMR in the west and relatively undeformed Vindhyan rocks in the east. This study has been carried out using digital and hard copy product of IRS 1C/1D LISS III geocoded FCC data. The morphometric and morphotectonic aspects have been studied for identification of present day tectonic activities in the area. The remote sensing data interpretation indicates that the landforms of the area are structurally controlled and mainly covered by linear and parallel strike ridges and valleys. These valleys indicate sign of stream rejuvenation and occasional presence of dynamic ravines. General morphometric parameters, bifurcation ratio, stream length and shape parameters have been computed. Longitudinal river profiles can be quantified by normalizing the elevation and the distance along rivers. Several parameters such as profile shape (concavity, gradient fluctuations, river grade and valley incision have been derived from longitudinal river profile. These quantified parameters and their interrelations are useful in comparing different drainage basins and also help drawing inferences on neotectonism. The computed values suggest that the area is covered by resistant rock and drainage network, affected by tectonic distur-bance. The valley floor ratio is very low, indicating channel down cutting vis-a-vis ground uplift. The gradient index

  10. Inferring 'weak spots' in phylogenetic trees: application to mosasauroid nomenclature.

    Science.gov (United States)

    Madzia, Daniel; Cau, Andrea

    2017-01-01

    Mosasauroid squamates represented the apex predators within the Late Cretaceous marine and occasionally also freshwater ecosystems. Proper understanding of the origin of their ecological adaptations or paleobiogeographic dispersals requires adequate knowledge of their phylogeny. The studies assessing the position of mosasauroids on the squamate evolutionary tree and their origins have long given conflicting results. The phylogenetic relationships within Mosasauroidea, however, have experienced only little changes throughout the last decades. Considering the substantial improvements in the development of phylogenetic methodology that have undergone in recent years, resulting, among others, in numerous alterations in the phylogenetic hypotheses of other fossil amniotes, we test the robustness in our understanding of mosasauroid beginnings and their evolutionary history. We re-examined a data set that results from modifications assembled in the course of the last 20 years and performed multiple parsimony analyses and Bayesian tip-dating analysis. Following the inferred topologies and the 'weak spots' in the phylogeny of mosasauroids, we revise the nomenclature of the 'traditionally' recognized mosasauroid clades, to acknowledge the overall weakness among branches and the alternative topologies suggested previously, and discuss several factors that might have an impact on the differing phylogenetic hypotheses and their statistical support.

  11. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  12. Applying a multiobjective metaheuristic inspired by honey bees to phylogenetic inference.

    Science.gov (United States)

    Santander-Jiménez, Sergio; Vega-Rodríguez, Miguel A

    2013-10-01

    The development of increasingly popular multiobjective metaheuristics has allowed bioinformaticians to deal with optimization problems in computational biology where multiple objective functions must be taken into account. One of the most relevant research topics that can benefit from these techniques is phylogenetic inference. Throughout the years, different researchers have proposed their own view about the reconstruction of ancestral evolutionary relationships among species. As a result, biologists often report different phylogenetic trees from a same dataset when considering distinct optimality principles. In this work, we detail a multiobjective swarm intelligence approach based on the novel Artificial Bee Colony algorithm for inferring phylogenies. The aim of this paper is to propose a complementary view of phylogenetics according to the maximum parsimony and maximum likelihood criteria, in order to generate a set of phylogenetic trees that represent a compromise between these principles. Experimental results on a variety of nucleotide data sets and statistical studies highlight the relevance of the proposal with regard to other multiobjective algorithms and state-of-the-art biological methods. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Traditional knowledge on zootherapeutic uses by the Saharia tribe of Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Jaroli DP

    2007-06-01

    Full Text Available Abstract The present zootherapeutic study describes the traditional knowledge related to the use of different animals and animal-derived products as medicines by the Saharia tribe reside in the Shahabad and Kishanganj Panchayat Samiti's of Baran district of Rajasthan, India. A field survey was conducted from April to June 2006 by performing interview through structured questionnaire with 21 selected respondents, who provided information regarding use of animals and their products in folk medicine. A total of 15 animal species were recorded and they are used for different ethnomedical purposes, including cough, asthma, tuberculosis, paralysis, earache, herpes, weakness, muscular pain etc. The zootherapeutic knowledge was mostly based on domestic animals, but some protected species like the peacock (Pavo cristatus,, hard shelled turtle (Kachuga tentoria, sambhar (Cervus unicolor were also mentioned as medicinal resources. We would suggest that this kind of neglected traditional knowledge should be included into the strategies of conservation and management of faunistic resources. Further studies are required for experimental validation to confirm the presence of bioactive compounds in these traditional remedies and also to emphasize more sustainable use of these resources.

  14. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  15. treeman: an R package for efficient and intuitive manipulation of phylogenetic trees.

    Science.gov (United States)

    Bennett, Dominic J; Sutton, Mark D; Turvey, Samuel T

    2017-01-07

    Phylogenetic trees are hierarchical structures used for representing the inter-relationships between biological entities. They are the most common tool for representing evolution and are essential to a range of fields across the life sciences. The manipulation of phylogenetic trees-in terms of adding or removing tips-is often performed by researchers not just for reasons of management but also for performing simulations in order to understand the processes of evolution. Despite this, the most common programming language among biologists, R, has few class structures well suited to these tasks. We present an R package that contains a new class, called TreeMan, for representing the phylogenetic tree. This class has a list structure allowing phylogenetic trees to be manipulated more efficiently. Computational running times are reduced because of the ready ability to vectorise and parallelise methods. Development is also improved due to fewer lines of code being required for performing manipulation processes. We present three use cases-pinning missing taxa to a supertree, simulating evolution with a tree-growth model and detecting significant phylogenetic turnover-that demonstrate the new package's speed and simplicity.

  16. Genetic and phylogenetic analysis of ten Gobiidae species in China ...

    African Journals Online (AJOL)

    To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...

  17. Age of initial cohort of dengue patients could explain the origin of disease outbreak in a setting: a case control study in Rajasthan, India.

    Science.gov (United States)

    Angel, Annette; Angel, Bennet; Yadav, Karuna; Sharma, Neha; Joshi, Vinod; Thanvi, Indu; Thanvi, Sharad

    2017-06-01

    Dengue fever (DF) and dengue hemorrhagic fever (DHF) is a public health problem with 390 million cases reported in world annually. In Rajasthan, DF with DHF is being reported for about two decades. For undertaking interventions into disease transmission, locating origin of transmission is very important. Present paper reports retrospective analysis of the hospital reported cases of dengue during the year 2013-2014 undertaken in Barmer, Rajasthan. To address task of investigating outbreak, detailed analysis of the data on serological test results (Mac-ELISA assay of NS1, IgG and IgM) performed by local hospital, Balotra was made. The domestic breeding containers were examined for the presence of larvae and adult forms of Aedes aegypti by visiting individual households as well as common places of human aggregation like schools and hospitals. The analysis showed that first dengue cases started from the lot of school going children and then followed by adults and finally during peak period of infection only children around 1-2 years got infected. The subsequent entomological investigations during the outbreak showed school as principal source of mosquito breeding. Present investigations highlight that schools (March to April) play the role of primary sites of disease transmission and should be preferred for undertaking vector control operations to prevent dengue transmission from getting aggravated.

  18. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  19. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  20. Taxonomic colouring of phylogenetic trees of protein sequences

    Directory of Open Access Journals (Sweden)

    Andrade-Navarro Miguel A

    2006-02-01

    Full Text Available Abstract Background Phylogenetic analyses of protein families are used to define the evolutionary relationships between homologous proteins. The interpretation of protein-sequence phylogenetic trees requires the examination of the taxonomic properties of the species associated to those sequences. However, there is no online tool to facilitate this interpretation, for example, by automatically attaching taxonomic information to the nodes of a tree, or by interactively colouring the branches of a tree according to any combination of taxonomic divisions. This is especially problematic if the tree contains on the order of hundreds of sequences, which, given the accelerated increase in the size of the protein sequence databases, is a situation that is becoming common. Results We have developed PhyloView, a web based tool for colouring phylogenetic trees upon arbitrary taxonomic properties of the species represented in a protein sequence phylogenetic tree. Provided that the tree contains SwissProt, SpTrembl, or GenBank protein identifiers, the tool retrieves the taxonomic information from the corresponding database. A colour picker displays a summary of the findings and allows the user to associate colours to the leaves of the tree according to any number of taxonomic partitions. Then, the colours are propagated to the branches of the tree. Conclusion PhyloView can be used at http://www.ogic.ca/projects/phyloview/. A tutorial, the software with documentation, and GPL licensed source code, can be accessed at the same web address.

  1. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  2. Transcriptome sequences resolve deep relationships of the grape family.

    Science.gov (United States)

    Wen, Jun; Xiong, Zhiqiang; Nie, Ze-Long; Mao, Likai; Zhu, Yabing; Kan, Xian-Zhao; Ickert-Bond, Stefanie M; Gerrath, Jean; Zimmer, Elizabeth A; Fang, Xiao-Dong

    2013-01-01

    Previous phylogenetic studies of the grape family (Vitaceae) yielded poorly resolved deep relationships, thus impeding our understanding of the evolution of the family. Next-generation sequencing now offers access to protein coding sequences very easily, quickly and cost-effectively. To improve upon earlier work, we extracted 417 orthologous single-copy nuclear genes from the transcriptomes of 15 species of the Vitaceae, covering its phylogenetic diversity. The resulting transcriptome phylogeny provides robust support for the deep relationships, showing the phylogenetic utility of transcriptome data for plants over a time scale at least since the mid-Cretaceous. The pros and cons of transcriptome data for phylogenetic inference in plants are also evaluated.

  3. Ecosystem productivity is associated with bacterial phylogenetic distance in surface marine waters.

    Science.gov (United States)

    Galand, Pierre E; Salter, Ian; Kalenitchenko, Dimitri

    2015-12-01

    Understanding the link between community diversity and ecosystem function is a fundamental aspect of ecology. Systematic losses in biodiversity are widely acknowledged but the impact this may exert on ecosystem functioning remains ambiguous. There is growing evidence of a positive relationship between species richness and ecosystem productivity for terrestrial macro-organisms, but similar links for marine micro-organisms, which help drive global climate, are unclear. Community manipulation experiments show both positive and negative relationships for microbes. These previous studies rely, however, on artificial communities and any links between the full diversity of active bacterial communities in the environment, their phylogenetic relatedness and ecosystem function remain hitherto unexplored. Here, we test the hypothesis that productivity is associated with diversity in the metabolically active fraction of microbial communities. We show in natural assemblages of active bacteria that communities containing more distantly related members were associated with higher bacterial production. The positive phylogenetic diversity-productivity relationship was independent of community diversity calculated as the Shannon index. From our long-term (7-year) survey of surface marine bacterial communities, we also found that similarly, productive communities had greater phylogenetic similarity to each other, further suggesting that the traits of active bacteria are an important predictor of ecosystem productivity. Our findings demonstrate that the evolutionary history of the active fraction of a microbial community is critical for understanding their role in ecosystem functioning. © 2015 John Wiley & Sons Ltd.

  4. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  5. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  7. Maternal Factors Associated with Nutritional Status of 1-5 years Children Residing in Field Practice Area of Rural Health Training Centre Naila, Jaipur (Rajasthan) India

    OpenAIRE

    Lokesh Sonkaria, Afifa Zafer, Kusum Lata Gaur, Ravindra Kumar Manohar

    2014-01-01

    Background: Good nutrition bene-fits families, their communities and the world as a whole. Maternal factors are important in maintaining the nutrition of 1-5 year children. Objective: To ascertain the association of maternal factors with nutrition of 1-5 year children. Materials and Methods: A community based cross sectional descriptive type of observational study was carried out in the field practice area of RHTC Naila in Jaipur district of Rajasthan. 30 Cluster sampling technique was ...

  8. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  9. Phylogenetic relationships and evolutionary history of the greater horseshoe bat, Rhinolophus ferrumequinum, in Northeast Asia.

    Science.gov (United States)

    Liu, Tong; Sun, Keping; Park, Yung Chul; Feng, Jiang

    2016-01-01

    The greater horseshoe bat, Rhinolophus ferrumequinum , is an important model organism for studies on chiropteran phylogeographic patterns. Previous studies revealed the population history of R. ferrumequinum from Europe and most Asian regions, yet there continue to be arguments about their evolutionary process in Northeast Asia. In this study, we obtained mitochondrial DNA cyt b and D-loop data of R. ferrumequinum from Northeast China, South Korea and Japan to clarify their phylogenetic relationships and evolutionary process. Our results indicate a highly supported monophyletic group of Northeast Asian greater horseshoe bats, in which Japanese populations formed a single clade and clustered into the mixed branches of Northeast Chinese and South Korean populations. We infer that R. ferrumequinum in Northeast Asia originated in Northeast China and South Korea during a cold glacial period, while some ancestors likely arrived in Japan by flying or land bridge and subsequently adapted to the local environment. Consequently, during the warm Eemian interglaciation, the Korea Strait, between Japan and South Korea, became a geographical barrier to Japanese and inland populations, while the Changbai Mountains, between China and North Korea, did not play a significant role as a barrier between Northeast China and South Korea populations.

  10. Phylogenetic placement of two species known only from resting spores

    DEFF Research Database (Denmark)

    Hajek, Ann E; Gryganskyi, Andrii; Bittner, Tonya

    2016-01-01

    resting spores, Zoophthora independentia, infecting Tipula (Lunatipula) submaculata in New York State, is now described as a new species and Tarichium porteri, described in 1942, which infects Tipula (Triplicitipula) colei in Tennessee, is transferred to the genus Zoophthora. We have shown that use......Molecular methods were used to determine the generic placement of two species of Entomophthorales known only from resting spores. Historically, these species would belong in the form-genus Tarichium, but this classification provides no information about phylogenetic relationships. Using DNA from...... of molecular methods can assist with determination of the phylogenetic relations of specimens within the form-genus Tarichium for an already described species and a new species for which only resting spores are available....

  11. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  12. Increased competition does not lead to increased phylogenetic overdispersion in a native grassland.

    Science.gov (United States)

    Bennett, Jonathan A; Lamb, Eric G; Hall, Jocelyn C; Cardinal-McTeague, Warren M; Cahill, James F

    2013-09-01

    That competition is stronger among closely related species and leads to phylogenetic overdispersion is a common assumption in community ecology. However, tests of this assumption are rare and field-based experiments lacking. We tested the relationship between competition, the degree of relatedness, and overdispersion among plants experimentally and using a field survey in a native grassland. Relatedness did not affect competition, nor was competition associated with phylogenetic overdispersion. Further, there was only weak evidence for increased overdispersion at spatial scales where plants are likely to compete. These results challenge traditional theory, but are consistent with recent theories regarding the mechanisms of plant competition and its potential effect on phylogenetic structure. We suggest that specific conditions related to the form of competition and trait conservatism must be met for competition to cause phylogenetic overdispersion. Consequently, overdispersion as a result of competition is likely to be rare in natural communities. © 2013 John Wiley & Sons Ltd/CNRS.

  13. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  14. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  15. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  16. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  17. Constructing level-2 phylogenetic networks from triplets

    OpenAIRE

    Iersel, Leo; Keijsper, J.C.M.; Kelk, Steven; Stougie, Leen; Hagen, F.; Boekhout, T.; Vingron, M.; Wong, L.

    2009-01-01

    htmlabstractJansson and Sung showed that, given a dense set of input triplets T (representing hypotheses about the local evolutionary relationships of triplets of taxa), it is possible to determine in polynomial time whether there exists a level-1 network consistent with T, and if so to construct such a network (Inferring a Level-1 Phylogenetic Network from a Dense Set of Rooted Triplets, Theoretical Computer Science, 363, pp. 60-68 (2006)). Here we extend this work by showing that this probl...

  18. Transcriptome sequences resolve deep relationships of the grape family.

    Directory of Open Access Journals (Sweden)

    Jun Wen

    Full Text Available Previous phylogenetic studies of the grape family (Vitaceae yielded poorly resolved deep relationships, thus impeding our understanding of the evolution of the family. Next-generation sequencing now offers access to protein coding sequences very easily, quickly and cost-effectively. To improve upon earlier work, we extracted 417 orthologous single-copy nuclear genes from the transcriptomes of 15 species of the Vitaceae, covering its phylogenetic diversity. The resulting transcriptome phylogeny provides robust support for the deep relationships, showing the phylogenetic utility of transcriptome data for plants over a time scale at least since the mid-Cretaceous. The pros and cons of transcriptome data for phylogenetic inference in plants are also evaluated.

  19. Phylogenetic tree based on complete genomes using fractal and correlation analyses without sequence alignment

    Directory of Open Access Journals (Sweden)

    Zu-Guo Yu

    2006-06-01

    Full Text Available The complete genomes of living organisms have provided much information on their phylogenetic relationships. Similarly, the complete genomes of chloroplasts have helped resolve the evolution of this organelle in photosynthetic eukaryotes. In this review, we describe two algorithms to construct phylogenetic trees based on the theories of fractals and dynamic language using complete genomes. These algorithms were developed by our research group in the past few years. Our distance-based phylogenetic tree of 109 prokaryotes and eukaryotes agrees with the biologists' "tree of life" based on the 16S-like rRNA genes in a majority of basic branchings and most lower taxa. Our phylogenetic analysis also shows that the chloroplast genomes are separated into two major clades corresponding to chlorophytes s.l. and rhodophytes s.l. The interrelationships among the chloroplasts are largely in agreement with the current understanding on chloroplast evolution.

  20. Application of isotopes and chemistry in unsaturated zone in arid areas of Rajasthan, India

    International Nuclear Information System (INIS)

    Navada, S.V.; Nair, A.R.; Sinha, U.K.; Kulkarni, U.P.; Joseph, T.B.

    2001-01-01

    Isotopes and chemistry of unsaturated zone soil profiles in Saraf ki Dani, Sihania and Lakrasar site in Barmer district of western Rajasthan, and precipitation samples collected at Chohtan, the nearest meteorological station, have been used to study groundwater recharge and to characterise the behaviour of contaminants in the subsurface. Soil water was extracted by vacuum distillation and analysed for 2 H and 18 O, whereas elutriation methods were used for chemistry. Based on the observed chloride profiles, groundwater recharge rates are estimated to be ∼10 to 18 mm per annum for the above sites. δ 18 O profiles at Sihania and Lakrasar (1999), reveal depleted δ 18 O values observed at a depth of ∼2 m, possibly due to an episode of heavy rains during 1998. Depthwise distribution of of F - , SO 4 -2 and NO 3 - at Sihania site II (1999) and δ 18 O signatures confirm that evaporative concentration occurs during dry periods. Enrichment of NO 3 - in the profiles may be related to fixation of nitrogen by leguminous plants. (author)

  1. Mitogenomic phylogenetic analyses of the Delphinidae with an emphasis on the Globicephalinae

    DEFF Research Database (Denmark)

    Mouatt, Julia Thidamarth Vilstrup; Ho, Simon Y. W.; Foote, Andrew David

    2011-01-01

    Previous DNA-based phylogenetic studies of the Delphinidae family suggest it has undergone rapid diversification, as characterised by unresolved and poorly supported taxonomic relationships (polytomies) for some of the species within this group. Using an increased amount of sequence data we test ...

  2. Phylogenetic reassessment of Specklinia and its allied genera in the pleurothallidinae (Orchidaceae)

    NARCIS (Netherlands)

    Karremans, Adam P.; Albertazzi, Federico J.; Bakker, Freek T.; Bogarín, Diego; Eurlings, M.C.M.; Pridgeon, Alec; Pupulin, Franco; Gravendeel, Barbara

    2016-01-01

    The phylogenetic relationships within Specklinia (Pleurothallidinae; Orchidaceae) and related genera are re-evaluated using Bayesian analyses of nrITS and chloroplast matK sequence data of a wide sampling of species. Specklinia is found paraphyletic in the DNA based trees, with species

  3. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities

    Directory of Open Access Journals (Sweden)

    Anthony Stuart Amend

    2015-02-01

    Full Text Available Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity. This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between phylogenetic diversity and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial phylogenetic diversity, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of sixty-six days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial phylogenetic diversity failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which phylogenetic diversity predicts ecosystem function will depend on environmental context.

  4. Beyond Linear Sequence Comparisons: The use of genome-levelcharacters for phylogenetic reconstruction

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2004-11-27

    Although the phylogenetic relationships of many organisms have been convincingly resolved by the comparisons of nucleotide or amino acid sequences, others have remained equivocal despite great effort. Now that large-scale genome sequencing projects are sampling many lineages, it is becoming feasible to compare large data sets of genome-level features and to develop this as a tool for phylogenetic reconstruction that has advantages over conventional sequence comparisons. Although it is unlikely that these will address a large number of evolutionary branch points across the broad tree of life due to the infeasibility of such sampling, they have great potential for convincingly resolving many critical, contested relationships for which no other data seems promising. However, it is important that we recognize potential pitfalls, establish reasonable standards for acceptance, and employ rigorous methodology to guard against a return to earlier days of scenario-driven evolutionary reconstructions.

  5. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  6. Factors associated with second trimester abortion in rural Maharashtra and Rajasthan, India.

    Science.gov (United States)

    Zavier, A J Francis; Jejeebhoy, Shireen; Kalyanwala, Shveta

    2012-01-01

    Many married women in India experience abortion in their second trimester of pregnancy. While there is an impression that second trimester abortions are now overwhelmingly used for sex selection, little is known about the extent to which second trimester abortions are indeed associated with son preference and sex selection motives, relative to other factors. Using data from a community-based study in rural Maharashtra and Rajasthan, research highlights the role of limited access in explaining second trimester abortion. While women with a single child who was a daughter were indeed more likely than other women to have terminated a pregnancy carrying a female foetus in the second trimester, more strikingly, exclusion from abortion-related decision-making, unsuccessful prior attempts to terminate the pregnancy, and distance from the facility in which their abortion was performed, were significantly associated with second trimester abortion, even after controlling for confounding factors. The study calls for greater efficiency in implementing the PCPNDT Act and addressing deep-rooted son preference. At the same time, findings that poverty and limited access to facilities are as, if not more, important drivers of second trimester abortion, highlight the need to meet commitments to ensure accessible abortion facilities for poor rural women.

  7. Methods of selection and training of personnel for the Rajasthan atomic power station

    International Nuclear Information System (INIS)

    Sarma, M.S.R.; Wagadarikar, V.K.

    1975-01-01

    Personnel selected to work in a nuclear electric generating station rarely have the necessary knowledge and experience in all the related fields. A station can be operated and maintained and at the same time radiation doses absorbed by station personnel can be kept to a minimum only if the operating personnel are familiar with, and can be used for, all phases of station operation and the maintainers have more than one skill or trade. More technical knowledge and more diversified skills, in addition to those required in other industries, are needed because of the nature of the nuclear reactor and the associated radiation environment and high automation. A training programme has been developed at the Nuclear Training Centre (NTC) near the Rajasthan Atomic Power Station (RAPS), Kota, India, to cater to the needs of the operation and maintenance personnel for nuclear power stations including the Madras Atomic Power Station. This programme has been in operation for the last five years. The paper describes the method of recruitment/selection of various categories of personnel and the method of training them to meet the job requirements. (author)

  8. Description of new mitochondrial genomes (Spodoptera litura, Noctuoidea and Cnaphalocrocis medinalis, Pyraloidea) and phylogenetic reconstruction of Lepidoptera with the comment on optimization schemes.

    Science.gov (United States)

    Wan, Xinlong; Kim, Min Jee; Kim, Iksoo

    2013-11-01

    We newly sequenced mitochondrial genomes of Spodoptera litura and Cnaphalocrocis medinalis belonging to Lepidoptera to obtain further insight into mitochondrial genome evolution in this group and investigated the influence of optimal strategies on phylogenetic reconstruction of Lepidoptera. Estimation of p-distances of each mitochondrial gene for available taxonomic levels has shown the highest value in ND6, whereas the lowest values in COI and COII at the nucleotide level, suggesting different utility of each gene for different hierarchical group when individual genes are utilized for phylogenetic analysis. Phylogenetic analyses mainly yielded the relationships (((((Bombycoidea + Geometroidea) + Noctuoidea) + Pyraloidea) + Papilionoidea) + Tortricoidea), evidencing the polyphyly of Macrolepidoptera. The Noctuoidea concordantly recovered the familial relationships (((Arctiidae + Lymantriidae) + Noctuidae) + Notodontidae). The tests of optimality strategies, such as exclusion of third codon positions, inclusion of rRNA and tRNA genes, data partitioning, RY recoding approach, and recoding nucleotides into amino acids suggested that the majority of the strategies did not substantially alter phylogenetic topologies or nodal supports, except for the sister relationship between Lycaenidae and Pieridae only in the amino acid dataset, which was in contrast to the sister relationship between Lycaenidae and Nymphalidae in Papilionoidea in the remaining datasets.

  9. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  10. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  11. Phylogenetic relationships among East African haplochromine fish as revealed by short interspersed elements (SINEs).

    Science.gov (United States)

    Terai, Yohey; Takezaki, Naoko; Mayer, Werner E; Tichy, Herbert; Takahata, Naoyuki; Klein, Jan; Okada, Norihiro

    2004-01-01

    Genomic DNA libraries were prepared from two endemic species of Lake Victoria haplochromine (cichlid) fish and used to isolate and characterize a set of short interspersed elements (SINEs). The distribution and sequences of the SINEs were used to infer phylogenetic relationships among East African haplochromines. The SINE-based classification divides the fish into four groups, which, in order of their divergence from a stem lineage, are the endemic Lake Tanganyika flock (group 1); fish of the nonendemic, monotypic, widely distributed genus Astatoreochromis (group 2); the endemic Lake Malawi flock (group 3); and group 4, which contains fish from widely dispersed East African localities including Lakes Victoria, Edward, George, Albert, and Rukwa, as well as many rivers. The group 4 haplochromines are characterized by a subset of polymorphic SINEs, each of which is present in some individuals and absent in others of the same population at a given locality, the same morphologically defined species, and the same mtDNA-defined haplogroup. SINE-defined group 4 contains six of the seven previously described mtDNA haplogroups. One of the polymorphic SINEs appears to be fixed in the endemic Lake Victoria flock; four others display the presence-or-absence polymorphism within the species of this flock. These findings have implications for the origin of Lake Victoria cichlids and for their founding population sizes.

  12. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  13. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  14. Decentralizing Governance of Natural Resources in India: Lessons from the Case Study of Thanagazi Block, Alwar, Rajasthan, India - Comment

    Directory of Open Access Journals (Sweden)

    Maria Costanza Torri

    2010-09-01

    Full Text Available Numerous countries have undergone decentralisation reforms in the management of natural resources. However, the policies implemented are often not applied in ways compatible with the democratic potential with which decentralisation is conceived. The paper analyses the issue of decentralisation in resource management, in Thanagazi block, Alwar District, Rajasthan. In this paper I present a case of community initiated decentralisation carried out through village organisations. The aim is to contrast it with the state initiated decentralisation system carried out through the local administrative unit, the Gram Panchayat. Some conclusive remarks will be made on the importance of promoting more inclusive and democratic institutions which take into account the local needs and priorities regarding the management of natural resources and development interventions.

  15. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  16. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  17. Revisiting the Zingiberales: using multiplexed exon capture to resolve ancient and recent phylogenetic splits in a charismatic plant lineage

    Directory of Open Access Journals (Sweden)

    Chodon Sass

    2016-01-01

    Full Text Available The Zingiberales are an iconic order of monocotyledonous plants comprising eight families with distinctive and diverse floral morphologies and representing an important ecological element of tropical and subtropical forests. While the eight families are demonstrated to be monophyletic, phylogenetic relationships among these families remain unresolved. Neither combined morphological and molecular studies nor recent attempts to resolve family relationships using sequence data from whole plastomes has resulted in a well-supported, family-level phylogenetic hypothesis of relationships. Here we approach this challenge by leveraging the complete genome of one member of the order, Musa acuminata, together with transcriptome information from each of the other seven families to design a set of nuclear loci that can be enriched from highly divergent taxa with a single array-based capture of indexed genomic DNA. A total of 494 exons from 418 nuclear genes were captured for 53 ingroup taxa. The entire plastid genome was also captured for the same 53 taxa. Of the total genes captured, 308 nuclear and 68 plastid genes were used for phylogenetic estimation. The concatenated plastid and nuclear dataset supports the position of Musaceae as sister to the remaining seven families. Moreover, the combined dataset recovers known intra- and inter-family phylogenetic relationships with generally high bootstrap support. This is a flexible and cost effective method that gives the broader plant biology community a tool for generating phylogenomic scale sequence data in non-model systems at varying evolutionary depths.

  18. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Comparing Phylogenetic Trees by Matching Nodes Using the Transfer Distance Between Partitions.

    Science.gov (United States)

    Bogdanowicz, Damian; Giaro, Krzysztof

    2017-05-01

    Ability to quantify dissimilarity of different phylogenetic trees describing the relationship between the same group of taxa is required in various types of phylogenetic studies. For example, such metrics are used to assess the quality of phylogeny construction methods, to define optimization criteria in supertree building algorithms, or to find horizontal gene transfer (HGT) events. Among the set of metrics described so far in the literature, the most commonly used seems to be the Robinson-Foulds distance. In this article, we define a new metric for rooted trees-the Matching Pair (MP) distance. The MP metric uses the concept of the minimum-weight perfect matching in a complete bipartite graph constructed from partitions of all pairs of leaves of the compared phylogenetic trees. We analyze the properties of the MP metric and present computational experiments showing its potential applicability in tasks related to finding the HGT events.

  20. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  1. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  2. Phylogenetic relationship of the genus Gilbertella and related genera within the order Mucorales based on 5.8 S ribosomal DNA sequences.

    Science.gov (United States)

    Papp, T; Acs, Klára; Nyilasi, Ildikó; Nagy, Erzsébet; Vágvölgyi, Cs

    2003-01-01

    The complete ITS (internal transcribed spacer) region coding the ITS1, the ITS2 and the 5.8S rDNA was amplified by polymerase chain reaction from two strains of Gilbertella persicaria, six strains in the Mucoraceae (Mucor piriformis, M. rouxii, M. circinelloides, Rhizomucor miehei, R. pusillus and R. tauricus) and four strains representing three species of the Choanephoraceae (Blakeslea trispora, Choanephora infundibulifera and Poitrasia circinans). Sequences of the amplified DNA fragments were determined and analysed. G. persicaria belongs to the monogeneric family (Gilbertellaceae), however, originally it was described as Choanephora persicaria. The goal of this study was to reveal the phylogenetic relationship among fungi belonging to Gilbertellaceae, Choanephoraceae and Mucoraceae. Our results support that the "intermediate" position of this family is between Choanephoraceae and Mucoraceae.

  3. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  4. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  5. Species coexistence: macroevolutionary relationships and the contingency of historical interactions.

    Science.gov (United States)

    Germain, Rachel M; Weir, Jason T; Gilbert, Benjamin

    2016-03-30

    Evolutionary biologists since Darwin have hypothesized that closely related species compete more intensely and are therefore less likely to coexist. However, recent theory posits that species diverge in two ways: either through the evolution of 'stabilizing differences' that promote coexistence by causing individuals to compete more strongly with conspecifics than individuals of other species, or through the evolution of 'fitness differences' that cause species to differ in competitive ability and lead to exclusion of the weaker competitor. We tested macroevolutionary patterns of divergence by competing pairs of annual plant species that differ in their phylogenetic relationships, and in whether they have historically occurred in the same region or different regions (sympatric versus allopatric occurrence). For sympatrically occurring species pairs, stabilizing differences rapidly increased with phylogenetic distance. However, fitness differences also increased with phylogenetic distance, resulting in coexistence outcomes that were unpredictable based on phylogenetic relationships. For allopatric species, stabilizing differences showed no trend with phylogenetic distance, whereas fitness differences increased, causing coexistence to become less likely among distant relatives. Our results illustrate the role of species' historical interactions in shaping how phylogenetic relationships structure competitive dynamics, and offer an explanation for the evolution of invasion potential of non-native species. © 2016 The Author(s).

  6. Molecular phylogenetics of finches and sparrows: consequences of character state removal in cytochrome b sequences.

    Science.gov (United States)

    Groth, J G

    1998-12-01

    The complete mitochondrial cytochrome b genes of 53 genera of oscine passerine birds representing the major groups of finches and some allies were compared. Phylogenetic trees resulting from three levels of character partition removal (no data removed, transitions at third positions of codons removed, and all transitions removed [transversion parsimony]) were generally concordant, and all supported several basic statements regarding relationships of finches and finch-like birds, including: (1) larks (Alaudidae) show no close relationship to any finch group; (2) Peucedramus (olive warbler) is phylogenetically far removed from true wood warblers; (3) a clade consisting of fringillids, passerids, motacillids, and emberizids is supported, and this clade is characterized by evolution of a vestigial 10th wing primary; and (4) Hawaiian honeycreepers are derived from within the cardueline finches. Excluding transition substitutions at third positions of codons resulted in phylogenetic trees similar to, but with greater bootstrap nodal support than, trees derived using either all data (equally weighted) or transversion parsimony. Relative to the shortest trees obtained using all data, the topologies obtained after elimination of third-position transitions showed only slight increases in realized treelength and homoplasy. These increases were negligable compared to increases in overall nodal support; therefore, this partition removal scheme may enhance recovery of deep phylogenetic signal in protein-coding DNA datasets. Copyright 1998 Academic Press.

  7. Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks.

    Science.gov (United States)

    Oh, S June; Joung, Je-Gun; Chang, Jeong-Ho; Zhang, Byoung-Tak

    2006-06-06

    To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway structures using meta-level information rather than sequence

  8. Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks

    Directory of Open Access Journals (Sweden)

    Chang Jeong-Ho

    2006-06-01

    Full Text Available Abstract Background To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. Results To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. Conclusion By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway

  9. Rooting phylogenetic trees under the coalescent model using site pattern probabilities.

    Science.gov (United States)

    Tian, Yuan; Kubatko, Laura

    2017-12-19

    Phylogenetic tree inference is a fundamental tool to estimate ancestor-descendant relationships among different species. In phylogenetic studies, identification of the root - the most recent common ancestor of all sampled organisms - is essential for complete understanding of the evolutionary relationships. Rooted trees benefit most downstream application of phylogenies such as species classification or study of adaptation. Often, trees can be rooted by using outgroups, which are species that are known to be more distantly related to the sampled organisms than any other species in the phylogeny. However, outgroups are not always available in evolutionary research. In this study, we develop a new method for rooting species tree under the coalescent model, by developing a series of hypothesis tests for rooting quartet phylogenies using site pattern probabilities. The power of this method is examined by simulation studies and by application to an empirical North American rattlesnake data set. The method shows high accuracy across the simulation conditions considered, and performs well for the rattlesnake data. Thus, it provides a computationally efficient way to accurately root species-level phylogenies that incorporates the coalescent process. The method is robust to variation in substitution model, but is sensitive to the assumption of a molecular clock. Our study establishes a computationally practical method for rooting species trees that is more efficient than traditional methods. The method will benefit numerous evolutionary studies that require rooting a phylogenetic tree without having to specify outgroups.

  10. Bacterial phylogenetic reconstruction from whole genomes is robust to recombination but demographic inference is not.

    Science.gov (United States)

    Hedge, Jessica; Wilson, Daniel J

    2014-11-25

    Phylogenetic inference in bacterial genomics is fundamental to understanding problems such as population history, antimicrobial resistance, and transmission dynamics. The field has been plagued by an apparent state of contradiction since the distorting effects of recombination on phylogeny were discovered more than a decade ago. Researchers persist with detailed phylogenetic analyses while simultaneously acknowledging that recombination seriously misleads inference of population dynamics and selection. Here we resolve this paradox by showing that phylogenetic tree topologies based on whole genomes robustly reconstruct the clonal frame topology but that branch lengths are badly skewed. Surprisingly, removing recombining sites can exacerbate branch length distortion caused by recombination. Phylogenetic tree reconstruction is a popular approach for understanding the relatedness of bacteria in a population from differences in their genome sequences. However, bacteria frequently exchange regions of their genomes by a process called homologous recombination, which violates a fundamental assumption of phylogenetic methods. Since many researchers continue to use phylogenetics for recombining bacteria, it is important to understand how recombination affects the conclusions drawn from these analyses. We find that whole-genome sequences afford great accuracy in reconstructing evolutionary relationships despite concerns surrounding the presence of recombination, but the branch lengths of the phylogenetic tree are indeed badly distorted. Surprisingly, methods to reduce the impact of recombination on branch lengths can exacerbate the problem. Copyright © 2014 Hedge and Wilson.

  11. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  12. Complete sequencing of five araliaceae chloroplast genomes and the phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Rong Li

    Full Text Available BACKGROUND: The ginseng family (Araliaceae includes a number of economically important plant species. Previously phylogenetic studies circumscribed three major clades within the core ginseng plant family, yet the internal relationships of each major group have been poorly resolved perhaps due to rapid radiation of these lineages. Recent studies have shown that phyogenomics based on chloroplast genomes provides a viable way to resolve complex relationships. METHODOLOGY/PRINCIPAL FINDINGS: We report the complete nucleotide sequences of five Araliaceae chloroplast genomes using next-generation sequencing technology. The five chloroplast genomes are 156,333-156,459 bp in length including a pair of inverted repeats (25,551-26,108 bp separated by the large single-copy (86,028-86,566 bp and small single-copy (18,021-19,117 bp regions. Each chloroplast genome contains the same 114 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 80 protein coding genes. Gene size, content, and order, AT content, and IR/SC boundary structure are similar among all Araliaceae chloroplast genomes. A total of 140 repeats were identified in the five chloroplast genomes with palindromic repeat as the most common type. Phylogenomic analyses using parsimony, likelihood, and Bayesian inference based on the complete chloroplast genomes strongly supported the monophyly of the Asian Palmate group and the Aralia-Panax group. Furthermore, the relationships among the sampled taxa within the Asian Palmate group were well resolved. Twenty-six DNA markers with the percentage of variable sites higher than 5% were identified, which may be useful for phylogenetic studies of Araliaceae. CONCLUSION: The chloroplast genomes of Araliaceae are highly conserved in all aspects of genome features. The large-scale phylogenomic data based on the complete chloroplast DNA sequences is shown to be effective for the phylogenetic reconstruction of Araliaceae.

  13. Adherence to evidence based care practices for childbirth before and after a quality improvement intervention in health facilities of Rajasthan, India.

    Science.gov (United States)

    Iyengar, Kirti; Jain, Motilal; Thomas, Sunil; Dashora, Kalpana; Liu, William; Saini, Paramsukh; Dattatreya, Rajesh; Parker, Indrani; Iyengar, Sharad

    2014-08-13

    After the launch of Janani Suraksha Yojana, a conditional cash transfer scheme in India, the proportion of women giving birth in institutions has rapidly increased. However, there are important gaps in quality of childbirth services during institutional deliveries. The aim of this intervention was to improve the quality of childbirth services in selected high caseload public health facilities of 10 districts of Rajasthan. This intervention titled "Parijaat" was designed by Action Research & Training for Health, in partnership with the state government and United Nations Population Fund. The intervention was carried out in 44 public health facilities in 10 districts of Rajasthan, India. These included district hospitals (9), community health centres (32) and primary health centres (3). The main intervention was orientation training of doctors and program managers and regular visits to facilities involving assessment, feedback, training and action. The adherence to evidence based practices before, during and after this intervention were measured using structured checklists and scoring sheets. Main outcome measures included changes in practices during labour, delivery or immediate postpartum period. Use of several unnecessary or harmful practices reduced significantly. Most importantly, proportion of facilities using routine augmentation of labour reduced (p = 0), episiotomy for primigravidas (p = 0.0003), fundal pressure (p = 0.0003), and routine suction of newborns (0 = 0.0005). Among the beneficial practices, use of oxytocin after delivery increased (p = 0.0001) and the practice of listening foetal heart sounds during labour (p = 0.0001). Some practices did not show any improvements, such as dorsal position for delivery, use of partograph, and hand-washing. An intervention based on repeated facility visits combined with actions at the level of decision makers can lead to substantial improvements in quality of childbirth practices at health facilities.

  14. Groundwater Quality in the Shallow Aquifers of the Hadauti Plateau of the District of Baran, Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Kumar Lokesh

    2014-07-01

    Full Text Available With the rapid pace of agricultural development, industrialization and urbanization, the commonly observed geogenic contaminants in groundwater are fluoride and nitrate, whereas nitrate is the dominant anthropogenic contaminant in the south-eastern plains of Rajasthan, India. Samples obtained using a tube well and hand pump in November, 2012, demonstrate that Na-Cl is the dominant salt in the groundwater, and the total salinity of the water is between 211-1056 mg L-1. Moreover, the observed sodium adsorption ratio (SAR and residual sodium carbonate (RSC values ranged between 0.87 to 26.22 meq L-1 and -12.5 to 30.5 meq L-1 respectively. The study further shows that 6% of the total samples contain high amounts of nitrate, and 49% contain fluoride. A water quality index (WQI rating was carried out using nine parameters to quantify the overall groundwater quality status of the area.

  15. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  16. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  17. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  18. Social Mating System and Sex-Biased Dispersal in Mammals and Birds: A Phylogenetic Analysis

    Science.gov (United States)

    Mabry, Karen E.; Shelley, Erin L.; Davis, Katie E.; Blumstein, Daniel T.; Van Vuren, Dirk H.

    2013-01-01

    The hypothesis that patterns of sex-biased dispersal are related to social mating system in mammals and birds has gained widespread acceptance over the past 30 years. However, two major complications have obscured the relationship between these two behaviors: 1) dispersal frequency and dispersal distance, which measure different aspects of the dispersal process, have often been confounded, and 2) the relationship between mating system and sex-biased dispersal in these vertebrate groups has not been examined using modern phylogenetic comparative methods. Here, we present a phylogenetic analysis of the relationship between mating system and sex-biased dispersal in mammals and birds. Results indicate that the evolution of female-biased dispersal in mammals may be more likely on monogamous branches of the phylogeny, and that females may disperse farther than males in socially monogamous mammalian species. However, we found no support for a relationship between social mating system and sex-biased dispersal in birds when the effects of phylogeny are taken into consideration. We caution that although there are larger-scale behavioral differences in mating system and sex-biased dispersal between mammals and birds, mating system and sex-biased dispersal are far from perfectly associated within these taxa. PMID:23483957

  19. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  20. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  1. Molecular evolution of ependymin and the phylogenetic resolution of early divergences among euteleost fishes.

    Science.gov (United States)

    Ortí, G; Meyer, A

    1996-04-01

    The rate and pattern of DNA evolution of ependymin, a single-copy gene coding for a highly expressed glycoprotein in the brain matrix of teleost fishes, is characterized and its phylogenetic utility for fish systematics is assessed. DNA sequences were determined from catfish, electric fish, and characiforms and compared with published ependymin sequences from cyprinids, salmon, pike, and herring. Among these groups, ependymin amino acid sequences were highly divergent (up to 60% sequence difference), but had surprisingly similar hydropathy profiles and invariant glycosylation sites, suggesting that functional properties of the proteins are conserved. Comparison of base composition at third codon positions and introns revealed AT-rich introns and GC-rich third codon positions, suggesting that the biased codon usage observed might not be due to mutational bias. Phylogenetic information content of third codon positions was surprisingly high and sufficient to recover the most basal nodes of the tree, in spite of the observation that pairwise distances (at third codon positions) were well above the presumed saturation level. This finding can be explained by the high proportion of phylogenetically informative nonsynonymous changes at third codon positions among these highly divergent proteins. Ependymin DNA sequences have established the first molecular evidence for the monophyly of a group containing salmonids and esociforms. In addition, ependymin suggests a sister group relationship of electric fish (Gymnotiformes) and Characiformes, constituting a significant departure from currently accepted classifications. However, relationships among characiform lineages were not completely resolved by ependymin sequences in spite of seemingly appropriate levels of variation among taxa and considerably low levels of homoplasy in the data (consistency index = 0.7). If the diversification of Characiformes took place in an "explosive" manner, over a relatively short period of time

  2. Phylogenetic relationships among members of the Pachydactylus ...

    African Journals Online (AJOL)

    The Pachydactylus capensis group is a phenetically-defined assemblage of five small-bodied geckos broadly distributed in eastern southern Africa. Several additional small-bodied Pachydactylus have been historically considered subspecies of P. capensis or members of this group. To assess evolutionary relationships ...

  3. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  4. Implementing a cumulative supermatrix approach for a comprehensive phylogenetic study of the Teloschistales (Pezizomycotina, Ascomycota)

    DEFF Research Database (Denmark)

    Gaya, Ester; Högnabba, Filip; Holguin, Ángela

    2012-01-01

    The resolution of the phylogenetic relationships within the order Teloschistales (Ascomycota, lichen-forming-fungi), with nearly 2000 known species and outstanding phenotypic diversity, has been hindered by the limitation in the resolving power that single-locus or two-locus phylogenetic studies...... – the Megalosporaceae – which is sister to the mainly rock-inhabiting, cosmopolitan, and species rich Teloschistaceae, with a diversity of growth habits ranging from crustose to fruticose. Our results confirm the use of a cumulative supermatrix approach as a viable method to generate comprehensive phylogenies...

  5. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  6. Epidemiological, bacteriological and molecular studies on caseous lymphadenitis in Sirohi goats of Rajasthan, India.

    Science.gov (United States)

    Kumar, Jyoti; Singh, Fateh; Tripathi, Bhupendra Nath; Kumar, Rajiv; Dixit, Shivendra Kumar; Sonawane, Ganesh Gangaram

    2012-10-01

    Corynebacterium pseudotuberculosis is the causative agent of caseous lymphadenitis (CL), a chronic debilitating disease of goats. In the present study, a total of 575 goats of Sirohi breed on an organized farm situated in the semi-arid tropical region of Rajasthan, India were clinically examined. Pus samples from superficial lymph nodes of 27 (4.7%) adult goats presenting clinical lesions suggestive of CL were collected for bacteriological and molecular analyses. Of these goats, 51.9% yielded C. pseudotuberculosis on the basis of morphological, cultural and biochemical characteristics. A polymerase chain reaction (PCR) assay targeting proline iminopeptidase gene specific to C. pseudotuberculosis was developed that confirmed all 14 bacterial isolates. The specificity of the PCR product was confirmed by sequencing of the 551-bp amplicon in both senses, showing 98-100% homology with published sequences. Thus, overall prevalence rate based on clinical, bacterial culture and PCR assay were found to be 4.7%, 2.4% and 2.4%, respectively. The PCR assay developed in this study was found to be specific and rapid, and could be used for confirmation of CL in goats as an alternative method to generally cumbersome, time-consuming and less reliable conventional methods.

  7. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  8. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  9. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  10. Pareto-optimal phylogenetic tree reconciliation.

    Science.gov (United States)

    Libeskind-Hadas, Ran; Wu, Yi-Chieh; Bansal, Mukul S; Kellis, Manolis

    2014-06-15

    Phylogenetic tree reconciliation is a widely used method for reconstructing the evolutionary histories of gene families and species, hosts and parasites and other dependent pairs of entities. Reconciliation is typically performed using maximum parsimony, in which each evolutionary event type is assigned a cost and the objective is to find a reconciliation of minimum total cost. It is generally understood that reconciliations are sensitive to event costs, but little is understood about the relationship between event costs and solutions. Moreover, choosing appropriate event costs is a notoriously difficult problem. We address this problem by giving an efficient algorithm for computing Pareto-optimal sets of reconciliations, thus providing the first systematic method for understanding the relationship between event costs and reconciliations. This, in turn, results in new techniques for computing event support values and, for cophylogenetic analyses, performing robust statistical tests. We provide new software tools and demonstrate their use on a number of datasets from evolutionary genomic and cophylogenetic studies. Our Python tools are freely available at www.cs.hmc.edu/∼hadas/xscape. . © The Author 2014. Published by Oxford University Press.

  11. Universal artifacts affect the branching of phylogenetic trees, not universal scaling laws.

    Science.gov (United States)

    Altaba, Cristian R

    2009-01-01

    The superficial resemblance of phylogenetic trees to other branching structures allows searching for macroevolutionary patterns. However, such trees are just statistical inferences of particular historical events. Recent meta-analyses report finding regularities in the branching pattern of phylogenetic trees. But is this supported by evidence, or are such regularities just methodological artifacts? If so, is there any signal in a phylogeny? In order to evaluate the impact of polytomies and imbalance on tree shape, the distribution of all binary and polytomic trees of up to 7 taxa was assessed in tree-shape space. The relationship between the proportion of outgroups and the amount of imbalance introduced with them was assessed applying four different tree-building methods to 100 combinations from a set of 10 ingroup and 9 outgroup species, and performing covariance analyses. The relevance of this analysis was explored taking 61 published phylogenies, based on nucleic acid sequences and involving various taxa, taxonomic levels, and tree-building methods. All methods of phylogenetic inference are quite sensitive to the artifacts introduced by outgroups. However, published phylogenies appear to be subject to a rather effective, albeit rather intuitive control against such artifacts. The data and methods used to build phylogenetic trees are varied, so any meta-analysis is subject to pitfalls due to their uneven intrinsic merits, which translate into artifacts in tree shape. The binary branching pattern is an imposition of methods, and seldom reflects true relationships in intraspecific analyses, yielding artifactual polytomies in short trees. Above the species level, the departure of real trees from simplistic random models is caused at least by two natural factors--uneven speciation and extinction rates; and artifacts such as choice of taxa included in the analysis, and imbalance introduced by outgroups and basal paraphyletic taxa. This artifactual imbalance accounts

  12. Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D

    2017-09-01

    Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  13. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  14. Phylogenetic framework for coevolutionary studies: a compass for exploring jungles of tangled trees.

    Science.gov (United States)

    Martínez-Aquino, Andrés

    2016-08-01

    Phylogenetics is used to detect past evolutionary events, from how species originated to how their ecological interactions with other species arose, which can mirror cophylogenetic patterns. Cophylogenetic reconstructions uncover past ecological relationships between taxa through inferred coevolutionary events on trees, for example, codivergence, duplication, host-switching, and loss. These events can be detected by cophylogenetic analyses based on nodes and the length and branching pattern of the phylogenetic trees of symbiotic associations, for example, host-parasite. In the past 2 decades, algorithms have been developed for cophylogetenic analyses and implemented in different software, for example, statistical congruence index and event-based methods. Based on the combination of these approaches, it is possible to integrate temporal information into cophylogenetical inference, such as estimates of lineage divergence times between 2 taxa, for example, hosts and parasites. Additionally, the advances in phylogenetic biogeography applying methods based on parametric process models and combined Bayesian approaches, can be useful for interpreting coevolutionary histories in a scenario of biogeographical area connectivity through time. This article briefly reviews the basics of parasitology and provides an overview of software packages in cophylogenetic methods. Thus, the objective here is to present a phylogenetic framework for coevolutionary studies, with special emphasis on groups of parasitic organisms. Researchers wishing to undertake phylogeny-based coevolutionary studies can use this review as a "compass" when "walking" through jungles of tangled phylogenetic trees.

  15. Phylogenetic reconstruction of endophytic fungal isolates using internal transcribed spacer 2 (ITS2) region.

    Science.gov (United States)

    GokulRaj, Kathamuthu; Sundaresan, Natesan; Ganeshan, Enthai Jagan; Rajapriya, Pandi; Muthumary, Johnpaul; Sridhar, Jayavel; Pandi, Mohan

    2014-01-01

    Endophytic fungi are inhabitants of plants, living most part of their lifecycle asymptomatically which mainly confer protection and ecological advantages to the host plant. In this present study, 48 endophytic fungi were isolated from the leaves of three medicinal plants and characterized based on ITS2 sequence - secondary structure analysis. ITS2 secondary structures were elucidated with minimum free energy method (MFOLD version 3.1) and consensus structure of each genus was generated by 4SALE. ProfDistS was used to generate ITS2 sequence structure based phylogenetic tree respectively. Our elucidated isolates were belonging to Ascomycetes family, representing 5 orders and 6 genera. Colletotrichum/Glomerella spp., Diaporthae/Phomopsis spp., and Alternaria spp., were predominantly observed while Cochliobolus sp., Cladosporium sp., and Emericella sp., were represented by singletons. The constructed phylogenetic tree has well resolved monophyletic groups with >50% bootstrap value support. Secondary structures based fungal systematics improves not only the stability; it also increases the precision of phylogenetic inference. Above ITS2 based phylogenetic analysis was performed for our 48 isolates along with sequences of known ex-types taken from GenBank which confirms the efficiency of the proposed method. Further, we propose it as superlative marker for reconstructing phylogenetic relationships at different taxonomic levels due to their lesser length.

  16. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  17. Phylogenetic signal in the acoustic parameters of the advertisement calls of four clades of anurans.

    Science.gov (United States)

    Gingras, Bruno; Mohandesan, Elmira; Boko, Drasko; Fitch, W Tecumseh

    2013-07-01

    Anuran vocalizations, especially their advertisement calls, are largely species-specific and can be used to identify taxonomic affiliations. Because anurans are not vocal learners, their vocalizations are generally assumed to have a strong genetic component. This suggests that the degree of similarity between advertisement calls may be related to large-scale phylogenetic relationships. To test this hypothesis, advertisement calls from 90 species belonging to four large clades (Bufo, Hylinae, Leptodactylus, and Rana) were analyzed. Phylogenetic distances were estimated based on the DNA sequences of the 12S mitochondrial ribosomal RNA gene, and, for a subset of 49 species, on the rhodopsin gene. Mean values for five acoustic parameters (coefficient of variation of root-mean-square amplitude, dominant frequency, spectral flux, spectral irregularity, and spectral flatness) were computed for each species. We then tested for phylogenetic signal on the body-size-corrected residuals of these five parameters, using three statistical tests (Moran's I, Mantel, and Blomberg's K) and three models of genetic distance (pairwise distances, Abouheif's proximities, and the variance-covariance matrix derived from the phylogenetic tree). A significant phylogenetic signal was detected for most acoustic parameters on the 12S dataset, across statistical tests and genetic distance models, both for the entire sample of 90 species and within clades in several cases. A further analysis on a subset of 49 species using genetic distances derived from rhodopsin and from 12S broadly confirmed the results obtained on the larger sample, indicating that the phylogenetic signals observed in these acoustic parameters can be detected using a variety of genetic distance models derived either from a variable mitochondrial sequence or from a conserved nuclear gene. We found a robust relationship, in a large number of species, between anuran phylogenetic relatedness and acoustic similarity in the

  18. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.

  19. Herbarium collection-based phylogenetics of the ragweeds (Ambrosia, Asteraceae).

    Science.gov (United States)

    Martin, Michael D; Quiroz-Claros, Elva; Brush, Grace S; Zimmer, Elizabeth A

    2018-03-01

    Ambrosia (Asteraceae) is a taxonomically difficult genus of weedy, wind-pollinated plants with an apparent center of diversity in the Sonoran Desert of North America. Determining Ambrosia's evolutionary relationships has been the subject of much interest, with numerous studies using morphological characters, cytology, comparative phytochemistry, and chloroplast restriction site variation to produce conflicting accounts the relationships between Ambrosia species, as well as the classification of their close relatives in Franseria and Hymenoclea. To resolve undetermined intra-generic relationships within Ambrosia, we used DNA extracted from tissues obtained from seed banks and herbarium collections to generate multi-locus genetic data representing nearly all putative species, including four from South America. We performed Bayesian and Maximum-Likelihood phylogenetic analyses of six chloroplast-genome and two nuclear-genome markers, enabling us to infer monophyly for the genus, resolve major infra-generic species clusters, as well as to resolve open questions about the evolutionary relationships of several Ambrosia species and former members of Franseria. We also provide molecular data supporting the hypothesis that A. sandersonii formed through the hybridization of A. eriocentra and A. salsola. The topology of our chloroplast DNA phylogeny is almost entirely congruent with the most recent molecular work based on chloroplast restriction site variation of a much more limited sampling of 14 North American species of Ambrosia, although our improved sampling of global Ambrosia diversity enables us to draw additional conclusions. As our study is the first direct DNA sequence-based phylogenetic analyses of Ambrosia, we analyze the data in relation to previous taxonomic studies and discuss several instances of chloroplast/nuclear incongruence that leave the precise geographic center of origin of Ambrosia in question. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  1. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea).

    Science.gov (United States)

    Martínez-Aquino, Andrés; Vidal-Martínez, Victor M; Aguirre-Macedo, M Leopoldina

    2017-01-01

    The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae), were analysed using partial 28S ribosomal DNA (Domains 1-2) and internal transcribed spacers (ITS1-5.8S-ITS2). Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum ( A. cf. americanum and A. burminis ) and paraphyly of the Acanthostominae . These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  2. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea

    Directory of Open Access Journals (Sweden)

    Andrés Martínez-Aquino

    2017-12-01

    Full Text Available The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae, were analysed using partial 28S ribosomal DNA (Domains 1–2 and internal transcribed spacers (ITS1–5.8S–ITS2. Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum (A. cf. americanum and A. burminis and paraphyly of the Acanthostominae. These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  3. High-resolution phylogenetic microbial community profiling

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett; Schwientek, Patrick; Clum, Alicia; Copeland, Alex; Ciobanu, Doina; Cheng, Jan-Fang; Gies, Esther; Hallam, Steve; Tringe, Susannah; Woyke, Tanja

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance our knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.

  4. What is the phylogenetic signal limit from mitogenomes? The reconciliation between mitochondrial and nuclear data in the Insecta class phylogeny

    Directory of Open Access Journals (Sweden)

    Talavera Gerard

    2011-10-01

    Full Text Available Abstract Background Efforts to solve higher-level evolutionary relationships within the class Insecta by using mitochondrial genomic data are hindered due to fast sequence evolution of several groups, most notably Hymenoptera, Strepsiptera, Phthiraptera, Hemiptera and Thysanoptera. Accelerated rates of substitution on their sequences have been shown to have negative consequences in phylogenetic inference. In this study, we tested several methodological approaches to recover phylogenetic signal from whole mitochondrial genomes. As a model, we used two classical problems in insect phylogenetics: The relationships within Paraneoptera and within Holometabola. Moreover, we assessed the mitochondrial phylogenetic signal limits in the deeper Eumetabola dataset, and we studied the contribution of individual genes. Results Long-branch attraction (LBA artefacts were detected in all the datasets. Methods using Bayesian inference outperformed maximum likelihood approaches, and LBA was avoided in Paraneoptera and Holometabola when using protein sequences and the site-heterogeneous mixture model CAT. The better performance of this method was evidenced by resulting topologies matching generally accepted hypotheses based on nuclear and/or morphological data, and was confirmed by cross-validation and simulation analyses. Using the CAT model, the order Strepsiptera was recovered as sister to Coleoptera for the first time using mitochondrial sequences, in agreement with recent results based on large nuclear and morphological datasets. Also the Hymenoptera-Mecopterida association was obtained, leaving Coleoptera and Strepsiptera as the basal groups of the holometabolan insects, which coincides with one of the two main competing hypotheses. For the Paraneroptera, the currently accepted non-monophyly of Homoptera was documented as a phylogenetic novelty for mitochondrial data. However, results were not satisfactory when exploring the entire Eumetabola, revealing the

  5. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  6. Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison.

    Science.gov (United States)

    Romanenko, Svetlana A; Volobouev, Vitaly T; Perelman, Polina L; Lebedev, Vladimir S; Serdukova, Natalya A; Trifonov, Vladimir A; Biltueva, Larisa S; Nie, Wenhui; O'Brien, Patricia C M; Bulatova, Nina Sh; Ferguson-Smith, Malcolm A; Yang, Fengtang; Graphodatsky, Alexander S

    2007-01-01

    The evolutionary success of rodents of the superfamily Muroidea makes this taxon the most interesting for evolution studies, including study at the chromosomal level. Chromosome-specific painting probes from the Chinese hamster and the Syrian (golden) hamster were used to delimit homologous chromosomal segments among 15 hamster species from eight genera: Allocricetulus, Calomyscus, Cricetulus, Cricetus, Mesocricetus, Peromyscus, Phodopus and Tscherskia (Cricetidae, Muroidea, Rodentia). Based on results of chromosome painting and G-banding, comparative maps between 20 rodent species have been established. The integrated maps demonstrate a high level of karyotype conservation among species in the Cricetus group (Cricetus, Cricetulus, Allocricetulus) with Tscherskia as its sister group. Species within the genera Mesocricetus and Phodopus also show a high degree of chromosomal conservation. Our results substantiate many of the conclusions suggested by other data and strengthen the topology of the Muroidea phylogenetic tree through the inclusion of genome-wide chromosome rearrangements. The derivation of the muroids karyotypes from the putative ancestral state involved centric fusions, fissions, addition of heterochromatic arms and a great number of inversions. Our results provide further insights into the karyotype relationships of all species investigated.

  7. Probing the phylogenetic relationships of a few newly recorded intertidal zoanthids of Gujarat coast (India) with mtDNA COI sequences.

    Science.gov (United States)

    Joseph, Sneha; Poriya, Paresh; Kundu, Rahul

    2016-11-01

    The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.

  8. Crystallochemical studies on davidite from Bichun, Jaipur District, Rajasthan, India

    Science.gov (United States)

    Singh, Yamuna; Saxena, Anubhooti; Bhatt, A. K.; Viswanathan, R.; Shaji, T. S.; Nanda, L. K.

    2018-02-01

    Crystallochemical data on metamict davidite from albitites and albitised rocks from the Bichun area (Jaipur district, Rajasthan, India) of Banded Gneissic Complex (BGC) are provided. Davidite occurs as euhedral, subhedral to anhedral crystals in the form of disseminated grains and also as fracture filled veins. The crystals of davidite are up to 8 cm in length and 6 cm in width. The powder X-ray diffraction (XRD) pattern of the heat-treated davidite (at 900{°}C) reveals well-defined reflections of crystallographic planes. The calculated unit-cell parameters of the heat treated davidite are: a0 = b0 = 10.3556 Å and c0 = 20.9067 Å, with unit-cell volume (V) = 1941.6385 Å3; and α=β= 90° and γ= 120°, which are in agreement with the values of davidite standard. Geochemical data reveals that the investigated davidite contains 51.5-52.6% TiO2, 14.8-15.1% Fe2 O3, 9.8-10.2% FeO, 6.97-7.12% U3 O8, 6.72-6.92% RE2 O3, 3.85-3.61% K2O, 0.9-1.4% Al2 O3, and 0.8-1.2% SiO2. The calculated structural formulae of the two davidite crystals are: D-1: K_{0.0044/0.004} Ba_{0.0044/0.005} Ca_{0.20/0.20} Na_{0.012/0.012} Mn_{0.053/0.053} Mg_{0.14/0.14} Pb_{0.0076/0.008} Fe_{2.675/2.675} Fe_{1.59/1.59} Y_{0.1175/0.118} P_{0.053/0.053} Nb_{0.008/0.008} Sn_{0.001/0.001} Zr_{0.033/0.033} U_{0.468/0.468} Th_{0.009/0.009} REE_{0.6829/0.683})_{6.05/6.05} (Ti_{12.15/12.15} Fe_{1.9022/1.903} Si_{0.372/0.372} Al_{0.517/0.517} Cr_{0.018/0.018} Co_{0.009/0.009} Ni_{0.027/0.027})_{15/15} O_{36/36} (OH_{0.319/0.319[]1.681/1.681})_{2/2} and D-2: (K_{0.004/0.004} Ba_{0.005/0.005} Ca_{0.20/0.20} Na_{0.012/0.012} Mn_{0.05/0.05} Mg_{0.094/0.094} Pb_{0.007/0.007} Fe_{2.58/2.58} Fe_{1.71/1.71} Y_{0.112/0.112} P_{0.106/0.106} Nb_{0.006/0.006} Sn_{0.001/0.001} Zr_{0.03/0.03} U_{0.48/0.48} Th_{0.009/0.009} REE_{0.665/0.665})_{6.088/6.088} (Ti_{12.48/12.48} Fe_{1.87/1.87} Si_{0.249/0.249} Al_{0.334/0.334} Cr_{0.019/0.019} Co_{0.008/0.008} Ni_{0.04/0.04})_{15/15} O_{36/36} (OH_{0

  9. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  10. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  11. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  12. SILVA tree viewer: interactive web browsing of the SILVA phylogenetic guide trees.

    Science.gov (United States)

    Beccati, Alan; Gerken, Jan; Quast, Christian; Yilmaz, Pelin; Glöckner, Frank Oliver

    2017-09-30

    Phylogenetic trees are an important tool to study the evolutionary relationships among organisms. The huge amount of available taxa poses difficulties in their interactive visualization. This hampers the interaction with the users to provide feedback for the further improvement of the taxonomic framework. The SILVA Tree Viewer is a web application designed for visualizing large phylogenetic trees without requiring the download of any software tool or data files. The SILVA Tree Viewer is based on Web Geographic Information Systems (Web-GIS) technology with a PostgreSQL backend. It enables zoom and pan functionalities similar to Google Maps. The SILVA Tree Viewer enables access to two phylogenetic (guide) trees provided by the SILVA database: the SSU Ref NR99 inferred from high-quality, full-length small subunit sequences, clustered at 99% sequence identity and the LSU Ref inferred from high-quality, full-length large subunit sequences. The Tree Viewer provides tree navigation, search and browse tools as well as an interactive feedback system to collect any kinds of requests ranging from taxonomy to data curation and improving the tool itself.

  13. Process and impact evaluation of a community gender equality intervention with young men in Rajasthan, India.

    Science.gov (United States)

    Freudberg, Halima; Contractor, Sana; Das, Abhijit; Kemp, Christopher G; Nevin, Paul E; Phadiyal, Ashima; Lal, Jagdish; Rao, Deepa

    2018-02-01

    This paper reports on the results of a process and impact evaluation to assess the effects of a project aiming to engage men in changing gender stereotypes and improving health outcomes for women in villages in Rajasthan, India. We conducted seven focus group discussions with participants in the programme and six in-depth interviews with intervention group leaders. We also conducted 137 pre- and 70 post-intervention surveys to assess participant and community knowledge, attitudes and behaviours surrounding gender, violence and sexuality. We used thematic analysis to identify process and impact themes, and hierarchical mixed linear regression for the primary outcome analysis of survey responses. Post-intervention, significant changes in knowledge and attitudes regarding gender, sexuality and violence were made on the individual level by participants, as well as in the community. Moderate behavioural changes were seen in individuals and in the community. Study findings offer a strong model for prevention programmes working with young men to create a community effect in encouraging gender equality in social norms.

  14. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Combining Phylogenetic and Occurrence Information for Risk Assessment of Pest and Pathogen Interactions with Host Plants

    Directory of Open Access Journals (Sweden)

    Ángel L. Robles-Fernández

    2017-08-01

    Full Text Available Phytosanitary agencies conduct plant biosecurity activities, including early detection of potential introduction pathways, to improve control and eradication of pest and pathogen incursions. For such actions, analytical tools based on solid scientific knowledge regarding plant-pest or pathogen relationships for pest risk assessment are needed. Recent evidence indicating that closely related species share a higher chance of becoming infected or attacked by pests has allowed the identification of taxa with different degrees of vulnerability. Here, we use information readily available online about pest-host interactions and their geographic distributions, in combination with host phylogenetic reconstructions, to estimate a pest-host interaction (in some cases infection index in geographic space as a more comprehensive, spatially explicit tool for risk assessment. We demonstrate this protocol using phylogenetic relationships for 20 beetle species and 235 host plant genera: first, we estimate the probability of a host sharing pests, and second, we project the index in geographic space. Overall, the predictions allow identification of the pest-host interaction type (e.g., generalist or specialist, which is largely determined by both host range and phylogenetic constraints. Furthermore, the results can be valuable in terms of identifying hotspots where pests and vulnerable hosts interact. This knowledge is useful for anticipating biological invasions or spreading of disease. We suggest that our understanding of biotic interactions will improve after combining information from multiple dimensions of biodiversity at multiple scales (e.g., phylogenetic signal and host-vector-pathogen geographic distribution.

  16. Analysis of Acorus calamus chloroplast genome and its phylogenetic implications.

    Science.gov (United States)

    Goremykin, Vadim V; Holland, Barbara; Hirsch-Ernst, Karen I; Hellwig, Frank H

    2005-09-01

    Determining the phylogenetic relationships among the major lines of angiosperms is a long-standing problem, yet the uncertainty as to the phylogenetic affinity of these lines persists. While a number of studies have suggested that the ANITA (Amborella-Nymphaeales-Illiciales-Trimeniales-Aristolochiales) grade is basal within angiosperms, studies of complete chloroplast genome sequences also suggested an alternative tree, wherein the line leading to the grasses branches first among the angiosperms. To improve taxon sampling in the existing chloroplast genome data, we sequenced the chloroplast genome of the monocot Acorus calamus. We generated a concatenated alignment (89,436 positions for 15 taxa), encompassing almost all sequences usable for phylogeny reconstruction within spermatophytes. The data still contain support for both the ANITA-basal and grasses-basal hypotheses. Using simulations we can show that were the ANITA-basal hypothesis true, parsimony (and distance-based methods with many models) would be expected to fail to recover it. The self-evident explanation for this failure appears to be a long-branch attraction (LBA) between the clade of grasses and the out-group. However, this LBA cannot explain the discrepancies observed between tree topology recovered using the maximum likelihood (ML) method and the topologies recovered using the parsimony and distance-based methods when grasses are deleted. Furthermore, the fact that neither maximum parsimony nor distance methods consistently recover the ML tree, when according to the simulations they would be expected to, when the out-group (Pinus) is deleted, suggests that either the generating tree is not correct or the best symmetric model is misspecified (or both). We demonstrate that the tree recovered under ML is extremely sensitive to model specification and that the best symmetric model is misspecified. Hence, we remain agnostic regarding phylogenetic relationships among basal angiosperm lineages.

  17. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  18. Building Phylogenetic Trees from DNA Sequence Data: Investigating Polar Bear and Giant Panda Ancestry.

    Science.gov (United States)

    Maier, Caroline Alexandra

    2001-01-01

    Presents an activity in which students seek answers to questions about evolutionary relationships by using genetic databases and bioinformatics software. Students build genetic distance matrices and phylogenetic trees based on molecular sequence data using web-based resources. Provides a flowchart of steps involved in accessing, retrieving, and…

  19. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  20. The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers.

    Science.gov (United States)

    Pan, Ting Shuang; Nie, Pin

    2013-07-01

    Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.

  1. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  2. The eastern Asian and eastern and western North American floristic disjunction: congruent phylogenetic patterns in seven diverse genera.

    Science.gov (United States)

    Xiang, Q Y; Soltis, D E; Soltis, P S

    1998-10-01

    One of the most remarkable examples of intercontinental disjunction of the North Temperate Flora involves eastern Asia and eastern and western North America. Although there has been considerable interest in this phytogeographic pattern for over 150 years (e.g., Gray, 1859; Li, 1952; Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983; Tiffney, 1985a, 1985b), relationships among taxa displaying the disjunction remain obscure. Understanding phylogenetic relationships is, however, a prerequisite for historical biogeographic analyses of this distributional pattern. To understand better the relationships of taxa displaying this intercontinental disjunction, phylogenetic analyses were conducted using a variety of DNA data sets for species of four genera (Cornus, Boykinia, Tiarella, and Trautvetteria) that occur in eastern Asia, eastern North America, and western North America. An area cladogram was constructed for each of the four genera, all of which show a similar pattern of relationship: the eastern Asian species are sister to all North American species. An identical phylogenetic pattern is also found in three other taxa exhibiting this disjunction (Aralia sect. Aralia, Calycanthus, and Adiantum pedatum). The congruent phylogenetic pattern found in these seven diverse genera raises the possibility of a common origin of the eastern Asia, eastern and western North America disjunction. The data are in agreement with the long-standing hypothesis that this well-known floristic disjunction represents the fragmentation of a once continuous Mixed Mesophytic forest community and suggest that the disjunction may have involved only two major vicariance events: an initial split between Eurasia and North America, followed by the isolation of floras between eastern and western North America. However, congruence between phylogenies and geographic distributions does not necessarily indicate an identical phytogeographic history. Taxa exhibiting the same phylogenetic pattern may have

  3. A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference.

    Science.gov (United States)

    Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis

    2016-09-02

    Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal

  4. Household Coverage of Fortified Staple Food Commodities in Rajasthan, India.

    Directory of Open Access Journals (Sweden)

    Grant J Aaron

    Full Text Available A spatially representative statewide survey was conducted in Rajasthan, India to assess household coverage of atta wheat flour, edible oil, and salt. An even distribution of primary sampling units were selected based on their proximity to centroids on a hexagonal grid laid over the survey area. A sample of n = 18 households from each of m = 252 primary sampling units PSUs was taken. Demographic data on all members of these households were collected, and a broader dataset was collected about a single caregiver and a child in the first 2 years of life. Data were collected on demographic and socioeconomic status; education; housing conditions; recent infant and child mortality; water, sanitation, and hygiene practices; food security; child health; infant and young child feeding practices; maternal dietary diversity; coverage of fortified staples; and maternal and child anthropometry. Data were collected from 4,627 households and the same number of caregiver/child pairs. Atta wheat flour was widely consumed across the state (83%; however, only about 7% of the atta wheat flour was classified as fortifiable, and only about 6% was actually fortified (mostly inadequately. For oil, almost 90% of edible oil consumed by households in the survey was classified as fortifiable, but only about 24% was fortified. For salt, coverage was high, with almost 85% of households using fortified salt and 66% of households using adequately fortified salt. Iodized salt coverage was also high; however, rural and poor population groups were less likely to be reached by the intervention. Voluntary fortification of atta wheat flour and edible oil lacked sufficient industry consolidation to cover significant portions of the population. It is crucial that appropriate delivery channels are utilized to effectively deliver essential micronutrients to at-risk population groups. Government distribution systems are likely the best means to accomplish this goal.

  5. Status of water pollution in relation to industrialization in Rajasthan.

    Science.gov (United States)

    Rajput, Ritu Singh; Pandey, Sonali; Bhadauria, Seema

    2017-09-26

    India is a large and densely populated country; its economy is largely agricultural. Making the best use of the country's manpower has always posed a challenge. Industrialization could become a dominant component of the economy and displace agriculture. Traditional livelihoods of occupational groups are threatened by the practice of disposing untreated industrial waste into rivers and bodies of water. These uncontrolled disposals impact local natural resources with negative long-term effects. Industrialization is the development of intellectual and financial trade that changes a predominantly rustic culture into a modern one. Many industrial units discharge wastewater locally without treatment. Many industries directly discharged their waste into lakes, rivers and ocean. Water contamination impacts the environment. Pesticides, chemical, waste oil and heavy metals are regularly transported into their waters. Humans and other living organisms can accumulate heavy metals from industrial discharges in their tissues. Industrial waste may be reactive, corrosive, flammable, or toxic. When untreated sewage is emptied into rivers, it causes diseases like typhoid, dysentery and cholera. Natural elements and plant supplements like nitrate and phosphates stimulate growth of algae on the water surface. The algae reduce the oxygen in the water and cause eutrophication. It is harmful to the water ecosystem. In Rajasthan proper, there are a number of sites bordering rivers and lakes where the pace of industrialization has proceeded far beyond the ability of regulators to establish and enforce meaningful limits on the amount of point source pollution permitted to the various industrial complexes, which include cement, chemical, fertilizer, textile, mining, quarrying, dyeing and printing facilities. The scale of the problem is obvious to the casual observer, but actual documentation of the total impact remains to be done.

  6. Nyay karo ya jail bharo] Sathins of Rajasthan demand justice.

    Science.gov (United States)

    Abha; Geetanjali; Radha; Ratna

    1992-01-01

    The experiences of Bhanwari, a 4-year old worker for the Women's Development Program in the Kumhar community in Rajasthan, India, is recounted. On September 22, 1992, 2 men from the Gujar community gang raped her and brutally assaulted her husband. The actions were viewed as a reprisal against her for trying to end child marriages. Legal and medical efforts were ineffective in protecting her human rights, and the actions of the men, who were known and identified within the community, were effectively concealed and condoned. The woman and her husband made a concerted effort to obtain a medical examination to prove that rape had occurred. The police accused her of making false allegations. A male doctor refused to examine her. The medical jurist refused to conduct an examination for rape unless orders were issued by the magistrate, who refused. The next day a doctor performed the examination and confirmed that Bhanwari (a mother of four) was not a virgin. Her clothing was taken as evidence, and she was forced to wear the blood-stained clothes of her husband. Since the rape, continued questioning by the police has taken the form of harassment. The National Commission for Women condemned the police behavior and concluded that evidence was tampered with and that the police were protecting the rapists. No arrests have been made. In protest over the mistreatment, a rally was held in Jaipur. During the public meeting, many accounts of sexual abuse by men were related. The issue of gender equality was raised as well as sexual harassment of female workers, who have not legal recourse. A comprehensive law is needed, and women need to speak out against the powerful alliance of politicians and state agencies.

  7. A phylogenetic perspective on species diversity, β-diversity and biogeography for the microbial world.

    Science.gov (United States)

    Barberán, Albert; Casamayor, Emilio O

    2014-12-01

    There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.

  8. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  9. Studies on the recovery of REEY from a hard-rock deposit of Rajasthan

    International Nuclear Information System (INIS)

    Karan, Ram; Giri, Nitai; Anand Rao, K.; Sreenivas, T.

    2017-01-01

    Dantala area in Banner district of Rajasthan is endowed with poly metallic mineralization hosted in tuffaceous rocks consisting of REE, Zr, Nb, U Th, Zn and Ag. The region has potential to become a hardrock rare earth resource in India. The chemical and XRF analysis of a representative borehole sample revealed that the ore has about 68% SiO_2, 7.7% Al_2O_3, 7.4% Fe_2O_3, 4.75% CaO along with 305 ppm Nb, 109 ppm Th, 3738 ppm TREE of which, 2580 ppm is LREE and 1158 ppm is HREE including 777 ppm Y. The deportment profile of REEY in the sample determined by sequential chemical extraction technique. Major distribution of REEY is dissolvable only under highly acidic conditions as the REEY are bound to iron oxides and are associated with refractory phases (zircon?). Heavy media separation of coarsely crushed material showed presence of about 90% of REEY values in specific gravity d'' 2.8. Therefore, the REEY values could not be preconcentrated by conventional physical beneficiation techniques. Direct 'whole ore' leaching using HCL and H_2SO_4 in 'pug cure leaching' mode with H_2SO_4 yielded about 50% dissolution of REEY values. The paper discusses the process complexities in the recovery of REEY from this hard rock ore sample

  10. Estimation of radon concentration in soil and groundwater samples of Northern Rajasthan, India

    Directory of Open Access Journals (Sweden)

    Sudhir Mittal

    2016-04-01

    Full Text Available In the present investigation, analysis of radon concentration in 20 water and soil samples collected from different locations of Bikaner and Jhunjhunu districts of Rajasthan, India has been carried out by using RAD7 an electronic Radon detector. The measured radon concentration in water samples lies in the range from 0.50 to 22 Bq l−1 with the mean value of 4.42 Bq l−1, which lies within the safe limit from 4 to 40 Bq l−1 recommended by United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR, 2008. The total annual effective dose estimated due to radon concentration in water ranges from 1.37 to 60.06 μSV y−1 with the mean value of 12.08 μSV y−1, which is lower than the safe limit 0.1 mSv y−1 as set by World Health Organization (WHO, 2004 and European Council (EU, 1998. Radon measurement in soil samples varies from 941 to 10,050 Bq m−3 with the mean value of 4561 Bq m−3, which lies within the range reported by other investigators. It was observed that the soil and water of Bikaner and Jhunjhunu districts are suitable for drinking and construction purpose without posing any health hazard.

  11. Knowledge regarding antibiotic drug action and prescription practices among dentist in Jaipur city, Rajasthan

    Directory of Open Access Journals (Sweden)

    Dushyant Pal Singh

    2015-01-01

    Full Text Available Introduction: Dentists prescribe antibiotics routinely to manage oral and dental infections. Unscrupulous antibiotic prescriptions can be associated with unfavorable side effects and the development of resistance. Thus, the aim of this study was to assess the level of knowledge regarding antibiotic prescription use among dentists in Jaipur City, Rajasthan. Materials and Methods: A questionnaire survey was conducted among 300 dentists in Jaipur city. A validated, self-designed, 21-item, closed-ended questionnaire was used to collect data on knowledge regarding antibiotic prescription. Descriptive statistics were calculated. Results: A total of 300 dental practitioners were included in the study. The majority of the respondents seem to prescribe antibiotics that are broad spectrum or the ones that are commonly used. A considerable percentage of the respondents were not aware of the pregnancy drug risk categories by Food and Drug Administration. The most of the respondents said that they prescribe antibiotics on the basis of the diagnosis, whereas more than two-thirds of the respondents said that they never advise culture sensitivity test before prescribing the antibiotics. Conclusion: Our findings suggest the knowledge of dentists regarding antibiotic prescription is inadequate and more focus should be given to the ongoing training regarding the pharmacological aspects, pertinent medical conditions, and prophylactic use of antibiotics in dentistry.

  12. Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.

    Science.gov (United States)

    Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan

    2016-10-31

    The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.

  13. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  14. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  15. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  16. Eye-size variability in deep-sea lanternfishes (Myctophidae): an ecological and phylogenetic study.

    Science.gov (United States)

    de Busserolles, Fanny; Fitzpatrick, John L; Paxton, John R; Marshall, N Justin; Collin, Shaun P

    2013-01-01

    One of the most common visual adaptations seen in the mesopelagic zone (200-1000 m), where the amount of light diminishes exponentially with depth and where bioluminescent organisms predominate, is the enlargement of the eye and pupil area. However, it remains unclear how eye size is influenced by depth, other environmental conditions and phylogeny. In this study, we determine the factors influencing variability in eye size and assess whether this variability is explained by ecological differences in habitat and lifestyle within a family of mesopelagic fishes characterized by broad intra- and interspecific variance in depth range and luminous patterns. We focus our study on the lanternfish family (Myctophidae) and hypothesise that lanternfishes with a deeper distribution and/or a reduction of bioluminescent emissions have smaller eyes and that ecological factors rather than phylogenetic relationships will drive the evolution of the visual system. Eye diameter and standard length were measured in 237 individuals from 61 species of lanternfishes representing all the recognised tribes within the family in addition to compiling an ecological dataset including depth distribution during night and day and the location and sexual dimorphism of luminous organs. Hypotheses were tested by investigating the relationship between the relative size of the eye (corrected for body size) and variations in depth and/or patterns of luminous-organs using phylogenetic comparative analyses. Results show a great variability in relative eye size within the Myctophidae at all taxonomic levels (from subfamily to genus), suggesting that this character may have evolved several times. However, variability in eye size within the family could not be explained by any of our ecological variables (bioluminescence and depth patterns), and appears to be driven solely by phylogenetic relationships.

  17. Inferring Phylogenetic Networks Using PhyloNet.

    Science.gov (United States)

    Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay

    2018-07-01

    PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.

  18. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  19. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences

    OpenAIRE

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-01

    Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...

  20. Analysis of Fatty Acid and Growth Profiles in Ten Shewanella spp. to Associate Phylogenetic Relationships

    Science.gov (United States)

    2015-10-25

    microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length distributions and growth of...phylogenetically dissimilar microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length...region contaminated with metals: relation with ecological characteristics and soil respiration. J. Biorem. Biodegrad . 6, 1000274/1000271-1000274

  1. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Host-range phylogenetic grouping of capripoxviruses. Genetic typing of CaPVs

    International Nuclear Information System (INIS)

    Le Goff, C.; Chadeyras, A.; Libeau, G.; Albina, E.; Fakhfakh, E.; Hammami, S.; Elexpeter Aba Adulugba; Diallo, A.

    2005-01-01

    Because of their close relationship, specific identification of the CaPVs genus inside the Poxviridae family relies mainly on molecular tools rather than on classical serology. We describe the suitability of the G protein-coupled chemokine receptor (GPCR), for host range phylogenetic grouping. The analysis of 26 CaPVs shows 3 tight genetic clusters consisting of goatpox virus (GPV), lumpy skin disease virus (LSDV), and sheeppox virus (SPV). (author)

  3. Phylogenetic assemblage structure of North American trees is more strongly shaped by glacial-interglacial climate variability in gymnosperms than in angiosperms.

    Science.gov (United States)

    Ma, Ziyu; Sandel, Brody; Svenning, Jens-Christian

    2016-05-01

    How fast does biodiversity respond to climate change? The relationship of past and current climate with phylogenetic assemblage structure helps us to understand this question. Studies of angiosperm tree diversity in North America have already suggested effects of current water-energy balance and tropical niche conservatism. However, the role of glacial-interglacial climate variability remains to be determined, and little is known about any of these relationships for gymnosperms. Moreover, phylogenetic endemism, the concentration of unique lineages in restricted ranges, may also be related to glacial-interglacial climate variability and needs more attention. We used a refined phylogeny of both angiosperms and gymnosperms to map phylogenetic diversity, clustering and endemism of North American trees in 100-km grid cells, and climate change velocity since Last Glacial Maximum together with postglacial accessibility to recolonization to quantify glacial-interglacial climate variability. We found: (1) Current climate is the dominant factor explaining the overall patterns, with more clustered angiosperm assemblages toward lower temperature, consistent with tropical niche conservatism. (2) Long-term climate stability is associated with higher angiosperm endemism, while higher postglacial accessibility is linked to to more phylogenetic clustering and endemism in gymnosperms. (3) Factors linked to glacial-interglacial climate change have stronger effects on gymnosperms than on angiosperms. These results suggest that paleoclimate legacies supplement current climate in shaping phylogenetic patterns in North American trees, and especially so for gymnosperms.

  4. Rb-Sr and Ar-Ar systematics of Malani volcanic rocks of southwest Rajasthan: evidence for a younger post-crystallization thermal event

    International Nuclear Information System (INIS)

    Rathore, S.S.; Srivastava, R.K.

    1996-01-01

    A new Rb-Sr age of 779 ± 10 Ma has been obtained for a suite of andesite-dacite-rhyolite from the Malani igneous province of southwestern Rajasthan, dated earlier at 745 ± 10 Ma by Crawford and Compston (1970). The associated basalts may be slightly younger than the felsic volcanics and have a mantle source. The felsic volcanics on the other hand were most probably derived by fractional crystallization of a crustal magma. 40 Ar- 39 Ar systematics of three samples viz., a basalt, a dacite and a rhyolite show disturbed age spectra indicating a thermal event around 500-550 Ma ago. This secondary thermal event is quite wide-spread and possibly related to the Pan-African thermo-tectonic episode observed in the Himalayas and south India. (author). 38 refs., 5 figs., 2 tabs

  5. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  6. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  7. Quartet-based methods to reconstruct phylogenetic networks.

    Science.gov (United States)

    Yang, Jialiang; Grünewald, Stefan; Xu, Yifei; Wan, Xiu-Feng

    2014-02-20

    Phylogenetic networks are employed to visualize evolutionary relationships among a group of nucleotide sequences, genes or species when reticulate events like hybridization, recombination, reassortant and horizontal gene transfer are believed to be involved. In comparison to traditional distance-based methods, quartet-based methods consider more information in the reconstruction process and thus have the potential to be more accurate. We introduce QuartetSuite, which includes a set of new quartet-based methods, namely QuartetS, QuartetA, and QuartetM, to reconstruct phylogenetic networks from nucleotide sequences. We tested their performances and compared them with other popular methods on two simulated nucleotide sequence data sets: one generated from a tree topology and the other from a complicated evolutionary history containing three reticulate events. We further validated these methods to two real data sets: a bacterial data set consisting of seven concatenated genes of 36 bacterial species and an influenza data set related to recently emerging H7N9 low pathogenic avian influenza viruses in China. QuartetS, QuartetA, and QuartetM have the potential to accurately reconstruct evolutionary scenarios from simple branching trees to complicated networks containing many reticulate events. These methods could provide insights into the understanding of complicated biological evolutionary processes such as bacterial taxonomy and reassortant of influenza viruses.

  8. Disturbance by an endemic rodent in an arid shrubland is a habitat filter: effects on plant invasion and taxonomical, functional and phylogenetic community structure.

    Science.gov (United States)

    Escobedo, Víctor M; Rios, Rodrigo S; Salgado-Luarte, Cristian; Stotz, Gisela C; Gianoli, Ernesto

    2017-03-01

    Disturbance often drives plant invasion and may modify community assembly. However, little is known about how these modifications of community patterns occur in terms of taxonomic, functional and phylogenetic structure. This study evaluated in an arid shrubland the influence of disturbance by an endemic rodent on community functional divergence and phylogenetic structure as well as on plant invasion. It was expected that disturbance would operate as a habitat filter favouring exotic species with short life cycles. Sixteen plots were sampled along a disturbance gradient caused by the endemic fossorial rodent Spalacopus cyanus , measuring community parameters and estimating functional divergence for life history traits (functional dispersion index) and the relative contribution to functional divergence of exotic and native species. The phylogenetic signal (Pagel's lambda) and phylogenetic community structure (mean phylogenetic distance and mean nearest taxon phylogenetic distance) were also estimated. The use of a continuous approach to the disturbance gradient allowed the identification of non-linear relationships between disturbance and community parameters. The relationship between disturbance and both species richness and abundance was positive for exotic species and negative for native species. Disturbance modified community composition, and exotic species were associated with more disturbed sites. Disturbance increased trait convergence, which resulted in phylogenetic clustering because traits showed a significant phylogenetic signal. The relative contribution of exotic species to functional divergence increased, while that of natives decreased, with disturbance. Exotic and native species were not phylogenetically distinct. Disturbance by rodents in this arid shrubland constitutes a habitat filter over phylogeny-dependent life history traits, leading to phylogenetic clustering, and drives invasion by favouring species with short life cycles. Results can be

  9. Evolutionary relationships among Astroviridae

    NARCIS (Netherlands)

    Lukashov, Vladimir V.; Goudsmit, Jaap

    2002-01-01

    To study the evolutionary relationships among astroviruses, all available sequences for members of the family Astroviridae were collected. Phylogenetic analysis distinguished two deep-rooted groups: one comprising mammalian astroviruses, with ovine astrovirus being an outlier, and the other

  10. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  11. Phylogenetic resolution and habitat specificity of members of the Photobacterium phosphoreum species group.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2005-10-01

    Substantial ambiguity exists regarding the phylogenetic status of facultatively psychrophilic luminous bacteria identified as Photobacterium phosphoreum, a species thought to be widely distributed in the world's oceans and believed to be the specific bioluminescent light-organ symbiont of several deep-sea fishes. Members of the P. phosphoreum species group include luminous and non-luminous strains identified phenotypically from a variety of different habitats as well as phylogenetically defined lineages that appear to be evolutionarily distinct. To resolve this ambiguity and to begin developing a meaningful knowledge of the geographic distributions, habitats and symbiotic relationships of bacteria in the P. phosphoreum species group, we carried out a multilocus, fine-scale phylogenetic analysis based on sequences of the 16S rRNA, gyrB and luxABFE genes of many newly isolated luminous strains from symbiotic and saprophytic habitats, together with previously isolated luminous and non-luminous strains identified as P. phosphoreum from these and other habitats. Parsimony analysis unambiguously resolved three evolutionarily distinct clades, phosphoreum, iliopiscarium and kishitanii. The tight phylogenetic clustering within these clades and the distinct separation between them indicates they are different species, P. phosphoreum, Photobacterium iliopiscarium and the newly recognized 'Photobacterium kishitanii'. Previously reported non-luminous strains, which had been identified phenotypically as P. phosphoreum, resolved unambiguously as P. iliopiscarium, and all examined deep-sea fishes (specimens of families Chlorophthalmidae, Macrouridae, Moridae, Trachichthyidae and Acropomatidae) were found to harbour 'P. kishitanii', not P. phosphoreum, in their light organs. This resolution revealed also that 'P. kishitanii' is cosmopolitan in its geographic distribution. Furthermore, the lack of phylogenetic variation within 'P. kishitanii' indicates that this facultatively

  12. The combination of phylogenetic analysis with epidemiological and serological data to track HIV-1 transmission in a sexual transmission case.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available To investigate the linkage of HIV transmission from a man to a woman through unprotected sexual contact without disclosing his HIV-positive status.Combined with epidemiological information and serological tests, phylogenetic analysis was used to test the a priori hypothesis of HIV transmission from the man to the woman. Control subjects, infected with HIV through heterosexual intercourse, from the same location were also sampled. Phylogenetic analyses were performed using the consensus gag, pol and env sequences obtained from blood samples of the man, the woman and the local control subjects. The env quasispecies of the man, the woman, and two controls were also obtained using single genome amplification and sequencing (SGA/S to explore the paraphyletic relationship by phylogenetic analysis.Epidemiological information and serological tests indicated that the man was infected with HIV-1 earlier than the woman. Phylogenetic analyses of the consensus sequences showed a monophyletic cluster for the man and woman in all three genomic regions. Furthermore, gag sequences of the man and woman shared a unique recombination pattern from subtype B and C, which was different from those of CRF07_BC or CRF08_BC observed in the local samples. These indicated that the viral sequences from the two subjects display a high level of similarity. Further, viral quasispecies from the man exhibited a paraphyletic relationship with those from the woman in the Bayesian and maximum-likelihood (ML phylogenetic trees of the env region, which supported the transmission direction from the man to the woman.In the context of epidemiological and serological evidence, the results of phylogenetic analyses support the transmission from the man to the woman.

  13. The effect of an affordable daycare program on health and economic well-being in Rajasthan, India: protocol for a cluster-randomized impact evaluation study

    Directory of Open Access Journals (Sweden)

    Arijit Nandi

    2016-06-01

    Full Text Available Abstract Background The provision of affordable and reliable daycare services is a potentially important policy lever for empowering Indian women. Access to daycare might reduce barriers to labor force entry and generate economic opportunities for women, improve education for girls caring for younger siblings, and promote nutrition and learning among children. However, empirical evidence concerning the effects of daycare programs in low-and-middle-income countries is scarce. This cluster-randomized trial will estimate the effect of a community-based daycare program on health and economic well-being over the life-course among women and children living in rural Rajasthan, India. Methods This three-year study takes place in rural communities from five blocks in the Udaipur District of rural Rajasthan. The intervention is the introduction of a full-time, affordable, community-based daycare program. At baseline, 3177 mothers with age eligible children living in 160 village hamlets were surveyed. After the baseline, these hamlets were randomized to the intervention or control groups and respondents will be interviewed on two more occasions. Primary social and economic outcomes include women’s economic status and economic opportunity, women’s empowerment, and children’s educational attainment. Primary health outcomes include women’s mental health, as well as children’s nutritional status. Discussion This interdisciplinary research initiative will provide rigorous evidence concerning the effects of daycare in lower-income settings. In doing so it will address an important research gap and has the potential to inform policies for improving the daycare system in India in ways that promote health and economic well-being. Trial registration (1 The ISRCTN clinical trial registry (ISRCTN45369145, http://www.isrctn.com/ISRCTN45369145 , registered on May 16, 2016 and (2 The American Economic Association’s registry for randomized controlled trials

  14. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae) in a phylogenetic context.

    Science.gov (United States)

    Martucci, Maria Elvira Poleti; Loeuille, Benoit; Pirani, José Rubens; Gobbo-Neto, Leonardo

    2018-01-01

    Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus). Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  15. Phylogenetic and population genetic analyses of diploid Leucaena (Leguminosae; Mimosoideae) reveal cryptic species diversity and patterns of divergent allopatric speciation.

    Science.gov (United States)

    Govindarajulu, Rajanikanth; Hughes, Colin E; Bailey, C Donovan

    2011-12-01

    Leucaena comprises 17 diploid species, five tetraploid species, and a complex series of hybrids whose evolutionary histories have been influenced by human seed translocation, cultivation, and subsequent spontaneous hybridization. Here we investigated patterns of evolutionary divergence among diploid Leucaena through comprehensively sampled multilocus phylogenetic and population genetic approaches to address species delimitation, interspecific relationships, hybridization, and the predominant mode of speciation among diploids. Parsimony- and maximum-likelihood-based phylogenetic approaches were applied to 59 accessions sequenced for six SCAR-based nuclear loci, nrDNA ITS, and four cpDNA regions. Population genetic comparisons included 1215 AFLP loci representing 42 populations and 424 individuals. Phylogenetic results provided a well-resolved hypothesis of divergent species relationships, recovering previously recognized clades of diploids as well as newly resolved relationships. Phylogenetic and population genetic assessments identified two cryptic species that are consistent with geography and morphology. Findings from this study highlight the importance and utility of multilocus data in the recovery of complex evolutionary histories. The results are consistent with allopatric divergence representing the predominant mode of speciation among diploid Leucaena. These findings contrast with the potential hybrid origin of several tetraploid species and highlight the importance of human translocation of seed to the origin of these tetraploids. The recognition of one previously unrecognized species (L. cruziana) and the elevation of another taxon (L. collinsii subsp. zacapana) to specific status (L. zacapana) is consistent with a growing number of newly diagnosed species from neotropical seasonally dry forests, suggesting these communities harbor greater species diversity than previously recognized.

  16. Phylogenetics of the Phlebotomine Sand Fly Group Verrucarum (Diptera: Psychodidae: Lutzomyia)

    Science.gov (United States)

    Cohnstaedt, Lee W.; Beati, Lorenza; Caceres, Abraham G.; Ferro, Cristina; Munstermann, Leonard E.

    2011-01-01

    Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity—the Lutzomyia longiflocosa–Lutzomyia sauroida pair and the Lutzomyia quasitownsendi–Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution. PMID:21633028

  17. Phylogenetics of the phlebotomine sand fly group Verrucarum (Diptera: Psychodidae: Lutzomyia).

    Science.gov (United States)

    Cohnstaedt, Lee W; Beati, Lorenza; Caceres, Abraham G; Ferro, Cristina; Munstermann, Leonard E

    2011-06-01

    Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity--the Lutzomyia longiflocosa-Lutzomyia sauroida pair and the Lutzomyia quasitownsendi-Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution.

  18. Two mitochondrial genomes in Alcedinidae (Ceryle rudis/Halcyon pileata) and the phylogenetic placement of Coraciiformes.

    Science.gov (United States)

    Sun, Xiaomin; Zhao, Ruoping; Zhang, Ting; Gong, Jie; Jing, Meidong; Huang, Ling

    2017-10-01

    Coraciiformes comprises 209 species belonging to ten families with significant divergence on external morphologies and life styles. The phylogenetic placement of Coraciiformes was still in debate. Here, we determined the complete mitochondrial genomes (mitogenomes) of Crested Kingfisher (Ceryle rudis) and Black-capped Kingfisher (Halcyon pileata). The mitogenomes were 17,355 bp (C. rudis) and 17,612 bp (H. pileata) in length, and both of them contained 37 genes (two rRNA genes, 22 tRNA genes and 13 protein-coding genes) and one control region. The gene organizations and characters of two mitogenomes were similar with those of other mitogenomes in Coraciiformes, however the sizes and nucleotide composition of control regions in different mitogenomes were significantly different. Phylogenetic trees were constructed with both Bayesian and Maximum Likelihood methods based on mitogenome sequences from 11 families of six orders. The trees based on two different data sets supported the basal position of Psittacidae (Psittaciformes), the closest relationship between Cuculiformes (Cuculidae) and Trogoniformes (Trogonidae), and the close relationship between Coraciiformes and Piciformes. The phylogenetic placement of the clade including Cuculiformes and Trogoniformes has not been resolved in present study, which need further investigations with more molecular markers and species. The mitogenome sequences presented here provided valuable data for further taxonomic studies on Coraciiformes and other related groups.

  19. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  20. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Phylogenetic Variants of Rickettsia africae, and Incidental Identification of "Candidatus Rickettsia Moyalensis" in Kenya.

    Science.gov (United States)

    Kimita, Gathii; Mutai, Beth; Nyanjom, Steven Ger; Wamunyokoli, Fred; Waitumbi, John

    2016-07-01

    Rickettsia africae, the etiological agent of African tick bite fever, is widely distributed in sub-Saharan Africa. Contrary to reports of its homogeneity, a localized study in Asembo, Kenya recently reported high genetic diversity. The present study aims to elucidate the extent of this heterogeneity by examining archived Rickettsia africae DNA samples collected from different eco-regions of Kenya. To evaluate their phylogenetic relationships, archived genomic DNA obtained from 57 ticks a priori identified to contain R. africae by comparison to ompA, ompB and gltA genes was used to amplify five rickettsial genes i.e. gltA, ompA, ompB, 17kDa and sca4. The resulting amplicons were sequenced. Translated amino acid alignments were used to guide the nucleotide alignments. Single gene and concatenated alignments were used to infer phylogenetic relationships. Out of the 57 DNA samples, three were determined to be R. aeschlimanii and not R. africae. One sample turned out to be a novel rickettsiae and an interim name of "Candidatus Rickettsia moyalensis" is proposed. The bonafide R. africae formed two distinct clades. Clade I contained 9% of the samples and branched with the validated R. africae str ESF-5, while clade II (two samples) formed a distinct sub-lineage. This data supports the use of multiple genes for phylogenetic inferences. It is determined that, despite its recent emergence, the R. africae lineage is diverse. This data also provides evidence of a novel Rickettsia species, Candidatus Rickettsia moyalensis.

  2. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  3. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  4. Phylogenetic tests of distribution patterns in South Asia: towards

    Indian Academy of Sciences (India)

    The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...

  5. Mitogenomic phylogenetic analyses of the Delphinidae with an emphasis on the Globicephalinae

    Directory of Open Access Journals (Sweden)

    de Stephanis Renaud

    2011-03-01

    Full Text Available Abstract Background Previous DNA-based phylogenetic studies of the Delphinidae family suggest it has undergone rapid diversification, as characterised by unresolved and poorly supported taxonomic relationships (polytomies for some of the species within this group. Using an increased amount of sequence data we test between alternative hypotheses of soft polytomies caused by rapid speciation, slow evolutionary rate and/or insufficient sequence data, and hard polytomies caused by simultaneous speciation within this family. Combining the mitogenome sequences of five new and 12 previously published species within the Delphinidae, we used Bayesian and maximum-likelihood methods to estimate the phylogeny from partitioned and unpartitioned mitogenome sequences. Further ad hoc tests were then conducted to estimate the support for alternative topologies. Results We found high support for all the relationships within our reconstructed phylogenies, and topologies were consistent between the Bayesian and maximum-likelihood trees inferred from partitioned and unpartitioned data. Resolved relationships included the placement of the killer whale (Orcinus orca as sister taxon to the rest of the Globicephalinae subfamily, placement of the Risso's dolphin (Grampus griseus within the Globicephalinae subfamily, removal of the white-beaked dolphin (Lagenorhynchus albirostris from the Delphininae subfamily and the placement of the rough-toothed dolphin (Steno bredanensis as sister taxon to the rest of the Delphininae subfamily rather than within the Globicephalinae subfamily. The additional testing of alternative topologies allowed us to reject all other putative relationships, with the exception that we were unable to reject the hypothesis that the relationship between L. albirostris and the Globicephalinae and Delphininae subfamilies was polytomic. Conclusion Despite their rapid diversification, the increased sequence data yielded by mitogenomes enables the

  6. Fourier transform inequalities for phylogenetic trees.

    Science.gov (United States)

    Matsen, Frederick A

    2009-01-01

    Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.

  7. Phylogenetic search through partial tree mixing

    Science.gov (United States)

    2012-01-01

    Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

  8. Let's jump in: A phylogenetic study of the great basin springfishes and poolfishes, Crenichthys and Empetrichthys (Cyprinodontiformes: Goodeidae.

    Directory of Open Access Journals (Sweden)

    D Cooper Campbell

    Full Text Available North America's Great Basin has long been of interest to biologists due to its high level of organismal endemicity throughout its endorheic watersheds. One example of such a group is the subfamily Empetricthyinae. In this paper, we analyzed the relationships of the Empetrichtyinae and assessed the validity of the subspecies designations given by Williams and Wilde within the group using concatenated phylogenetic tree estimation and species tree estimation. Samples from 19 populations were included covering the entire distribution of the three extant species of Empetricthyinae-Crenichthys nevadae, Crenichthys baileyi and Empetricthys latos. Three nuclear introns (S8 intron 4, S7 intron 1, and P0 intron 1 and one mitochondrial gene (Cytb were sequenced for phylogenetic analysis. Using these sequences, we generated two separate hypotheses of the evolutionary relationships of Empetrichtyinae- one based on the mitochondrial data and one based on the nuclear data using Bayesian phylogenetics. Haplotype networks were also generated to look at the relationships of the populations within Empetrichthyinae. After comparing the two phylogenetic hypotheses, species trees were generated using *BEAST with the nuclear data to further test the validity of the subspecies within Empetrichthyinae. The mitochondrial analyses supported four lineages within C. baileyi and 2 within C. nevadae. The concatenated nuclear tree was more conserved, supporting one clade and an unresolved polytomy in both species. The species tree analysis supported the presence of two species within both C. baileyi and C. nevadae. Based on the results of these analyses, the subspecies designations of Williams and Wilde are not valid, rather a conservative approach suggests there are two species within C. nevadae and two species within C. baileyi. No structure was found for E. latos or the populations of Empetricthyinae. This study represents one of many demonstrating the invalidity of

  9. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  10. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  11. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  12. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  13. Soft-tissue anatomy of the extant hominoids: a review and phylogenetic analysis

    Science.gov (United States)

    Gibbs, S; Collard, M; Wood, B

    2002-01-01

    This paper reports the results of a literature search for information about the soft-tissue anatomy of the extant non-human hominoid genera, Pan, Gorilla, Pongo and Hylobates, together with the results of a phylogenetic analysis of these data plus comparable data for Homo. Information on the four extant non-human hominoid genera was located for 240 out of the 1783 soft-tissue structures listed in the Nomina Anatomica. Numerically these data are biased so that information about some systems (e.g. muscles) and some regions (e.g. the forelimb) are over-represented, whereas other systems and regions (e.g. the veins and the lymphatics of the vascular system, the head region) are either under-represented or not represented at all. Screening to ensure that the data were suitable for use in a phylogenetic analysis reduced the number of eligible soft-tissue structures to 171. These data, together with comparable data for modern humans, were converted into discontinuous character states suitable for phylogenetic analysis and then used to construct a taxon-by-character matrix. This matrix was used in two tests of the hypothesis that soft-tissue characters can be relied upon to reconstruct hominoid phylogenetic relationships. In the first, parsimony analysis was used to identify cladograms requiring the smallest number of character state changes. In the second, the phylogenetic bootstrap was used to determine the confidence intervals of the most parsimonious clades. The parsimony analysis yielded a single most parsimonious cladogram that matched the molecular cladogram. Similarly the bootstrap analysis yielded clades that were compatible with the molecular cladogram; a (Homo, Pan) clade was supported by 95% of the replicates, and a (Gorilla, Pan, Homo) clade by 96%. These are the first hominoid morphological data to provide statistically significant support for the clades favoured by the molecular evidence. PMID:11833653

  14. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  15. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  16. Comprehensive Phylogenetic Analysis of Bovine Non-aureus Staphylococci Species Based on Whole-Genome Sequencing

    Science.gov (United States)

    Naushad, Sohail; Barkema, Herman W.; Luby, Christopher; Condas, Larissa A. Z.; Nobrega, Diego B.; Carson, Domonique A.; De Buck, Jeroen

    2016-01-01

    Non-aureus staphylococci (NAS), a heterogeneous group of a large number of species and subspecies, are the most frequently isolated pathogens from intramammary infections in dairy cattle. Phylogenetic relationships among bovine NAS species are controversial and have mostly been determined based on single-gene trees. Herein, we analyzed phylogeny of bovine NAS species using whole-genome sequencing (WGS) of 441 distinct isolates. In addition, evolutionary relationships among bovine NAS were estimated from multilocus data of 16S rRNA, hsp60, rpoB, sodA, and tuf genes and sequences from these and numerous other single genes/proteins. All phylogenies were created with FastTree, Maximum-Likelihood, Maximum-Parsimony, and Neighbor-Joining methods. Regardless of methodology, WGS-trees clearly separated bovine NAS species into five monophyletic coherent clades. Furthermore, there were consistent interspecies relationships within clades in all WGS phylogenetic reconstructions. Except for the Maximum-Parsimony tree, multilocus data analysis similarly produced five clades. There were large variations in determining clades and interspecies relationships in single gene/protein trees, under different methods of tree constructions, highlighting limitations of using single genes for determining bovine NAS phylogeny. However, based on WGS data, we established a robust phylogeny of bovine NAS species, unaffected by method or model of evolutionary reconstructions. Therefore, it is now possible to determine associations between phylogeny and many biological traits, such as virulence, antimicrobial resistance, environmental niche, geographical distribution, and host specificity. PMID:28066335

  17. Honey bee dopamine and octopamine receptors linked to intracellular calcium signaling have a close phylogenetic and pharmacological relationship.

    Directory of Open Access Journals (Sweden)

    Kyle T Beggs

    Full Text Available BACKGROUND: Three dopamine receptor genes have been identified that are highly conserved among arthropod species. One of these genes, referred to in honey bees as Amdop2, shows a close phylogenetic relationship to the a-adrenergic-like octopamine receptor family. In this study we examined in parallel the functional and pharmacological properties of AmDOP2 and the honey bee octopamine receptor, AmOA1. For comparison, pharmacological properties of the honey bee dopamine receptors AmDOP1 and AmDOP3, and the tyramine receptor AmTYR1, were also examined. METHODOLOGY/PRINCIPAL FINDINGS: Using HEK293 cells heterologously expressing honey bee biogenic amine receptors, we found that activation of AmDOP2 receptors, like AmOA1 receptors, initiates a rapid increase in intracellular calcium levels. We found no evidence of calcium signaling via AmDOP1, AmDOP3 or AmTYR1 receptors. AmDOP2- and AmOA1-mediated increases in intracellular calcium were inhibited by 10 µM edelfosine indicating a requirement for phospholipase C-β activity in this signaling pathway. Edelfosine treatment had no effect on AmDOP2- or AmOA1-mediated increases in intracellular cAMP. The synthetic compounds mianserin and epinastine, like cis-(Z-flupentixol and spiperone, were found to have significant antagonist activity on AmDOP2 receptors. All 4 compounds were effective antagonists also on AmOA1 receptors. Analysis of putative ligand binding sites offers a possible explanation for why epinastine acts as an antagonist at AmDOP2 receptors, but fails to block responses mediated via AmDOP1. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AmDOP2, like AmOA1, is coupled not only to cAMP, but also to calcium-signalling and moreover, that the two signalling pathways are independent upstream of phospholipase C-β activity. The striking similarity between the pharmacological properties of these 2 receptors suggests an underlying conservation of structural properties related to receptor

  18. Treelink: data integration, clustering and visualization of phylogenetic trees.

    Science.gov (United States)

    Allende, Christian; Sohn, Erik; Little, Cedric

    2015-12-29

    Phylogenetic trees are central to a wide range of biological studies. In many of these studies, tree nodes need to be associated with a variety of attributes. For example, in studies concerned with viral relationships, tree nodes are associated with epidemiological information, such as location, age and subtype. Gene trees used in comparative genomics are usually linked with taxonomic information, such as functional annotations and events. A wide variety of tree visualization and annotation tools have been developed in the past, however none of them are intended for an integrative and comparative analysis. Treelink is a platform-independent software for linking datasets and sequence files to phylogenetic trees. The application allows an automated integration of datasets to trees for operations such as classifying a tree based on a field or showing the distribution of selected data attributes in branches and leafs. Genomic and proteonomic sequences can also be linked to the tree and extracted from internal and external nodes. A novel clustering algorithm to simplify trees and display the most divergent clades was also developed, where validation can be achieved using the data integration and classification function. Integrated geographical information allows ancestral character reconstruction for phylogeographic plotting based on parsimony and likelihood algorithms. Our software can successfully integrate phylogenetic trees with different data sources, and perform operations to differentiate and visualize those differences within a tree. File support includes the most popular formats such as newick and csv. Exporting visualizations as images, cluster outputs and genomic sequences is supported. Treelink is available as a web and desktop application at http://www.treelinkapp.com .

  19. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  20. Inferring phylogenetic networks by the maximum parsimony criterion: a case study.

    Science.gov (United States)

    Jin, Guohua; Nakhleh, Luay; Snir, Sagi; Tuller, Tamir

    2007-01-01

    Horizontal gene transfer (HGT) may result in genes whose evolutionary histories disagree with each other, as well as with the species tree. In this case, reconciling the species and gene trees results in a network of relationships, known as the "phylogenetic network" of the set of species. A phylogenetic network that incorporates HGT consists of an underlying species tree that captures vertical inheritance and a set of edges which model the "horizontal" transfer of genetic material. In a series of papers, Nakhleh and colleagues have recently formulated a maximum parsimony (MP) criterion for phylogenetic networks, provided an array of computationally efficient algorithms and heuristics for computing it, and demonstrated its plausibility on simulated data. In this article, we study the performance and robustness of this criterion on biological data. Our findings indicate that MP is very promising when its application is extended to the domain of phylogenetic network reconstruction and HGT detection. In all cases we investigated, the MP criterion detected the correct number of HGT events required to map the evolutionary history of a gene data set onto the species phylogeny. Furthermore, our results indicate that the criterion is robust with respect to both incomplete taxon sampling and the use of different site substitution matrices. Finally, our results show that the MP criterion is very promising in detecting HGT in chimeric genes, whose evolutionary histories are a mix of vertical and horizontal evolution. Besides the performance analysis of MP, our findings offer new insights into the evolution of 4 biological data sets and new possible explanations of HGT scenarios in their evolutionary history.